Gujarat's Gentle Giant- Whale shark final · In 2004, the Gujarat Forest Department joined hands with International Fund for Animal Welfare – Wildlife Trust of India (IFAW—WTI)

ii

Wildlife Trust of India (WTI) is a non-profit conservation

organisation, committed to help conserve nature, especially

endangered species and threatened habitats, in partnership

with communities and governments. Our principal

objectives include managing or preventing wildlife crises

and mitigating threats to individual wild animals, their

populations and habitats through holistic strategies and

practical interventions.

Established in 1939, Tata Chemicals Limited (TCL) is

India’s leading manufacturer of inorganic chemicals,

fertilisers and food additives. Part of the US$ 22 billion

Tata group, the company owns and operates the largest

and most integrated inorganic chemicals complex in the

country at Mithapur, Gujarat. The company’s state-of-the-

art fertiliser complex at Babrala, Uttar Pradesh, is known

for its world-class energy efficiency standards, and has won

several awards in the fields of environmental conservation,

community development and safety. TCL’s phosphatic

fertiliser complex at Haldia in West Bengal is currently

the only manufacturing unit for DAP/NPK complexes in

West Bengal. The acquisition of an equal partnership in

Indo Maroc Phosphore S.A. (imacid) along with Chambal

Fertilisers and the global phosphate major, OCP of

Morocco recently, is the first step that TCL took towards

globalisation. In early 2006, TCL acquired the UK based

Brunner Mond Group (BM). This acquisition makes TCL

one of the most diversified companies with manufacturing

facilities in three continents and markets across the world.

Tata Chemicals Society for Rural Development (TCSRD)

was established by Tata Chemicals in 1980 for the benefit

of the rural population in an around the company’s plants

and township. Over the years it has initiated a number of

development, welfare and relief activities. 2004 onwards,

WTI with support of Tata Chemicals has worked hard

and turned the hunters of whale shark into its protectors.

Whale shark is now called Vhali "the dear one" and

people celebrate whale shark day at the local level. Tata

Chemicals won the Green Governance Award 2005 for the

Whale Shark Conservation Project. The award was given

by Dr Manmohan Singh, former Prime Minister of India on

November 10, 2005 in New Delhi.

The Gujarat Forest Department is entrusted with the prime

responsibility of protection, conservation and development

of forests and wildlife of the state. They have extended

support to the Whale Shark campaign even beyond the

shores of the state.

Suggested citation: Matwal. M., Premjothi. P.V.R., Joshi.D.,

Praveenkumar. B.M., Farukhkha. B., Goutham. S., Wafar.

M.V.M., Choudhury. B.C. and Kaul. R. (2014) Gujarat's

Gentle Giant — Conservation of Whale shark (Rhincodon

tupus) in Gujarat. Wildlife Trust of India, Noida, Uttar

Pradesh.

Keywords: Conservation, Whale Shark, Gujarat, scientific

study, campaign, satellite tagging, self documentation.

The designations of geographical entities in this

publication and the presentation of the material do not

imply the expression of any opinion whatsoever on the

part of the authors or WTI concerning the legal status

of any country, territory or area, or of its authorities, or

concerning the delimitation of its frontiers or boundaries.

All rights reserved. Reproduction and dissemination of

material in this publication for educational or any non-

commercial purposes are authorised without any prior

written permission from the copyright holders provided

the source is fully acknowledged and appropriate credit

given. Reproduction of material in this information

product for or other commercial purposes is prohibited

without written permission of the copyright holders.

Applications for such permission should be addressed to

the Executive Director, Wildlife Trust of India or by e-mail

to [email protected]

Copyright © Wildlife Trust of India 2014

Wildlife Trust of India

F-13, Sector-8, NOIDA - 201301,

Uttar Pradesh, India

Website : www.wti.org.in

Layout by : Dilip Swain and John Kunjukunju

Printed at : Lipee Scan Pvt. Ltd., New Delhi

Photo credit : WTI Library: Front Cover, Pg 3; Simon Pierce: Title Pg; BNHS Library: Pg 4, (1& 2); Gujarat FD Library: Pg 4

(3rd); Dipak: Pg 22; Manoj Matwal- Plates: 1,2,3,4,5,6,7,12,13,25,31,32 and 33 (Left); Jayanthi Bai Plate 8; Kansan Ranji: Plate

9 (left); Prem Sakthi: Plate 9 (middle); Dinesh Koraba: Plate 9 (right); Ravi Teja: Plate 10; Subburaman: Plate 22; Goutham:

Plate 28; Prakash Doria: Plate 33 (right); Sheren Sheresta: Plate 29 and 30; Dhiresh Joshi: Plate 27; Mohan Been Solanki:

Plate 25 and Minla Lachungu: Plate 17.

iii

Message iv

Foreword v

Preface vi

Acknowledgements vii

Executive Summary 01

Chapter 1 : Project Background and Objectives 05

Chapter 2 : Project Area 07

Chapter 3 : Historical Whale Shark Occurrence and Distribution along the Coast of Gujarat: A Survey 10

Chapter 4 : Whale Shark Rescue Analysis 22

Chapter 5 : Redefining Whale Shark Rescue Operation: Development of Self-Documentation Scheme 32

Chapter 6 : Whale Shark Habitat Preference 36

Chapter 7 : Whale Shark Migration 54

Chapter 8 : Genetic Study of Whale Sharks in Gujarat 64

Chapter 9 : New Records of Neonatal (Pup) Whale Sharks from the Gujarat Coast 67

Chapter 10 : Education, Awareness, Communication and Outreach 73

Chapter 11 : Future Plans for Whale Shark Conservation Project 79

Appendices 85

References 148

Other WTI Publications 162

CONTENTS

iv

Dr. C. N. Pandey, IFS

Principal Chief Conservator of Forests and

Chief Wildlife Warden (WL)

Gujarat.

It is gratifying to see the Whale Shark Conservation Project, initiated in the year 2003 through

initiative of the Gujarat Forest Department, the Wildlife Trust of India and corporate houses come

of age.

The project began with a massive awareness campaign (see Turning the Tide) followed by a scientific

study initiated in 2008 to find answers to specific questions. However, what I am particularly pleased

about is that the project has allowed the main stakeholders — the fishing community to take a lead

in conserving this magnificent animal by releasing the whale shark accidentally caught in their net.

Recently, a self- documentation scheme introduced by WTI, with the forest department which

essentially entails giving the fishermen water-proof cameras to document cutting the net themselves,

resulted in greatly reducing the stress on the fish and increasing its chances of survival, as the

amount of time it spent in the net came down. This project has now become a well- tested model of

conservation.

I am also happy that the world also has acknowledged the success of this project in the form of

the recent UNDP award to this project. There is still a long way to go as more fishermen need to be

empowered to save the fish. However, I am sure with Gujarat Forest Department's commitment to

facilitate the initiative this goal shall soon be met too.

The first successful satellite tagging of the whale shark in India by WTI and the Gujarat Forest

Department has paved the way forward to understand the whale shark movement in Indian waters.

Genetic studies and research have yielded interesting data which support previous findings of high

genetic diversity in whale shark populations.

This report captures all the scientific initiative that have been taken from 2008 to 2013 for this

species through this project and will create the much needed awareness to manage this species and

other marine life better.

Date: 20th June, 2014 (Dr. C.N. Pandey)

Message

v

FOREWORD

Whale sharks are the world’s largest fish. Yet, they remained unknown, hidden underneath

the ocean depths, to all except the fishing communities in India until about two decades

ago.

In Gujarat where most sightings were recorded, the fishing communities called it ‘barrel’ —

an indication to the tool used to hunt this species. The fish was hunted in hundreds for liver

oil used in water-proofing boats and the by-product meat was exported.

In 2001, the whale shark was brought under protection of Indian laws, making it the first

fish to be listed in Schedule I of the Indian Wildlife (Protection) Act, 1972. However,

awareness was low, mandating a campaign to let people know its legal status, and to change

perceptions about this fish in itself.

In 2004, the Gujarat Forest Department joined hands with International Fund for Animal

Welfare – Wildlife Trust of India (IFAW—WTI) and Tata Chemicals Limited to begin the

widely acclaimed Whale Shark Campaign.

The campaign brought about unprecedented change in the mindset of the people of Gujarat

regarding the whale shark. The fishermen began releasing whale sharks accidentally

trapped in their nets; local authorities in eight cities declared the fish as city mascots; a

whale shark day was declared and many others. The campaign had converted the quarry to

an icon, from ‘barrel’ to Vhali – the dear one.

At Tata Chemicals many employees also volunteered their effort towards the “Save the

Whale Shark” campaign. Following on the success of the campaign, we started scientific

efforts to learn more about this fish. This has included establishing a camp office at Mithapur

for the study and initiatives like photo-identification, satellite or physical tagging, genetic

studies, even as freeing the whale shark by the fishing communities continued in Gujarat.

The activities carried out have not just helped save whale sharks in Gujarat but has become

a role model for the conservation of this species across the country.

Of course, there is more work required to unravel the mysteries of this unique fish – also

known as the gentle giants of the sea. As we recommit ourselves to continued efforts in

conservation of whale sharks in the country, we are happy to come out with this publication

that chronicles the activities carried out over the past five years through our collaborative

project.

R. Mukundan

Managing Director,

Tata Chemicals Limited

vi

PREFACE

The whale shark is indubitably the largest fish in the world. The conservation of the whale shark

is debatably the most successful conservation project undertaken by WTI in its history. This

project in collaboration with Tata Chemicals Limited and the Forest Department of Gujarat has

won several conservation laurels. These include the BNHS Green Governance Award in 2005,

as well as the Gujarat Ecology Commission (GEC) Award for 18 environment friendly practices

of Gujarat for whale shark rescues in 2012, both for Tata Chemicals Limited. The UNDP-MoEF

Indian Biodiversity Award was also recently awarded to the Gujarat Forest Department for co-

management in the Whale Shark Conservation Project in 2014.

For us at WTI, these awards given to our partners are the culmination of eleven years of hard

work, first in designing and implementing an on ground campaign, then in the policy work that

followed at centre and state, then in the rescue of the sharks themselves and finally in entering

the domain of science to know more about this wondrous creature.

This report documents those eleven years and the many milestones that come with it. For me

personally the memories of first distributing Mike Pandey’s film at the CITES conference in

Santiago in 2002, my very first visit with my then Vice Chair Sujit Gupta to the coast of Gujarat

to see the location of the whale shark Arribadas and attending the Whale Shark Day celebrations

at Porbander with thousands of school children thronging the streets are all equally vivid. That

from those early days, using the charismatic appeal of the social activist and guru Morari

Bapu, so much has been achieved is testimony to a well-planned and choreographed campaign.

Eight cities adopting the whale shark as a mascot, the Gujarat government announcing a relief

scheme for fishermen who cut their nets and freed the shark, the popular movement that

christened the hitherto un-named fish as Vhali or the loved one were all unprecedented. And

what was even more interesting was that all this was being done, not for the tiger, not for the

elephant, not even for Gujarat’s own symbol of wildlife the lion, but for a fish.

Within one year of launching the campaign in 2004, it was won. Nobody in Gujarat killed the

whale shark anymore. Yes, we had to do much more to ensure that the policy was in line with

the campaign findings. Most certainly much had to be learnt about the movements, behaviour

and demography of whale sharks off our coasts. But the conservation imperative of stopping

the killing of hundreds of sharks annually had come to a grinding halt. There could not have

been a more spectacular and swift ending to a conservation campaign.

And thus, with this report we document the planning, acknowledge the partners and popular

support and celebrate a great conservation victory. May more happen in the whale sharks

wake, especially in the marine realm where conservation success is a rare creature.

Vivek Menon

Executive Director & CEO

Wildlife Trust of India

vii

ACKNOWLEDGEMENTS

We wish to express our gratitude to Dr. S. K. Nanda, Additional Chief Secretary, Home Department, Government

of Gujarat, Mr. Pradeep Khanna (Former Principal Chief Conservator of Forests, Gujarat), Mr. Satish K. Goyal,

(Former Principal Chief Conservator of Forests (WL), Gujarat), Mr. C. N. Pandey (Principal Chief Conservator

of Forests and Chief Wildlife Warden, Gujarat) for their support in providing permission to undertake this

work. Mr. G. Yadaiah (Chief Conservator of Forests), Ms. Aradhana Sahu (Deputy Conservator of Forests),

Mr. B. V. Padshala, (Former Range Forest Officer), Mr. N. B. Dodiya (Range Forest Officer) and Mr. M. M.

Goswami (Forester) for their help throughout the project.

We are grateful to Mr. Vivek Talwar (Chief Culture Officer), Tata Power Ltd, Mrs. Alka Talwar (Head, Sustainability

& Corporate Communications, TCL), Mr. Satish H. Trivedi (Senior Officer, Community Development, TCL,

Mithapur) and Mr. Pankaj C. Varia (Offic er, Community Development, TCL, Mithapur) for their unstinting

moral support.

We are thankful to Mr. Vivek Menon, Dr. N.V.K. Ashraf and Dr. Sandeep Kumar Tiwari of WTI for their support

throughout the project and our sincere thanks to all the scientific advisors for their valuable contribution.

We would like to thank Scientist-in-Charge, Mr. Koya Mohammed from CMFRI, Veraval for analyzing physico-

chemical parameters to study the whale shark habitat in Gujarat waters. We are thankful to the Principal

Scientist & Head, Dr. K. K. Vijayan from CMFRI, Cochin for analyzing whale shark tissue sample for studying

whale shark genetics in Gujarat waters.

Our sincere thanks to the Indian Coast Guard for their participation in all campaigns and events. We would

also like to acknowledge Customs Department, Veraval for providing us with necessary permissions for

entering Gujarat waters. Our hearty thanks to the Fisheries Department, Veraval for their support in rescues.

We appreciate the technical support given by the Wildlife Institute of India for the project. Our sincere

thanks to all the staff and students of Choksi College and Fisheries College, Veraval for their undeterred

support in campaign activities.

We would like to acknowledge the sincere efforts of the WTI team - Rupa Gandhi Choudhary, Divya Bhardwaj,

Sheren Shrestha, Smita Warnekar, Tapajit Bhattacharya, Jose Louies, Radhika Bhagat, Mayukh Chatterjee,

Sujai Veeramachaneni, Aditi Rajagopal, Neha Sharma and John Kunjukunju.

We further extend our thanks to all the staff of Tata Chemicals Limited, Gujarat Forest Department for their

valuable support.

Last but not the least we are sincerely thankful to Siddique Adham, Hameed, Imran, Altaf and all the

Fishermen Patels (Heads) and Fishermen of Sutrapada, Veraval, Dhamlej and Mangrol for their sincere

support in conserving and studying this magnificent animal.

1

EXECUTIVE SUMMARY

The largest fish on earth, the whale shark

(Rhincodon typus) is a large, plankton-feeding,

ovoviviparous and highly migratory shark

species. Although widely distributed across

tropical and warm temperate seas, limited

information is available on the population status

of this species, especially along the Indian

coastline. Catch statistics and anecdotal reports

suggest that this unique species along the Indian

coast is in severe decline. The species is mainly

threatened by unregulated and unsustainable

capture to meet international trade demands

for shark fins, liver oil, skin and meat. Other

threats include accidental entanglement in trawl

nets and set nets, collision with boats, as well as

extensive coastal pollution.

Prior to 2001, due to the lack of legal protection,

whale sharks were ritually, brutally and

extensively hunted across the shores of Gujarat

state in western India. This was brought to light

by the documentary film, “Shores of Silence” by

Mike Pandey. The film highlighted the plight of

the whale shark, and went on to not only win the

Green Oscar Award but also attract large-scale

attention of policymakers and conservationists

alike, towards this species. Following this, the

Wildlife Trust of India (WTI), along with Mike

Pandey, actively lobbied with the Ministry of

Environment and Forests (MoEF), for legal

protection of the species by placing it in the

Schedule I of the Wildlife (Protection) Act, 1972.

In the year 2002, due to the efforts by India and

the Philippines, the fish was included under

(Appendix II) of the Convention on International

Trade in Endangered Species (CITES). WTI

further escalated its lobbying in Santiago,

Chile, to garner more attention on the species’

conservation status. It subsequently conducted

a brief survey in 2004 along the coastal town

of Veraval and the inland city of Ahmedabad, in

Gujarat. The survey revealed low awareness level

(19%) on poaching and the protection status of

whale shark among the people of Veraval, the

hub of the whale shark slaughter.

From whale shark campaign and rescue to

whale shark science

Following the survey, WTI launched a large-

scale whale shark awareness campaign in 2004

in Gujarat, with special focus on Veraval and

Ahmedabad. The widely-acclaimed whale shark

campaign spread awareness on the plight of the

species and its protected status in Gujarat. It

not only helped convert Gujarat fishermen into

protectors of the whale shark by bringing about

a major change in the perception and attitude of

local people, but also helped in local protection

of the species. Since its inception and by the end

of 2013, over 372 whale sharks had been rescued

and voluntarily released by fishermen.

The campaign also led to a model relief programme

that offered monetary support to fishermen

whose nets were damaged or had to be cut open

during the rescue and release of whale sharks.

Despite the efforts of the rescue team, a large

number of whale sharks were still dying due to

entanglement and stress induced mainly by the

extensive travel time taken by the rescue team to

reach the site and address the situation. To speed

up the release and reduce stress on the sharks,

a self-photo documentation process started.

1200 water proof cameras were distributed to

fishermen in Sutrapada, Dhamlej and Veraval.

The captured images of a rescue by fisher folk

served as evidence to prove the damage to nets.

The photos also helped fishermen claim financial

relief from the government scheme to repair/

buy nets.

Although large-scale hunting of whale sharks in

Gujarat has been curbed, a greater understanding

2

of the species ecology is still required. Due to

the dearth of scientific information on whale

sharks in India, the generation of baseline data/

information on its population, ecology and

migration across the entire Indian coastline is

necessary to plan conservation measures and

aid the recovery of the species along India’s

coastline.

Whale shark science

Acknowledging this need, WTI with support

from Tata Chemicals Limited launched

the Whale Shark Conservation Project in

November 2008. The project was initiated after

constituting the Scientific Advisory Council

(SAC) and a Governing Council (GC) to facilitate

its implementation. While the SAC included

Indian and international marine experts, the GC

included the project implementers and senior

Gujarat Forest Department officials.

The thrust of the project was to :

a) Enhance the efficacy of rescue and

the release of whale sharks through

community participation

b) Identify whale sharks through photo

identification for migration studies

c) Create a genetic profile of the whale

shark population across Indian waters in

relation to global waters

d) Mark whale sharks with markers and

satellite tags, to understand their

migration patterns and habitat utilisation

e) Explore the prospect of community based

whale shark tourism to provide alternate

livelihood options to fishing communities

Photo-identification

Implemented with the aim of contributing to

population estimates as well as studies on whale

shark migration, photo-identification entails

underwater photography and comparison of

the photographs with the global database.

The photo-identification carried out under the

project, contributed whale shark photographs

to the database managed by ECOCEAN. Whale

sharks are identified using the pattern of spots,

which are unique (equivalent to stripes in tigers)

for each individual. India began contributing to

global whale shark research with the initiation of

photo-identification in 2010. The first individual

from Indian shores was identified in April, 2010.

It was labelled as I-001 and was a new entry to

ECOCEAN’s global database. After this, only

one more individual was added to the database.

Genetic analysis

Whale sharks also occur in the off shore waters

of India. It is believed there are discrete whale

shark population in the different seas with

varied genetic signature. Therefore, genetic

analysis of whale shark along the Gurajat coast

has shed light on the genetic varied diversity

of whale sharks as well as helped establish the

relationship between whale sharks along the

Indian coast with different populations across

the globe, In addition, it has also contributed to

understanding the species’ long term migratory

patterns, to some extent.

Migration studies

After tagging the whale sharks with marker

tags and satellite tags, and through the use of

online tracking portals, WTI was able to track

whale shark movement along the west coast

of India and their migratory patterns, and also

understanding the habitats preferred by the

species.

