Golgin160 Recruits the Dynein Motor to Position the Golgi Apparatus

Developmental Cell

Article

Golgin160 Recruits the Dynein Motorto Position the Golgi ApparatusSmita Yadav,1 Manojkumar A. Puthenveedu,1 and Adam D. Linstedt1,*1Department of Biological Sciences, Carnegie Mellon University, Pittsburgh, PA 15213, USA

*Correspondence: [email protected]

http://dx.doi.org/10.1016/j.devcel.2012.05.023

SUMMARY

Membrane motility is a fundamental characteristic ofall eukaryotic cells. One of the best-known examplesis that of the mammalian Golgi apparatus, whereconstant inward movement of Golgi membranesresults in its characteristic position near the centro-some. While it is clear that the minus-end-directedmotor dynein is required for this process, the mech-anism and regulation of dynein recruitment to Golgimembranes remains unknown. Here, we show thatthe Golgi protein golgin160 recruits dynein to Golgimembranes. This recruitment confers centripetalmotility to membranes and is regulated by theGTPase Arf1. Further, during cell division, motorassociation with membranes is regulated by thedissociation of the receptor-motor complex frommembranes. These results identify a cell-cycle-regu-lated membrane receptor for a molecular motorand suggest a mechanistic basis for achieving thedramatic changes in organelle positioning seenduring cell division.

INTRODUCTION

The positioning of the Golgi apparatus near the centrosome-

basedmicrotubule-organizing center is a striking and physiolog-

ically relevant feature of the interphase mammalian cell. Golgi

membranes are constantly captured by outgrowing microtu-

bules and actively translocated toward the microtubule minus

ends (Ho et al., 1989; Presley et al., 1997) by the dynein and

dynactin motor complex (Burkhardt et al., 1997; King and

Schroer, 2000; Roghi and Allan, 1999). Once positioned near

the centrosome, Golgi membranes are linked laterally to form

the ribbon-like membrane network, after which the Golgi ribbon

may be anchored directly to the microtubule organizing center

(MTOC) (Infante et al., 1999; Takahashi et al., 1999).

Several fundamental processes rely on an accurately posi-

tioned Golgi including differentiation of myoblasts into myo-

tubes, immunological synapse formation, neuronal arborization,

and directed cell migration. The pericentrosomally positioned

Golgi apparatus, in combination with oriented microtubule

arrays, defines a physiologically important axis of secretion to

the most proximate aspect of the plasma membrane. In

response to a polarity cue, cells reorient their microtubule array

Deve

and reposition the Golgi apparatus toward the stimulus defining

the cell leading edge (Kupfer et al., 1982; Pu and Zhao, 2005).

Specific disruption of Golgi positioning blocks polarized delivery

of secretory cargo to the leading edge, resulting in a collapse of

cell polarity and an inability to migrate and heal a wound (Yadav

et al., 2009).

Golgi positioning is dramatically regulated during these

processes. When myoblasts fuse to form a myotube, the peri-

centrosomal Golgi ribbon fragments and is repositioned as

isolated Golgi stacks that encircle each nucleus (Ralston,

1993). This repositioning may be caused by a loss of Golgi

membrane motility and could be an obligate part of the muscle

differentiation pathway (Lu et al., 2001). When natural killer cells

and cytotoxic T cells form an immunological synapse with target

cells, the Golgi repositions toward the synapse to secrete lytic

factors that kill the target cell (Kupfer et al., 1983; Stinchcombe

et al., 2006). In hippocampal neurons, the Golgi aligns on the

side facing a newly forming axon (de Anda et al., 2005). In pyra-

midal neurons, the cell body-localized, or somatic, Golgi orients

toward the apical dendrites (Horton et al., 2005). Interestingly,

neuronal Golgi elements are also present in dendrites as multiple

Golgi ‘‘outposts,’’ whose positioning is required for dendritic

arborization (Ye et al., 2007).

Mitotic regulation of Golgi positioning is perhaps even more

striking. As microtubules reorganize to form the spindle-pole

body, the Golgi membrane network fragments and then

completely vesiculates giving rise to a mixture of Golgi vesicles

and Golgi vesicle clusters that are dispersed throughout the

mitotic cytoplasm (Shorter and Warren, 2002). The uncoupling

of membranes from their microtubule-based positioning is

thought to ensure their uniform partitioning during cell division

(Yadav and Linstedt, 2011). At the end of mitosis, the Golgi

membranes once again move toward microtubule minus ends

and reestablish their pericentrosomal position in each daughter

cell.

Despite its importance, our understanding of the mechanisms

that position the Golgi and move secretory cargo inward is

incomplete. Particularly vexing is that the components that

specifically link the dynein/dynactin complex to these mem-

branes to confer pericentrosomal positioning remain unknown

(Kardon and Vale, 2009). Although there are several dynein-inter-

acting proteins on the Golgi, none of these have been shown

required for membrane association of the motor. Identifying

the membrane receptor for the molecular motor is critical, as it

will help us understand both the regulation of motor recruitment

during membrane transport and organelle positioning, and the

regulatory events that allow the motor to switch to its specialized

roles during cell division.

lopmental Cell 23, 153–165, July 17, 2012 ª2012 Elsevier Inc. 153

mailto:[email protected]


Developmental Cell

Golgin160 Recruits Dynein

Golgin160, a homodimeric coiled-coil protein localized

primarily to cis Golgi cisternae (Hicks et al., 2006; Hicks and

Machamer, 2002), is an excellent candidate receptor because

its depletion blocks Golgi positioning and yields dispersed min-

istacks (Yadav et al., 2009). Here, unlike all previously identified

dynein interacting proteins, we show that golgin160 satisfies

a list of stringent criteria expected from a candidate motor

receptor on the Golgi. Golgin160 was specifically required for

dynein recruitment and Golgi motility. It directly bound dynein

and its dynein-binding site was required for Golgi positioning.

Golgin160 was also sufficient to confer functional motor recruit-

ment. Golgin160 directly bound the Arf1 GTPase and this

interaction was responsible for membrane association of the

golgin160 motor complex. Finally, golgin160 dissociated from

Golgi membranes at mitosis and this dissociation was required

for mitotic Golgi dispersal. Together, our data suggest that the

Golgi positioning depends on constant motility provided by the

recruitment of dynein by golgin160, a cell cycle regulated motor

receptor. The membrane attachment of this motor receptor,

through the highly regulated GTPase Arf1, is likely a key control

point for the dramatic changes in motility and organelle posi-

tioning observed during cell differentiation, polarization, and

division.

RESULTS

Golgin160 Depletion Blocks Minus-End Motilityof Golgi MembranesWe first confirmed the requirement for golgin160 in Golgi posi-

tioning by depleting golgin160 with small interfering RNAs

(siRNAs) individually targeting distinct exons shared by known

splice isoforms. Consistent with our previous work, each siRNA

yielded loss of pericentrosomal Golgi positioning (Figure S1

available online), suggesting a loss of minus-end motility. To

assay Golgi motility directly, it was assessed after washout of

the microtubule depolymerizing agent nocodazole in cells

coexpressing the fluorescently tagged Golgi protein mCherry-

GRASP55 and the microtubule plus-end protein EB1-green fluo-

rescent protein (GFP) using high-resolution live cell confocal

microscopy. In control cells, microtubule outgrowths were

coupled to inward tracking movements of the Golgi membranes

resulting in a pericentrosomally positioned Golgi complex (Fig-

ure 1A upper panels and Movie S1). Consistent with previous

work (Blum et al., 2000; Ladinsky et al., 1999; Presley et al.,

1997; Simpson et al., 2006), inward-tracking membranes ap-

peared tubular presumably due to distension of the membrane

by force exerted by the motor. In contrast, in cells lacking

golgin160, although outward microtubule growth was normal,

there was no inward tracking of Golgi membranes (Figure 1A,

lower panels, Figure 1B, and Movie S2). These cells failed to

establish a pericentrosomal Golgi. Unlike controls, even when

Golgi objects were grazed by outward tracking plus-ends, there

was no inward Golgi movement in golgin160-depleted cells (Fig-

ure 1C). Thus, Golgi membrane inward motility specifically

depends on golgin160.

Golgin160 was also critical for centripetal motility in the dynein

driven process of endoplasmic reticulum (ER)-to-Golgi trans-

port. In control cells, release from the restrictive temperature

initiated ER-to-Golgi and then Golgi-to-plasma membrane traf-

154 Developmental Cell 23, 153–165, July 17, 2012 ª2012 Elsevier In

ficking of temperature sensitive viral cargo protein vesicular

stomatitis virus G protein (VSVG)-GFP (Figure 1D, upper panels,

0–12 min and 12–20 min, respectively). Tracking movements

were exclusively inward during the fist period and outward

during the second period. In golgin160-depleted cells, however,

VSVG-GFP moved in a nondirected fashion as it emerged from

the ER in the first time period, but then tracked persistently

outward as it left the Golgi in the second time period (Figure 1D,

lower panels). Directional persistence of movement during the

ER-to-Golgi time period was significantly inhibited in these cells,

whereas that during the Golgi-to-PM time period was not

(Figure 1E).

