Genome Editing of Hematopoietic Stem Cells to Treat Genetic Diseases

Matthew Porteus MD PhDDepartment of Pediatrics

Divisions of Stem Cell Transplantation and Regenerative Medicine, Hematology/Oncology and Human Gene Therapy

Institute of Stem Cell Biology and Regenerative MedicineChild Health Research Institute

Stanford Universitymporteus@stanford.edu

14 March 2019

Potential Conflicts of Interest

CRISPR Therapeutics: Equity and SABAllogene Therapeutics: Equity and SAB

Managed through Stanford in accordance with their conflict of interests policy.

Honored to be included in a list of speakers who have transformed their fields

Kathy High: Curative gene therapy for hemophilia--from academic discovery to commercial product

Ching-Hon Pui: Leader in transforming pediatric ALL into a disease that is now routinely cured (>90%)

Neal Young: Transformed our understanding and treatment of aplastic anemia (>90% cured)

Honored to be in Seoul, South Korea where one of the leaders in genome editing has done his pioneering work

Professor Jin-Soo Kim PhDDirector, Center for Genome Engineering

Institute for Basic ScienceSeoul National University

Outline of Talk

1. Development of RNP/AAV6: a highly active and robust system for homologous recombination mediated genome editing (HR-GE)

2. Engineering Hematopoietic Stem and Progenitor Cells (HSPCs) to revert a single disease causing variant

3. Improving Specificity 4. Engineering HSPCs to secrete proteins to cross-correct for a

missing enzyme (synthetic biology)

Monogenic Diseases Permeate Medicine(6,000-10,000 such diseases)

(Patients: ~30 million in USA, ~350 million worldwide)

Hematology: Sickle Cell Disease/ThalassemiaHematology: Hemophilia

Pulmonary: Cystic FibrosisImmunology: Primary Immunodeficiencies (e.g. Severe

Combined Immunodeficiency (SCID))Cardiology: Familial Hypercholesterolemia

Dermatology: Epidermolysis bullosaGenetics: Muscular Dystrophy, MPS I

Neurology: Huntington’s Disease, Myotonic Dystrophy, NGLY1 deficiency

.

.Each patient affects a larger community of people(echoes of the disease) + life years saved

Genome Editing Provides a Precise Method of Genetically Engineering Cells

Precise Spatial Modification (DSB stimulates process by >1010)

Method to Break Things

Precise Spatial AND Nucleotide Modification of Genome

(DSB stimulates process by >105)

Method to Fix Things

Donor DNA

*

HomologousRecombination

(copy and paste)

Non-homologousend-joining(stitching)

Engineered Nuclease

Hgb A Hgb S Sickle (E6V)

Sickle Cell Disease is Caused by a Single Nucleotide Variant in the HBB Gene

Hertz Nazaire

Median Lifespan

United States: mid-40s(though taking medicine for pain >3 times/week)(neurocognitive damage starts occurring in first

years of life)

Africa: 5-8 years old

RBC Formation from Hematopoietic Stem Cells

In order to fix this cell…

… we need to fix this cell.

RBC Formation from Hematopoietic Stem Cells

Matched Sibling Donor Outcomes: 2016 Update

Mixed chimerism shows 20% corrected cells can

cure the disease (Tisdale and colleagues)

(though as low as 2-5% might provide significant

benefit (Walters and colleagues))

Replace Allogeneic Cells with Corrected Autologous Cells

Donor

Allogeneic Cells

CorrectedAutologous Cells

Genome Editing Provides a Precise Method of Genetically Engineering Cells

Precise Spatial Modification (DSB stimulates process by >1010)

Method to Break Things

Precise Spatial AND Nucleotide Modification of Genome

(DSB stimulates process by >105)

Method to Fix Things

Donor DNA

*

HomologousRecombination

(copy and paste)

Non-homologousend-joining(stitching)

Engineered Nuclease

Two Principles to Get High Frequencies of HR Mediated Editing: Good Nuclease + Lots of Donor

More Nuclease Leads to More

Editing (both HR and NHEJ Mediated)

More Donor Shifts to HR Mediated

Editing From NHEJ Mediated

Editing

Dever & Bak et al., under review Hendel, Kildebeck et al Cell Reports (2014)