Whale shark tourism

The value of whale sharks in terms of the

revenue generated through tourism is much

higher compared to that generated from whale

shark hunting. This has been established in

Australia, which is among the few countries with

best-known whale shark tourism practices in the

globe. This project has explored the possibility

of establishing whale shark tourism in India

with an aim to provide incentives to coastal

communities for contributing to conservation

of marine wildlife and their habitats, as well as

to garner greater public support and awareness

towards the conservation of this species.

3

Whale shark recovery plan development

A whale shark status survey was started in 2008

along India’s west and east coast to identify

whale shark aggregations and develop state-level

recovery plans for the species. As of today, whale

shark aggregation sites have been identified

along India’s west coast and draft recovery plans

have been developed.

The Wildlife Trust of India intends that the Whale

Shark Conservation Project will generate

voluminous information on the species distribution,

ecology and migratory patterns, which will

provide the basis for the development of a

whale shark management strategy that takes

into account both the conservation needs of the

species and the economic needs of fishermen,

the direct stakeholders of this project.

Since the initiation of the project in late 2008,

till the project tenure of September 2013,

several milestones have been achieved and

WTI is confident of extending the whale shark

conservation project beyond the Gujarat coast

to other states along India’s west coast and

hopes to join global efforts in whale shark

conservation, research and management. It also

hopes to pursue enhanced conservation science

and field action with corporate and community

support to make the whale shark population in

the Arabian Sea a global hotspot.

MoU signing between (left to right) Vivek Menon (WTI), Homi Khusrokhan (TCL),

Dr. S. K. Nanda and Pradeep Khanna (Gujarat Forest Department)

4

The project team at the BNHS Green Governance Award Ceremony, 2005

Junagadh Forest Division of Gujarat receiving Indian Biodiversity Award, 2014

for co-management of whale shark conservation with fishing community

Former Prime Minister Shri Manmohan Singh presenting the

BNHS - Green Governance Award to TCL, 2005

RECOGNITIONS

5

The whale shark belongs to the order Orectolobiformes and is

the only species in the family Rhincodontidae. Although it does

not have close relation with other sharks, it shares some features

with sharks belonging to the order Orectolobiformes, such as

the nurse shark (Ginglymostoma cirratum) and the zebra shark

(Stegostoma fasciatum). The whale shark (Rhincodon typus) is

a slow-moving filter-feeding shark and the largest known extant

fish species. There are two other large filter-feeding sharks, the

basking shark (Cetorhinus maximus) and megamouth shark

(Megachasma pelagios), but they are in the mackerel shark order

and are not closely related to the whale shark.

Whale sharks lives in all tropic and warm-temperate seas, except the

Mediterranean. They are thought to be primarily pelagic (preferring

an open-ocean habitat) but seasonal feeding aggregations are also

known to occur at several coastal sites throughout the tropics.

The whale shark is known to occur in the waters of over 130

countries (Turnbull and Randell 2006 a), and the best-documented

whale shark sites are in the Gulf of Mexico, Gulf of California,

Belize, Honduras, Western Australia, the Galapagos, New Zealand,

Philippines, Indonesia, Madagascar, Mozambique, Kenya, India,

Pakistan, Maldives, Seychelles, Indonesia, and Thailand. The first

historic account describing a whale shark was from Seychelles

waters, in an entry in the ship’s log of the Marion Dufresne

expedition in 1768, just 12 years after the first settlement of these

islands (Lionnet, 1984). The first record of a whale shark being

fished is also from these waters, in the 1805 log of Captain Philip

Beaver (Smith, 1829), and foretells the fate of the species in the

Indian Ocean. Despite these early records and the first scientific

recording of the species from the Indian Ocean by Andrew Smith

in 1828 and 1829 (Smith, 1829), remarkably little is known about

the whale sharks’ range and status in this region (Fowler, 2000).

Targeted fisheries in the northern Indian Ocean show a dramatic

decline of the species (Hanfee, 2001) calling for an urgent review

of the species status in this region.

Whale shark is generally of limited value to traditional fisheries.

However, since the early 1990s, an increase in demand for whale

shark flesh and fins in some Southeast Asian countries, especially

Taiwan (Chen et al. 1997), led to localised targeted increase in

CHAPTER 1

Project background and objectives

Globally, the best

documented whale

shark sites are in

the Gulf of Mexico,

Gulf of California,

Belize, Honduras,

Western Australia,

the Galapagos, New

Zealand, Philippines,

Indonesia,

Madagascar,

Mozambique, Kenya,

India, Pakistan,

Maldives, Seychelles,

Indonesia and

Thailand

6

fishery landings in some regions, especially the

Philippines, India and Taiwan. Artisanal fishing

for whale sharks has existed in a number of

countries, e.g. Indonesia, the Philippines, Iran,

Maldives, India and Pakistan (Anderson and

Ahmed (1993), Hanfee (2001), Compagno (2002),

Rowat (2007), White and Cavanagh (2007)). The

surface swimming behaviour of whale sharks has

also led to mortality from collisions with boats,

which are not often reported but presumably

are a regular occurrence in some areas (Rowat

2010). Strandings are also relatively common

in some areas, e.g. off South Africa where it is

thought that the whale sharks may be killed or

stunned by sudden chilling due to cold water

masses (Beckley et al. 1997).

Over the last two decades, a number of countries

have banned fishing of whale sharks, e.g.

Maldives in 1993 (Anderson and Ahmed 1993),

the Philippines in 1998 (Pine et al. 2007),

Honduras in 1999 (Compagno 2002), Thailand

in 2000 (Fishing Act B.E. 2490), India in 2001

(Wildlife Protection Act, 1972), Palau (2003),

Belize in 2003 (Graham 2007), Seychelles in

2004 (Wild Animals Bill), and Taiwan in 2008.

The increase in fishing effort and targeted fishing

for elasmobranchs in the world oceans led to

concerns over the sustainability of vulnerable

species, including whale sharks, given their low

productivity. International policies relating to

conservation and protection of whale sharks,

include Appendix II of Convention for the

Conservation of Migratory Species of Wild

Animals in 1999 (CMS 1999), Appendix II of

CITES (Convention on International Trade in

Endangered Species) (CITES 2002) (Fowler

2000), Annex 1 (Highly Migratory Species) of the

United Nations Convention on the Law of the Sea

(UNCLOS), and the Convention on Biological

Diversity. Despite its protected status in many

countries, illegal and incidental capture of the

species continues to be reported (Kasinathan et

al. 2006; Riley et al. 2009).

In spite of the ban on the fishing or killing of

whale sharks or possession of whale shark

products in India, incidental catch of the species

has continued along the coastline (Romanov

(2002), Chaudhary et al. (2008), Sajeela et al.

(2010)), where some cases go unreported due

to the large area covered. This is in part due to

the lack of awareness of the imposed law, lack of

education on vulnerability of the species and the

high cost incurred when rescuing and releasing

an accidentally netted whale shark, including a

stranding and rescue operation network.

In view of this plight of the species, WTI, in

partnership with the Gujarat Forest Department

(GFD) and Tata Chemicals Limited (TCL), felt

the need to initiate a whale shark conservation

project along the west coast of India.

A better understanding of the

ecology of the whale shark and

defining critical habitats off the

west coast of India would help

in the long term conservation of

the species globally

The broad objectives of the conservation action

project are to :

Rescue and release the incidentally

captured whale sharks

Track whale shark migration in the marine

environment

Understand whale sharks relationship

with its marine habitat

Genetically profile whale sharks in Indian

waters

Assess whale shark aggregation areas on

the Gujarat coast

Create awareness through campaigns

Explore the prospect of whale shark

tourism in Gujarat

7

CHAPTER 2

Project area

The state of Gujarat along India’s west coast has a 1600 km coastline

with a continental shelf extending over an area of 1,84,000 km2.

The state comprises 13 coastal districts, with 263 fishing villages.

A total of 123 fish landing centres are spread across the 13 coastal

districts. The landing centres support 24,152 fishing crafts, of

which 13,047 are mechanised craft, 7,376 motorised and 3,729

traditional crafts. Based on the State fisheries statistics 2012, the

total fishing population in Gujarat is 3,23,215, which depends

heavily on marine resources for their livelihood.

The study area and base station for the project activities were

selected based on the following criteria:

Historical whale shark landing records: Gujarat has

the highest recorded landings of 279 sharks in Dec 1999

alone, with nearly 40 whale shark landings in a single day

(Hanfee. 2001). This was the primary reason for initiating a

conservation action programme in the state. A review of the

landing records of Gujarat revealed that Gujarat coast had

the highest hunting records of whale sharks before the ban.

The data also provides the whale shark abundance in the

targeted locality.

Whale shark historical sighting: Whale sighting records off

the coastal villages in Gujarat were collected by interviewing

fisherfolk. This information provided the team possible

whale shark aggregation sites along the Gujarat coast,

where the team could focus their attention.

Community involvement: As the project objectives also

required the involvement of local communities in the

conservation programme, assisting and empowering them,

the fishing villages along the Gujarat coast which were

earlier involved in whale shark hunting and trade were

chosen to be WTI's main focus of attention. While the local

government authorities were willing to collaborate, Tata

Chemicals Limited who supported the project, was also

located in Gujarat, hence, the project was initiated along

the Porbandar coast.

The project area

comprising of four

villages along the

Gujarat coast, was

chosen, taking into

account historical

whale shark landing

and sighting records

and accessibility to

the landing centres

and the sea

8

Accessibility: A focal point with access

to maximum landing centres and to the

sea was also considered for setting up of

a base station. Based on these criteria,

the following sites were selected for

implementing the project.

2.1. Project area

Based on the past records of whale shark landing

and hunting along the coastal areas of Gujarat,

four major fishing villages i.e. Veraval, Sutrapada,

Dhamlej and Mangrol in Junagadh district, were

found to be most sensitive sites, as they had the

maximum number of incidental capture of whale

sharks, and had active fishing ports and landing

centres. The following four sites were chosen as

the project area:

2.1.1. Veraval

Veraval town, situated along the Saurashtra

coast, is one of the largest fish landing zones

of Gujarat. It has three fish landing centres:

Jaleshwar, Bhidiya and Veraval port which

accounts for 20 to 30% of fishermen of the total

population of the three towns. As per provisional

reports of Census India, the population of Veraval

in 2011 was 153,696; comprising 78,1661 males

and 75,535 females. The fishermen of Veraval

and Bhidiya port mostly belong to Kharva

samaj (community) and Koli samaj, whereas

more than 90% of Jaleshwar fishermen belong

to Machhiyara samaj. There are about 5000

IBM (in board motor) trawler boat operators at

Veraval, including Bhidiya port and at least 1500

OBM (board motor) small fibre boats (locally

called ‘peelani’ boat) operate from Veraval port,

including Jaleshwar fishing point. Veraval was

also selected for setting up the base station as it

was strategically a good location for accessibility

into the sea and other project sites.

2.1.2. Sutrapada

Sutrapada is 20 kms south of Veraval, towards

Kodinar. Sutrapada has a total population of

1,22,406, of which 62,435 are male and 59,971

female. About 20% of the population comprises

fishermen who are isolated from the rest of the

population and inhabit the Sutrapada coast.

In Sutrapada, there are 60 IBM (comparatively

smaller than a trawler and locally called

‘bethada’) and 800 OBM small fibre boats

operated by fishermen.

Fig. 1: Project area along the Gujarat coast

9

2.1.3. Dhamlej

Twenty kilometres north of Sutrapada is

Dhamlej, a previous whale shark landing

village, which also has a considerable number of

fishermen who depend on daily fishing for their

livelihood. The total population of Dhamlej is

about 70000, of which 30-40% are fishermen,

who live separately along the coast of Dhamlej.

There are 600 to 700 OBM (Out Board Motor)

boats operated by the Dhamlej fishermen. It has

only two bethada, but does not have any trawler.

2.1.4. Mangrol

Mangrol is situated 50 km north off Veraval,

towards Dwaraka and is one of the most

important fish landing centres along Gujarat’s

Saurashtra coast. The total population of

Mangrol is 1,32,733, which comprises of 68,186

males and 64,547 females. The fishermen

comprise 15-20% of Mangrol’s population. Like

Veraval, Mangrol also has a considerable number

of trawler boats, in addition to ‘peelani’ fibre

boats. There are over-1500 trawler boats and 500

small fibre ‘peelani’ boats operating at Mangrol

fishing port. Mangrol has emerged as one of

the well-known fishing boat building centre in

Gujarat, in addition to Veraval.

2.2. Demography of the selected project

sites

As interaction with the fishing community

was an essential component of the project. A

demographic understanding of the locations was

compiled by the project sociologist. A literature

survey, community interaction and a field survey

by the sociologist revealed the following,

Gujarat fishermen community comprise of four

different castes; Rajput Kharwa, Koli Kharwa,

Ghoghala samaj, Machhiyara samaj (the only

Muslim fishing community).

2.2.1. Rajput Kharwa

Rajput Kharwa is the largest fishing community

among the four. Members of the community

are Hindus by religion and Rajputs by caste.

They are based largely on the Veraval coast.

Rajput Kharwas are comparatively more literate

and economically better off than the other

communities of fishermen.

2.2.2. Koli Kharwa

The second major community of Hindu fishermen

is Koli Kharwa, concentrated in Bhidiya site

of Veraval coastland, but also based in several

village settlements in Saurashtra and a few other

parts of coastal Gujarat. They are also known by

their sub-castes, such as, Moila Koli, Ghedia Koli,

Ghoghaliya Koli etc.

2.2.3. Ghoghala

Also Hindus, this community is mostly based in

Sutrapada, Dhamlej and Muldwarka fishermen

villages.

2.2.4. Machhiyara

Machhiyaras are the only Muslim fishermen

community, concentrated mostly in Jaleshwer

area, adjacent to Veraval. A few Machhiyara

families also inhabit Muldwarka, Dhamlej,

Hirakot, Chorwad and Mangrol Bara regions of

Saurashtra coast of Gujarat.

10

CHAPTER 3

Historical whale shark occurrence and

distribution along the coast of Gujarat:

A survey

Owing to colossal

hunting globally,

whale shark

numbers dwindled

and they needed

legal protection. It

was unlikely that

they could tolerate

intensive fishing

pressures as they

grow slowly and

mature late in life

Despite their size and ranging patterns, whale shark (Rhincodon

typus) is among the most threatened species of the world. People

have hunted whale sharks for years for their meat and fins and

bones for use in delicacies and medicines, skin as an abrasive

and mostly for their massive livers for extraction of oil. The

World Conservation Union (IUCN 2013) lists the whale shark as

vulnerable to extinction, as a result of directed fisheries, high value

in international trade, a highly migratory nature, a K-selected life

history and generally low abundance (Norman 2000). Owing to

this colossal hunting globally, their numbers have dwindled and

they are hence given legal protection by various countries, among

which the Indian Government had given the highest possible

legal protection under the Schedule–I of the Indian Wildlife

(Protection) Act, 1972 as amended in 2002.

It is unlikely that whale sharks can tolerate intensive fishing

pressures because they are thought to share the typical

elasmobranchs’ life-history patterns of slow growth and late

maturity (Colman 1997). The effects of overfishing of this species

may be manifested in other parts of the world since these are

reported to be highly migratory with some individuals travelling

thousands of kilometres across oceans (Eckert and Stewart, 2001).

Whale shark abundance in Taiwan (Chen and Phipps, 2002), India

(Hanfee 2001), Philippines (Alava et al. 1997) has been inferred from

fisheries dependent data. Although catch independent population

estimates of marine mammals are commonly available, in part due

to their need to surface and breathe, most population estimates of

large migratory fish, particularly sharks, remain primarily based

on catch-dependent/by catch data. These surveys are, therefore,

linked to fishing areas/zones as opposed to the species’ activity

spaces or full habitat range and, therefore, may not adequately

represent the studied populations (Graham and Roberts, 2007).

However, very little is known about their occurrence, numbers

and home range. Though whale sharks were reported from all

11

along the Indian coast, majority of the reports

are from the north western maritime state of

Gujarat from where, 1,866 whale sharks were

reported between 1989 to 1998 (Pravin, 2000).

A staggering 591 whale sharks were reportedly

caught and slaughtered during 1999-2000 alone

along the Gujarat coast (Hanfee. 2001). After the

launch of awareness programmes by the Wildlife

Trust of India (WTI) in 2004, supported by Tata

Chemicals Limited (TCL) and in collaboration

with the Gujarat Forest Department and the local

fishing communities (Chaudhary et al. 2008), it

was felt necessary to have some knowledge of

their historical occurrences in the off-shore waters

off the state of Gujarat where nearly 187 whale

sharks were released from fishing gears during

2004-2005. The survey aimed to find whether

there was any change in the seasonality and

place of occurrence, numbers and associations

of whale sharks if any, with marine mammals,

over the past 50 years along the Gujarat coast.

3.1. Survey area

The state of Gujarat is located on the north-western

side of the Indian peninsula, with a coast line of

1600 km, with an estimated 3,23,215 fishermen

from 263 marine fishing villages dependent on

marine and coastal fishery resources. The survey

was undertaken from September–October 2008,

covering 31 key fishing villages across the coast

of Gujarat, starting from Jakau in the north and

extending up to Nargol in the south (Fig. 2).

Based on the prevailing fishing practices and

also for the benefit of analysis and presentation,

the entire coastline of Gujarat was divided into

three regions, Region-I, starting from Jakau

in the north to Salaya in the south; Region-II,

starting from Rupen in the north to Jafrabad in

the south; and Region-III, starting from Hajira in

the north up to Nargol in the south (Fig. 2).

3.2. Methodology

The survey was done in three phases, covering

one region at a time. Fishermen above the

age of 55 and who have already retired from

active fishing were selected for the survey. 151

fishermen from 31 villages were interviewed for

the survey (Appendix I). The questionnaire was

developed following Maynou et al. 2011, except

Fig. 2. Map showing survey area

12

that the time period was not further divided

into any segments owing to the stress put on

interviewees’ memory.

A questionnaire was circulated

to 151 fishermen who were

50-95 years old and have been

fishing, as their traditional

means of livelihood, since they

were 12-15 years old

After recording the name, age and place, the

questions asked during the interview included:

1) the age at which the interviewee started

fishing, 2) the age at which he stopped fishing,

3) whether he had seen a whale shark during

his fishing career, 4) if, yes, the frequency, 5) the

season in which most of the sightings occurred,

6) whether they observed any change in the

seasonality of occurrences during their fishing

career, 7) the number of whale sharks seen

together mostly, 8) the location of frequent

sightings, such as the distance and direction

from the shore, depth at sightings, 9) the

estimated number of encounters during their

career, 10) whether they had seen any mammals

such as whales, fin-less porpoises and dolphins,

11) if so, their frequency, 12) and their location

13) whether they observed any association

between whale sharks and mammals and/or sea

turtles etc.

Questions one and two were asked to calculate

the time period from which the fishermen

reported their observations. For questions,

four and eleven, the interviewees were asked to

rate frequency as frequent, occasional and rare.

Pictures of mammals were shown for easy and

accurate identification.

3.3. Results

Since the respondents were between 50-95 years

old and they took to fishing as a traditional

source of livelihood since they were 12-15-years-

old, the results were based on observations made

by them over a period of 54 years, from 1926

to 1980, going back to 82 years in time (Table

1) since the beginning of the present study. For

the ease of presentation and understanding, the

results are presented separately for the three

regions viz., Region–I (Kachchh), Region–II

(Saurashtra) and Region–III (Khambhat).

3.3.1. Region – I

The northern coast of Jamnagar and Rajkot

districts were also included in the Kachchh

region during the survey, keeping in mind

the prevailing fishing practices. A total of 66

fishermen were interviewed from eight fishing

villages, namely, Salaya, Sikka, Bedi, Tuna,

Bhadreshwar, Mundra, Mandvi and Jakhau. The

fishermen interviewed were between 60 and 92

years of age (Fig. 3).

A total of 66 fishermen were surveyed from

various fishing villages from this region, among

whom, 37.8% reported to have seen whale

sharks during fishing operations for more than

two decades, and about 62.2% reported not

having seen a whale shark during their fishing

life (Fig. 4).

The likelihood of sighting a whale shark had

shown a gradual decline from Salaya towards

Jakhau in the northern most part of Gujarat (Fig.