Golgi Localization of Dynein Requires Golgin160To test whether Golgi membranes, upon golgin160 depletion,

lacked minus-end motility because dynein was not recruited,

antibodies against Tctex1, a subunit of the dynein motor

complex, were used to localize the motor (Tai et al., 1998).

Depletion of Tctex1 confirmed antibody specificity (Figure S2A).

Control cells showed dynein on Golgi membranes, while cells

lacking golgin160 did not (Figure 2A). Dynein remained evident

on nocodazole-induced Golgi ministacks, indicating that neither

Golgi fragmentation nor loss of microtubules displaced the

motor on their own. Line profiles showed that Golgi objects coin-

cided with peaks of dynein fluorescence except in the absence

of golgin160 (Figure 2B). Total dynein fluorescence on Golgi

objects decreased by more than 90% in cells lacking golgin160,

compared to control cells (Figure 2C). The golgin160 depen-

dence of dynein Golgi localization was confirmed using an

antibody against dynein heavy chain (Figure S2B) and this effect

was specific because other peripheral membrane proteins

(GMAP210, GBF1 and golgin97) remained Golgi-localized in

cells depleted of golgin160 (Figure S2C). Consistent with these

microscopic assays, dynein recovery on Golgi membranes iso-

lated using anti-giantin-coated magnetic beads was reduced

by 70% by golgin160 knockdown, whereas control proteins

remained membrane associated (Figure 2D). Thus, depletion of

golgin160 inhibited recruitment of dynein to Golgi membranes.

Golgin160 Binds DyneinTo elucidate the mechanism of golgin160-mediated dynein

recruitment, we first tested whether golgin160 binds dynein.

Indeed, the dynein intermediate chain (DIC) and golgin160

coimmunoprecipitated using either anti-golgin160 or anti-DIC

antibodies (Figure 3A). The quantified recovery of golgin160 in

anti-DIC immunoprecipitates was 10.3% ± 0.7% (n = 8). The

dynactin subunit p150was also present in anti-golgin160 precip-

itates, indicating that the golgin160-dynein complexes con-

tained the dynein regulatory complex dynactin (Schroer, 2004).

Control golgins, GM130 and giantin, did not precipitate with

the anti-DIC antibody (Figure 3A).

The golgin160 dynein-binding site was then mapped. GFP-

tagged constructs were generated (Figure 3B) corresponding

to the golgin160 N-terminal domain (Nterm), which contains its

Golgi localization determinant (Hicks and Machamer, 2002),

and the remaining C-terminal section enriched in coiled-coil

segments (cc2-8). Whereas Nterm failed to bind dynein, cc2-8

yielded a robust interaction (Figure 3C). Further dissection

showed that the seventh coiled-coil segment (cc7) was required

c.

Figure 1. Golgin160 Is Required for Inward Golgi Motility

(A) Nocodazole washout motility assay in control and golgin160-depleted HeLa cells (seeMovies S1 and S2) showing EB1-GFP andmCh-GRASP55 as amerged

image at 5 min postwashout, EB1-GFP as 20 s of projected tracks and mCh-GRASP55 with tracks marked using MTrackJ. Projected tracks are also shown in

insets with first frame in blue, intervening in green and last in red such that blue/green/red order indicates motility and direction (EB1 = 20 s, GRASP55 = 100 s).

Bar = 10 mm.

(B) Percentage of total EB1-GFP objects showing blue/green/red tracks oriented outward to cell cortex and the number of GRASP55-mCh tracks oriented inward

toward cell center are plotted (mean ± SEM, n = 3).

(C) Time series of representative growing EB1-GFP plus-ends grazing GRASP55-mCh Golgi objects (arrows indicate displacement).

(D) VSVG-GFP transport assay with VSVG tracks during the 0–12 min (red) and 12–20 min (yellow) time periods overlayed on the VSVG pattern at 0 or 12 min

posttemperature shift. GRASP55 in the same cells is shown at the 0 min time point to mark the Golgi. In control cells all detectedmovements were inward toward

the cell center during the first period and outward toward the cell periphery during the second period. In cells depleted of golgin160 tracking movements were

minimal in the first period and exclusively outward in the second period. MTrackJ plugin from ImageJwas used to generate tracks and calculate distancesmoved.

Bar = 10 mm.

(E) Quantified directional motility (linear distance/actual distance) of VSVG-GFP objects for the indicated time periods (mean ± SEM, n = 3).

See also Figure S1.

Developmental Cell


and sufficient for dynein binding (Figure 3C). The cellular localiza-

tion of these constructs strongly supported the interaction

assays. Note that, at the expression levels used, none of the

constructs interfered with the Golgi localization of endogenous

golgin160 (not shown). As expected, full-length and Nterm local-

ized to Golgi membranes (Figure 3D). However, constructs that

lacked the Golgi localization region but contained the dynein

interaction region cc7, including cc7 itself, localized to the cyto-

plasm and centrosomes (Figure 3D). Dynein moves toward, and

Deve

is localized at, centrosomes (Roghi and Allan, 1999) so partial

centrosome localization is expected for a binding partner of

dynein. In contrast, the construct cc2-6 that lacked cc7 was

cytoplasmic (Figure 3D). Further, endogenous golgin160 was

centrosome localized after being displaced from the Golgi by

BFA and centrosome localization of both endogenous golgin160

and cc7was nocodazole sensitive (Figure S3). Thus, centrosome

localization was a result of dynein-mediated motility rather than

binding to a centrosome core component.


Figure 2. Golgin160 Is Required for Dynein Recruitment on Golgi Membranes

(A) Immunofluorescence images of HeLa cells after 72 hr of knockdown or 2 hr of nocodazole treatment were stained using anti-giantin and anti-Tctex-1 anti-

bodies. The white line in the merge panels indicates the pixels used for the RGB profile plots shown. Scale bar = 10 mm.

(B) RGB profiles of Golgi objects (green) and dynein (red) corresponding to lines in merge of (A) as shown in insets.

(C) Total Tctex-1 staining intensity on Golgi objects was determined by thresholding the giantin channel to select only giantin positive pixels and then quantifying

TcTex-1 staining for the selected pixels. The average value per control Golgi was used to normalize the data set (n = 10, ±SEM).

(D) Golgi membranes from control and golgin160-depleted cells were immunoisolated using anti-giantin antibody coated magnetic beads and immunoblotted to

determine GPP130, golgin97, dynein heavy chain, DIC, and tubulin levels. DIC recovery on the isolated Golgi membranes is indicated after normalizing using the

DIC/GPP130 ratio and setting the control to 100% (n = 5, ±SEM).

See also Figure S2.

Developmental Cell


The cc7 Domain Directly Binds Dynein IntermediateChain and Mediates Golgi PositioningThese results prompted us to test whether cc7 directly binds

dynein and whether this binding is functionally significant. The

DIC is known to mediate several key dynein interactions (Kardon

and Vale, 2009; King et al., 2003) via its N terminus while its C

terminus binds the dynein heavy chain. Consistent with this, puri-

fied His-DIC1-237 bound purified glutathione S-transferase

(GST)-cc7 of golgin160 (Figure 4A). His-DIC1-237 did not bind

GST alone or GST-cc8. Binding of His-DIC1-237 to GST-cc7

was saturable with an apparent Kd of 1.2 mM (Figure 4B). Thus,

the golgin160 cc7 domain directly interacts with the dynein

motor via the DIC N terminus.

If this interaction is functionally significant, then a version of

golgin160 lacking cc7 should fail to rescue the golgin160 knock-

down phenotype. Indeed, whereas expressing siRNA-resistant,

full-length golgin160 in cells depleted of endogenous golgin160

restored pericentrosomal Golgi positioning, a golgin160 replace-

ment construct lacking cc7 did not (Figures 4C and 4D). The

replacement construct appeared stable and properly localized

to the Golgi indicating that the cc7 dynein-binding domain is

required for Golgi positioning.