The intracellular pathogen sensing

innate immune response is a barrier to

successful genome editing when

components are delivered as naked

DNA molecules

Gene Description Fold-Induction

IFNB1 interferon, beta 1, fibroblast 89.07

IFIT2 interferon-induced protein with tetratricopeptide repeats 2 83.49

IFIT1 interferon-induced protein with tetratricopeptide repeats 1 58.41

RSAD2 radical S-adenosyl methionine domain containing 2 55.08

OASL 2'-5'-oligoadenylate synthetase-like 52.97

--- class=mRNAlike lncRNA name=NULL transcriptId=HIT000062856 44.52

NR4A2 nuclear receptor subfamily 4, group A, member 2 42.77

--- accn=AF352781 class=mRNAlike lncRNA name=NULL ref=H-invitational v7.5 42.47

---havana:sense_intronic chromosome:GRCh37:8:39771748:39773240:1 gene:ENSG00000253838 gene_biotype:sense_intronictranscript_biotype:sense_intronic |

40.73

HERC5 HECT and RLD domain containing E3 ubiquitin protein ligase 5 32.09

CXCL11 chemokine (C-X-C motif) ligand 11 31.53

IFIT3 interferon-induced protein with tetratricopeptide repeats 3 24.65

CXCL10 chemokine (C-X-C motif) ligand 10 22.31

--- class=lncRNA name= ref=RefGeneNoncode transcriptId=NR_028308 21.42

CCL5 chemokine (C-C motif) ligand 5 21.08

IFI44 interferon-induced protein 44 18.9

EMP1 epithelial membrane protein 1 18.84

IDO1 indoleamine 2,3-dioxygenase 1 17.37

CSAG2 CSAG family, member 2, CSAG family, member 3 16.37

Collaboration with Agilent Research Laboratories

Nature Biotechnology 2015

Ribonucleoprotein (RNP): Purified Cas9 protein complexed to synthetic stabilized single guide molecule (s3gRNA)

0102030405060708090

Unm

odifi

ed MS

Unm

odifi

ed MS

5 µgCas9

protein

15 µgCas9

protein

Modified sgRNAs Enhance Editing when Delivered as a Ribonucleoprotein (RNP) Complex

Gene Correction using CRISPR/Cas9/gRNA and a non-integrating virus (AAV6)

Recombinant Adeno-Associated Virus (AAV6)

(non-integrating) Bak, Dever et al Nature Protocols (2018)

Combining Cas9/gRNA and rAAV6 Mediates High Targeting Efficiencies in peripheral blood

CD34+ HSPCs

RNP and AAV6 change gene expression much less significantly than Cas9 mRNA in CD34+

HSPCs

24h

6h

Cromer et al (2018) Molecular Therapywith Ayal Hendel and Agilent

106 57 221 208

Editing Sickle Variant in CD34+ HSPCs from Six Sickle Cell Disease Patients

Nature 2016

Do the gene corrected stem cells do what they are supposed to do?1. Make non-sickling red blood cells2. Retain their stem cell properties

Gene Corrected Patient Derived CD34+ HSPCs Differentiated in vitro into RBCs Generate High

Levels of HgbA and Low Levels of HgbS

Sample Hgb A Hgb S

Mock 0.73 +/- 1.0 99.27 +/- 1.0

Gene Corrected(RNP+AAV6) 92.5 +/- 4.3 7.5 +/- 4.3

Percent of Beta-Globin Derived Hemoglobin in Total RBC Population

(no selection)

N=6

Keeping the %S <30% stops disease progression

Allele Frequency in Human Cells at 16 Weeks Post-

Transplant into NSG Mice

High Frequencies of Gene Correction at HBB in Patient Derived CD34+ HSPCs is maintained after

transplantation into NSG mice

What about potential off-target INDELs?

Peter Marks (head of CBER, FDA): “We don’t want off-target events leading to serious adverse events.”

Implication: Off-target changes per se are not serious adverse events—only if they lead to functional adverse events.

Example: We do not let the fact that extra somatic mutations are generated by flying in a plane inhibit us from personally engaging with the worldwide biomedical research community.

Bioinformatic

Oligo capture

In vitro Cas9/gDNA cleavage

Multiple Methods to Identify Potential Off-Target Sites

COSMID GUIDE-Seq

CIRCLE-Seq Site Sequence Closest Gene Distance

(kb) Feature hg19 Location NHEJ Mock

R02 CTTGCCCCACAGGGCAGTAANGG HBB n/a Exon Chr11:5248198-5248220 54.7 0.767

COS1 GS1 CS2 OT1 TCAGCCCCACAGGGCAGTAAGGG GRIN3A 95.004 Intergenic Chr9:104595866-104595888 16.2 0.076

COS2 OT2 CCTCTCCCACAGGGCAGTAAAGG LINC01482 0.034 Intergenic Chr17:66624239-66624261 0.048 0.041