5). Among the 37.8% (n=25)of respondents who

reported to have seen a whale shark, 24% (n=6)

reported to have sighted them frequently and

76% (n=19) reported occassional sightings off

the coast of Rupen and Okha (Fig. 6).

Table 1. Age class and average age of the fishermen interviewed from the three regions surveyed

Region of survey No. of interviews Age range of interviewees Average age

Region – I (Kachchh) 66 60 – 92 70.7

Region – II (Saurashtra) 66 50 – 95 63.4

Region – III (Khambhat) 19 55 – 80 62.1

13

Fig. 4. Whale shark sightings in the Kachchh region

Fig. 5. Whale shark sightings across various landing centres in Kachchh region

Fig. 3. Distribution of respondents across various age groups

14

Fig. 6. Frequency of whale shark sightings

Fig. 7. Responses indicating seasonality of whale shark sightings

The seasonality of sightings began in October,

attaining a peak during November-March and

lasting up to April, and sometimes even till May.

However, most sightings reportedly occurred

between November and April (Fig. 7).

Among the respondents, 36% (n=9) claimed to

have had less than 50 whale shark encounters

during fishing, 24% (n=6) had 50 to 100

enconters, and 40% (n=10) had more than 100

encounters during their fishing lives (Fig. 8).

About 36.9% of the total respondents reported

to have sighted whales, 18.4% had seen fin-less

porpoises and 69.2% had seen dolphins during

their fishing operations. However, no one had

reported seeing a dugong even once. Dolphins

were reported to have been sighted frequently

by 60% of the respondents, 33.3% have reported

to had seen them occassionally, and only 2 of

the respondents said that they rarely saw them

during a fishing operation. With respect to

other marine mammals, 58% of the respondents

reported occassional sightings of fin-less

porpoises, 50% of the respondents had reported

to have sighted whales occassionally, and 41.6%

reported rare sightings of whales (Fig. 9).

3.3.2. Region – II

The Saurashtra coast has long been an abode

for whale shark congregations and fishermen

from this region are known to have caught

whale sharks in staggering numbers before

legal protection for the species came into force.

Fifteen fishing villages starting from Okha in

the north and extending up to Jafrabad in the

15

Fig. 8. Distribution of whale shark encounters along Saurashtra coast

south were covered under this region, and 66

fishermen between the age of 50 and 95 years

were interviewed (Fig. 10). Everybody except one

respondent reported to have seen a whale shark

during fishing operations and 95% reported the

sightings are frequent (Fig. 11 and 12).

The seasonality of sightings of whale sharks was

similar to that reported from the Kachchh region

(Fig.6). Though 6% of the respondents claimed

to have seen whale sharks throughout the year,

the seasonality of sightings seems to be more

Fig. 9. Frequency of marine mammal sightings during fishing operations

along Saurashtra coast

Fig. 10: Distribution of respondents across various age groups along Saurashtra coast

16

Fig. 11. Whale shark sightings along Saurashtra coast

Fig. 12. Frequency of whale shark sightings along Saurashtra coast

concentrated during the months of November

to March, and sometimes extended up to April

(Fig. 13).

The possibility of sighting a whale shark during

fishing is mostly reported between the depths 20-

30 fathoms (1 fathom = 1.822 meters) while they

come as close as up to 5 fathom deep waters, and

move out as far as up to 60 and sometimes even

up to 100 fathom depths during the season.

The group size of the whale sharks sighted varied

across the survey area. 40% of the respondents

claimed to have seen a group of 2—3 whale

sharks during sightings, while 44.6% claimed

to have seen them basking solitarily, and 10.7%

reported to have seen groups of 3-5 whale sharks

together. Such variations in this section may be

due to a difference in the time of the day of the

sighting, which suggests differing social behavior

of the whale sharks at different times of the day

(Fig. 14).

When asked about the total number of whale

shark sightings observed during their fishing

days, 52.3% (n=34) reported to have seen

50—100 whale sharks, 29.2% (n=19) reported

25—50 sightings and 15.3% (n=10) reported to

have seen more than 100 whale sharks (Fig. 15).

62.12% (n=41) of the repondents have reported

to have sighted whales, 8.66% (n=8) had seen fin-

less porpoises and every one (100%; n=66) saw

dolphins during fishing (Fig. 16). However, no

one had seen a dugong. Among the repondents

17

Fig. 13: Seasonality of whale shark sightings along Saurashtra coast

Fig. 14: Group size of whale sharks along Saurashtra coast

Fig. 15: Total whale shark encounters along Saurashtra coast

who had sighted these marine mammals, 53.6%

(n=22) had reported occassional sightings of

whales, and 12% (n=5) reported to have sighted

them rarely. Fin-less porpoises were sighted

occassionally by 50% (n=4) of the respondents,

and rarely by 12.5% (n=1) of the respondents.

18

However, dolphins seem to be more in numbers

since 65% (n=43) of the respondents have

reported to have seen them frequently during

their fishing operations, and as close as 2—3

nautical miles away from the shore.

3.3.3. Region – III

The marine fishermen from this region fish

within the mud banks and creeks of the Gulf of

Khambhat and most of them were engaged in

mud-skipper fishing during the older days. Very

few fishermen ventured into the sea towards the

shores of Saurashtra. Seven fishing villages were

surveyed and 19 fishermen between the age of

55 and 80 were interviewed (Fig.17).

Of the 19 fishermen interviewed, 14 respondents

reported to have seen a whale shark during

fishing, of these 42.1% (n=8) had reported to

see them rarely and 28.5% (n=4) had seen them

occassionally while fishing off the shores of

Saurashtra (Fig. 18). The reported seasonality

of whale shark sightings were similar to that

reported from Kachchh and Saurashtra regions.

Though they tend to start congregating as early

as July, the sightings peaked between the months

of November and March to April (Fig. 19).

The whale shark sighted during fishing had been

reported to be solitary by 57.14% (n=8) of the

respondents; 21.42% (n=3) reported seeing two

Fig. 16: Frequency of occurrences of marine mammal sightings in Gulf of Khambhat

Fig. 17: Distribution of respondents across various age groups in Gulf of Khambhat

19

whale sharks together, and 14.28% (n=2) reported

to have seen two to three whale sharks together

(Fig. 20). Nine out of 14 respondents had seen

10-50 whale sharks during fishing, three had

seen below 10, while two have seen between

51 and 100 (Fig. 21). Of the total respondents,

seven had rarely sighted whales, 11 had seen fin-

less porpoises rarely and 13 had seen dolphins

frequently (Fig. 22) and as close as 2—3 nautical

miles from the coast.

3.4. Conclusion

A total of 151 fishermen, between 50 and 95 years

of age, were interviewed from 31 fishing villages

along the coast of Gujarat. Of these, 68% (n=105)

reported to have seen whale sharks during

fishing operations for more than two decades.

Among them, 72% (n=106) claimed to have seen

whale sharks frequently, and 27% (n=48) saw

them occassionally during their fishing trips. The

numbers of respondents who had seen whale

sharks varied across the fishing villages and

their information on their fishing grounds has

revealed that the probability of sighting a whale

shark is higher towards the coast of Dhamlej

and Muldwaraka villages, and that the maximum

Fig. 18. Frequency of whale shark sighting in Gulf of Khambhat

Fig. 19. Seasonality of whale shark sighting in Gulf of Khambhat

20

Fig. 20: Group size of whale sharks sighted in Gulf of Khambhat

Fig. 21: Total whale shark encounters in Gulf of Khambhat

Fig. 22: Occurrences of marine mammals along the coast of South Gujarat

in Gulf of Khambhat

21

concentration of whale sharks occured along

the Saurashtra coast (Fig. 23) from November

to April and some times till May.

Only one of the repondents reported any change

in the numbers, or seasonality or the location

of sightings throughout these years. However,

most fishermen reported to have seen whale

sharks at depths of 20-40 fathoms off the coast

from Porbandar to Diu. This and the present

information on whale shark rescue suggest that

there is no change in the whale shark’s habitat

and the season of occurrence for the past 80-

85 years. Whale sharks also do not exhibit

a continual association with other marine

mammals and reptiles such as sea turtles.

The fishermen's responses

suggest that there is no change

in the whale shark’s habitat and

the season of occurrence for

the past 80-85 years along the

Gujarat coast

It can be inferred from the above observations

on their past abundance and distribition that

there are no natural threats to the whale shark

populations along the coast of Gujarat. Though

their population was threatened to a major extent

by fishing and trade, recent conservation efforts

by WTI and the local forest department, with

support from the local fishing communities, has

abated the threat to some extent, as is evident

from the voluntary rescue of the animals caught

accidentally.

Only a better understanding

of their habitat and migratory

patterns, along with estimates

of their population can help

formulate long-term species

recovery programmes along the

coastal waters of Gujarat, and

perhaps India

However, it cannot be ascertained that whale

shark populations and distribution are immune

to human activities in the state’s offshore waters.

There is a need to regulate fishing along the

coastal waters to create safer waters for this

species. Only a better understanding of their

habitat and migratory patterns, along with

estimates of their population can help formulate

long-term species recovery programmes along

the coastal waters of Gujarat and perhaps India.

Fig. 23: Whale shark sightings across various fishing villages along the coast of Gujarat

y = 0.0024x3 - 0.1416x2 + 2.2587x - 4.1288

R² = 0.4126

-4

-2

0

2

4

6

8

10

12

14

16

18

Jak

au

Mu

nd

ra

Tu

na

Sik

ka

Ok

ha

Da

mle

j

Ma

ng

rol

Ve

rava

l

Hir

ak

ot

Ph

era

Va

na

kb

ara

Jafr

ab

ad

Na

rgo

l

Um

ars

ad

i

Ub

hra

t

Region-I Region-II Region-III

Wh

ale

sh

ark

occ

ure

nce

Landing Centres

Yes

No

Total

Poly. (Yes)

Poly. (No)

22

CHAPTER 4

Whale shark rescue analysis

Providing relief

to fisherfolks,

who voluntarily

cut their fishing

nets to release

incidentally caught

whale shark was the

basis of community

involved rescue of a

vulnerable species

Launched in 2004, the Save the Whale Shark Campaign led to the

creation of Vhali (or “dear one”) – a whale shark depicted by a

local popular religious leader Morari Bapu as an incarnate of God.

Bapu also correlated it with the long-standing Indian tradition of

‘Atithi Devo Bhavo’ in which guests are likened to gods, and he

described the whale shark as a guest who deserves equal respect.

It proved to be a people-friendly method to reach out to the masses

and spread awareness: now not only do most fishermen realise the

implications of whale shark hunting, but they also have started to

contribute to the cause by agreeing to release accidentlly caught

whale sharks.

This, however, also meant heavy losses incurred by the fishermen

when their nets had to be cut in order to free any trapped whale

sharks and paved the way for a new policy implemented by the

Gujarat Forest Department in 2006 to provide compensation to

the affected fishermen whose nets were destroyed in the process.

The Wildlife Trust of India’s marine team on the Whale Shark

Conservation project started assisting such rescues from January

2010 onwards to analyse their efficiency and improve the rescue

operation methods.

Photo Courtesy : Dipak

23

Since 2005, the Forest Department of Gujarat,

Wildlife Trust of India, Tata Chemicals Ltd.

jointly started the Whale Shark Conservation

Project. Since that time fishermen along the

Gujarat coast are releasing incidentally-caught

whale sharks from their nets. In return, they are

provided compensation by the Forest Department

for the loss of their nets.

A total of 372 whale sharks (Fig. 24) have

been rescued until 7th May 2013 in Gujarat

waters, which shows the success of the whale

shark campaign that led to the Gujarat fishing

community to regard the whale shark as a

daughter of the state, a concept popularised by

the spiritual leader Morari Bapu.

4.1. Year-wise whale shark rescue

Based on the seven year data of whale shark

rescue, the highest number of whale sharks

were rescued in Sutrapada, Veraval and

Dhamlej locality fishing villages in Gujarat.

A self-documentation scheme that was initiated

in the villages is discussed in detail in the

forthcoming section of this report. From 2012

till June 2013, a total of 57 whale sharks have

been rescued in Sutrapada, Veraval and Dhamlej

under this new method (Fig. 25 and 26).

Fig. 24: Total number of whale sharks rescued in Gujarat waters (year-wise)

Fig. 25: Number of whale sharks rescued in different fishing villages in Gujarat

24

4.2. Review of the rescue methods

By the year 2010, a review of the whale shark

rescue methodology and release operation

was considered in an attempt to make it

simplified and much less time consuming,

keeping in mind the reaction of the rescued

after release whale shark to stress and

possible mortality.

4.3. Fish stress and mortality- A brief review:

4.3.1. Sharks have negative buoyancy

Sharks do not have an air bladder as other fishes

do; but they have a large liver with fats and oils

which help them to get some buoyancy. This still

does not help them remain totally buoyant and

so they move their bodies regularly, else they

Fig. 26: Map showing whale shark capture and rescue locations in Saurashtra coast

Table 2 : Overall whale shark rescue data in Gujarat waters

Fishing villages 2005 2006 2007 2008 2009 2010 2011 2012 2013

Sutrapada 1 1 4 26 13 20 20 34 5

Veraval 0 0 29 32 50 29 7 14 7

Dhamlej 0 0 2 16 7 8 11 11 1

Mangrol 0 0 0 2 2 5 1 0 0

Diu 0 0 1 0 0 0 0 0 0

Muldwaraka 0 0 1 0 7 5 0 0 0

Total rescue 1 1 37 76 79 67 39 59 13

Overall rescue 372

25

would sink. (Weihs 1981). In case they die and

internal decomposition starts, or air gets trapped

in the gut, they may start floating.

4.3.2. Sharks and their osmoregulation

Every marine fish has to drink water to retain

osmoregularity and release excess salt through

their gills or skin. It is just the opposite case with

fresh water fishes which continuously release

water, as the fluids concentration is higher in the

body compared to surrounding fresh water. In

marine fishes, the concentration of outside water

is higher and so they drink water.

Dragging a shark against its gills can kill it in minutes, while entanglement with nets ruptures their gills, fins and skin. Roping around its gills and keel causes injuries and rashes, and blocks blood flow

4.3.3. Exposure to air and dragging

Exposure to air for any marine fish is fatal.

Dragging a shark against its gills can kill it in

minutes. The gill lamellae may get impaired,

making sharks susceptible to breathe normally.

4.3.4. Netting, roping and hooking

Accidentally caught sharks are prone to get

injuries and internal haemorrhage. Entanglement

of the fish with nets ruptures gills, fins and skin.

Roping around its gills and keel causes injuries

and rashes, and also blocks blood flow, causing

internal haemorrhage. Hooking directly injures

tissues and cause blood loss.

4.3.5. Discussion

Fish react to the acute stress of capture,

exhaustive exercise and handling, with greater

disruptions to their physiology and biochemistry

than higher vertebrates (Pickering 1981; Adams

1990; Wood 1991; Milligan 1996; Kieffer 2000).

Myotomal muscle mass of nearly all species of

fish is dominated by anaerobic white muscle

(80–95%), which allows high work output in

short bursts (Driedzic & Hochachka 1978). Most

fishing techniques cause high anaerobic activity

and muscular fatigue, resulting in physiological

disruptions of the internal milieu of fish (Wells

et al. 1984). As the body mass of fish comprises

more than 30% white muscle and only 3–6%

blood, changes in muscle biochemistry are

strongly reflected in the blood (Wells et al. 1986).

Wells et al. (1986) sampled the post-mortem

blood chemistry of a limited number of

tunas, marlins and sharks after tournament

capture and concluded that elevated levels

of plasma electrolytes, osmoregularity, blood

metabolites (glucose, lactate), plasma enzymes

and haematocrit were useful indicators of

capture stress. Manire et al. (2001) quantified

serological changes associated with gillnet

capture in bonnet head sharks (Sphyrna tiburo),

black tip sharks (Carcharhinus limbatus),

and bull sharks (Carcharhinus leucas). They

concluded that species-specific differences in

gill-net mortality were likely associated with the

animal’s respiratory physiology and the degree

of struggling.

Piiper et al. (1972) and Holeton & Heisler (1978)

found that spotted dogfish, Scyliorhinus stellaris

(Linnaeus), required up to 24 hrs physiologically

to recover from exhaustive activity. Barham &

Schwartz (1992) reported that blood glucose

and haematocrit levels required 24 hrs to

return to normal in neonatal smooth dogfish,

Mustelus canis (Mitchill). Similarly, capture-

induced blood chemistry changes in the dusky

shark (Carcharhinus obscurus), required 24 hrs

for recovery (Cliff & Thurman 1984). However,

Spargo (2001) and Skomal (2006) found that

acid–base blood chemistry in rod-and-reel-caught

sandbar sharks (Carcharhinus plumbeus),

recovered to pre-stress levels in less than three

hours, thereby emphasising the need for species-

specific studies.

Francis (1989) found that recapture rates of the

gummy shark (Mustelus lenticulatus), were less

in sharks taken in trawls than in nets, which

suggests that trawl-caught fish had significantly

greater release mortality.

26

In the Skomal & Chase (2002) and Skomal

(2006) studies, the single Bluefin tuna that

died immediately after release had low blood

pH and high blood lactate levels indicative of

a severe acidemia. Muscular fatigue associated

with the angling bout precluded obligatory ram

ventilation after release, leading to respiratory

failure Skomal & Chase (2002) and Skomal

(2006).

Gill-net capture and restraint probably involve

respiratory and metabolic acidosis and

hypoglycaemia as well as cellular damage.

Species-specific and individual differences in the

mortality of sharks caught in gill nets are likely

related to an animal's respiratory physiology and

degree of struggling upon capture as well as to

the extent of net entanglement around the gill

area (Manire et al. 2001).

Trawling created an upward spike in pCO2

and a massive drop in pH relative to presumed

basal (T3) values in dogfish. These responses

were presumably a combined function of net

constriction, exhaustive activity and the brief

periods on deck following capture. Inversely

related pCO2 increases and blood pH decreases

have also been reported for other elasmobranchs

(Piiper et al. (1972), Holeton and Heisler (1983),

Cliff and Thurman, (1984)), and teleosts (e.g.

(Wood et al. (1977 and 1983), Schwalme and

Mackay, (1985), Milligan and Wood, (1986),

Ferguson and Tufts, (1992))

Given the large size and pelagic nature of these

fishes, assessing post-release mortality is difficult

and should include multiple approaches that

quantify the extent of physical damage and the

level of physiological disruption. These fishes

interact with multiple gear types, which impose

varying levels of stress. Hence, studies must be

conducted on a fishery-specific basis.

4.4. Efficacy of whale shark rescues

In order to review the current and past rescues,

WTI prepared a report in 2011, based on past

rescue video documentation analysis and

on the levels of stress to the rescued whale

sharks, and suggested a new rescue protocol

for the future rescues. To understand the level

of whale shark stress during rescue it was felt

necessary to prepare a similar report based on

the rescues attended to, and underwater videos

and photographs for the 40 rescues that marine

team of WTI had participated in the analysis was

based on close encounters between the marine

team and the gentle giants. The purpose of the

investigation was to study the condition of the

rescued sharks at the time of release and to

assess the efficiency of the rescue mechanism.

Between 2005-2010, a total

of 261 whale sharks had been

rescued and released and a

review of the efficiency of

operation was felt a necessity

All whale shark rescue operations undertaken

by the Gujarat Forest Department have been

photo and/or video documented. Details of

the fishermen and vessels at the time of rescue

were also noted down. In the current review,

the rescue documentation footage was used to

assess the condition of sharks during the rescue

and using different indices of measurement, WTI

tried to speculate their fate during and after

release.

4.5. Methodology for stress assessment

All the videos were reviewed at the office of

the Gujarat Forest Department in Veraval. The

condition of sharks was ranked on a scale of 0—3,

no values indicating impaired function, condition

of whale sharks were rated based on breathing

rate (0-3), body movement 0—3; injuries and

internal haemorrhage: 0—3 (Plate 1), Association

of other fishes (P-a) and draggfing (P-a) (Plate 2),

ropes around its gills or keel to control it (Plate

3); hooked (Plate 4).

The overall health condition of the shark was

assessed as normal, impaired (moribund with

high chances of delayed mortality), and no signs

of life.