Golgin160 Confers Dynein Recruitmentand Organelle PositioningAs dynein recruitment by golgin160 was required for Golgi posi-

tioning, we examined whether this was sufficient to confer


pericentrosomal positioning of a distinct organelle, mitochon-

dria, which is not normally positioned there. Golgin160 was

targeted to the outer membrane of mitochondria using the trans-

membrane mitochondrial-targeting determinant of Tom20 (T20)

(Sengupta et al., 2009). Localization to the mitochondria was

confirmed by colocalization with Mitotracker (Figure S4A). In

contrast to a control construct, GFP-tagged T20, which failed

to recruit dynein and left mitochondria dispersed, the chimeric

full-length golgin160 construct, T20-G160, induced dynein

recruitment to mitochondria and their juxtanuclear clustering

(Figure 5). When targeted to mitochondria, the dynein binding

domain cc7 was sufficient to cause dynein recruitment and clus-

tering while cc2-6 had neither activity (Figure 5). In radial profile

plots, full-length and cc7 showed a peak near the fluorescence

centroid (blue lines) indicating strong clustering. This reflected

microtubule dependent motility of mitochondria, as the gol-

gin160 induced mitochondrial clustering was blocked by

nocodazole (red lines). Indeed, centrosome staining indicated

that clustering occurred at the minus ends of microtubules (Fig-

ure S4B). Also, clustering was unaffected by Golgi dispersal

using BFA indicating that it did not depend on interaction with

Golgi membranes (Figure S4C). As a further control, microtu-

bule-independent clustering of mitochondria induced by T20-

GM130, which recruits the tether GRASP65 to form cross

bridges between mitochondria (Sengupta et al., 2009) was

insensitive to nocodazole and did not involve dynein recruitment

(Figure 5).

c.

Figure 3. Golgin160 Interacts with the Dynein Motor Complex

(A) Coimmunoprecipitation using control (preimmune or golgin84), golgin160,

or DIC antibodies with detection of the indicated endogenous proteins by

immunoblot. Loading control (10%) is shown.

(B) Schematic representation of GFP-tagged golgin160 constructs. The eight

predicted coiled-coil regions and a residue number scale are shown.

(C) Lysates from cells expressing the indicted GFP tagged construct were

used for coimmunoprecipitation using control (anti-myc) or DIC antibodies

with detection of the indicated golgin160 constructs by immunoblot (anti-

GFP).

(D) Cells expressing the indicated GFP-tagged golgin160 constructs were

fixed 24 hr after transfection and stained using anti-g-tubulin and anti-giantin

antibodies. Arrows indicate centrosomal accumulation. Bar = 10 mm.

See also Figure S3.

Figure 4. Golgin160 Binds Dynein via Direct Interaction with the

Dynein Intermediate Chain

(A) The indicated amounts of bead-absorbed purified GST constructs were

incubated with either purified His-DIC and binding was determined by

immunoblot with anti-DIC antibodies. The loading controls indicate 10% of the

total material present.

(B) Binding curve indicating recovery of His-DIC at the indicated concentration

after incubation with 2.3 mM GST-cc7 or GST (mean ± SEM, n = 2).

(C) Cells were either treated or not treated with siRNA against golgin160 and

after 48 hr they were transfected with GFP-tagged, siRNA-resistant full-length

golgin160 (FL) or an identical construct lacking cc7 (Dcc7). After another 24 hr,

they were stained to detect giantin. Bar = 10 mm.

(D) Percentage of cells expressing the indicated rescue construct with a

juxtanuclear Golgi (mean ± SEM; n = 3).

Developmental Cell


GTP-Bound Arf1 Controls Golgi Localizationof Golgin160We next investigated the mechanism by which golgin160/dynein

complex was targeted to the Golgi. Because golgin160 was dis-

placed from theGolgi by BFA before aGolgi marker redistributed

to the ER (Figure S5A), consistent with previous work (Hicks and

Machamer, 2002; Misumi et al., 1997), we hypothesized that

Deve

GTP-bound Arf1 may recruit golgin160 to impart minus-end

motility to Golgi membranes. Indeed, depletion of the Arf1

guanine nucleotide exchange factor GBF1 displaced golgin160

from the Golgi and blocked Golgi positioning (Figure S5B). To

ask whether Arf1 directly regulates the N-terminal Golgi localiza-

tion domain of golgin160, we first used rapid-acquisition, live

cell, confocal imaging to compare the rates of BFA-induced

membrane dissociation of Nterm and Arf1. Consistent with direct

control of Nterm by Arf1, dissociation of each followed single-

phase exponential decay kinetics immediately after BFA addi-

tion, with Arf1 (t1/2 = 27 s) slightly faster than Nterm (t1/2 = 39 s)

(Figures 6A and 6B). In further support of this, expression of


Figure 5. Golgin160 Is Sufficient to Recruit Dynein to Mitochondria

In Vivo

The indicated mitochondrially targeted constructs were expressed in HeLa

cells for 24 hr prior to fixation and imaging to reveal GFP (to localize the

construct) and DIC staining (marker of dynein). Scale bar = 10 mm. Graphs

record mitochondrial clustering induced by each construct in the absence

(blue line) or presence of a 2 hr nocodazole treatment (red line) as measured

using the ImageJ radial profile plugin in which the fluorescence intensity

starting from the fluorescence centroid is plotted as a function of radial

distance (n = 3, ±SEM, 15 cells per experiment). See also Figure S4.

Developmental Cell


GTP-restricted Arf1-Q71L increased membrane localization of

endogenous golgin160 and also conferred BFA resistance. In

contrast, inhibiting Arf1 activation by expressing guanosine

diphosphate (GDP)-restricted Arf1-T31N caused membrane

dissociation of golgin160 (Figures S5C and S5D).

Next, we testedwhether Ntermdirectly binds Arf1. GST-Nterm

and previously described His-tagged Arf1 constructs (Rein

et al., 2002) were purified (Figure 6C). GST-Nterm bound

GTP-restricted Arf1-Q71L and wild-type Arf1, but did not bind

GDP-restricted Arf1-T31N (Figure 6D) indicating that golgin160

is an Arf1 effector. As a control, GST-cc8 bound none of the

His-tagged Arf1 constructs. To determine if membrane associa-

tion of golgin160 was dependent on the GTPase activity of

Arf1, we analyzed the fluorescence recovery of Nterm after

photobleaching the Golgi pool. Compared to wild-type Arf1,

expression of Arf1-Q71L dramatically impaired the recovery of

Nterm after photobleaching on the Golgi confirming that the

GTP hydrolysis cycle of Arf1 actively regulates membrane

binding of the Golgi localization domain of golgin160 (Figures

6E and 6F).


Golgin160 Dissociates from Mitotic Golgi MembranesCausing DispersalBased on our identification of golgin160 as the dynein Golgi

receptor we examined whether mitotic Golgi dispersal might

be mediated by mitotic inhibition of either the dynein/golgin160

interaction or the golgin160/membrane interaction. Significantly,

golgin160 was absent from mitotic Golgi membranes and was

now evident on each spindle pole (Figure 7A), implying that

during mitosis golgin160 membrane binding was inhibited while

its dynein binding was maintained. Line profiles across Golgi

objects confirmed the loss of golgin160 fluorescence during

mitosis (Figure 7B). Additionally, when cell homogenates were

fractionated,mitotic golgin160wasmostly recovered in the cyto-

solic supernatant fraction (Figure 7C). Consistent with its spindle

localization, golgin160 from mitotic cell extracts coimmunopre-

cipitated with DIC (Figure 7D). Thus, dissociation of golgin160/

dynein complexes from membranes provides a straightforward

mechanism of mitotic Golgi dispersal.

Next, we tested whether golgin160 release from membranes

is required for mitotic Golgi dispersal. To bypass the mitotic

membrane regulation, we permanently anchored the dynein-

binding cc7 domain of golgin160 using the transmembrane

domain of the Golgi protein giantin. Significantly, whereas

a control membrane-anchored construct localized to mitotic

Golgi clusters and had no effect on mitotic Golgi dispersal, the

Golgi-anchored cc7 domain induced clustering of mitotic Golgi

membranes at each spindle pole (Figure 7E). To quantify this

effect, the position of the metaphase plate was used to orient

hemi-circles encompassing the Golgi fluorescence in one-half

of each mitotic cell and the integrated fluorescence intensity

for each degree radian was plotted. The peak of fluorescence

evident at 90�, which was the axis perpendicular to the

metaphase plate, corresponds to the accumulation of Golgi

membranes at spindle poles (Figure 7F). Thus, mitotic Golgi

membranes failed to disperse when membrane dissociation of

golgin160 was specifically prevented. In summary, these exper-

iments indicate that golgin160 dissociates from the Golgi at

mitosis and that this dissociation is required for Golgi dispersal.

DISCUSSION

This work identifies golgin160 as the regulated Golgi-localized

receptor for dynein. Golgin160 recruits dynein using its cc7

segment by directly binding dynein through its intermediate

chain. This interaction is required and sufficient to confer dynein

recruitment, minus-end motility, and pericentrosomal posi-

tioning. Golgin160 in turn is localized to Golgi membranes by

direct, nucleotide-dependent binding of its N terminus to Arf1.

Together, these observations imply that golgin160 provides an

elongated linkage of the motor to Golgi membranes that is

regulated by the switch-like behavior of a GTPase (Figure 7G).