COS3 OT3 TTTTCCCCAAAGGGCAGTAATAGMYO16 n/a Intron Chr13:109818336-

109818358 0.012 0.007

COS8 GS2 CS7 OT4 GTGGCCCCACAGGGCAGGAANGG MAGEE2 1.209 Intergenic ChrX:75006240-75006262 0.003 0.005

COS7 GS3 CS4 OT5 GCTGCCCCACAGGGCAGCAANGG FAM101A 3.258 Intergenic Chr12:124803828-124803850 0.15 0.015

GS4 OT6 GATGCCATTCATAGCAGTCANCG C22orf34 225.248 Intergenic Chr22:49582904-49582926 0 0.001

COS23 OT7 CTCGCCCCTCAGGGCAGTAGTGG GREB1 n/a Intron Chr2:11777795-11777817 0.006 0.042

COS9 CS1 OT8 TGTGCCCCACAGAGCACTAANGG LOC101929350 1.3kb Intergenic Chr22:17230606-17230628 0.028 0.064

COS19 CS3 OT9 ATTGCCCCACGGGGCAGTGANGG LOC643339 n/a Intron Chr12:93549185-93549207 0.054 0.016

COS26 CS5 OT10 GTTGCCCCTCAGGACAGTACNGG LOC105370802 374kb Intergenic Chr15:46598112-46598134 n.d. n.d.

CS6 OT11 GAAGCCCTACAGGGCAGCAANGG NRSN1 416kb Intergenic chr6:23709573-23709595 0.024 0.006

COS15 CS8 OT12 ATGGCCCCACAAGGCAGAAANGG IFI27 2.3kb Intergenic Chr14:94585321-94585343 0.013 0.018

CS9 OT13 AGTGCCACACACAGCAGTAANGG DOCK5(H3K27Ac) 110kb Intergenic chr8:24931375-24931397 0.015 0.006

CS10 OT14 TGTGCACCACAGAGCAATAANGG ZNF716 183kb Intergenic chr7:57716460-57716482 0.019 0.04

CS11 OT15 GTTATCCCACAGGACAGTGANGG SFTA3 53kb Intergenic chr14:36889532-36889554 0.055 0.043

All bonafide Off-Target Sites (two) in CD34+ HSPCs using RNP were Identified by all three methods

with Ciaran Lee and Gang Bao (Rice University)

Qualitative Biochemical Understanding of Nuclease Specificity

p(Editing) ≈ c1[conc] * c2(Time) * c3(Kd) (on/off) * c4(Kcat) * c5(p(repair fidelity))

Kd ≈ (guideRNA binding energy)(Cas9-DNA binding energy)

Using SCD-CD34s

IDT HiFi SpCas9 (R691A) Mediates High Level Sickle Gene Correction while Reducing Off-Target INDELs

by > 1-log in Sickle Cell Patient Derived CD34+ HSPCs

Vakulskas, Dever, Camarena, Lee, Bao, Behlke(Nature Medicine (2018))

Scaling up the Gene Correction Process

Assay Specs Run 1 Run 2 Run 3 Run 4 Run 5 Run 6

Viability (%) >70% 90 79 65 75 75 80

Total Viable Cell Count Report 100

million24

million29

million73

million111

million145

million

Phenotypic Analysis

>80% CD34 85.0 99.8 99.7 93.0 92.0 92.0

Percent Allele Correction Report 56 41 39 37 44.5 52

Percent Cells Corrected >20% 65 47 53 54 ND 61

Hematopoietic Stem Cells

Harvested from Patient

Transplant Autologous Gene Corrected Cells Back into Patient

Myeloablative Busulfan(Non genotoxic conditioning)

Genome Editing: Gene correction

with nuclease mediated

homologous recombination

Moving Towards a Phase I/II Clinical Trial for Gene Correction for Sickle Cell Disease in 2019

Minimum: 2 x 106 CD34/kgIdeal: >5 x 106 CD34/kg

AtMinimum: 10% Gene Correction

Ideal: >20% Gene Correctionwhile

Passing Quality Control (QC) and Quality Assurance (QA) assays

GMP Grade HiFi Cas9 Protein (Aldevron)GMP Grade sgRNA (Agilent)

GMP Grade AAV6 (CMO)GMP Grade Electroporation (Lonza)

Minimum: 5 x 106 CD34/kgIdeal: >10 x 106 CD34/kg

Engineered hematopoietic stem cells to deliver protein therapeutics

Natalia Gomez-Ospina M.D., Ph.D.Assistant Professor - Division of Medical

GeneticsStanford Medicine - Stanford University

gomezosp@stanford.edu

Engineering blood stem cells for autologous transplants for lysosomal diseases: Correction

of MPS I using human, genome-edited hematopoietic stem and progenitor cells

BioRxiv: doi: https://doi.org/10.1101/408757

The effect of a small amount of enzyme on the severity of the disease (MPS I)