27

All videos were analysed and rated in the presence

of officials of the Forest Department, Gujarat who

were implementing the compensation scheme.

Till October 2010, a total of 216 rescue operations

were conducted by the Forest Department at

Veraval and 156 videos were available with the

Gujarat Forest Department during the time of

video analysis. The analysis focused on assessing

factors such as:

a. Breathing rate / internal haemorrhage /

body movement

b. Fish association, dragging, hook and

roped

c. Time factor

d. Overall assessment

Each has been discussed in detail ahead:

4.5.1. Breathing rate / Internal hemorrhage /

Body movement

An analysis of the 156 videos resulted in 58 cases

(37.1%) showed no gill or mouth movement; 34

cases (21.7 %) showed occasional movement and

only seven cases (4.48%) showed some frequent

movements. It was difficult to place individuals

into any category in 57 cases (36.53%). Extreme

internal haemorrhage was found in five cases

(3.2 %), while it was high and clearly visible in

22 cases (14.1%). In 26 cases (16.6 %) there were

mild injuries and in 18 cases (11.5%) sharks were

seen without injury or haemorrhage. Eighty five

cases (54.4 %) were difficult to analyse.

In 75 cases (48%) no body movement was

detected. Some signs of movement were found

in 43 (27.5%) cases and 19 cases (12.1 %) showed

frequent movements. Only in three cases (1.9 %)

some strong movements were noticed. (Fig 27);

16 cases (10.2%) were difficult to categorise.

4.5.2. Fish association, dragging, hooking

and roping

Fish association with the shark is an indicator

of its health. Out of 156 videos, in 23 cases (14.7

%) no other fish were seen associated with the

Plate 4. HookedPlate 3. Ropes around its gills

Plate 2. Dragging the whale sharkPlate 1. Injuries and internal hemorrhage

28

netted whale shark. In the remaining 133 (85.25

%), it was difficult to make out any association.

Whale sharks were towed in 35 cases (22.4 %)

against its gills at the time of rescue. In117 (75%),

no dragging was visible at the time of rescue and

in the remaining 4 cases (2.56 %) it was difficult

to assess how the animal was dragged.

Whale sharks were hooked in 15 cases (9.16%),

whereas in 135 cases (86.5%) no hook was visible

to control the fish. In 6 cases (3.84%), the video

quality did not allow a proper assessment (Fig 28).

Whale sharks were roped around its gills, keel

and caudal peduncle in 154 cases (98.71 %). In

2 cases (1.28 %) it was difficult to make anything

out from video.

4.5.3. Time factor

An attempt to assess the time taken to complete

each rescue was also carried out. Only the

time of receiving a rescue call and the time of

Fig. 28. Graph showing number of cases with presence and absence status with

different indices

Fig. 27. Graph showing number of cases in each grade of health indices of shark

(0= Poorest, 1= Bad, 2=Good, 3= Normal)

29

completing a rescue was available with the Forest

Department. Therefore, it was not possible to

account for the time between the actual time of

fish entanglement with the net and its release.

Out of 156 videos, 146 rescue videos were

available with the time code.

The rescues were completed on an average time

of 1 hour and 53 minutes (SD ±63.10 min), with

a shortest time of 20 minutes to longest duration

of 6 hours. The frequency distribution showed a

mode at 1:30 – 2:30 hrs (Fig. 29).

The total time for the rescue, in the 19 rescues

which had WTI involvement was also calculated.

The average time between the actual catch (time

the fishermen discover the trapped whale shark)

and release was within 5 hours 12 min (SD± 132

min). The mode of the frequency distribution was

4-8 hrs, much higher than calculated earlier with

the data from the Forest Department (Fig. 30).

4.5.4. Assessment results

Based on the analysis carried out through video

recordings, 38 cases (24.35 %), were in comatose

condition, 108 cases (69%) were found with high

risk of possible delayed mortality and only five

cases (3.2%) were found in normal condition

before release (Fig. 31).

In five cases (3.2 %), the videos were corrupted

and no assessment was possible.

Fig. 29. Number of rescues at different time intervals

Fig. 30. Number of rescues at different time intervals

30

4.6. Discussion

Little is known about the post-release mortality

associated with the catch and release of sharks,

tunas and marlins. Regardless of the fishing

gear, captured fish are exposed to varying

degrees of stress, which includes the cumulative

impacts of physical trauma and physiological

stress. Although the magnitude of stress

depends on the capture method and handling,

studies on fishes show that they all react to the

acute stress of capture, exhaustive exercise and

handling with more exaggerated disruptions to

their physiology and biochemistry than higher

vertebrates (reviewed by Pickering 1981; Adams

1990; Wood 1991; Milligan 1996; Kieffer 2000).

In elasmosbranchs too, it appears that no

phylogenetic predisposition occurs as even very

closely-related sharks species respond differently

to capture. For example, Morgan and Burgess

(2004), reported that at-vessel mortality was 36%

for the sandbar shark (Carcharhinus plumbeus),

less than half of those for the cogeneric black tip

shark (Carcharhinus limbatus, 88% mortality)

and dusky shark (Carcharhinus obscures, 81%

mortality). There appear to be no references

available on studies conducted on stress level

and post release mortality of whale sharks or

similarly-sized sharks. The video reviews are,

therefore, an extremely important tool for the

conservation of this species. Though whale

sharks are big and are known to have a great

healing capacity, anaerobic conditions for long

durations, internal haemorrhage, dragging,

hooking and roping can kill the animals.

Review of videos of rescue

operations that WTI was

engaged in showed 23.5% of

the sharks with no signs of life

and 69% with high chances of

delayed mortality

Time is a critical factor for any kind of rescue:

the greater the delay for any rescue lesser is

the chances of survival. The average time of 1

hour and 53 minutes obtained from the data set

was actually the time taken by the rescue team

to complete the operation after the call from

the fishermen was received. The fish could be

caught in the net during the night or early hours

of the morning. Data from 19 rescues in which

WTI participated revealed the total rescue time

increased to 4—8 hrs when the actual time of fish

being caught was added. Even a delay of 1—2

hrs negatively impacts the fish’s survival.

The video review showed a significant percentage

(23.35 %) of individuals with no signs of life, and

an alarming 69 % with high chances of delayed

Fig 31. Overall health assessment of whale shark recued

31

mortality. In 35 cases, it was found that the fish

was dragged even during the rescues, which

would harm the fish the most. Significantly in

154 cases, it was found that fish was roped from

its keel (before tail) and on its gills, mostly to

control it and prevent net tearing. This would

harm the fish by inflicting internal injuries to

gills and blocking the continuous flow of blood

(over tightening), causing internal haemorrhage.

Severe and high injuries and internal

haemorrhage, which were visible in 17.3%

cases is a major risk factor causing instant or

delayed mortality. The cause for the internal

haemorrhage appears to be anaerobic conditions,

dragging, hooking and over-tight ropes used

to restrain whale sharks. Direct injuries due

to hooking on mouth were found in 9.16 % of

the cases, resulting in local tissue damage and

bleeding. 37.1 % cases were found with no gill

or mouth movement, indicating anaerobic

and tiring conditions. In 36.6 % of cases it was

difficult to make out such movements, due to the

fish position in the videos.

Though no significant difference was found

between the timing of suspected dead, impaired

and normal sharks tested (Mann-Whitney U test)

at 95 % confidence level (impaired vs normal (z=-

.370, p=.711), suspected dead vs impaired (z=-

.799, p=.424), normal vs suspected dead (z=.883,

p=.887). It seems that lack of data on the actual

time of entanglement plays a critical function here.

As mentioned before, the chances of survival of

a whale shark decrease with an increase in the

time taken for rescues. Therefore, it becomes

imperative that time of rescues must be curtailed

substantially. The most desirable situation is to

release a trapped whale shark as soon as possible.

This review resulted in redefining the whale

shark rescue operation (Plate 5) on the Gujarat

coast.

Plate 5: Fishermen rescuing whale shark at Veraval

32

CHAPTER 5

Redefining whale shark rescue operation:

Development of self-documentation scheme

To cut time wasted

in notifying the

relevant authorities

about an accidental

capture of a whale

shark and waiting for

them to arrive on the

spot and release it,

local fishermen were

trained to release

the shark quickly

and photograph the

process, using water-

proof cameras, for

evidence

The initial rescue protocol dictated that if a whale shark was

caught in a net, the fisherman had to report it to the authorities

and a rescue team would reach the spot to cut it loose, mainly

for documentation. But it led to a significant amount of time and

transportation expenses. The stress of being captive, at times for

hours, was quite intense on the whale sharks (leading to stress

and high chances of immediate or delayed mortality), with some

of them even dying because of it.

The 2011 assessment of the rescue video showed that the

stress caused to the fish needed to be reduced, if not eliminated

completely and that is when the idea of self-documentation arose.

It essentially involved providing the fisherman with cameras,

training them to use them and allowing them to document the

release operation while cutting the whale shark loose without any

assistance. Theoretically, by allowing fisherman to document the

capture and release of the big fish, the time taken for it to be

released would be drastically reduced. The fisherman would not

have to wait around for the rescue team to arrive and would also

get adequate compensation in a shorter period of time.

The conceptual refinement rescue method was discussed

in consultative meetings with Forest Department, fishing

communities, researchers and local stakeholders to explore the

feasibility of the method. The Governing Council meeting held

in December 2011 chaired by Secretary Dr. S. K. Nanda, agreed

to recommend the changes in the relevant Government Rule

of rescue in March 2012. The government of Gujarat made the

necessary changes recommended by the Governing Council.

Under the Rapid Action Projects of WTI, the conceptual model

was executed at Sutrapada, Dhamlej and Veraval to equip and

train several fishing communities in self-documentation of a whale

shark rescue operation using the revised methodology.

5.1. Methodology of new rescue protocols

Using water-proof cameras provided by WTI or their mobile camera

33

Plate 7: Story in local print media

the fishermen were advised to photograph the

incidentally-caught whale sharks along with

their boat number (usually written on the sides

of their boat) in a single frame to stake claims for

monetary relief against their damaged nets.

5.2. Empowering fishing communities to

use photo documentation

Several demonstrations on operating the water-

proof camera was conducted in Jaleshwar,

Veraval, Dhamlej and Sutrapada. For wider

understanding of the method, street plays,

dance dramas and other methods were used.

Immediately after the training programme,

cameras were distributed to the fishermen,

through their respective fishing community

heads. A total of 1159 cameras were distributed.

The coverage of such programmes through

print and electronic media enhanced interest in

the self-documentation scheme in other fishing

villages as well.

On a request of the village head, additional

16 cameras were later distributed in Mangrol.

Mangrol fishing port having 500 small OBM boats

and about 1500 boat operators. Based on the

Patel’s (community head) recommendation, WTI

arranged for a small gathering of fishermen with

forest officials, where 16 water-proof cameras

were distributed and training was provided to

them on using the cameras.

5.3. Train the trainers programme

In order to train the fishermen on how to use

the cameras and the kind of photographs

needed to claim relief money, a “Train the

trainers programme” was organised in each

fishing village. In this training programme, 10-15

fishermen were trained, who would further train

the rest of the fishermen.

5.4. Media hits

The awareness drive and self-documentation

scheme was well supported by local and national

media. It was also popularised through social

networking sites such as Facebook and Twitter

(Plate 7).

Plate 6. Volunteers and WTI Marine team conducting workshops for fishermen.

34

5.5. Results of the self-documentation

scheme

Soon after the camera distribution, the first

rescue happened on 2nd October, 2012, where a

whale shark was accidentally caught in a gill net

near Veraval. No rescue team ventured into sea

to document it; the fisherman used his mobile

camera (Plate 8) for documentation and reported

to have released the whale shark immediately.

After this, 111 more rescues happened under

the self-documentation scheme, from Veraval,

Sutrapada and Dhamlej (Plate 9). Details about

the rescues have been given in Appendix III. The

new method has drastically reduced the rescue

duration, as it eliminated the time taken for

informing the concerned departments after an

incidental catch by the fishermen and the time

taken for a rescue team to reach the location.

Analyses of the pictures obtained in the self-

documentation scheme are under process, which

will provide us with the data on the efficiency of

the new method.

5.6. Other concerns of whale shark rescue

Rescuing the netted whale shark by fishermen,

using a camera under the self documentation

scheme has shown admirable results for whale

shark conservation project in terms of the

number of rescues. It has developed a good

understanding among fishermen to rescue the

whale shark on their own and as soon as possible.

Certain factors that need to be looked into for

making the scheme more effective include:

1. Fishermen deploy their nets in the late

evening and start retrieving them early

morning, and if a whale shark gets

entangled in their net, the fishermen have

to wait for sunrise to get sufficient light

as they do not have cameras to take

photographs.

Solution: They should be given training

in using torch light along with the

camera to give suffcient light for a decent-

quality photo and/or provide them with

improved cameras with flash units.

2. Forest officials who undertake rescue

documentation work report that fishermen

are unable to provide rescue photographs

of the qualtiy recommended and required

by the forest department, which leads to

rejection of their relief claim. This has

been found mainly due to two reasons;

i. Fishermen have not received suffcient

training as complaints on camera

operation is the common reason for

bad pictures.

Plate 8: The first rescue under the self-

documentation scheme on 2nd October, 2012.

This picture was taken using a mobile phone.

Plate 9: Sample photos of whale shark rescue documented using the water—proof camera.

35

ii. Cameras are handled by untrained

fishermen while the trained fishermen

are engaged in retrieving nets.

Solution: Effective hands-on training needed

for the each indivdual fisherman, who recieved

the waterproof camera. The training should

cover all the activities such as,

a) How to rotate the roll manually after

taking one picture

b) Documenting rescue pictures as per forest

deparment requirements which are:

1. An entangled whale shark in the net.

2. Cutting the net, without harming the

whale shark.

3. Releasing the entangled whale shark

from the net.

4. Taking a snap of both the whale

shark and boat number for Forest

Department documentation purpose.

It's easier for the department to

process the document for net damage

compensation.

c) Fishermen heads to inform their fishermen

to replace the used roll in the water proof

camera with a new roll after each whale

shark rescue documentation.

For effective rescue records, the date and time

are required to be printed on the clicked photos,

but the current cameras do not have this feature,

which needs to considered for future work.

School and college students also

strived to sensitise communities

through street plays and spread

awareness on the whale shark

conservation campaign

Most whale sharks are accidentally caught

in the gill nets that are laid out. In the first

instance, Dinesh Khoraba had spread his maul

net to catch tuna fish and ended up catching the

majestic whale shark instead. The endeavour

of trying to save whale sharks, and give them

a fighting chance for survival would not have

been possible without the cooperation of the

local fishing communities in Gujarat. Students

from schools and colleges such as the Choksi

College and Fisheries College (under the

Junagadh Agriculture University) also strived to

sensitise the communities through street plays

and spreading awareness about the stress to

the whale shark, the change in the government

ruling, and the benefits to the fishermen, with

respect to time and finances.

While local fishermen of Gujarat have voluntarily

released the accidentally-captured whale sharks,

the ingenious self-documentation process cut the

time lost in reaching and releasing the sharks,

making it a pivotal point in the history of the

conservation effort to save the whale shark.

36

CHAPTER 6

Whale shark habitat preference

In general,

occurrences of

whale sharks

appear to be

sporadic and

unpredictable,

which is partly a

reflection of the

lack of knowledge

about the animal's

habitat and

ecology

The accessibility of the seasonal aggregation of whale sharks

in the Veraval regions provides an excellent opportunity for

researchers to undertake studies on this rarely-encountered and

poorly-understood shark. Initial research efforts lacked clearly-

defined objectives and were often hampered by limited scientific

research on whale shark biology and ecology. Some aspects of

the research should seek to provide information to environmental

management bodies to minimise possible detrimental impacts. In

general, occurrences of whale sharks appear to be sporadic and

unpredictable, which is partly a reflection of the lack of knowledge

about the animal's habitat and ecology.

6.1. Methodology

WTI aimed to study the habitat and ecology of whale shark along

the Saurashtra coast. Three experimental sites were selected

based on the information available on the whale shark citations.

The experimental sites included: 1.Veraval - A (0 km), B (5 km), C

(10 km), D (20 km); 2. Diu - A (0 km), B (5 km), C (10 km), D (20

km); and 3. Mangrol - A (0 km), B (5 km), C (10 km), D (20 km)

(Plate 10). Sampling was done in the fishing season, which fell in

three categoriehs: post monsoon (September to October), winter

(November to February), and pre-summer (March to April).

All water sampling and water quality analyses were carried

out according to the standard sea water analysing protocols

(Strickland & Parsons, 1968) at the regional centre of the Central

Marine Fishery Research Institute, Veraval (Appendix II). The

methods used for the analysis of various parameters are tabulated

in Table-4. Parameters such as sea surface temperature, salinity,

pH, visibility, DO, gross and net primary productivity, ammonia,

nitrate, phosphate, silicate, chlorophyll concentration, photos, and

zooplankton biomass and diversity were recorded from September

2010 (post monsoon) to April 2011 (pre-summer).

37

The study analysed water

samples for sea surface

temperature, salinity, pH,

visibility, gross and net primary

productivity, ammonia, nitrate,

phosphate, silicate, chlorophyll

concentration, photosynthesis,

zooplankton biomass and

diversity

Zooplankton samples were collected (Pate

11) from surface hauls by employing standard

plankton nets. The plankton net is towed

horizontally from the boat for 10 minutes using

three bridles (suspension lines), which are tied

to the ring at equal distance from each other.

While making the collections the speed of the

vessel is maintained at 1 to 2 nautical miles

per hour. After the 10 minutes haul, the net is

taken out of water and is washed from outside by

jetting seawater to bring down all the plankton

into a collecting bucket. After the excess water is

drained off from the net and through the window

of the collecting bucket, the bucket is carefully

removed from the net and the plankton, along

with the water, is poured into a wide-mouthed

500-ml polythene bottle. The collected samples

were preserved in 5% formaldehyde solution.

With regard to phytoplankton, one litre of water

from each station is collected in a wide-mouthed

1000-ml polythene bottle and preserved in 5%

formaldehyde solution.

The gross and net primary production rates

were calculated, using the light and dark bottle

oxygen technique (Gaarder & Gran, 1927). The

chlorophyll content of the water was estimated

following the methods of Strickland & Parsons

(1968). A sample of one litre water with

phytoplankton was collected from the surface of

the stations. The phytoplankton organisms were

enumerated by the settling method and qualitative

and quantitative evaluation of the flora. For the

quantitative estimation of zooplankton in the

samples, displacement method was used and

the zooplankton volume was determined. As it

is not possible to analyse the entire zooplankton

sample collected during a haul, sub-samples

of minimum 2 ml of zooplankton were used

for qualitative analysis of plankton groups.

The sub-sampled planktons were analysed by

counting in a plankton-counting chamber under

a microscope (Plate 12).

The analysis of all data was done using NCSS

software package for statistical analysis (ver. 8).

6.2. Results

Auto-correlation was checked between various

habitat parameters (e.g. pH, ammonia etc). None

of the variables seemed to be strongly correlated.

Strong para correlation was found among the

variables.

Only two variables -- depth and visibility -- showed

a significant correlation (r=0.644614).

The correlation matrix is given in Table 5.

Difference in the readings of various habitat

variables (e.g. pH, ammonia etc) between different

sites were analyzed by applying ANOVA.

Based on the locations (places), among all

parameters studied, the pH values showed a

significant difference (F=3.44, P=0.043902).

Visibility also showed a significant difference

(F= 9.39, P= 0.000592). Other factors such as

gross productivity, nitrate and silicates also

showed a significant difference between Veraval,

Mangrol and Diu (F=3.53, P=0.040715), (F=4.56,

P=0.017909) and (F ratio=3.68, P=0.036080)

respectively.