Further, golgin160 is displaced from mitotic Golgi membranes

revealing the mechanism of uncoupling dynein from Golgi

membranes to achieve mitotic Golgi dispersal.

Golgin 160 Is the Major Membrane Receptor for Dyneinin the Early Secretory PathwayA normal Golgi ribbonmay be disrupted under a variety of condi-

tions. The disruption of specific proteins by siRNA-mediated

c.

Figure 6. Arf1 GTPase Directly Binds and Regulates Golgin160 Membrane Association

(A) Dissociation upon BFA addition of Arf1-GFP and the golgin160 construct GFP-Nterm compared to Golgi marker mCh-GPP130 (see Movies S3 and S4).

(B) Golgi region fluorescence from (a) normalized to the starting value and fit to a single-phase exponential decay (mean ± SEM, n = 6, r2 = 0.99 for Arf1-GFP and

GFP-Nterm).

(C) Coomassie staining of the indicated proteins (6 mg) used for the direct binding experiments.

(D) Recovery of the indicated purified His-Arf1 proteins (detected by immunoblot) bound to GST-cc8 or GST-Nterm. Loading control (10%) is shown.

(E) Dual-color fluorescence recovery after photobleaching the Golgi region (outlined) in cells expressing mCh-Nterm with either Arf1 or Arf1-Q71L.

(F) Fluorescence in the bleached Golgi region from (E) as a fraction of the prebleach level (mean ± SEM, n = 8).

See also Figure S5.

Developmental Cell


knockdown, confirmed by rescue, has provided distinct cate-

gories of phenotypes corresponding to distinct steps in Golgi

ribbon assembly (Feinstein and Linstedt, 2008; Mukhopadhyay

et al., 2010; Puthenveedu et al., 2006; Puthenveedu and

Linstedt, 2004; Sengupta et al., 2009; Yadav et al., 2009). Of

these, the golgin160 category of dispersed, secretion-compe-

tent, Golgi ministacks is clearly the best match for a specific

defect in inward motility of Golgi membranes. Because the Golgi

apparatus is highly dynamic and its integrity depends on many

pathways, stringent tests are needed to establish a candidate

as a direct mediator of Golgi motility. The candidate must be

(1) localized on Golgi membranes, (2) required for Golgi localiza-

tion of dynein, (3) required for Golgi positioning and motility, (4)

a direct binding partner of the motor complex, (5) sufficient to

confer dynein recruitment and motility, and (6) regulated during

mitosis. There are other dynein-interacting proteins on the Golgi

but only golgin160 meets these criteria. Of particular signifi-

Deve

cance, only golgin160 is known to be required for Golgi associ-

ation of the dynein motor complex. Most of the previously

identified candidates act via dynactin (Vallee et al., 2012), but

dynactin knockdown leaves dynein Golgi localized (Haghnia

et al., 2007). Accumulating evidence indicates that dynactin is

a complicated regulator of dynein activity rather than a specific

mediator of motor-cargo binding (Vallee et al., 2012). Bicaudal-

D (BICD), a conserved protein that interacts with dynein and

dynactin (Hoogenraad et al., 2001, 2003; Suter et al., 1989), is

a well-known candidate, but evidence also argues against

its role as the Golgi dynein receptor. First, although BICD

localizes to the trans Golgi network it is also present on cyto-

plasmic vesicles, centrosomes, nuclear pore complexes and,

in Drosophila, lipid droplets and mRNP particles (Akhmanova

and Hammer, 2010; Splinter et al., 2010). Second, overexpres-

sion of a BICD construct that lacks the dynein-binding domain

affects retrograde Golgi-to-ER trafficking but not Golgi


Figure 7. Mitotic Regulation of Golgin160-Mediated Golgi Positioning

(A) Dissociation of golgin160 during mitosis. Interphase and metaphase HeLa cells stably expressing GFP-GalNAc-T2 were imaged to detect GFP and stained

with anti-golgin160 antibodies. The white line in the merge panels indicates the pixels used for the RGB profile plots shown in (B). Scale bar = 10 mm.

(B) RGB profiles of Golgi (green) and golgin160 (red) corresponding to lines in merge of (A).

(C) Postnuclear supernatants from interphase and nocodazole-arrested mitotic cells were centrifuged to sediment Golgi membranes and the pellet (P) and

supernatant (S) fractions were immunoblotted to detect golgin160, GPP130, and tubulin. The percentage of golgin160 recovered in the pellet and supernatants is

shown after normalization using GPP130 and tubulin recovery (n = 3, ±SEM).

(D) Interphase and nocodazole-arrestedmitotic extracts were subjected to immunoprecipitation using anti-golgin84 (Ctrl) and anti-DIC antibodies and recovery of

golgin160 was determined by immunoblot and compared to 10% loading controls.

(E) Mitotic Golgi positioning (GFP to detect Golgi anchored construct and Hoechst staining to detect chromatin) in cells expressing the indicated constructs. Red

line indicates spindle axis. Bar = 10 mm.

(F) For azimuthal analysis, each hemisphere orthogonal to spindle axis was divided into sectors of one degree radian and the normalized Golgi fluorescence

intensity in each degree sector was plotted. This analysis yields a peak at 90� for clustering at the spindle (mean ± SEM, n = 3 with 15 cells per experiment).

(G) The schematic diagram depicts golgin160-mediated recruitment of the dynein motor to Golgi membranes and its regulation by the GTPase Arf1.

Developmental Cell


positioning (Matanis et al., 2002). Third, depletion of BICD does

not cause fragmentation of the Golgi apparatus (Fumoto et al.,

2006). Rather, it perturbs the localization of the centrosomal

protein ninein. Intriguingly, some dynein-interacting proteins

play specialized, rather than ubiquitous, roles. Rhodopsin inter-

acts with dynein and mediates the movement of post-Golgi,

rhodopsin-containing vesicles to the outer segments of photore-

ceptor neurons (Tai et al., 1999). Lava lamp, aDrosophila protein,

binds dynein, and mediates apical movement of Golgi mem-

branes during cellularization of Drosophila embryos (Papoulas


et al., 2005). However, it is not known if it is required for dynein

recruitment, and, more importantly, it does not have a mamma-

lian homolog.

The Role of Golgin160-Mediated Dynein Recruitmentin Golgi PositioningGolgi positioning is largely the result of microtubule organization

and the interaction of Golgi membranes with the dynein motor

complex. En route to the Golgi apparatus, membranes that

bud from the ER coalesce and fuse forming the ER Golgi

c.

Developmental Cell


intermediate compartment (ERGIC). Recruitment of the Arf

guanine nucleotide exchange factor GBF1 begins the process

by which these membranes acquire Golgi-like properties

(Garcıa-Mata and Sztul, 2003). GBF1 recruits and activates

Arf1 and other Arf isoforms. The activated Arf proteins interact

with multiple effectors to initiate ER retrieval and ERGIC-to-

Golgi trafficking (Szul et al., 2007; Volpicelli-Daley et al.,

2005). Our results suggest that golgin160-mediated dynein

recruitment plays a role at multiple steps in establishing Golgi

positioning. First, golgin160 might act as a critical Arf1 effector,

directly recruiting dynein, and therefore imparting inward

motility to peripheral ERGIC membranes. This model, that

Arf1 recruits dynein through golgin160, is consistent with the

findings that supplementing an in vitro reaction with a constitu-

tively activated form of Arf1 increases dynein recovery in

a Golgi membrane fraction, and that the GTPase cdc42 nega-

tively regulates Arf1 to control dynein membrane association

(Chen et al., 2005; Hehnly et al., 2010). Second, continued

presence of Arf1, and therefore golgin160, on Golgi membranes

ensures retention of membranes at the MTOC by constant

dynein-driven inward motility. Third, Arf1 recruitment of gol-

gin160/dynein complexes to Golgi membranes might also

mediate Golgi organization involving Golgi-nucleated microtu-

bules. Golgi microtubules contribute to maintenance of Golgi

positioning near the cell center and, upon nocodazole washout,

clustering of Golgi membranes in the cell periphery (Efimov

et al., 2007; Miller et al., 2009). That these events depend on

golgin160 is suggested by the lack of either Golgi cell-center

positioning or clustering in the periphery in cells depleted of

golgin160.

Arf1-based, nucleotide-dependent, golgin160/dynein recruit-

ment provides a potential model for regulating the cycling of

the motor complex on and off Golgi membranes. Spatial control

of Arf activity, by relative enrichment of GBF1 activity in the cell

periphery and Arf1-GAP activity on centrally localized Golgi

membranes could drive a cycle of the motor complex involving

cargo capture in the periphery and release in the cell center.

