Genome Sequencing in the Legumes

Le et al. 2007

Phylogeny

• Major sequencing efforts

• Minor sequencing efforts

QuickTime™ and aTIFF (Uncompressed) decompressor

are needed to see this picture.

~14 MY

~45 MY

Zhu et al. 2005

Papilionoideae in GenBank

GSS EST Nucleotide Total Total bpLens 485 na 189 674 413,706Vicia 686 1 949 1,636 1,087,983Pisum 154 3,592 2,391 6,137 4,385,740Melilotus na na 60 60 33,298Trifolium 35,181 38,208 2,997 76,386 34,558,567Medicago 168,810 256,447 5,910 431,167 535,567,512Cicer 48,339 1,948 974 51,261 37,288,840Lotus 46,569 150,684 2,190 199,443 212,142,103Phaseolus 92,009 45,721 2,182 139,912 90,443,599Vigna 50,216 728 1,192 52,136 37,921,985Glycine 368,272 411,806 6,209 786,287 468,155,008Cajanus 357 884 42 1,283 668,582

GenBank Records

Types of sequencing

• Physical map --> Sequence map– Traditional--human & Arabidopsis

• Sequence map --> Physical map– Drosophila

• Incomplete sequence map– With or without physical information

QuickTime™ and aTIFF (Uncompressed) decompressor

are needed to see this picture.

Genome

..actggtcgtaatgtagttgccctcagfgttagtaattttattgtagtatgatgt..

?

150 kb fragments

BAC library

Physical to Sequence (rice, Arabidopsis, human)

QuickTime™ and aTIFF (Uncompressed) decompressorare needed to see this picture.

fingerprint Integrate genetic physical map

Map-based Genome Sequencing

Chromosome

Genetic map

Physical map

actggagtggatgaactgactaaactgtaactgtacgatcgtttagctacggcggcgatcgatcgggtcagcacgtagctagctgacgtgggctagctaattatacgatcggagatcgatcgtaatcggatcgatcgcgcggcatctacgatcgatcgtagctagtc

Minimum Tiling Path

Shotgun sequencing

QuickTime™ and aTIFF (Uncompressed) decompressor

are needed to see this picture.

Soybean chromosomes

contig

scaffold

•Lots of contigs/scaffolds

•Not anchored to genetic map

Shotgun Genome Sequencing

Chromosome

Genetic map

Physical map

shotgun sequence

Outcomes• Map-based approach

– Highly ordered, clone-based, genetically integrated, contiguous sequence (gold standard)

– Slower, costly

• Shotgun approach– Initially disordered, though can be genetically

integrated– May or may not have underlying physical map– May have assembly problems– Fast and less expensive

Prerequisites

• Understand genome structure– Neopolyploidy?– Repeat content?– Repeat distribution?– Comparisons to related genomes. How

valuable will they be?

Leveraging Genomes

• Understand and introgress diversity

• Marker development for selection and gene cloning

• Basic questions: evolution, genome structure

Genus Oryza

A - O. rufipogon B - O. nivara C - O. glaberrima

How to deal with incompletely sequenced genomes

• Genetic and physical maps/information are imperative

• Leverage related genomes to aid in assembly

• Target finishing to regions of interest– Genic/QTLs/anchored scaffolds…

• Low coverage sequencing of MTP or entire BAC library

QuickTime™ and aTIFF (LZW) decompressor

are needed to see this picture.

Doyle and Luckow 2004