38

Plate 10: Project area at Mangrol, Veraval and Diu (in yellow) and sampling sites

(in red)

SL. NO. PARAMETERS METHODS INSTRUMENTS

1. Temperature - Thermometer

2. pH - pH meter

3. Salinity - Salinometer

4. Dissolved Oxygen Winkler’s -

5. Visibility - Secchi Disk

6. Nitrate Strickland & Parsons (1968) Spectrophotometer

7. Phosphate Strickland & Parsons (1968) Spectrophotometer

8. Ammonia Strickland & Parsons (1968) Spectrophotometer

9. Silicate Strickland & Parsons (1968) Spectrophotometer

10. Chlorophyll Strickland & Parsons (1968) Spectrophotometer

11. Primary productivity Gaarder & Gran, 1927 (Light &

Dark Bottle)

12. Phyto- and

Zooplankton

analyses

Standard phyto- and zooplankton

sample collection and analysis

method

Hemocytometer,

Microscope

Table 4. Various parameters measured

39

Fig. 32. Response of pH between

different places

Fig. 33. Response of visibility between

different places

Fig. 35. Response of Nitrate

(Veraval=1, Diu=2, Mangrol=3)

Fig. 34. Response of Gross Productivity

Plate 11: On board fixing of water samples Plate12: Zooplankton collection through

planktonic net

40

Table 5. Correlation matrix showing correlation coefficients (r) of only significantly correlated

habitat parameters

Fig. 37. Response of temperature Fig. 38 Response of salinity

(Post-monsoon=1, Winter=2, Pre Summer=3)

Season Season

Fig. 36 . Response of silicate between different places

(Post-monsoon=1, Winter=2, Pre Summer=3)

Season

Depth

(m)

Visibility

(m)

DO

(ml/L)

Net

Productivity

(mg C/L/hr)

Ammonia

(µg /L)

Nitrate(µg

/L)

Silicate(µg

at /L)

Temperature (°C) 0.42

pH 0.41 0.42

Depth (m) 0.64 -0.40

Visibility (m) -0.39

Gross Productivity

(mg C/L/hr)

0.51

Phosphate(µg/L) 0.45

Auto-correlation was checked among different habitat variables and the significantly correlated

habitat parameters are indicated in Table 5. Among them, only two variables- depth and visibility-

showed a strong positive correlation (r= 0.64), this may be explained as with increasing depth,

concentration of silicate decreased (r=-0.40).

41

Post-monsoon=1, Winter=2, Pre Summer=3

SeasonSeason

Fig. 41. Response of Depth Fig. 42. Response of Visibility

Station (A=1=0 km, B=2=5 km, C=3= 10 km, D=4=20 km)

Station Station

Fig. 39. Response of DO between

different seasons

Fig. 40. Response of Nitrate

different seasons

42

6.4. Whale shark habitat analysis with free

source satellite data

An overlay of satellite image data available for

various parameters for the whale shark rescue

and tagged locations was prepared to analyse

habitat preferences of whale sharks off the

Gujarat coast.

6.4.1. Data acquisition and methodology

Monthly and eight-day composites of SST and

chlorophyll MODIS images having 4 km resolution

Table 6. Data acquired from MODIS

Chlorophyll SST

March 2010 (8 day composites) March 2010 (Monthly)

April 2010 (Monthly) April 2010 (Monthly)

May 2010 (Monthly) May 2010 (8 day composites)

December 2010 (Monthly) December 2010 (Monthly)

October 2010 (Monthly) October 2010 (Monthly)

February 2011 (Monthly) February 2011 (Monthly)

April 2011 (Monthly) April 2011 (Monthly)

Fig. 44(a). Variable= X1 = Diu_field_temp, X2 = Diu_Sat_temp. for confidence limits

= 2.1009

Fig. 43. Response of salinity based on distance from shore

Station

43

were downloaded from http://oceancolor.gsfc.

nasa.gov/cgi/l3?per=DAY. Level-3 from MODIS

products were produced for several time period

composites. In general, longer time periods fill

in more of the naturally occurring data gaps

(caused by, for example, clouds, sun glint, inter-

orbits gaps, ice, low light, etc.) at the expense of

short-lived features which tend to get smoothed

out in longer-period composites.

Sea surface temperature (SST) and chlorophyll

data was acquired on the different dates when

signals were acquired for tagged whale sharks

as well as rescue locations. Both data sets were

processed. HDF files downloaded were converted

to ASCII using HDFView, and edited to remove

the null values using ConText. The SST was

linearly stretched using SAGA GIS. Chlorophyll

data did not require any stretching. Values of

the tagged shark locations and rescue locations

was extracted using ArcGIS

6.4.2. Analysis

Sea surface temperature and chlorophyll

The mean SST was 27.0737oC (+14oC) at the

tagged whale shark locations and the mean

temprature for rescued whale shark location was

26.5264°C (+0.29oC). But a number of the whale

shark rescue locations were found to be around

25°C (Table 7).

Table 7. Mean SST

N Mean Std.

Deviation

Std. Error

Mean

SST

(Tagged)

18 27.0737 0.61405 0.14473

SST

(Rescued)

33 26.5264 1.702241 0.296322

The mean chlorophyll was 4.8072 mg/cubic m

for tagged whale shark locations and 3.769849

for whale shark rescue locations (Table 8). The

chlorophyll value for whales shark locations

varied drastically among the locations, leading

to no conclusion about weather chlorophyll

goverened whale shark movement.

Table 8. Mean chlorophyll

N Mean Std.

Deviation

Std. Error

Mean

Chlorophyll

(Tagged)

18 4.8072 3.9974 0.9422

Chlorophyll

(Rescued)

33 3.769849 2.973909 0.517691

6.5. Comparative study of satellite data

with field data on sampling location

In order to check the reliability of satellite data,

a test run was conducted between data gathered

from field and satellite data.

6.5.1. Temperature

Paired T-test was applied to the data. There

appears a selective bias in the data originated

from satellite, which might be caused by many

factors. For temperature, data collected in field

was found higher than satellite data (Table 9).

Field data of Diu was compared with the satellite

data. Against a null hypothesis i.e. field data

was similar to satellite data, three alternative

hypotheses were tested, and it was found that

temperature data from the field was elevated as

compared with satellite data.

Table 9. Temp. test for difference between temperature means section

Alternative hypothesis T-Value Prob. Level Reject HO at 0.050

Diu_field_temp-Diu_Sat_temp<>0 2.2071 0.040534 Yes

Diu_field_temp-Diu_Sat_temp<0 2.2071 0.979733 NO

Diu_field_temp-Diu_Sat_temp<0 2.2071 0.020267 Yes

Variable= X1 = Diu_field_temp, X2 = Diu_Sat_temp for confidence limits = 2.1009

44

6.5.2. Chlorophyll

The chlorophyll data was not normally

distributed. Against a null hypothesis, ie. field

data is similar to satellite data, three alternative

hypothesis were tested, and it was found that

the chlorophyll data from field was lower than

satellite data.

Table 10. Tests of assumptions about different

sections

Tests of assumptions about differenct sections

Assumption Value Probability

Skewness Normality -3.4381 0.000586

Kurtosis Normality 2.6648 0.007702

Omnibus Normality 18.9223 0.000078

6.5.3. Seasonal variation in temperature and

chlorophyll content with correlation to whale

shark rescue and migration location of tagged

whale shark using satellite data:

The satellite data was analysed to find the

seasonal variation in temperature and chlorophyll

content with correlation to whale shark rescue

and migration location of tagged whale sharks.

The analysed data did not yield any correlation

between the seasonal variation in temperature

and chlorophyll content; this could be due to

the low sample size or due to the previously

discussed errors in the deviation of satellite data

and actual field data. Further analysis is needed

for any possible correlation to be identified.

Table 11: T-Test for difference between means section

Alternative hypothesis T-Value Prob. Level Reject HO at 0.050

Chloro_field-Chloro_

Sat<>0

-2.8005 0.012827 Yes


Sat<0

-2.8005 0.006414 Yes


Sat>0

-2.8005 0.993586 No

Variable= X1 = Chloro_field, X2 = chloro_sat temp. for confidence limits = 2.1199

6.5.4. Seasonal variation in whale shark

sighting or rescues:

With the available data it was not possible to run

any analysis, but the graphs below show some

higher whale shark sightings/rescues in some

specific season (Fig 45 a, b).

6.6. Whale shark occurrence with

reference to depth

When whale shark catch locations (of rescued

whale sharks) were plotted in a map, not much

difference was found between the numbers

of whale sharks accidently caught in shallow

Fig. 44(b). Seasona-wise mean chlorophyll concentration and (c) season-wise mean SST variation

45

Fig.45 a. Temperature vs whale

shark sightings/rescues

wh

ale

shar

k s

igh

tin

g

Fig 45 b. Chlorophyll vs whale

shark sightings/rescues

wh

ale

shar

k s

igh

tin

g

and deeper areas. Eleven catch locations were

reported from deeper areas ( 50 m or > 50 m) and

almost similar number of 12 whale sharks were

caught in shallow areas (30 or less than 30 m).

6.6.1. Zooplankton community analysis

Hierarchical Cluster analysis was applied

to analyse how the community structure

of zooplanktons, phytoplankton, diatoms,

dinoflagellates, silicoflagellates, blue green algae

and nannoplanktons at three study sites varies

with seasons. The results are depicted as cluster

dendrograms of three seasons, post monsoon,

winter and pre-summer.

Among the zooplanktons (Table 12),

Hydromedusae and copepods were most

distantly associated (Fig. 46) for all the seasons

except winter. Hydromedusae and Siphonophora

were most closely associated zooplanktons

throughout the year (Fig. 46, 47, 48, 49).

Table 12. List of zooplankton community

analysis in dendrogram.

1 Hydromedusae

2 Siphonophora

3 Chaetognatha

4 Copepod

5 Sergestidae

6 Invertebrate larvae

7 Thaliacea

8 Fish eggs

9 Fish larvae

46

Fig. 46. All season

Fig. 48. Winter

Fig. 47. Post-monsoon

Fig. 49. Pre-summer

47

Fig. 50. Post-monsoon Fig. 52. Pre-summer

Fig. 51. Winter

Table 13. List of species in dendrogram

1 Skeletonema costatum

2 Thallassiophyxix palmeriana

3 Thallassiosira subtilis

4 Coscinodiscus excentricus

5 Planktoniella sol

6 Rhizosolenia robusta

7 Eucampia cornuta

8 Biddulphia mobiliensis

9 Ditylum brightwelli

10 Biddulphia sinensis

11 Cerataulina bergonii

12 Cyclotella sp

13 Chaetoceros sp

14 Lithodesmium sp

6.6.2. Phytoplankton community analysis

Phytoplankton community analysis was carried

out in two phases, one for Diatom centrales

(Figure 50, 51, 52) and other for Diatom pennales

(Figure 53, 54, 55). Skeletonema costatum

and Thallassiiophyxix palmeriana were very

closely related during post monsoon and

winter, however, in pre-summer, Skeletonema

costatum and Rhizosolenia robusta were closely

associated.

48

Fig. 53. Post-monsoon Fig. 55. Pre-summer

Fig. 54. Winter

Table 14. List of species in dendrogram

1 Grammatophora undulate

2 Licmophora delicatula

3 Fragilaria oceanic

4 Rhaphoneis discoides

5 Thallasiothrix frauenfeldii

6 Asterionella japonica

7 Mastogloia exilis

8 Cocconeis littoralis

9 Gyrosigma balticum

10 Bacillaria paradoxa

11 Nitzschia closterium

12 Nitzschia sp

13 Surirella fluminensis

14 Campylodiscusi yengarii

15 Navicula sp

16 Thalassionemanitz schioides

6.6.3 Diatoms pennales

In case of diatom pennales, three separate assemblages were evident in post monsoon (Fig. 53)

whereas only two community associations were depicted in winter and pre-summer (Fig. 54 and 55)

(Table 14).

49

6.6.4 Dinoflagellates

In case of Dinoflagellates, close association was depicted for Ceratium sp. and Cochlodinium citron

for all the three seasons (Fig. 56, 57 and 58). However, several changes in community composition

were also depicted between winter and pre-summer.

Table 15. List of species in dendrogram.

1 Ceratium sp

2 Cochlodinium citron

3 Amphisolenia bifurcata

4 Ceratium declinatum

5 Dinophysis caudata

6 Peridinium claudicans

7 Podolampas bipes

8 Pyrophacus horologium

9 Diplopsalis sp

10 Ornithocercus magnificus

11 Prorocentrum sp


Fig. 58. Pre-summers

Fig. 57. Winter

50


Fig. 61. Pre-summer

Fig. 60. Winter

6.6.5. Silicoflagellates, blue-green algae &

nannoplankton

For this group, blue-green algae and Nanno

chloropsis were not at all associated for all the

three seasons (Fig. 59, 60, 61) and were part of

two different communities for all the seasons.

Table 16. List of taxon in dendrogram

1 Blue green algae

2 Spirulina sp

3 Pavlova sp

4 Dunaliena sp

5 Nanno chloropsis

6 Chlorella sp

7 Tetraselmis sp

51

6.7. Conclusion

6.7.1. Various habitat parameters their

relation and responses to places, seasons

and distance from shore

Among all habitat parameters, only depth and

visibility showed some relation, which was

expected as visibility often improves with depth.

The rest of the parameters were weakly or not

correlated at all and so nothing could be inferred.

Whale shark tourism depends on good visibility

and current studies show that only the deeper

areas which are far from shore show a visibility

range of 2.5 m to 10 m (mean = 6.5m). Among

the three study sites, Mangrol showed good

visibility compared to Veraval which showed

a broad range of visibility. Diu had the lowest

visibility. This suggests that deeper areas in

Mangrol and Veraval are good for initiating whale

shark tourism and satellite tagging studies. The

low visibility in Diu may be due to heavy land

runoffs and shallow seas compared to Veraval

and Mangrol.

Analysis of various parameters

indicated that deeper areas

in Mangrol and Veraval are

good for initiating whale shark

tourism and satellite tagging

studies

The pH values of all three habitats did not

show significant changes and were within

normal ranges. But further studies are needed

specifically in areas near Veraval where heavy

industrial runoffs are discharged directly into

sea by fish- processing units.

Gross productivity, nitrates and silicates showed

a significant difference among three study sites.

The Veraval area, where maximum number

of whale sharks sightings and rescues were

reported, showed a greater range and mean

values for these parameters, which are important

to support zooplankton and phytoplankton

growth (whale shark food). Further studies are

needed to confirm whether areas near Veraval

are highly productive compared to the rest, as

the present study was limited to one seasonal

cycle. It is speculated that the high numbers of

recues from Veraval may also be due to increased

fishing efforts, compared to Mangrol and Diu.

Different seasons showed a marked difference in

temperature changes in water. In winter, when

the maximum number of rescues was reported,

the mean water temperature was 24.35°C

(±0.58°C SD). But more studies are needed to

confirm the seasonal temperature preference for

whale sharks at Saurashtra coast.

A significant difference of DO and Nitrate during

post-monsoon suggests heavy runoffs from lands

into the sea and churning due to heavy water

currents and monsoon.

The depth and visibility revealed a significant

difference from shore which was expected. Low

visibility closer to shore areas may be due to

the heavy disturbance factors of too many boats

operating.

6.7.2.Satellite field data and comparison

with field data

Satellite data is reliable to study various

marine species’ habitat and their distribution.

In the current studies, when temperature and

chlorophyll data from satellite studies and the

field were compared, a significant difference was

found, which suggests the need to either refine

the field protocols and sample analysis, or need

further studies to understand satellite data.

6.7.3. Temperature and chlorophyll

preference by satellite tagged whale shark

However, when the satellite data was analysed

for temperature and chlorophyll at the locations

where tagged animals migrated, it was found

that the temperature variations between these

places were small, indicating that the tagged

whale shark preferred a specific temperature

of 27.07°C (± 0.61°C SD). Probably this was

52

because the data was only for two months (13

March 2011- 24 April 2011). Chlorophyll had a

wide variations (Mean 4.80 ± 3.99 SD), indicating

that there was probably no relation.

6.7.4. Whale shark locations with respect

to depth

No difference was found between the number of

whale sharks caught in shallow and deeper areas.

It shows that irrespective of the depth, whale

sharks search for productive feeding grounds.

In the case of tagged whale sharks also, frequent

switching between deeper and shallow areas was

observed. The team could not come to a definite

conclusion as the present data size is limited.

6.7.5. Comparison of whale shark rescues/

sightings with seasonal temperature and

chlorophyll field data

When the numbers of whale shark sightings/

rescues are compared with the seasonal water

quality changes, the maximum number of

rescues were recorded in winter, followed by

-monsoon and -summer. If the mean temperature

value of pre summer time and satellite tagged

animal location temperature data (satellite data)

which was during pre-summers (March and

April), are compared, there is only a difference of

0.1°C, which suggests that during pre-summers

of 2011 whale shark preferred this temperature.

However further studies are needed to confirm

such preferences for specific temperature range

by whale shark for specific seasons.

6.7.6. Zooplankton community analysis

Samples collected from the study sites listed

the presence of Hydromedusae, Siphorophora,

Chaetognatha, Copepod, Sergestidae, invertebrate

larvae, Thaliacea, fish eggs and fish larvae.

Chaetognatha, Sergestidae and Siphonophora

were found continuously, forming clusters during

all three seasons. During post-monsoon, fish

larvae were found in close association with these

species. The high density of fish larvae during

post-monsoon is expected as most fish breed

during monsoon. Hydromedusae and Thaliacea

were found abundantly during winters.

Fish eggs and copepods were also found forming

a specific cluster during winters. It is important

to note that copepods and fish eggs form a major

part of whale shark diet. So their increased

growth during winters might be the reason for

whale sharks sightings in winters.

6.7.7. Phytoplankton analysis

Phytoplanktons are the base of a marine

ecosystem: they serve as food not only for many

small and big marine organisms, but also for

whale sharks. Their enormous growth is also

known as food capsules of oceans, which attracts

whale sharks.

6.7.8. Diatoms centrales

Samples collected from three sites showed

the presence of Skeletonemaco statum,

Thallassiophyxix palmeriana, Thallassiosira

subtilis, Coscinodiscus excentricus, Planktoniella

sol, Rhizosolenia robusta, Eucampia cornuta,

Biddulphia mobiliensis, Ditylum brightwelli,

Biddulphia sinensis, Cerataulina bergonii,

Cyclotella sp., Chaetoceros sp. and

LIthodesmium sp.

Species such as Lithodesmium sp. and

Planktoniella sol showed a consistent grouping

throughout all seasons. Two other species,

Biddulphia mobiliensis and Cyclotella sp., were

also found high in numbers during winters,

especially when whale shark sighting is at its

peak. The consistent presence of some species

of diatom centrals throughout the seasons and

the specific presence of some during winters

might be the reason for consistent whale shark

sightings and more specific sightings in winters.

6.7.9. Diatoms pennales

The analysis of water samples revealed the

presence of 16 diatom pennales species viz.

Grammatophora undulata, Licmophora

delicatula, Fragilaria oceanica, Rhaphoneis

discoides, Thallasiothrix frauenfeldii,

53

Asterionella japonica, Mastogloia exilis,

Cocconeis littoralis, Gyrosigma balticum,

Bacillaria paradoxa, Nitzschia closterium,

Nitzschia sp, Surirella fluminensis,

Campylodiscus iyengarii, Navicula sp. and

Thalassionema nitzschioides.

Among diatoms pennales species, Surirella

fluminensis, Campylodiscus iyengarii and

Asterionella japonica which are specific

community structure during post monsoon and

pre-summer season are replaced by species like

Nitzschia sp, Grammatophora undulate and

Mastogloia exilis while during winters forming

a different community structure.

6.7.9.1 Dinoflagellates

Ceratium sp, Cochlodinium citron,

Amphisolenia bifurcata, Ceratium declinatum,

Dinophysis caudata, Peridinium claudicans,

Podolampas bipes, Pyrophacus horologium,

Diplopsalis sp, Ornithocercus magnificus

and Prorocentrum sp were reported from the

analysed samples.

Diplop salis sp, podolampas bipes,

prorocentrum sp, ceratium declinatum and

dinophysis caudata are consistent for post-

monsoon and winter. During pre-summer three

of these species are replaced by Amphisolenia

bifurcatea Ornithocercusmagnificus and

Prorocentrum sp.

6.7.9.2 Silicoflagellates, blue-green algae

and nanoplankton

Blue-green algae Spirulina sp, Pavlova sp,

Dunaliena sp, Nanno chloropsis, chlorella sp

and Tetraselmis sp have been reported from the

three study sites.