Our identification of the receptor as being a peripheral, rather

than integral, component of the Golgi membrane suggests that

at least a fraction of the motor returns to the cell periphery by

diffusion in the cytosol. Whether a significant fraction also

returns on retrograde cycling membranes is an interesting ques-

tion that remains to be answered. Arf-based recruitment of

dynein, through its receptor golgin160, suggests that regulation

of motor recruitment by GTPases to organelles is a common

theme in intracellular trafficking.

As mentioned above, Golgi positioning can change dramati-

cally during diverse physiological scenarios such as differentia-

tion, polarization, immune synapse formation, myotube forma-

tion in muscle, and axonal and dendritic outgrowth in neurons.

In most cases, the change can be understood in terms of two

associated mechanisms: a rearrangement of the microtubule

array, and regulation of motor association with the Golgi

membranes. The latter, which had been difficult to study due

to the dearth of bona fide motor receptors, can now be studied

with a focus on dynein/golgin160/Arf1 associations and, espe-

cially, the control of Arf1 activation and inactivation. Further

work on golgin160 is likely to reveal mechanistic insights into

motor regulation in diverse organellar processes.

Deve

Arf/Golgin160/Dynein Complex as a Control Point forRegulating Golgi Motility during Mitotic Golgi DispersalMitotic Golgi dispersal occurs in a stepwise fashion. The Golgi

ribbon begins to fragment and disperse in late G2, and, as the

cell progresses tometaphase, these fragments vesiculate result-

ing in dispersed vesicles and vesicle clusters. While it has been

proposed that inhibition of motility plays a key part in mitotic

Golgi disassembly, the mechanisms have been unclear. Our

findings that golgin160/dynein complexes are released from

Golgi membranes duringmitosis, and that this release is required

for normal mitotic Golgi dispersal, provides significant mecha-

nistic insight into how motility might be inhibited in mitosis.

One obvious possibility is that golgin160 membrane dissociation

is mediated by mitotic inhibition of Arf1. Indeed, expression of

GTP-restricted Arf1 impairs mitotic Golgi dispersal (Altan-

Bonnet et al., 2003) and GBF1 is mitotically phosphorylated

and released frommembranes, suggesting that it no longer acti-

vates Arf1 (Morohashi et al., 2010). Nevertheless, whether Arf1 is

inhibited during mitosis is controversial. GBF1 is not the only

exchange factor for Arf1, and Arf1 remains active in mitotic

extracts (Xiang et al., 2007). It may be that GBF1 function

is specific to the pool of Arf1 on ERGIC and cis Golgi

membranes. If so, only Arf1 effectors on these membranes,

such as golgin160, would be mitotically inhibited. Golgin160 is

also regulated by phosphorylation (Cha et al., 2004). Although

mitotic phosphorylation of golgin160 has not been studied in

detail, another possibility is that golgin160 binding to Arf1 is

regulated by phosphorylation of golgin160. Interestingly, under

mitotic conditions, golgin160 remained bound to dynein. This

is somewhat surprising, as phosphorylation of dynein during

mitosis modulates its binding to other partners (Whyte et al.,

2008). Whether the golgin160 bound dynein pool has a specific

mitotic function is unknown, but it is a strong possibility that

release of dynein from the Golgi membranes allows the motor

to switch from its interphase function in organelle positioning

to its mitotic roles.

In summary, we have identified golgin160 as a key cell cycle

regulated dynein receptor that drives Golgi positioning. It is

specifically Golgi localized through the interaction of its N

terminus with the GTPase Arf1. It is required for both dynein

recruitment and inward motility of Golgi membranes. It directly

binds the intermediate chain of dynein. It confers both dynein

recruitment and minus-end motility at an exogenous site. And

finally, it dissociates from mitotic Golgi membranes to allow

Golgi dispersal. The relationship between its role as a dynein

receptor and others identified for golgin160, including trafficking

of specific cargos (Hicks et al., 2006; Williams et al., 2006),

apoptosis (Maag et al., 2005; Mancini et al., 2000), and sper-

matogenesis (Banu et al., 2002; Matsukuma et al., 1999) is at

present unclear. Intriguingly, different splice isoforms of the

protein exhibit different cargo binding activities (Hicks and

Machamer, 2005). Whether the dynein-binding activity of

golgin160 is specific to certain isoforms remains to be tested.

Regardless, the present work elucidates a key aspect of organ-

elle positioning and its regulation for accurate organelle partition-

ing during cell division. It also impacts our understanding of the

spatial organization of the secretory pathway, and the processes

that depend on this spatial organization such as cell polarity, cell

migration, and wound healing.


Developmental Cell


EXPERIMENTAL PROCEDURES

Constructs and Reagents

EB1-GFP, pRSET-DIC(1–257), and pTREArf1 were gifts from Drs. Shaw

(UCSF), Schroer (JHU), and Vilardaga (U Pitt), respectively. mCh-GRASP55,

VSVG-GFP, and GFP-golgin160 have been described (Feinstein and Linstedt,

2008; Yadav et al., 2009). Mutagenesis was by Quickchange. Residue

numbers of golgin160 constructs were Nterm (1–496), cc2-8 (393–1498),

cc2-6 (393–1244), and cc7 (1245–1385). The GFP-golgin160 siRNA-resistant

construct was made by silent base pair changes (3598GTGGAAGCCGGG to

GTCGAGGCCGGC) and residues 1245–1385 were deleted using loopout

primers (Sengupta et al., 2009) to generate Dcc7. The Tom-20 fragment

(Sengupta et al., 2009) was inserted by PCR to create an N-terminal tag.

mCh-Nterm was in pcS2-mCh. GST-N term, GST-cc7, and GST-cc8 were in

pGEX4T1 at the SalI and NotI cloning sites. Arf1-GFP, Q71L, and T31N were

in pEGFP-N3. His-D17Arf1 was made using loopout primers in pRSET and

Q71L and T31N were then introduced. C-terminally anchored GFP-Gtn and

cc7-GFP-Gtn were by appending giantin sequence (residues 3155–3255) at

the XbaI site in the corresponding pcS2-GFP vectors. The siRNAs were as

follows: control (GACCAGCCATCGTAGTACTTT), golgin160 (exon 2: AACCT

GCAACCAAAACGAGAC, exon 11: AGAGAAGTTAAGAGAAGAATT, exon 15:

GGCCCTCGCGGCCAAGGAGGC, and exon19: CTCCTTGGAGCTGAGTGA

GGT), GBF-1 (Szul et al., 2007) (AAACGAAA TGCCCGATGGAGC) and Tctex1

(Palmer et al., 2009) (AAGUGAACCAGUGGACCACAA). Affinity-purified rabbit

antibodies against Tctex1 were a gift from Dr. Sung (Cornell). Rabbit anti-

bodies against golgin160 were generated against amino acids 1400–1498

(Covance). Antibodies against GPP130 and giantin have been described

(Mukhopadhyay et al., 2010). Commercial antibodies were dynein interme-

diate chain (Millipore), His (Bethyl labs), GMAP210 and GBF1 (BD Transduc-

tions), golgin97 (Invitrogen), g-tubulin, a-tubulin, and dynein heavy chain

(Sigma). Nocodazole (used at 0.5 mg/ml for 2 hr), brefeldin-A (used at

2.5 mg/ml), GDP and GTPgS were from Sigma. Transfection reagents were

oligofectamine (Invitrogen) for siRNA and JETpei (PolyPlus) for plasmids and

were used according to manufacturer’s instructions.

Confocal Microscopy

Live-cell imaging was performed using an Andor Revolution XD Spinning disk

system on a Nikon Eclipse Ti inverted microscope with a 1003 1.49 NA objec-

tive (Nikon). Solid-state lasers 488 and 561 nm (Coherent) were used for both

imaging and photobleaching. Cells were imaged in Opti-MEM (GIBCO) with

10% serum and 35 mM HEPES (pH 7.4), maintained at 37�C in a temperature

controlled chamber (In Vivo Scientific). Time-lapse images were acquired with

an iXon+897 EM-CCD 16-bit camera driven by iQ (Andor). Fixed cell image-

stacks were acquired using a Zeiss Axiovert 200 microscope with a 1003

1.4 NA objective (Zeiss) attached to an UltraView spinning-disk confocal

system (PerkinElmer) equipped with three-line laser, independent excitation

and emission filter wheels (PerkinElmer) and a 12-bit Orca ER digital camera

(Hamamatsu Photonics).

Nocodazole Washout Golgi Motility Assay

HeLa cells were transfected with siRNA, and then 48 hr later were cotrans-

fected with EB1-GFP and mCh-GRASP55 plasmids. After 24 hr, the cells

were incubated with nocodazole for 2 hr and washed with cold media. Within

5 min single optical section 16 bit confocal images were recorded for each

channel every 2 s. Using ImageJ, EB1-GFP comet tracks and mCh-GRASP55

Golgi tracks were analyzed by projecting frames from a period of 20 s and

100 s, respectively, such that the first frame was color coded blue, intervening

frames were green, and the last frame was red. The blue/green/red tracks indi-

cate directionality and persistence of movements (Jaulin and Kreitzer, 2010).

