22
Genetics News F 1 completed last night • P’s doing fine

Genetics NewsGenetics News F 1 completed last night P’s doing fine

Embed Size (px)

Citation preview

Page 1: Genetics NewsGenetics News F 1 completed last night P’s doing fine

Genetics News• F1 completed last night

• P’s doing fine

Page 2: Genetics NewsGenetics News F 1 completed last night P’s doing fine

Phenotype of F1

Page 3: Genetics NewsGenetics News F 1 completed last night P’s doing fine

Regulation of Gene ExpressionStrategy for next three weeks

• Regulation of gene expression (prokaryotes)

- The lac operon

How does environment affect expression?

What is the decision making machinery?

• Regulation of gene expression (eukaryotes)

• Development of an organism

Page 4: Genetics NewsGenetics News F 1 completed last night P’s doing fine

The phenomenonDiauxic growth

Page 5: Genetics NewsGenetics News F 1 completed last night P’s doing fine

The lac operon

Page 6: Genetics NewsGenetics News F 1 completed last night P’s doing fine

The lac operon

--------operator------- GAAAGCGGGCAGTGAGCGCAACGCAATTAATGTGAGTTAGCTCACTCATTAGGCACCCCAGGCTTTACACTTTATGCTTCCGGCTCGTATGTTGTGTGGAATTGTGAGCGGATAACAATTTCACACAGGAAACAGCTATGACCATGATT CTTTCGCCCGTCACTCGCGTTGCGTTAATTACACTCAATCGAGTGAGTAATCCGTGGGGTCCGAAATGTGAAATACGAAGGCCGAGCATACAACACACCTTAACACTCGCCTATTGTTAAAGTGTGTCCTTTGTCGATACTGGTACTAA

--lacI-- --CAP site--- -35 -10 rbs lacZ -----promoter-----

--------operator-------CACCCCAGGCTTTACACTTTATGCTTCCGGCTCGTATGTTGTGTGGAATTGTGAGTGGGGTCCGAAATGTGAAATACGAAGGCCGAGCATACAACACACCTTAACACT

-35 -10 -----promoter-----

Page 7: Genetics NewsGenetics News F 1 completed last night P’s doing fine

The lac operonSQ10: RNA polymerase binds to each gene separately?

DNA

RNA

PROTEIN

Page 8: Genetics NewsGenetics News F 1 completed last night P’s doing fine

The lac operonSQ10: Each gene encodes a different protein?

DNA

RNA

PROTEIN

Page 9: Genetics NewsGenetics News F 1 completed last night P’s doing fine

The lac operonSQ10: Each gene has its own start codon?

DNA

RNA

PROTEIN

Page 10: Genetics NewsGenetics News F 1 completed last night P’s doing fine

The lac operonSQ10: Ribosomes bind to each gene separately?

DNA

RNA

PROTEIN

Page 11: Genetics NewsGenetics News F 1 completed last night P’s doing fine

The lac operonSQ10: Each gene is replicated separately?

DNA

RNA

PROTEIN

Page 12: Genetics NewsGenetics News F 1 completed last night P’s doing fine

ß-galactosides

Lactose

IPTG

ONPG

PGal

Page 13: Genetics NewsGenetics News F 1 completed last night P’s doing fine

Properties of Galactosides

ß-galactosideSubstrate for

ß-galactosidase?Binds to

Lac repressor?Use

Glucosyl-ß-D-galactoside (lactose) Yes Yes Natural substrate

Phenyl-ß-D-galactoside (PGal) Yes No Selects for lacI-

ortho-nitrophenyl-ß-D-galactoside (ONPG) Yes ?Assay for

ß-galactosidase

Isopropyl-ß-D-thiogalactoside (IPTG) No Yes Induces lac operon

Quiz Q2: Which would increase ß-galactosidase activity?

Page 14: Genetics NewsGenetics News F 1 completed last night P’s doing fine

Enzyme Activity

Is it:

Potential: Machinery available to manufacture product?

Actuality: How many products made?

Page 15: Genetics NewsGenetics News F 1 completed last night P’s doing fine

Properties of Galactosides

ß-galactosideSubstrate for

ß-galactosidase?Binds to

Lac repressor?Use

Glucosyl-ß-D-galactoside (lactose) Yes Yes Natural substrate

Phenyl-ß-D-galactoside (PGal) Yes No Selects for lacI-

ortho-nitrophenyl-ß-D-galactoside (ONPG) Yes ?Assay for

ß-galactosidase

Isopropyl-ß-D-thiogalactoside (IPTG) No Yes Induces lac operon

Quiz Q2: Which would increase ß-galactosidase activity?

Page 16: Genetics NewsGenetics News F 1 completed last night P’s doing fine

The lac operonSQ13: Why do some galactosides only induce?

Why IPTG?

Why not Pgal?

Page 17: Genetics NewsGenetics News F 1 completed last night P’s doing fine

The lac operonSQ12: Phenotype of lacI mutant unable to bind allolactose?

Page 18: Genetics NewsGenetics News F 1 completed last night P’s doing fine

Study Question 6

Strain Sugar(s) added Growthwild type lactose

lacZ lactoselacY lactose

wild type PGalwild type PGal + IPTG

lacY lactose + IPTG

Will these strains grow?

Page 19: Genetics NewsGenetics News F 1 completed last night P’s doing fine

Study Question 6

Strain Sugar(s) added Growthwild type lactose

lacZ lactoselacY lactose

wild type PGalwild type PGal + IPTG

lacY lactose + IPTG

Will these strains grow?

SQ7: Why does growth on PGal alone select for lacI- mutants?

Page 20: Genetics NewsGenetics News F 1 completed last night P’s doing fine

Predict the Lac phenotype

Chromosome Plasmid Phenotype

I+ P+ O+ Z+ Y+ I+ P+ O+ Z+ Y+ Inducible, growth

I- P+ O+ Z+ Y+ I+ P+ O+ Z- Y+

I- P+ O- Z+ Y+ I+ P+ O+ Z- Y+

I- P- O+ Z+ Y+ I+ P+ O+ Z- Y+

Page 21: Genetics NewsGenetics News F 1 completed last night P’s doing fine

The lac operonSQ14: Explain diauxic growth in terms of the lac operon.

Page 22: Genetics NewsGenetics News F 1 completed last night P’s doing fine

The lac operonSQ14: Explain diauxic growth.