Four species, Spirulina sp, Tetraselmis sp,

Nanno chloropsis and Dunaliena sp are

consistent during post monsoon and winters, but

during pre- summers Dunaliena sp and Nanno

chloropsis, are replaced by Nanno chloropsis

and blue green algae.

With data available from only one seasonal cycle,

it is difficult to arrive at a definite conclusion

for whale shark habitat preferences at the

Saurashtra coast. In current studies, various

habitat parameters showed some differences

between the three study sites, which could be a

reason for increased sightings specifically near

Veraval, though it could also be directly related

to more intensified fishing as Veraval port has

the maximum number of operational fishing

vessels compared to Diu and Mangrol. Further

studies are needed to understand the reasons.

Similarly it is imperative to conduct further

research on the status of quantum of zooplankton

and phytoplankton in the sites. The current study

has shown that these areas are rich in copepods

and other species which are the preferred food

for whale sharks.

It is also important to refine either the field

protocols of sampling and analysis, or data

extraction techniques from satellite images,

because the current studies showed a significant

difference between the two sources. Once it is

done, satellite data may help considerably in

understanding the whale shark habitat. Similar

efforts are needed in satellite tagging of whale

sharks, as their movement data will be a great

source of information on the reasons behind

these migrations.

During all three seasons, a continuous heavy

untreated discharge from fish processing units of

Veraval was noticed. It is also important to study

the impact of such discharges on the coastal

waters of Gujarat, including possible alterations

to the marine environment.

54

CHAPTER 7

Whale shark migration

Photographic

identification has

several advantages

over conventional

tagging, as it is non-

invasive

Whale sharks are believed to migrate between feeding grounds.

Preliminary results from various tagging studies and other

observations appear to indicate that this species migrate in

response to seasonal concentrations of food. Whale sharks returns

regularly to certain locations to feed on blooms of zooplankton

(i.e., concentrations of eggs and larvae from the synchronous

spawning of fish, crabs or coral) that occur for a few months

each year. Whale sharks in the Indian Ocean is highly migratory,

as indicated by Rowat (2007). The tracking information from

GPS data and anecdotes from fishermen and tour operators in

the Indian Ocean have shown that shark migrate annually east

towards continental Africa, then both south into the Mozambique

area and to the north off Somalia, after which they migrate west

towards Sri Lanka. The pattern of temporal occurrence shows

that the whale sharks are generally seen on a regular basis during

specific periods. The movements have been also linked with the

monsoon wind seasons (Anderson and Ahmed 1993). Sleeman

(2010) found that surface geostrophic currents did not affect the

movements of whale sharks. The tracked individuals confirmed

that whale sharks can effectively swim against prevailing surface

currents and they did not seem to utilise the currents to get to

productive areas.

Whale sharks travel long distances and the timing of their

movements are typically associated with localised blooms of

planktonic organisms and water temperature changes (Compagno

2002). In the Gulf of California (GOC), Eckert and Stewart (2001)

used towed satellite tags to demonstrate extensive movement of

whale sharks into the north Pacific Ocean. Using towed tags off

Southeast Asia, Eckert et al. (2002) reported two whale sharks

that travelled 4,567 and 8,025 km with an overall mean travel rate

of 24.7 km/day. By applying PSATs to whale sharks at Ningaloo

Reef, Western Australia, Wilson et al. (2005) documented long-

term movements characterised by both in-shore and off-shore

habitat utilisation, north-easterly travels into the Indian Ocean.

Collectively these studies indicate that whale shark is capable

of transoceanic movements, crossing numerous geopolitical

55

boundaries, which highlights the need for both

regional and multinational levels of management

for this species. Whether the migrations (i.e. the

seasonal movements of animals from one region

to another) of several thousand kilometres are

solely driven by feeding events or linked to other

aspects of their life history is yet to be determined.

Although the whale shark has been documented

in various parts of the Gulf of Mexico (GOM)

(Burks et al. 2006 and Hoffmayer et al. 2007)

and Caribbean Sea (Gudger 1939 and Heyman

et al. 2001), the team know very little about the

movement and migration patterns of this species.

Conventional tagging is increasingly used

to estimate and assess shark populations

and movements and since 1962 the National

Oceanographic and Atmospheric Administration’s

National Marine Fisheries Service Laboratory

(NOAA-NMFS) has implemented a cooperative

shark tagging programme with recreational

anglers and commercial fishers, leading to the

tagging of over 87,000 sharks (Kohler et al.

1998). However tag shedding appears common

in a range of shark species, undermining viable

population estimates (Davies and Joubert,

(1967), Gruber, (1982), Carrier, (1985), Heupel

and Bennett, (1997). Graham et al. (2007) has

also reported conventional tagging efforts off

Gladden Spit, Belize has resulted in very few re-

sightings outside the study area.

By comparison, photo identification is a non-

invasive method of identifying individuals that

relies on cataloguing distinctive scars or markings

originally developed to identify terrestrial

animals and marine mammals that can be clearly

seen (Katona et al. (1979) and Arnbom, (1987 b)).

In elasmobranchs, photo-identification has been

adapted to identify basking sharks in Britain

(Sims et al. 2000), white sharks at California’s

Farallon Islands (Klimley, 1996), nurse sharks

in Brazil’s Atol das Rocas (Castro and Rosa,

2005) and whale sharks worldwide including

Ningaloo Reef, Australia (Arzoumanian et al.

2005), Belize (Graham, 2003) and more recently

in combination with tagging in the Isla Contoy

in Mexico, the Bay Islands of Honduras, the

Seychelles and Djibouti.

Whale sharks are born with unique body

pigmentation that is retained throughout their

lives (Norman 2004). This natural patterning of

lines and spots shows no evidence of significant

change over years and may, therefore, be used to

identify individual sharks (Taylor 1994; Norman

1999): its uniqueness has been corroborated

by traditional tagging and identifications made

based on scarring and other visual markers.

By combining photographed encounters and

spot-pattern matching, a shark may be ‘tagged’

without physical contact or interference with

the animal. In an early effort, Norman (1999)

established a photo-identification library of whale

sharks at Ningaloo Reef, Western Australia, with

photographs of individual sharks examined by

eye for identifying characteristics, including spot

patterns.

Photographic identification as several advantages

over conventional tagging, particularly for a

large threatened species like the whale shark.

Photo-ID is non-invasive, reducing both the

potential for detrimental impacts from the tags

or a behavioural response to tagging, which may

bias future re-sighting. Given that underwater

digital cameras are now ubiquitous within the

diving and marine tourism industry, it is easy

to obtain ID shots from tourism operators or

interested clients themselves as well as from

within the scientific community.

It is vital to gather more information through

scientific studies on whale shark movement,

so that better conservation models can be

developed in collaboration with other range

states and countries. The project has used all

the three techniques i.e. photo- identification,

marker tagging and satellite tagging technique,

to trace and understand the migration route of

whale shark in the Arabian Sea. All techniques

have shown varying levels of success in spite

56

of the challenges faced due to extreme natural

conditions of the coastal waters of Gujarat.

7.1. Photo identification

Whale sharks are easily distinguishable from

other species due to their large size and

distinctive white-spotted dorsal coloration. The

spot patterns are individually unique and appear

to be consistent over time, enabling long-term

re-sighting of individuals and the application of

standard sighting re-sighting based population

estimation methods (Meekan et al. 2006).

The flanks of the shark are the areas used for

identification, based on other successful studies.

Photographs should be taken from right angles

to the shark. The important areas to include in

the photograph are the upper and lower fifth gill

slit and the inner trailing edge of the pectoral fin.

The flank areas approximate a two-dimensional

surface, containing large distinctive spots and

include suitable reference points for comparison

between images (Plate 13).

A platform like ECOCEAN (www.whaleshark.org)

provides a global platform for the submission

of whale sharks photographs, where these

photographs are processed and IDs are given to

individual animals. ECOCEAN was incorporated

in India on January 2010 for the joint research

work of Wildlife Trust of India, Tata Chemicals

Ltd, and Forest Department, Gujarat.

7.1.1. Photo ID of the whale sharks of Gujarat

coast

All photographs used for the photo ID were

taken during the rescue operations. Though

a number of photographs were documented

during the project period, only two were of

acceptable quality. They were uploaded on to

the global online whale shark photo ID directory,

ECOCEAN. The whale sharks were identified as

new individuals, not previously photographed/

photo identified, and, therefore, are new additions

to the ECOCEAN global directory.

Some of the hurdles for the a good-quality photo

ID in Gujarat are:

• Visibility is one of the prime requirements

for a good photo ID. But poor water

visibility in the Gujarat waters has been a

major hurdle for photo ID. In 40 rescues,

an average visibility of 2.01m (SD±1.37) was

recorded

• Position of the rescued whale shark is also a

major hurdle for photo ID. As photographs

of the sides of the sharks (specifically near

the gills), need to be taken for identification,

the position of the trapped sharks is

sometimes unsuitable for documentation

for a photo Id.

• Net entanglement is a third major problem,

as the trapped whale sharks are completely

Plate 13: Photographs for a perfect photo ID

57

covered in net, to an extent that the spots

are not visible. In such cases a photo Id is

not possible.

• Post-release from the entangled net, the

rescued whale shark immediately dives into

deeper waters, making photo ID impossible

in such situations.

Considering all of the above factors, it seems

logical not to depend exclusively on photo ID for

migration or whale shark population studies off

the coast of Gujarat.

External marker tags carry

an individual code, batch

code,and visible instructions

for reporting. They include

ribbons, threads, wires, plates,

disks, dangling tags and straps.

They are usually attached to the

dorsal fin

7.2. Marker tags

Conventional external tags are another way to

mark the whale sharks; the tags are applied

externally on the animal. It follows that the tag

is easily detectable and no special equipment

is required for detection. The tags may carry

an individual code, a batch code and/or visible

instructions for reporting. Examples of these

types of tags include ribbons, threads, wires,

plates, disks, SSD, dangling tags and straps

(McFarlane et al. 2009).

7.2.1. Tag Used

The stainless steel head dart (SSD tags) tags

(Plate 14) were used to mark the animals. Each

SSC tag is labelled with the project name, specific

number and email id and contact number of

the project leader to maximise the chances of

reporting in cases of recapture.

7.2.2. Protocol

During rescue, the tags are deployed with the

help of an applicator. The preferable area for

inserting tags is the base of dorsal fin. At an

angle of 45 degrees, the tags are harpooned into

the dorsal muscle where the tag will anchor itself

without locking to any specific bony structure.

The upper denticles are slightly removed using a

drill, which serves as an easy insertion point for

the tag to move in with the help of an applicator.

This reduces the chances of secondary injuries

to the animal, as using a harpoon at the close

end may cause injuries. This method also further

helps to take samples for genetic studies.

7.2.3. Marker tags on the whale sharks of

Gujarat coast

Four marker tags have been successfully

deployed during rescues operation, and no

recapture of these sharks have been reported till

date.

Plate 14. A standard SSD tag

58

Table 17. Details of deployed marker tags

S. No Date Place Marker Tag Number GPS location

1 14/12/2010 Sutrapada 001 N 20°46'377" E 70°29'637"

2 05/03/2011 Veraval 002 N 20°52'376" E 70°16'366"

3 09/03/2011 Sutrapada 003 N 20°47'592" E 70°21'528"

4 13/03/2011 Sutrapada 004 N 20°44'495" E 70°29'349"

A major hurdle in deploying the marker tags

is the position of the sharks during rescue, as

marker tags are required to be inserted below

the dorsal fin, and in many instances the position

of the sharks makes it unreachable.

7.3. Satellite tagging

Satellite tags help study animal

movements and their migration

patterns through transmitted

signals

Satellite tags across the world are used in various

wildlife conservation organisations to track

and study the movement of a targeted animal,

thereby, helping them not only to understand the

animal’s migration pattern, but also to conserve

and secure the habitat the targeted animal uses.

Similarly, to understand the migration pattern

and also, if required, to extend the conservation

activities for whale sharks, satellite tags were

used in the project.

7.3.1. Tag used

Two fin mount SPOT 5 (Smart Position or

Temperature Transmitting Tag) tag supplied

by Wildlife Computers were used to monitor

the whale shark movement in the project.

The transmitted signals data location was

obtained through ARGOS service provider,

which is accurate up to ±350m. The tags can

measure temperatures from -40°C to +60°C,

with a resolution of approximately 0.2° C. The

temperature is reported in “time-at-temperature”

histograms. Several battery configurations are

available for the SPOT5 tag. For position-only

deployments, a single “AA” battery is capable of

providing approximately 70,000 transmissions;

a single C-cell provides 180,000 transmissions.

As a general rule, a budget of 250 transmissions

per day is sufficient to provide daily location

calculations via ARGOS. Therefore, a single

AA cell provides locations for approximately

280 days; a single C-cell provides locations for

700 days, though the actual results depend on

animal behaviour and other environmental

temperatures (Plate 15).

Plate 15. Fin mount SPOT tag

59

Additionally, the Government of Gujarat has

supported in purchasing 10 tow (SPOT 5) tags

supplied by Wildlife Computers. The fin mount

tags need to be bolted onto the dorsal fin, while

the tow tags are needed to be speared onto the

base of the dorsal fin (Plate 16).

7.3.2. Tag configuration and testing

Each tag can be configured, using a computer

system using SPOT5 host v5.50.2003 software.

Transmission intervals and temperature ranges

for up to 12 bins, as well as the number of

hours over which the temperature histograms

are collected (1 to 24), were set by using the

SPOT5 Host v 5.50.2003 programme. Based

on information available at www.satscape.co.uk

satellite pass was predicted and tag transmission

was tested. A WTI research team continuously

practised on a dummy fin made of hard

cardboard and fibre, before setting out for actual

deployment.

7.3.3. First tag deployment in India

During a rescue call at Sutrapada on 13th March

2011, the first satellite tag was deployed on a

rescued male whale shark (Plate 17). WTI’s

Plate 17: First satellite tagging of the whale shark in India

Plate 16: Floating buoy SPOT tag

60

research team and officials from the Gujarat

Forest Department were involved in the tagging.

On reaching the rescue spot, the health of the

whale shark was assessed, after which the tag

deployment was initiated.

Prior discussions with fishermen and several

international whale shark experts revealed that

the tail portion is the most visible part of the body

above the water when a whale shark surfaces

and they suggested placing the tag on the caudal

fin of whale shark. The suggested protocols were

followed and the tag was deployed on the tail.

Plastic bolts and plastic washers along with

stainless steel nuts provided with the satellite tag

were used to fix the tag firmly onto the top end

tail. The whole tagging process was completed

within 10 min. During release, the whale shark

showed no symptoms of over- stress or turmoil.

Plate 18: First satellite tagged whale shark's movement in Arabian sea

Plate 19: Tagged WS with migrating potential fishing zone (red dot- whale shark position /

blue dot -potential fishing zone)

Plate 20: Tagged whale shark with migrating potential fishing zone (red dot- whale shark

position/blue dot -potential fishing zone)

61

7.3.4. Tag transmission

For the first two days, no transmission signal

was received from the tag. On 15 March 2011,

the first signal was received through ARGOS

satellite tag monitoring system. After the

first transmission, regular transmissions were

received every two or three days. The project

received the tag’s location data for 41 days after

which the transmission stopped.

7.3.5. Tagged whale shark movement

After three days, the data revealed that the whale

shark was located some 130 km away from the

release location. Thereafter, the transmission

signals received showed a gradual movement

towards the waters of south Maharashtra,

Mumbai and Gulf of Khambhat, followed by

Diu. Later it was located 25 km away from the

location where it was released. The whale shark

moved back to Gulf of Khambhat where it spent

a longer time compared to the rest of locations

during the 41 days of observation (Plate 18).

On several occasions, the whale shark was found

close to PFZ (Potential Fishing Zones), a forecast

done by INCOIS (Indian National Centre for

Ocean Information Services) based on optimum

temperature and chlorophyll–content sensed

through satellite imagery (Plates 19 & 20).

7.3.6. A second attempt of satellite tagging

In May 2013, a second attempt to satellite tag a

rescued female whale shark (10 ft) was attempted.

(Plate 21) Due to high turbidity and unsuitable

weather conditions, the procedure was cancelled

and the whale shark was released.

Plate 21: Attempt to tag the rescued

whale shark

7.3.7. Second satellite tagging

On 27th December 2013, a recipient of a camera

under the self-documentation scheme informed

the local forest range officer that a whale shark

was caught in his fishing net approximately

4.73 nautical miles from Sutrapada coast. The

forest department in turn informed the WTI

whale shark research camp at Sutrapada. The

WTI whale shark rescue team immediately set

off to the sea along with all required tagging

instruments and reached the fishing vessel with

the captured whale shark around 10.25 am.

On reaching the rescue spot, the health of the

whale shark was assessed, after which the tag

deployment process was initiated (Plate 22).

Plate 22. Second satellite tagging

62

After examining the condition of the whale

shark the team deployed a SPOT Tag bearing

the following details (Plate 23).

• SPOT Tag Argos PTT number: 102680 or

0A7A298B

• Tagging Location: Latitude - 20°46'40.30"N

Longitude - 70°32'13.50"E

7.3.8. Tag transmission from second tag

On 1st January 2014, the first signal was received

through the ARGOS satellite tag monitoring

system. After the first set of transmissions

were received for seven days, the transmission

stopped (Plate 24).

7.3.9. Tagged whale shark movement

The first signal was received on 28th December

2013 from the tagged whale shark, but the quality

of the signals was poor and we were unable to

plot the location. The second signal was received

on 1st January 2014 from the tagged whale

shark. The quality of the signal was good and

the location was plotted. The whale shark had

travelled around 208 nautical miles from the

tagged location.The third signal was received on

3rd January 2014 from the tagged whale shark.

The total distance the whale shark travelled from

the tagged location was around 287 nautical

miles.

Based on the transmission from the tag it was

deduced that the tagged whale shark has gone

in to depths ranging from 24 - 3800 m during

the seven days. It is believed that the satellite

tag may have stopped signalling due to high

pressure during a deep dive of the whale shark.

Plate 23: Second whale shark satellite tagged location

Plate 24. Tagged whale shark movement between 28 December, 2013 to 7 January, 2014 – had

travelled 287 NM from tagged location

63

The first successful satellite

tagging of whale shark in

India has paved the way for

understanding the tagging

process and monitoring whale

shark movements in Indian

waters

7.4. Discussion

The first successful satellite tagging of

whale sharks in India has paved the way

for understanding the tagging process and

monitoring whale shark movement in Indian

waters. Interesting movement patterns were

shown by the tagged individuals, restricted to the

west coast of India. One is that it moved closer

to the shore, especially during its longer stay

of 41 days in the Gulf of Khambhat. There is a

need to understand the water conditions around

the movement locations during the particular

periods.

To understand the sudden move southwards after

the release and then the gradual migration back,

along with some interesting movement towards

PFZ and increased amount of time spent in Gulf

of Khambhat, habitat-related studies are required

in these areas. The failure of tag transmission

after 41 days is another issue that needs to be

studied as it could be because of the failure of

tag’s wet and dry sensor, or some other technical

reason. This may require some modification on

the tag to avoid such short survival of the tag in

future.

In the future actitivies of the project, eight

satellite tags procured with support from the

Gujarat Forest Department will be used to

monitor whale shark movements along the

Gujarat coast, of which two have been deployed

already.

64

CHAPTER 8

Genetic study of whale sharks in Gujarat

Preliminary

analysis

of the five

mitochondrial

control region

sequences

has yielded

interesting data

and contributed

new haplotypes

not yet found in

whale sharks.