All discernable EB1-GFP tracks were counted for five 20 s periods in a given

experiment and the percentage of these that showed a blue/green/red order

projecting to the cell periphery was determined. For GRASP55-mCh, all

discernable tracks showing blue/green/red order projecting inward were

counted during five 100 s periods in a given experiment.

VSVG Transport Assay

HeLa cells transfected with siRNA were retransfected 48 hr later with VSVG-

GFP and mCh-GRASP55 plasmids and after 12 hr were shifted to 40�C for


12 hr. The cells were mounted and confocal image stacks were acquired every

5 s at 37�C. ImageJ plugin MTrackJ was used to track VSVG-GFP object

movement after max-value projection of the image stack, create projected

tracks, and calculate distance at each step. Directional motility was taken to

be the ratio of theminimumXY distance between starting and final coordinates

over the actual distance traversed. Only objects that tracked through at least

four successive frames were included. At least 20 tracks per experiment were

included for each track cluster.

Fluorescence Level Determinations

ImageJ RGB Profiler plugin was used on single optical sections for profile

plots. For Golgi level determinations, average value projections were created

from confocal image stacks. For Tctex1 levels, Golgi pixels were selected

using thresholding of giantin staining and the mean Tctex1 intensity over these

pixels was obtained using the ‘‘Measure’’ function of ImageJ. Golgin160

levels on the Golgi were similarly obtained after selecting Arf1-positive pixels

except that mean values were multiplied by the area of the selected regions

and the results are presented as a percentage of total golgin160 fluorescence

in each cell, which was determined in the same way after selecting the

entire cell.

Magnetic Immunoisolation of Golgi Membranes

Anti-rabbit IgG Dynabeads M-280 (50 ml packed, Invitrogen) were incubated

with rabbit anti-giantin (20 ml serum) for 30 min at 4�C and then blocked with

0.1% bovine serum albumin in phosphate buffer saline. Postnuclear superna-

tants were prepared from 150 ml of packed HeLa cells 72 hr posttransfection

and homogenized in an equal amount of buffer (50 mM NaCl, 1 mM EDTA,

10 mM triethanolamine [pH 7.4]) using a 25 g needle and centrifuged 5 min

at 1,000 3 g. After a 2 hr, 4�C incubation of the postnuclear supernatant

with the beads, the beads were collected using a magnet, washed twice

and analyzed by immunoblotting with enhanced chemiluminescence and an

LAS-3000 imager with ImageGauge software (Fujifilm).

Coimmunoprecipitation Assay

HeLa cells (10 cm plate) were collected, lysed in 200 ml buffer (10 mM HEPES

[pH 7.2], 50 mMKCl, 0.5% Triton X-100, 2mMDTT, 1 mMEDTA, and protease

inhibitors), passed through a 25 gauge needle and incubated for 30 min on ice.

The lysate was centrifuged in a microfuge for 5 min. The supernatant was pre-

cleared for 30 min using 10 ml packed Sepharose beads (Invitrogen) and then

incubated overnight with antibody-bound Sepharose beads (4 ml anti-DIC with

10 ml protein G beads or 2 ml anti-golgin160 with 10 ml protein A beads). The

bound fraction was treated to three washes with buffer and two washes with

buffer lacking detergent, SDS-PAGE, and immunoblotting.

Direct Binding Assays

GST- and His-tagged proteins were purified as described (Sengupta et al.,

2009) and nucleotide was exchanged in the Arf1 proteins (Rein et al., 2002).

For DIC binding to golgin160, 2–10 mg of eachGST protein was bound to gluta-

thione beads and incubatedwith His-DIC (1.2 mM) for 1 hr at 4�C in 200 ml buffer

(10 mM HEPES [pH 7.2], 50 mM KCl, 0.5% Triton X-100, 2 mM DTT, 1 mM

EDTA, and protease inhibitors). After three washes with buffer and twowashes

with buffer lacking detergent, the bound fraction was analyzed by Ponceau S

staining and immunoblotting. For Kd determination, the assay was carried out

using 2.3 mM GST protein and 0–6.8 mM His-DIC and the resulting DIC immu-

noblot signal was quantified using ImageJ and Prism (GraphPad Software Inc.,

La Jolla, CA) by nonlinear regression analysis assuming one-site binding. For

Arf1 binding to golgin160, 2–10 mg of each GST protein was bound to gluta-

thione beads and incubated with the nucleotide-exchanged Arf1 constructs

at 1.2 mM for 1 hr at 4�C in binding buffer (25 mM HEPES [pH 6.8], 300 mM

potassium acetate, 1 mM DTT, 0.5 mM MgCl2, 0.2% Triton X-100, and

0.7 mMGDP or GTPgS). The beads were washed twice with the binding buffer

and twice with the binding buffer without detergent (Rein et al., 2002). Anti-His

immunoblot or Ponceau S staining, respectively, determined Arf1 and GST

protein level.

Gene Replacement Rescue Assay

Cells were transfected with siRNA using oligofectamine (Invitrogen) and then

after 48 hr the cells were transfected with GFP or siRNA-resistant GFP-tagged

c.

Developmental Cell


golgin160 constructs. After another 24 hr, the cells were fixed using parafor-

maldehyde and immunostained for giantin. The percentage of rescue was

the percentage of GFP-positive cells showing a juxtanuclear Golgi normalized

by the knockdown penetrance (�90%), which was the fraction of knockdown

cells showing dispersed Golgi after expression of GFP alone (Puthenveedu

and Linstedt, 2004).

Mitochondrial Clustering Analysis

After 24 hr, transfected cells were left untreated or treated for 3 hr with noco-

dazole and immunostained using anti-DIC antibody. Quantification of clus-

tering was performed on average value projections of confocal image stacks

using the ImageJ plugin Radial profile as described (Sengupta et al., 2009).

Grayscale thresholds were set for each experiment and the centroid of the

fluorescence for each cell was determined using the ‘‘Measure’’ function.

The normalized fluorescence intensity in each concentric circle drawn from

the determined centroid was obtained using the Radial profile plugin.

Arf1 Imaging Assays

To compare Golgi dissociation kinetics of golgin160 and Arf1 to GPP130, HeLa

cells were transfected with mCh-GPP130 and either Arf1-GFP or GFP-Nterm

and after 24 hr were imaged at three frames/s in two channels before and after

BFA (2.5 mg/ml) addition. The fluorescence in the Golgi region over time was

determined using the ImageJ ‘‘Measure’’ function as a ratio of the initial Golgi

fluorescence. Prism5 was used to fit that data to a single-phase exponential

decay equation to calculate the t1/2. For fluorescence recovery after photo-

bleaching, HeLa cells were transfected with mCh-Nterm and either Arf1-

GFP or Q71L-GFP. After 24 hr, a prebleach image was acquired and the Golgi

region was selected and bleached using 488 and 568 nm laser light. Confocal

image stacks were then acquired every 5 s for each channel. The fluorescence

in the Golgi region over time was determined as a function of the initial Golgi

fluorescence and Prism5 was used to fit that data to a single-phase associa-

tion equation using Prism5.

Mitotic Cell Analysis

HeLa cells stably expressing GalNAcT2 were fixed in paraformaldehyde and

stained with anti-golgin160 and Hoechst. Metaphase cells were identified

based on presence of a metaphase plate. RGB Profile plots were drawn using

ImageJ. Mitotic cell extracts were obtained from HeLa cells treated with

0.5 mg/ml nocodazole for 12–16 followed by shakeoff. Coimmunoprecipitation

was as above. For fractionation, the cells were homogenized in buffer (250mM

sucrose, 10 mM HEPES [pH 7.2], 1 mM EDTA, 1 mM DTT, and protease inhib-

itors) using a 25 gauge needle and centrifuged at 1,0003 g for 5min. The post-

nuclear supernatant was then centrifuged at 100,0003 g for 60min to yield the

cytosol fraction, which was precipitated using trichloroacetic acid and washed

with acetone. The pellet fraction was briefly rinsed and both the cytosol and

membrane pellet fractions were analyzed by immunoblotting. For analysis of

cells expressing membrane anchored GFP-Gtn and cc7-GFP-Gtn constructs,

cells were fixed 24 hr posttransfection and stained using anti-tubulin and

Hoechst. To assay Golgi distribution the ImageJ Azimuthal Average plugin

was used. Mitotic cells in thresholded, average-projected, image stacks

were divided into hemispheres along the metaphase plate. Each hemisphere

was then selected and using the Azimuthal Average plugin, divided into

sectors of one degree radian and the normalized Golgi fluorescence intensity

in each degree sector was measured.