Symptom Severe Attenuated

Cognitive impairment +++ ---

Coarse facial features +++ ---

Hydrocephalus +++ ---

Stiff joints +++ ++

Skeletal abnormalities +++ ++

Cardiac valvular disease +++ ++

Recurrent upper airway infection +++ +

Corneal clouding +++ +

Hepato/splenomegaly +++ +

Hearing loss +++ +

IDUA enzymatic activity 0.18% (0-06) 0.79% (0.3-1.8)

Severe

Attenuated

http://www.personalhealthnews.ca/education-and-advocacy/rare-genetic-diseases-deserve-a-

place-on-physicians-radars

Current Therapeutic Options for Severe MPS I (Hurler Syndrome)

• Enzyme Replacement Therapyo Challenges in crossing the blood-brain barrier (BBB)

• Allogeneic Stem Cell Transplant (blood derived cells deliver enzyme to tissues with cross-correction)o Toxicity of procedureo Transplants from donors who are carriers are less effective

than from homozygous wild-type donors (dose response)

IDUAEnzyme

Isolate CD34+ HSPCs

Genome editing:Cas9/sgRNA

X X

Enzyme-HSPCs

Autologous Transplant

TissueMacrophages and immune cells

Safe harbor

Using Genetically Engineered Cells to Deliver Missing Enzymes

Cas9

+

Targeted Integration of Expression Cassette into a Safe Harbor using Genome Editing

Cas9 Protein Synthetic MS modifiedRNA (single) RNP Electroporation

Electroporation-aidedTransduction of AAV6

E1 E2 E3CCR5

E3

E1 E2 E3CCR5

Promoter P2AEnzyme MarkerE3 E3

Promoter P2AEnzyme MarkerE3

DSBs

HR

1 2

3

Bak, Dever, and Porteus 2018– Nature Protocols

IDUA-HSPCs express stable, high levels of functional IDUA

Enzyme Expression in CD34+ HSPCsEnzyme Expression in Macrophages

Derived from CD34+ HSPCs

Biochemical and phenotypic correction of the MPSI phenotype by

IDUA-HSPCs

Biochemical Correction: Decreased Urinary GAGs Over Time

Phenotypic Correction of the Bone Defect

Behavioral Correction by IDUA-HSPCs

High On-Target INDELs with no measurable off-target INDELs at CCR5 using HiFi RNP in CD34+ HSPCs

with Ciaran Lee and Gang Bao (Rice University)

Porteus Lab (current)Ron BaikJoab CamarenaCarsten CharlesworthKyle Cromer PhDDaniel Dever PhDAmanda Dudek PhDNatalia Gomez-Ospina MD, PhDKazuya Ikeda PhDSruthi MantriRenata MartinNathalie MostrelMara Pavel-Dinu PhDSamantha ScharenbergCamille Sindhu PhDWai SrifaSriram Vaidyanathan PhDVolker Wiebking MD

Ginger ExleyCita NicolasLoan Nguyen

Annalisa Lattanzi PhD

Funding: NIH/NHLBI/NIAID, NIH/NDC, CIRM, Amon Carter Foundation, Laurie Kraus Lacob Faculty Scholar Fund, Binns Family Cord Blood Research Program. Chan-Zuckerberg Biohub, Sutardja Foundation, Taube Foundation

Division of Pediatric SCTRMMaria-Grazia RoncaroloSandeep SoniRajni AgarwalKen WeinbergRosa BacchettaAmi ShahRobby ParkmanKatja WeinachtAgnieszka CzechowiczAlice BertainaJulia ChuMelissa Mavers

CollaboratorsAnu NarlaJennifer AndrewsMichael JengBert GladerMohan Narla/Lionel Blanc

Rachel Lynn/Crystal Mackall

Nobuko UchidaAnn Tsukamoto (BOCo)

Ayal Hendel (Bar-Ilan Univ)

Rasmus Bak (Aarhus Univ)

Andreas ReinischRavi MajetiMichael ClearyGreg Gurtner

Laurakay Bruhn (Agilent)

Mark Behlke (IDT)Chris Vakulskas (IDT)

Suk See DeRavin (NIH)Harry Malech (NIH)

Gang Bao (Rice)Ciaran Lee (Rice)

Laboratory of Cell andGene Medicine (LCGM)Chy-Anh TranNeehar BhatiaHelen SegalAbla BakirPremanjali LahiriRashi Srivastava

Thank You(for your attention and the opportunity to present our work)