The data support

previous findings

of high genetic

diversity in

whale shark

populations

Quantification of inter-specific and intra-specific sequence

variations within the mitochondrial (mtDNA) genome is a

powerful tool for examining the population genetic structure,

gene flow and migratory movements within and among different

populations of fish and sharks (Heist et al. 1996; Rosel and Block,

1996; Haig, 1998). It is important to select a locus or loci with a

relatively high mutation rate to detect sufficient polymorphism

for population-level studies (Heist et al. 1996). Various studies

have shown that the rate of mutation is greater in mtDNA than

in coding regions of nuclear DNA (Heist et al. 1996; Parker et

al. 1998). The mtDNA genome also includes a small non-coding

region known as the control region or displacement loop (D-loop),

which serves as the origin of replication for the mitochondrial

genome, and is usually more variable than other coding genes

(Parker et al. 1998; Avise, 1994). As maternal inheritance and in a

haploid condition, mitochondrial genes have an effective size that

is one-fourth that of nuclear genes, Nf = 1/4Ne (Randi, 2000), and

therefore, mtDNA variability is sensitive to random drift in small

populations and an ideal marker for assessing genetic structure of

recently-diverged or closely related populations or species (Avise,

1994; Randi, 2000).

Sequencing of the mitochondrial control region has been suggested

as a useful tool to evaluate genetic structure in sharks (Heist et

al. 1996; Keeney et al. 2003). Pardini et al. (2001) analysed the

control region in white shark Carcharodon carcharias, which

revealed significant differences between Australian/New Zealand

and South African populations. Keeney et al. (2003) analysed the

entire control region sequence of black tip shark Carcharhinus

limbatus and detected significant partitioning of haplotypes

between Gulf and Atlantic nurseries.

The use of microsatellites as a tool to understand the population

genetics of a species has revolutionised the field of conservation

biology. These repetitive sequences undergo mutations that add or

subtract repeat units, and they are, therefore, highly polymorphic.

They provide excellent resolution for assessing intra-specific

genetic variability and differentiation. Here scientists employ

microsatellite analysis to evaluate levels of genetic variability across

65

a global panel of whale sharks, and to determine

whether sharks from different regions comprise

geographically restricted breeding populations.

The first identification and analysis of whale

shark microsatellites demonstrated moderate

levels of genetic diversity within the species

as a whole, but little evidence for population

structure between different geographic regions

(Schmidt et al. 2009).

8.1. Objective of the project

Whale sharks tissue biopsies were collected for

DNA extraction, and then the DNA analysed using

mitochondrial and nuclear genetic markers.

This component of the project was carried out

in collaboration with Central Marine Fisheries

Research Institute, CMFRI, Cochin (Table 18).

8.2. Genetic sample collection

A small piece of tissue is scraped out using a

sharp object. The whale shark tissue samples

(Plate 25) collected from rescued animals is

preserved in alcohol and processed later in

the lab using DMSO tissue buffer. The DNA is

extracted and the extracted DNA is compared

to the genomic sequences available in the

genomic library of whale sharks. Tissue biopsies

were collected from 12 whale sharks, when the

entangled animals were being freed from fishing

nets.

Table 18. Details of whale shark tissue sample submitted for DNA analysis

Sl. No DateWhale shark tissue sample

No. of Sample Sex Length (feet)

1 25/09/10 1 Female 15

2 20/10/10 1 Female 12.4

3 30/11/10 1 Male 23

4 13/12/10 1 Male 13

5 14/12/10 1 Female 28

6 13/01/11 1 Female 8

7 05/03/11 1 Female 19.6

Plate 25. Whale shark tissue sample in sterile vial for genetic analysis

66

8 09/03/11 1 Unidentified 20

9 13/03/11 1 Male 21.3

10 10/10/11 1 Male 20

11 13/01/12 1 Female 10

12 16/5/13 1 Female 20

DNA from five of these samples has so far been

subjected to mitochondrial DNA sequence

analysis, by amplifying a characteristic portion

of the mitochondrial control region. So far five

samples were analysed and seven more samples

is under process. Microsatellite analysis of all

samples is planned for the future and will serve to

extend the population genetic analysis initiated

through control region sequencing.

8.3. Results and disscussion

Tissue samples of whale shark preserved in

alcohol sent to CMFRI were used for analysis

8.3.1. DNA extraction and PCR

DNA was extracted from the tissue preserved

in ethanol using standard phenol/chloroform

protocol followed by ethanol precipitation

(Sambrook et al. 1989). PCR amplifications

were carried out using the primers WSCR1F

(5'-TTGGCTCCCAAAGCCAAGATTCTTC-3') and

(5'-GCATGTataATTTTGGTTACAA-3') WSCR1R

following the instruction given by Dr. Jennifer V.

Schmidt.

8.3.2. Cloning and Analysis

The amplified PCR products (~1400 bp) were

purified and ligated into pJET 1.2/blunt cloning

vector, and cloned using CloneJETTM PCR

Cloning Kit (Fermentas Life Sciences, EU)

according to manufacturer’s instruction.

Sequencing was performed using pJET 1.2

forward and pJET 1.2 reverse sequencing primers

(vector primers) and the contigs were assembled

using BioEdit sequence alignment editor version

7.0.5.2 (Hall, 1999).

BLAST analysis showed 98-100% identity

with different haplotypes of whale shark

mitochondrial DNA control region reported by

Castro et al. (2007), The whale shark Rhincodon

typus (Smith 1828).

Rty-2 (1397 bp) showed 100% similarity with

haplotype 14 (Northwest Pacific) and haplotype

20 (western Indian) with a query coverage of

88%.

Rty-3 (1404 bp) showed 98-99% similarity with

most of the haplotypes with a query coverage

of 88% and showed 100% similarity with a

few haplotypes (including Indian) with query

coverage of 47—48% (Appendix IV).

Preliminary analysis of the five mitochondrial

control region sequences has yielded interesting

data, and contributed new haplotypes not

yet found in whale sharks. The data support

previous findings of high genetic diversity in

whale shark populations. There are currently

seven more samples available for analysis. To

draw conclusions on population levels of Gujarat

whale sharks, more genetic samples are required.

Table 19. Details of whale shark subjected to DNA analysis

Sl. No. Sample ID Date of collection Sex Sampling location Other details

1 Rty-02 25/09/2010 F Veraval (Adri) --

2 Rty-03 20/10/2010 F Veraval Length - 3.8 m

67

CHAPTER 9

New records of neonatal (pup) whale sharks

from the Gujarat coast

The discovery

and reporting

of four neonatal

(pups) whale

sharks confirms

that the Gujarat

coast is indeed a

breeding area of

the aggregating

whale sharks

Globally, a number of areas are now known to have seasonal

populations of whale sharks and most of the populations comprise

sharks from 3 to 12 m in size. These include studies from the

Sulu Sea, Asia (Eckert et al. 2002), Ningaloo in Western Australia

(Taylor (1989), Taylor (1994), Meekan et al. (2006), South Africa

(Beckley et al. (1997), Belize (Heyman et al. 2001), Sea of Cortez

(Eckert and Stewart 2001), La Paz, Mexico (Clarke and Nelson

1997), the Gulf of Mexico (Hoffmayer et al. 2005; Hueter et al.

2005) and from the Indian Ocean (Anderson and Ahmed, (1993),

Rowat, (1997), Pravin (2000), Hanfee (2001). While the number of

occurrence records of whale shark has increased there is, however,

concern that these populations are decreasing in size as noted

from areas with targeted fisheries (Pravin 2000; Hanfee 2001) and

more recently from areas where there have never been targeted

fisheries (Meekan et al. 2006; Bradshaw et al. 2007). Despite an

increase in the known areas of occurrences, few records exist of

neonatal whale sharks or juveniles less than 3 m in length. This is

of particular concern in the development of national and regional

conservation initiatives, as potential pupping and nursery areas

may unknowingly be impacted by anthropogenic activities. The

paucity of such information makes the reporting of any such

sightings extremely valuable.

9.1. Discovery of neonatal whale sharks across the world

The first discovery of a live and almost fully developed embryonic

whale shark was from an egg case trawled from a depth of 57 m

in the Gulf of Mexico (Breuer 1954; Baughman 1955). This 35-cm

total length (TL) embryo was found to have absorbed a large mass

of yolk into the abdomen thought sufficient to support the young

shark for some time (Reid 1957; Garrick 1964). Wolfson described

a further seven juvenile whale shark specimens ranging in size

from 55 to 93 cm TL (Wolfson 1983), all caught in pelagic purse

seine fishery operations. Three were found in the Atlantic and four

in the Pacific oceans where the sea bed ranges from 2600 m to

4750 m. Three of the specimens, ranging from 55 to 63 cm TL had

a faint vitelline scar marking the attachment of the yolk-sac that

disappears within a few months of birth in other elasmobranchs

(D’Aubrey 1964).

68

Wolfson also remarked that while her description

of the seven juvenile sharks helped provide

information on the size at birth, there were

no records of sharks between 1 and 4 m TL

(Wolfson 1983). The capture in 1995 of a gravid

female shark off Taiwan coast (Joung et al.

1996) confirmed that the species is ovoviparous,

retaining the lecithotrophic young within the

uteri, allowing further development. Of the three

size classes of prenatal sharks recorded, the

largest (58 to 64 cm TL) was a free-swimming

pup which was without a yolk-sac but which

did exhibit a vitelline scar; so the authors

suggested that these prenates were ready to

be birthed. There are a few other reports of

very young whale sharks: one was a 61 cm TL

specimen found alive in the stomach of a blue

marlin, Makaira mazara, off Mauritius in 1993

(D. Goorah, personal communication and cited

in Colman 1997). Two others were reported from

the tropical Atlantic (Kukuyev 1995), one trawled

from water deeper than 2000 m and the other in

the stomach of a blue shark, Prionace glauca.

Taylor 1994 reported from Ningaloo, Western

Australia, sighting of 14 young whale sharks.

In Bangladesh, the Marine Life Alliance, Comilla,

was informed of the capture of an unusually

small whale shark in March 2006. The specimen

was seen at the local fish market at the town of

Cox’s Bazar, but by the time researchers arrived,

the specimen had been sold. Interviews with the

fishers revealed that the pup had been caught

during a fishing expedition from 15–17 March

2006, in a set bag-net 140 km offshore of the town

of Cox’s Bazar. The specimen was already dead

when the net was recovered and was measured

at 1.13 m TL. The area where the net was set was

in shallow waters of 10 to 20 m depth but was

close to the 30- m contour where the sea bed

falls steeply to depths of over 100 m.

In the south western Indian Ocean, the Marine

Conservation Society, Seychelles, has recorded

three sightings of less-than3- m whale sharks off

Seychelles. The first was c.a. 1.5 m in September

1998, off of N.E. Mahe (Rowat, 1998); a second

pup of 1.8 m was recorded by aerial survey off

S.W. Mahe in October 2005, the length being

confirmed by reference to an object measured

shortly afterwards; and the third sighting of a

less-than-2-m pup was in May 2007, off of Isle

Farquar (Henn, 2007).

Table 20. Historical record of whale shark pup or juvenile (< 3 m) and past sightings published

across the globe

Location of

Whale Shark

sighting

information

Total Length

of the

Embryo/

Pup/

Juvenile

Year of

Sighting

Details of the information Source of

information

Gulf of Mexico 35 cm Not

Mentioned

Fully developed embryonic

whale shark in landing

center

Reid 1957;

Garrick 1964

Atlantic and

Pacific Ocean

55 to 93 cm 1983 Seven, juvenile whale shark

caught in pelagic purse

seine fishery operations.

Wolfson 1983

Taiwan 58 to 64 cm 1995 First pregnant female whale

shark, 10.6 m TL female

caught in Taiwan carried

304 embryos in the uteri

Joung et al. 1996,

Chang et al. 1997,

Leu et al. 1997

Mauritius 61 cm 1993 Young whale shark found

alive in the stomach of a blue

marlin, Makaira mazara

Colman 1997

69

Ningaloo,

Western Australia

1 m 1994 14 young whale sharks

freely swimming along

Ningaloo Sea

Taylor 1994

B a l o c h i s t a n ,

Pakistan

58.6 cm 2000 Fishermen observed the two

whale shark pup in their gill

net, the pup was preserved

in formalin by the Fisheries

Department, Omara

Rowat et al. 2008

North East Mahe,

Seychelles

1.5 m 1998 Personal observation by

Rowat

Rowat et al. 2008

South West Mahe,

Seychelles

1.8 m 2005 Pup was recorded by

aerial survey off of S.W.

Mahe, the length being

confirmed by reference to

an object measured shortly

afterwards.

Rowat et al. 2008

North West Mahe,

Seychelles

2.5 m 2006 Anecdotal record of a pup

of c.a. 2.5 m was reported

from a diving trip off of N.W.

Mahe.

Rowat et al. 2008

Isle Farquar,

Seychelles

< 2 m 2007 Personal observation by

Henn (one of the author)

Rowat et al. 2008

Comilla,

Bangladesh

1.13 m 2006 Whale Shark pup had been

seen at the local fish market

at the town of Cox’s Bazar

but by the time researchers

arrived, the specimen had

been sold. Interviews with

the fishers revealed that this

pup had been caught in a

set bag-net 140 km offshore

of the town of Cox’s Bazar.

Rowat et al. 2008

Donsol,

Philippines

46 cm 2009 Smallest whale shark ever

recorded had been caught

on in nearby San Antonio,

a barangay of Pilar town,

adjacent to Donsol. WWF

- Philippines researcher

rushed and rescued the pup.

Aca and Schmidt

2011

9.2. Discovery of neonate whale sharks across the Indian coast, Arabian sea and Bay of Bengal

As noted above, of live-born whale sharks, only

nine post-natal and no neonatal sharks have

been reported previously. The large number of

adult whale shark aggregations known from

the Indian Ocean (Taylor (1989), Anderson

and Ahmed (1993), Taylor (1994), Beckley et

al. (1997), Hanfee (1997) Rowat (1997), Pravin

(2000), Meekan et al. (2006) would suggest that

there should be a population of neonatal sharks

somewhere in this region.

70

Table 21. Historical record of whale shark pup or juvenile (< 3 m) and past sightings published

in the Arabian Sea and Bay of Bengal off Indian coast

Location of whale

shark sighting

informationn (India)

Total

length of

embryo/

pup/

juvenile

Year of

sighting


information

West Coast ( Arabian Sea)

Kaup, Karnataka 2.5 m 1981 Juvenile whale shark observed

in landing center

Pai et al.

1983

Vizhinjam, Kerala 1 m 1996 16 juveniles of about 1 m were

reported to be swimming with

a whale shark of 5.5 m off

Vizhinjam

Krishna-

Pillai 1998

Calicut, Kerala 94 cm 2001 Fishermen reported a young

whale shark with yolk sac

found swimming away 5 km

from the Calicut shores.

Manoj

Kumar 2003

Thiruvananthapuram,

Kerala

95 cm 2002 Pup whale shark was caught

in a net and given to the

Central Marine Fisheries

Research Institute (CMFRI) at

Thiruvananthapuram, where it

survived in their aquarium for

only a day.

Rowat et al.

2008

Vizhinjam, Kerala 97.5 cm 2002 Juvenile whale shark was alive

and kept in an aquarium at

CMFRI in Vizhinjam for 13 h

after being landed at Vizhinjam

landing site.

Gopakumar

et al. 2003

Kochi, Kerala 115 cm 2008 Small juvenile whale sharks

observed during landing sites

surveys

Akhilesh et

al. 2012

Both India and Bangladesh indicated that

January to March were peak months of whale

shark occurrence (Rowat 2007). The Indian

whale shark fishery, which closed in 2001, had

been particularly active from March to May off the

northwest coast of Gujarat (Pravin 2000; Hanfee

2001), confirming the presence of high numbers

of whale sharks throughout the northern Indian

Ocean during this season. A search of public

reports revealed that a pup had been caught in

India off of the south-west coast of Vizhinjam,

Kerala (MFIS, CMFRI 2002). The 95-cm-pup was

caught in a net in December 2002 and given to

the Central Marine Fisheries Research Institute

(CMFRI) at Thiruvananthapuram, where it

survived in their aquarium for only a day. In

1998, 16 juveniles of about 1 m were reported to

be swimming with an adult whale shark of 5.5 m

off Vizhinjam, India (Krishna- Pillai, 1998).

The smallest recorded whale shark previously

recorded in India has been a 3.15-m specimen

caught off of the south-east coast of Mandapam

(Nammalvar 1986 cited in Pravin 2000).

71



surveys

Akhilesh et

al. 2012



surveys

Akhilesh et

al. 2012



surveys

Akhilesh et

al. 2012



surveys

Akhilesh et

al. 2012



surveys

Akhilesh et

al. 2012

East Coast (Bay of Bengal)

South East Coast of

Mandapam, Tamil

Nadu

3.15 m Not

Mentioned

The smallest individual whale

shark recorded between 1990

and 1998 by Pravin (2000)

Akhilesh et

al. 2012

Tuticorin, Tamil Nadu 119 cm 2007 Small juvenile whale sharks


surveys

Akhilesh et

al. 2012

9.3. Whale shark pup recorded along the

Gujarat coast

In March 2013, the WTI research team received

the first cogent evidence of whale shark pups

being found along the Gujarat coast. A young

pup was caught in the net of a local fisherman –

Mohan Beem Solanki – in Sutrapada. Following

years-long tradition of the fishing community of

Gujarat, through the internationally-acclaimed

whale shark campaign, Solanki set the whale

shark free. When he reported the incident to

us, Solanki was unaware of the flutter created

by this serendipitous discovery (Plate 26). He

had unveiled a treasure-trove, and the fishing

community held the key.

Even as our research lead by a sociologist went

about asking the fishing communities whether

they had seen or – hopefully – photographed

a whale shark pup with the cameras provided

Plate 26. Whale shark pup recorded at the Saurashtra coast of Gujarat in the year 2013

72

to them to facilitate self-documentation during

rescues, the fishermen themselves started

approaching WTI with information on the pup.

Within a month, WTI had reports of four pups

spotted off Gujarat coastline (Table 22).

These are significant finds for the project. All

caught pups seemed to be between 1 and 3

months old – the size of an arm – indicating that

the fish may be breeding, and definitely pupping

off the Gujarat coast.

Neonatal whale sharks are thought to have

limited swimming abilities compared to juveniles

and adults (Martin 2007). Neonatal whale

sharks have an elongated body with a strongly

heterocercal caudal fin (Garrick 1964; Wolfson

1983; Kukuyev 1995), very similar to neonatal

tiger sharks, Galeocerdo cuvier, which have

an inefficient anguilliform swimming stroke

(Branstetter et al. 1987). The new records of pups

in the Saurashtra Coast, Gujarat, indicate that

the region is not just a whale shark aggregating

site, but also an important pupping ground.

Identification and recording of whale shark pups

may well be the key to the conservation of this

species on a regional and global scale (Rowat,

2007). Encouraged by the important findings,

the project has launched a reply-paid postcard

questionnaire survey along the entire west coast

of India, in which the photograph of a whale

shark pup is on the postcard is retained by the

fishermen, and information about when and/or

where the informer has seen one is printed on

the reply-paid card. In this way, the project hopes

to collect further information of whale shark

pupping locations along India’s west coast.

Table 22. Whale shark pup and juvenile reported during the project

Location of whale

shark sightings

Total length of

the embryo/

pup/ juvenile

Year of

sighting


information

Sutrapada,

Gujarat

< 60 cm 2013 A young pup was caught in the

gill net of a local fisherman in

Sutrapada. The Pup caught and

released immediately into the

sea. (Fig. 1a, 1b)

Fisher folk

Sutrapada,

Gujarat

< 60 cm 2013 A young pup was caught in the

nylon gill net of a local fisherman

in Sutrapada. The Pup caught

and released immediately into

the sea. (Fig. 2a to 2d)

Fisher folk

Sutrapada,

Gujarat

< 60 cm 2013 A young pup was shored in

the Sutrapada beach. The local

fishermen taken picture of the

pup and buried near the beach.

(Fig. 3a, 3b)

Fisher folk

Sutrapada,

Gujarat

< 100 cm 2013 Fishermen reported a young

whale shark found swimming

away 20 km from the Sutrapada

beach.

Fisher folk

73

CHAPTER 10

Education, Awareness, Communication

and Outreach

Whale Shark

Day and Melas

are being

observed in

Gujarat, as part

of a statewide

awareness

campaign

to save and

conserve the

whale shark

Although the project focused on whale shark science since 2008,

the awarness campaign continued on a smaller scale throughout

the duration of the project. A ‘Whale Shark Day’, continues to

be celebrated with great enthusiasm by the fishing community,

school children and authorities from the Forest Department, Coast

Guard, Navy etc every year. During the project period eight cities

(Porbandar, Diu, Dwarka, Okha, Ahmedabad, Veraval, Dwarka and

Mangrol) adopted the whale shark as its mascot. (Dwarka adopted

it twice).