SUPPLEMENTAL INFORMATION

Supplemental Information includes five figures, Supplemental Experimental

Procedures, and four movies and can be found with this article online at

http://dx.doi.org/10.1016/j.devcel.2012.05.023.

ACKNOWLEDGMENTS

We thank T.H. Lee, S. Mukhopadhyay, D. Sengupta, C. Bachert, and C. Priddy

for critical reading of the manuscript and T. Schroer (JHU) and C. Sung

(Cornell) for essential contributions. This study was supported by NIH grants

GM056779 to A.D.L. and DA024698 to M.A.P.

Deve

Received: February 20, 2012

Revised: April 19, 2012

Accepted: May 29, 2012

Published online: July 16, 2012

REFERENCES

Akhmanova, A., and Hammer, J.A., 3rd. (2010). Linking molecular motors to

membrane cargo. Curr. Opin. Cell Biol. 22, 479–487.

Altan-Bonnet, N., Phair, R.D., Polishchuk, R.S., Weigert, R., and Lippincott-

Schwartz, J. (2003). A role for Arf1 in mitotic Golgi disassembly, chromosome

segregation, and cytokinesis. Proc. Natl. Acad. Sci. USA 100, 13314–13319.

Banu, Y., Matsuda, M., Yoshihara, M., Kondo, M., Sutou, S., and Matsukuma,

S. (2002). Golgi matrix protein gene, Golga3/Mea2, rearranged and re-ex-

pressed in pachytene spermatocytes restores spermatogenesis in the mouse.

Mol. Reprod. Dev. 61, 288–301.

Blum, R., Stephens, D.J., and Schulz, I. (2000). Lumenal targetedGFP, used as

a marker of soluble cargo, visualises rapid ERGIC to Golgi traffic by a tubulo-

vesicular network. J. Cell Sci. 113, 3151–3159.

Burkhardt, J.K., Echeverri, C.J., Nilsson, T., and Vallee, R.B. (1997).

Overexpression of the dynamitin (p50) subunit of the dynactin complex

disrupts dynein-dependent maintenance of membrane organelle distribution.

J. Cell Biol. 139, 469–484.

Cha, H., Smith, B.L., Gallo, K., Machamer, C.E., and Shapiro, P. (2004).

Phosphorylation of golgin-160 by mixed lineage kinase 3. J. Cell Sci. 117,

751–760.

Chen, J.L., Xu,W., and Stamnes,M. (2005). In vitro reconstitution of ARF-regu-

lated cytoskeletal dynamics on Golgi membranes. Methods Enzymol. 404,

345–358.

de Anda, F.C., Pollarolo, G., Da Silva, J.S., Camoletto, P.G., Feiguin, F., and

Dotti, C.G. (2005). Centrosome localization determines neuronal polarity.

Nature 436, 704–708.

Efimov, A., Kharitonov, A., Efimova, N., Loncarek, J., Miller, P.M., Andreyeva,

N., Gleeson, P., Galjart, N., Maia, A.R., McLeod, I.X., et al. (2007). Asymmetric

CLASP-dependent nucleation of noncentrosomal microtubules at the trans-

Golgi network. Dev. Cell 12, 917–930.

Feinstein, T.N., and Linstedt, A.D. (2008). GRASP55 regulates Golgi ribbon

formation. Mol. Biol. Cell 19, 2696–2707.

Fumoto, K., Hoogenraad, C.C., and Kikuchi, A. (2006). GSK-3beta-regulated

interaction of BICDwith dynein is involved inmicrotubule anchorage at centro-

some. EMBO J. 25, 5670–5682.

Garcıa-Mata, R., and Sztul, E. (2003). The membrane-tethering protein p115

interacts with GBF1, an ARF guanine-nucleotide-exchange factor. EMBO

Rep. 4, 320–325.

Haghnia, M., Cavalli, V., Shah, S.B., Schimmelpfeng, K., Brusch, R., Yang, G.,

Herrera, C., Pilling, A., and Goldstein, L.S. (2007). Dynactin is required for

coordinated bidirectional motility, but not for dynein membrane attachment.

Mol. Biol. Cell 18, 2081–2089.

Hehnly, H., Xu, W., Chen, J.L., and Stamnes, M. (2010). Cdc42 regulates

microtubule-dependent Golgi positioning. Traffic 11, 1067–1078.

Hicks, S.W., and Machamer, C.E. (2002). The NH2-terminal domain of

Golgin-160 contains both Golgi and nuclear targeting information. J. Biol.

Chem. 277, 35833–35839.

Hicks, S.W., and Machamer, C.E. (2005). Isoform-specific interaction of

golgin-160 with the Golgi-associated protein PIST. J. Biol. Chem. 280,

28944–28951.

Hicks, S.W., Horn, T.A., McCaffery, J.M., Zuckerman, D.M., and Machamer,

C.E. (2006). Golgin-160 promotes cell surface expression of the beta-1 adren-

ergic receptor. Traffic 7, 1666–1677.

Ho, W.C., Allan, V.J., van Meer, G., Berger, E.G., and Kreis, T.E. (1989).

Reclustering of scattered Golgi elements occurs along microtubules. Eur.

J. Cell Biol. 48, 250–263.

Hoogenraad, C.C., Akhmanova, A., Howell, S.A., Dortland, B.R., De Zeeuw,

C.I., Willemsen, R., Visser, P., Grosveld, F., and Galjart, N. (2001).



Developmental Cell


Mammalian Golgi-associated Bicaudal-D2 functions in the dynein-dynactin

pathway by interacting with these complexes. EMBO J. 20, 4041–4054.

Hoogenraad, C.C., Wulf, P., Schiefermeier, N., Stepanova, T., Galjart, N.,

Small, J.V., Grosveld, F., de Zeeuw, C.I., and Akhmanova, A. (2003).

Bicaudal D induces selective dynein-mediated microtubule minus end-

directed transport. EMBO J. 22, 6004–6015.

Horton, A.C., Racz, B., Monson, E.E., Lin, A.L., Weinberg, R.J., and Ehlers,

M.D. (2005). Polarized secretory trafficking directs cargo for asymmetric

dendrite growth and morphogenesis. Neuron 48, 757–771.

Infante, C., Ramos-Morales, F., Fedriani, C., Bornens, M., and Rios, R.M.

(1999). GMAP-210, A cis-Golgi network-associated protein, is a minus end

microtubule-binding protein. J. Cell Biol. 145, 83–98.

Jaulin, F., and Kreitzer, G. (2010). KIF17 stabilizes microtubules and contrib-

utes to epithelial morphogenesis by acting at MT plus ends with EB1 and

APC. J. Cell Biol. 190, 443–460.

Kardon, J.R., and Vale, R.D. (2009). Regulators of the cytoplasmic dynein

motor. Nat. Rev. Mol. Cell Biol. 10, 854–865.

King, S.J., and Schroer, T.A. (2000). Dynactin increases the processivity of the

cytoplasmic dynein motor. Nat. Cell Biol. 2, 20–24.

King, S.J., Brown, C.L., Maier, K.C., Quintyne, N.J., and Schroer, T.A. (2003).

Analysis of the dynein-dynactin interaction in vitro and in vivo. Mol. Biol. Cell

14, 5089–5097.

Kupfer, A., Louvard, D., and Singer, S.J. (1982). Polarization of the Golgi appa-

ratus and the microtubule-organizing center in cultured fibroblasts at the edge

of an experimental wound. Proc. Natl. Acad. Sci. USA 79, 2603–2607.

Kupfer, A., Dennert, G., and Singer, S.J. (1983). Polarization of the Golgi appa-

ratus and the microtubule-organizing center within cloned natural killer cells

bound to their targets. Proc. Natl. Acad. Sci. USA 80, 7224–7228.

Ladinsky, M.S., Mastronarde, D.N., McIntosh, J.R., Howell, K.E., and

Staehelin, L.A. (1999). Golgi structure in three dimensions: functional insights

from the normal rat kidney cell. J. Cell Biol. 144, 1135–1149.

Lu, Z., Joseph, D., Bugnard, E., Zaal, K.J., and Ralston, E. (2001). Golgi

complex reorganization during muscle differentiation: visualization in living

cells and mechanism. Mol. Biol. Cell 12, 795–808.

Maag, R.S., Mancini, M., Rosen, A., and Machamer, C.E. (2005). Caspase-

resistant Golgin-160 disrupts apoptosis induced by secretory pathway stress

and ligation of death receptors. Mol. Biol. Cell 16, 3019–3027.

Mancini, M., Machamer, C.E., Roy, S., Nicholson, D.W., Thornberry, N.A.,

Casciola-Rosen, L.A., and Rosen, A. (2000). Caspase-2 is localized at the

Golgi complex and cleaves golgin-160 during apoptosis. J. Cell Biol. 149,

603–612.

Matanis, T., Akhmanova, A., Wulf, P., Del Nery, E., Weide, T., Stepanova, T.,

Galjart, N., Grosveld, F., Goud, B., De Zeeuw, C.I., et al. (2002). Bicaudal-D

regulates COPI-independent Golgi-ER transport by recruiting the dynein-

dynactin motor complex. Nat. Cell Biol. 4, 986–992.

Matsukuma, S., Kondo, M., Yoshihara, M., Matsuda, M., Utakoji, T., and

Sutou, S. (1999). Mea2/Golga3 gene is disrupted in a line of transgenic mice

with a reciprocal translocation between Chromosomes 5 and 19 and is

responsible for a defective spermatogenesis in homozygotes. Mamm.

Genome 10, 1–5.

Miller, P.M., Folkmann, A.W., Maia, A.R., Efimova, N., Efimov, A., and

Kaverina, I. (2009). Golgi-derived CLASP-dependent microtubules control

Golgi organization and polarized trafficking in motile cells. Nat. Cell Biol. 11,

1069–1080.

Misumi, Y., Sohda, M., Yano, A., Fujiwara, T., and Ikehara, Y. (1997). Molecular

characterization of GCP170, a 170-kDa protein associated with the cyto-

plasmic face of the Golgi membrane. J. Biol. Chem. 272, 23851–23858.

Morohashi, Y., Balklava, Z., Ball, M., Hughes, H., and Lowe, M. (2010).

Phosphorylation and membrane dissociation of the ARF exchange factor

GBF1 in mitosis. Biochem. J. 427, 401–412.

Mukhopadhyay, S., Bachert, C., Smith, D.R., and Linstedt, A.D. (2010).

Manganese-induced trafficking and turnover of the cis-Golgi glycoprotein

GPP130. Mol. Biol. Cell 21, 1282–1292.


Palmer, K.J., Hughes, H., and Stephens, D.J. (2009). Specificity of cytoplasmic

dynein subunits in discrete membrane-trafficking steps. Mol. Biol. Cell 20,

2885–2899.

Papoulas, O., Hays, T.S., and Sisson, J.C. (2005). The golgin Lava lamp

mediates dynein-based Golgi movements during Drosophila cellularization.

Nat. Cell Biol. 7, 612–618.

Presley, J.F., Cole, N.B., Schroer, T.A., Hirschberg, K., Zaal, K.J., and

Lippincott-Schwartz, J. (1997). ER-to-Golgi transport visualized in living cells.

Nature 389, 81–85.

Pu, J., and Zhao, M. (2005). Golgi polarization in a strong electric field. J. Cell

Sci. 118, 1117–1128.

Puthenveedu, M.A., and Linstedt, A.D. (2004). Gene replacement reveals that

p115/SNARE interactions are essential for Golgi biogenesis. Proc. Natl. Acad.

Sci. USA 101, 1253–1256.

Puthenveedu, M.A., Bachert, C., Puri, S., Lanni, F., and Linstedt, A.D. (2006).

GM130 and GRASP65-dependent lateral cisternal fusion allows uniform

Golgi-enzyme distribution. Nat. Cell Biol. 8, 238–248.

Ralston, E. (1993). Changes in architecture of the Golgi complex and other

subcellular organelles during myogenesis. J. Cell Biol. 120, 399–409.

Rein, U., Andag, U., Duden, R., Schmitt, H.D., and Spang, A. (2002). ARF-GAP-

mediated interaction between the ER-Golgi v-SNAREs and the COPI coat.

J. Cell Biol. 157, 395–404.

Roghi, C., and Allan, V.J. (1999). Dynamic association of cytoplasmic dynein

heavy chain 1a with the Golgi apparatus and intermediate compartment.

J. Cell Sci. 112, 4673–4685.

Schroer, T.A. (2004). Dynactin. Annu. Rev. Cell Dev. Biol. 20, 759–779.

Sengupta, D., Truschel, S., Bachert, C., and Linstedt, A.D. (2009). Organelle

tethering by a homotypic PDZ interaction underlies formation of the Golgi

membrane network. J. Cell Biol. 186, 41–55.

Shorter, J., and Warren, G. (2002). Golgi architecture and inheritance. Annu.

Rev. Cell Dev. Biol. 18, 379–420.

Simpson, J.C., Nilsson, T., and Pepperkok, R. (2006). Biogenesis of tubular

ER-to-Golgi transport intermediates. Mol. Biol. Cell 17, 723–737.

Splinter, D., Tanenbaum, M.E., Lindqvist, A., Jaarsma, D., Flotho, A., Yu, K.L.,

Grigoriev, I., Engelsma, D., Haasdijk, E.D., Keijzer, N., et al. (2010). Bicaudal

D2, dynein, and kinesin-1 associate with nuclear pore complexes and regulate

centrosome and nuclear positioning during mitotic entry. PLoS Biol. 8,

e1000350.

Stinchcombe, J.C., Majorovits, E., Bossi, G., Fuller, S., and Griffiths, G.M.

(2006). Centrosome polarization delivers secretory granules to the immunolog-

ical synapse. Nature 443, 462–465.

Suter, B., Romberg, L.M., and Steward, R. (1989). Bicaudal-D, a Drosophila

gene involved in developmental asymmetry: localized transcript accumulation

in ovaries and sequence similarity to myosin heavy chain tail domains. Genes

Dev. 3 (12A), 1957–1968.

Szul, T., Grabski, R., Lyons, S., Morohashi, Y., Shestopal, S., Lowe, M., and

Sztul, E. (2007). Dissecting the role of the ARF guanine nucleotide exchange

factor GBF1 in Golgi biogenesis and protein trafficking. J. Cell Sci. 120,

3929–3940.

Tai, A.W., Chuang, J.Z., Bode, C., Wolfrum, U., and Sung, C.H. (1999).

Rhodopsin’s carboxy-terminal cytoplasmic tail acts as a membrane receptor

for cytoplasmic dynein by binding to the dynein light chain Tctex-1. Cell 97,

877–887.

Tai, A.W., Chuang, J.Z., and Sung, C.H. (1998). Localization of Tctex-1, a cyto-

plasmic dynein light chain, to the Golgi apparatus and evidence for dynein

complex heterogeneity. J. Biol. Chem. 273, 19639–19649.

Takahashi, M., Shibata, H., Shimakawa, M., Miyamoto, M., Mukai, H., and

Ono, Y. (1999). Characterization of a novel giant scaffolding protein, CG-

NAP, that anchors multiple signaling enzymes to centrosome and the golgi

apparatus. J. Biol. Chem. 274, 17267–17274.

Vallee, R.B., McKenney, R.J., and Ori-McKenney, K.M. (2012). Multiple modes

of cytoplasmic dynein regulation. Nat. Cell Biol. 14, 224–230.

c.

Developmental Cell


Volpicelli-Daley, L.A., Li, Y., Zhang, C.J., and Kahn, R.A. (2005). Isoform-selec-

tive effects of the depletion of ADP-ribosylation factors 1-5 on membrane

traffic. Mol. Biol. Cell 16, 4495–4508.

Whyte, J., Bader, J.R., Tauhata, S.B., Raycroft, M., Hornick, J., Pfister, K.K.,

Lane, W.S., Chan, G.K., Hinchcliffe, E.H., Vaughan, P.S., and Vaughan, K.T.

(2008). Phosphorylation regulates targeting of cytoplasmic dynein to kineto-

chores during mitosis. J. Cell Biol. 183, 819–834.

Williams, D., Hicks, S.W., Machamer, C.E., and Pessin, J.E. (2006). Golgin-160

is required for the Golgi membrane sorting of the insulin-responsive glucose

transporter GLUT4 in adipocytes. Mol. Biol. Cell 17, 5346–5355.

Deve

Xiang, Y., Seemann, J., Bisel, B., Punthambaker, S., and Wang, Y. (2007).

Active ADP-ribosylation factor-1 (ARF1) is required for mitotic Golgi fragmen-

tation. J. Biol. Chem. 282, 21829–21837.

Yadav, S., and Linstedt, A.D. (2011). Golgi positioning. Cold Spring Harb.

Perspect. Biol. 3, 3.

Yadav, S., Puri, S., and Linstedt, A.D. (2009). A primary role for Golgi posi-

tioning in directed secretion, cell polarity, and wound healing. Mol. Biol. Cell

20, 1728–1736.

Ye, B., Zhang, Y., Song, W., Younger, S.H., Jan, L.Y., and Jan, Y.N. (2007).

Growing dendrites and axons differ in their reliance on the secretory pathway.

Cell 130, 717–729.


Documents

Golgin160 Recruits the Dynein Motor to Position the Golgi Apparatus