Other than that, awareness activities were held occasionally

among the local communities and educational institutions such

as schools and colleges.

Awareness activities were also held to appraise fishermen about

the things they should do to reduce the stress on whale sharks

during rescues, as part of promoting the self-documentation

scheme.

10.1. Whale Shark Day and Whale Shark Mela

Although 30 August is celebtrated as the World Whale Shark day,

in Gujarat taking the Hindu calender in to consideration and to

conduct the whale shark day in multiple coastal towns and cities

different dates have been used as 'Local Whale Shark Day". On

February 17, 2007, the state forest minister declared the ‘Whale

Shark Day’, for Gujarat designating Kartik Amas as the annual

date. This marked a significant milestone in the campaign, making

whale shark the first animal in India with a day designated in its

honour.

During this period, five Whale Shark Days and Melas were

coordinated by the project in Porbandar, Dwarka, Mangrol,

Sutrapada and Veraval.

Thousands of stakeholders including fishermen, school and

college students, and government authorities participated in the

events. The events saw talks and speeches by experts as well as

74

street plays on the plight of the fish. Fun activities

were also organised for the children and other

stakeholders (Plate No. 27, 28, 29 and 30).

10.1.1. Whale Shark Day – Porbandar,

November 27, 2008

The event took place at the Chowpatti cricket

ground in Porbandar. In addition to the local

stakeholders, the event saw participation of

international marine experts (Scientific Advisory

Council members) and a filming crew from

Australia.

‘Whale Shark Day 2008 or ‘Vhali Utsav’ began

with a colourful procession, in support of ‘Vhali’-

the dear one, as the fish is locally known. Led

by the campaign’s flagship life-size inflatable

whale shark mounted on a camel cart, about

1000 students dressed in symbolic whale shark

coloured T-shirts, and holding whale shark

campaign flags, rallied across Porbandar from

Kirti Nagar to Chowpatti cricket ground. At the

venue, whale shark coloured balloons brightened

up the celebrations in honour of the species.

Talks and street plays ensued.

10.1.2. Whale Shark Day – Dwarka, November

27, 2009

The event was held at the Sunset Point ground

for the celebration. The event was chaired by

Hon’ble Minister of State for Environment

and Forests, Shri Kiritsinh Rana. Indian and

international marine experts, government

officials and conservationists participated in the

event, along with hundreds of school students.

The celebrations began with a colourful rally by

school children donning the campaign T-shirts

and sun visors, waving whale shark flags, and

chanting slogans for whale shark. The rally was

led by the inflatable. It also witnessed talks and

street play on the fish.

Plate 27: Students create a whale shark at the

sand art competition, Sutrapada, 2011

Plate 28: School children involved in kite flying

in the Whale Shark Mela, Sutrapada, 2011

75

Plate 30: Children of the fishing community at the Mela

Plate 29: Members of the Forest Department, Navy, TCL, WTI and

the fishing community took part in the rally

76

Plate 33: Street play at Jaleshwar, near Veraval.

Plate 31: Students from Choksei College and Fisheries College, along with some volunteers from

private banks helping to make a street play enacting whale shark stress under current rescue

practices.

Plate 32: Students doing their first show at Sutrapada, which was applauded by all. Support form

Forest Department and fishing community helped start this drive. Cameras were also distributed

for doing self-documentation.

77

Plate 34: Awareness campaign in coastal villages for awareness

10.1.3. Whale Shark Day – Mangrol, January

25 2011

After several delays due to unavoidable

circumstances, the whale shark day 2010 was

organised on January 25, 2011 in Mangrol.

The whale shark day in Mangrol saw the town

adopting the fish as its mascot, making Mangrol

the seventh in the state to do so.

The celebrations were kicked off with a rally

by hundreds of children, following the 40- foot

long whale shark inflatable from Parmeshwar

Vidyalaya to the event venue at the Town

Jetty, Mangrol. The event was chaired by SK

Chaturvedi, Chief Conservator of Forests and

was attended by the local member of legislative

assembly (MLA) Rajgi Bhai Jatwa along with

representatives from WTI and TCL.

10.1.4. Whale Shark Day and Mela – Sutrapada,

November 25, 2011

With a number of distinguished guests, including

the local MLA of Mangrol, Bhagwanbhai Kargatia;

Rajsinh, MLA Somnath; Govindbhai Parmar, ex

MLA of Mangrol; Jethabhai Fulbaria, sarpanch,

Sutrapada bunder, and TCL Deputy General

Manager Paresh Tank; the Whale Shark Day

was organized at the Navdurga temple grounds.

Over 250 school children from Vivekanand Vinay

Mandir and Manas Vidyalaya took part in the

event.

A number of fun games on the whale shark

theme, including snakes and ladders, and jig

saw puzzles, were organised for the children. A

signature campaign in which the children drew

the outline of their hand and left a message on

the screen was also organised.

A short ceremony by the forest department

was held where its officials, local NGOs, and

other groups shared their views on whale shark

conservation. It was followed by a play by girls

from the Navodaya school.

Fishermen who rescued whale sharks were given

appreciation certificates and cheques for their

participation in whale shark conservation, and

monetary relief for their net loss.

10.1.5. Whale Shark Day and Mela – Veraval,

December 17, 2012

Whale shark day celebration was held at Chokshi

College, Veraval, on December 17, 2012, which

were organised by the Veraval Forest Department.

The event saw participation from local schools

and colleges, NGOs and volunteers. The whale

shark film was screened during the session and

a street play based on the self-documentation

scheme street play was performed by volunteers.

78

10.1.6. Whale Shark Day and Mela – Dwarka,

March 6-7, 2013

On March 6, 2013, the annual whale shark mela

kicked off in Dwarka, with a cycle rally. Over

30 cyclists from the Rupen fishing community,

Tata Chemicals Limited (TCL), Gujarat Forest

Department, the Navy, college volunteers, and

WTI started off from ISKCON gate. The rally

went around the town through the main markets

as well as residential areas, crossing the Dwarka

temple, and moving 4-5 km to reach the cricket

ground, where a cricket tournament was held.

The cricket tournament had six teams

participating – two from the fishing community,

and one each from TCL, the forest department,

Navy and Saradapith College. A fishing

community team won the tournament, and the

team from the Navy was the runner-up.

Day 2 of the mela saw various activities involving

local school children including kite- flying,

rangoli, tug-of-war, etc. Interaction with the

children indicated a good awareness about the

fish and its status.

10.2. Self-documentation scheme campaign

To reduce the stress on the whale shark during

rescues, the project suggested and ensured

changes in the rescue protocol. This mandated

self-documentation by the fishermen to reduce

time taken for rescues. A rapid action project

was implemented to provide water-proof

cameras to over 1000 fishermen to facilitate the

implementation of the updated protocol.

The project carried out awareness campaigns to

spread the information on the new development,

as well as to make the local fishermen aware of the

self-documentation scheme and methodology.

Numerous meetings and awareness activities

were held with the communities on the issue.

The project deployed local volunteers (college

students as well as corporate workers) to spread

the word. A street play was devised along with

the volunteers for o the fishing communities,

along with talks (Plate 31, 32, 33 and 34).

Trainings were also held for the local fishermen

on the use of the cameras. These focused on

making the fishermen aware of the use of the

camera, and the kind of photographs needed to

claim a refund for their nets damaged during

whale shark rescues. A training of trainers was

organised in the various fishing villages, with

around 15 fishermen participating in each to

become ambassadors for the new scheme.

A series of interactive sessions with various

schools, colleges and fishermen societies were

conducted during the project period in Jaleshwar.

In these sessions, the target audience was

introduced to the importance of whale sharof

whale sharks and their conservation, using power

point presentations and active discussions. The

school and college students were also urged to

be volunteers in the whale shark conservation

project, which led to their active participation

during whale shark campaigns, with a few

helping with whale shark science.

79

CHAPTER 11

Future plans for whale shark conservation

project

A conservation effort leading to the species emerging as one of the flagship species will seal a safe future for the whale sharks not just in Gujarat, but in the whole marine environment of India

The Wildlife Trust of India has been working on the whale shark

now for over a decade. This decade saw very effective lobbying

and a successful campaign that catapaulted this gentle giant

into wildlife conservation agendas both internationally (CITES)

and nationally. Such was the campaign that within a year of

its initiation, the hunters of this fish (the fishermen) turned

conservationists when they cut their nets through to let a captured

whale shark go free. This got institutionalised further when the

Gujarat Forest Department stepped in and offered compensation

for the loss of net in case a fisherman cut his net to set free a

trapped whale shark. Tata Chemicals Ltd was recognised for their

role in this initiative with the BNHS Green Governance Award

by the then prime minister Dr Manmohan Singh. A state-wide

'Whale Shark Day' on ‘Karthik Amas’ was declared by the forest

minister Mangubhai Patel on February 17, 2007, making it the

first animal with a day in its honour in the state. The Kharva

fishing community of the coastal city 'Veraval' also showed their

commitment to whale shark conservation by making the life size

whale shark inflatable a part of their most important celebration.

Eight cities and towns in Gujarat, including a non-coastal city,

adopted the fish as their mascot.

WTI also initiated scientific work on the species to find out hotspots

of whale shark aggregations within Gujarat waters and figure out

population estimates using various contemporary techniques.

Marine research in India is still in its infancy and despite the

presence of a very august scientific advisory committee, it has

taken the team time to find its feet. Information obtained over the

last four years has been important and it is time to build on this

and the progress is expected to be much more rapid now. One

important and landmark piece of research concerned the stress the

whale shark suffered from post capture upto its release. Through

the initiative of the government of Gujarat, a self documentation

scheme has now been introduced where a fisherman does not have

to wait for the forest department to document before releasing a

whale shark. The fisherman can document the evidence himself

using either the camera provided for the purpose by WTI or his

mobile phone camera.

80

Thus in the future, WTI shall concentrate on

completing the scientific initiatives, take the

whale shark information network forward

and continue with the awareness activities.

Specifically the activities would include:

11.1. Spatial analysis using satellite imagery

Baseline information on the occurrence and

preferred zones of whale sharks is lacking along

the Gujarat coast. The information is important

to target conservation efforts and potential

tourism also. Ocean colour remote sensing

is an important tool for detecting regional to

global trends and patterns in ocean biology

and biogeochemistry. Scientists have made

important discoveries during the SeaWiFS/

MODIS , which have drastically transformed the

field. Monthly composites of parameters such

as sea surface temperature (SST), chlorophyll

and salinity are available from Sea-viewing

Wide Field-of-view Sensor (SeaWiFS) and the

National Oceanographic and Atmospheric

Administration-Advanced Very High Resolution

Radiometer (NOAA-AVHRR), which can be used

to find out the preferred zones of whale shark.

With the overlay of whale shark rescue location

data and oceanographic parameters, it is adviced

to identify variables that govern the distribution

of whale sharks along the Gujarat coast.

11.1.1 Migration studies

Satellite Tagging: A total of ten tags have been

provided by the Gujarat Forest Department,

of which two have been deployed so far. The

remaining eight shall be deployed on both

rescued and free moving whale sharks.

Marker Tag: Marker tags are defined as visible

tags applied externally on the fish. It follows

that the tag is easily detectable and no special

equipment is required for detection. These types

of tags may carry an individual code, a batch

code and/or visible instructions for reporting.

Examples of the tags include ribbons, threads,

wires, plates, disks, dangling tags and straps

(McFarlane et al. 1990). The use of external

tags are the oldest and the most widely used

technology for identifying individuals or groups

of fish. External tags have been used for both

scientific and assessment purposes.

The justification for any type of tag on a fish is the

future recovery or recapture and the resultant

information collected. The more advanced

external tags can carry extra information

on individual fish together with reporting

instructions, information on rewards etc. The best

known examples of external tags are probably

T-Bar Anchor Tags (Jones, 1979, Morgan &

Walsh, 1993) and Carlin tags (Carlin, 1955) and

various modifications of these. Several different

external tagging methods have been evaluated

by Bartel et al. (1987), Dunning et al. (1987),

Mattson et al. (1990), McAllister et al. (1992),

Nielsen (1988), Nakashima & Winters (1984),

Weathers et al. (1990) and Rasmussen (1980,

1982). These marker tags will be distributed to

fishermen who will be formally trained so that

they can tag the animals in case of any whale

shark encounters. Through this awareness

among fishermen, the chances of reporting in

cases of recapture will increase.

Archival/Pop-up tags: Additionally pop-up tags

will be purchased, which would give us a

greater benefit of storing up data (archive)

and transmitting it as a whole when a satellite

reception is available so that no data is lost.

Understanding the movement patterns of

large migratory fishes is important for their

conservation and management. To investigate

these patterns, satellite-linked radio transmitters

have been widely used on species that regularly

swim in surface waters. However, this technology

is less effective when studying species that may

remain submerged for long periods as radio

signals are rapidly attenuated in seawater, and

are also reflected downward at the sea surface.

Consequently, the signals either have limited

strength or never reach earth-orbiting satellites

unless the transmitter’s antenna is above the

surface of the sea. In recent years, new types of

tags have been developed that overcome some

of these constraints (Block et al. 1998). These

‘‘pop-up’’ archival tags store recorded data

81

until they detach from the fish and float to the

surface. They then transmit the information to

Argos satellites. The technology has permitted

researchers to examine the horizontal and

vertical movement patterns of a wide range of

fishes, such as tunas (e.g. Wilson et al. 2005),

billfishes (e.g. Takahashi et al. 2003), and sharks

(e.g. Sims et al. 2003).

11.1.2 Genetic studies

Genealogy: The use of microsatellites as a tool to

understand the population genetics of a species

has revolutionized the field of conservation

biology (Ellegren, 2004 and DeSalle and Amato,

2004). The repetitive sequences undergo

mutations that add or subtract repeat units, and

they are, therefore, highly polymorphic. They

provide excellent resolution for assessing intra-

specific genetic variability and differentiation.

Here we employ microsatellite analysis to

evaluate levels of genetic variability across a

global panel of whale sharks, and to determine

whether sharks from different regions comprise

geographically restricted breeding populations.

Thus more genetic samples shall be collected

and analysed from both rescued and free-ranging

whale sharks.

Bio-makers: In search for biomarkers for health

in whale sharks and exploration of metabolomics

as a modern tool for understanding animal

physiology, the metabolite composition of the

serum in whale sharks can explored using 1H

nuclear magnetic resonance (NMR) spectroscopy

and direct analysis in real time (DART) mass

spectrometry (MS). Metabolomics is the study of

the low-molecular-weight molecules in a biological

sample using bio-analytical and bioinformatics

tools (Viant, 2007). The approach has been

reinvigorated recently by new technologies,

allowing its application to understand metabolic

perturbations such as those occurring during

disease and exposure to toxicants (Viant, 2007,

Miller et al. 2007, Robertson 2005, Samuelsson

et al. 2006, Viant 2003). In metabolomic studies,

the progression of a disease can be observed as a

trajectory deviating away from a ‘‘normal’’ state

in principal component space (Hines et al. 2007).

Using NMR and MS metabolomic approaches,

we can seek to characterise variations in the

metabolism of healthy and unhealthy whale

sharks over a period of several months and,

thereby, identify biomarkers of health in this

elasmobranch species. The team can succeed in

distinguishing healthy and unhealthy animals

and in identifying several promising biomarker

compounds.

11.1.3 Feeding biology

The whale shark (Smith, 1828) is the world’s

largest fish as well as the largest filter feeding

fish, yet its feeding biology is still under studied.

Better understood, but still controversial, is the

diet of this circum global giant. Early scientists

recognised that, despite its size, it had a unique

filtering apparatus and subsisted on plankton

near the surface (Gill, 1905). Gudger (1941a)

noted that in addition to planktonic crustaceans,

Rhincodon had been conclusively demonstrated

to feed on squid and cuttle fish. He postulated that

an invertebrate diet is insufficient to maintain this

species, and summarised observations of whale

sharks purportedly ingesting schooling clupeids.

Since those early, and often anecdotal, studies,

numerous dietary analyses have been conducted

at whale shark aggregation sites. These analyses

based on stomach contents, faecal samples,

behavioural observations and plankton tows,

indicated that whale sharks primarily feed on a

variety of planktonic organisms. These include

euphausids, copepods, chaetognaths, crab larvae,

molluscs, siphonophores, salps, sergestids,

isopods, amphipods, stomatopods, coral spawn,

and fish eggs. In addition, they also feed on small

squid and fish (Silas and Rajagopalan, (1963),

Taylor, (1994, 1996, 2007), Clark and Nelson,

(1997), Taylor and Pearce, (1999), Heyman et al.

(2001), Wilson and New bound, (2001), Duffy,

(2002), Jarman and Wilson, (2004), Hacohen-

Domene et al. (2006); Hoffmayer et al. (2007);

Nelson and Eckert, (2007), Meekan et al. (2009).

To understand the feeding biology of the shark

in Indian waters, the following techniques are

proposed to be undertaken.

82

Collecting faecal sample from live animal:

Using Cannulation technique for collecting

faecal samples from entangled whale shark

(Fig. 5). The collection of faecal samples from

animals for individual identification and mark-

recapture purposes has been used in a number

of circumstances (Lukacs & Burnham 2005).

Collection of faecal samples has been used

successfully to identify prey species of whale

sharks (Jarman & Wilson 2004).

Collecting gut content sample from dead

animal: The study of the feeding habits of

fish and other animals based upon analysis

of stomach content has become a standard

practice (Hyslop 1980). Stomach content

analysis provides important insights into fish

feeding patterns and quantitative assessment of

food habits is an important aspect of fisheries

management. Lagler (1949) pointed out that

the gut contents only indicate what the fish

would feed on. Direct observation on the feeding

habits of a whale shark in its natural habitats

is virtually impossible and thus, to ascertain the

exact nature of a fish food, the best way is to

examine its gut contents.

11.1.4 Education, awareness and outreach

Administrative measures and scientific

knowledge, only when accepted and supported

by the society, can lead to greater success of

conservation measures.

Whale Shark Mela: A Whale shark mela will be

conducted to raise awareness in coastal schools.

A possible integration into the Coast Guard and

Naval day celebrations shall also be looked into.

Assistance in celebrating whale shark day for

GFD shall be continued.

Self-documentation scheme: After several

complaints that previous rescue methods were

biased, new rescue protocols were developed,

in which fishermen themselves photograph the

accidentally caught whale sharks and release

them without the need to wait for the authorities

to arrive. Then the photographs are produced

for net compensation, reducing the trapped time

and hence the stress to the caught animal. So

far, 1174 cameras have been distributed with an

additional requirement of 4000 cameras. More

improved models of water-proof cameras will be

distributed to local fishermen (Plate 35).

Rescue: Assistance in rescue of whale sharks in

case of accidental catch.

New strategies: A number of new strategies

will be adopted to increase awareness among

targeted groups:

Plate 35. Reusable waterproof film camera

83

Signboards: Placement of sign boards in

strategic areas (landing centres, fishing

village squares, markets) on whale sharks,

endangered status, rescue methods and

other endangered marine fauna.

Friends of whale shark initiative: On

trawlers/fishing boats which voluntarily

release whale sharks, brass plates with

the words ‘Friends of the Whale Shark’

will be fixed, , thus recognising them and

spreading awareness.

Marker tags: The fishermen will be trained

in marker tagging technique and will be

equipped with marker tags to be deployed

during whale shark encounters. A reward

scheme will be in place for fishermen who

successfully tag the whale sharks.

11.1.5 Whale shark information network

Wireless radio: An exclusive wireless canal for the

whale shark will be created and will be intimated

to all fishermen and Coast Guard personnel

(Plate 35). In case of whale shark sightings, the

fishermen or CG will be able to call the wireless

canal and provide information. If a team is at sea

survey when the information is received, they

will also be able to reach the spot and tag the

animal. A reward scheme will also be in place for

providing information with evidence.

Post cards: Self-addressed post cards with

whale shark photos and simple questions on its

whereabouts are given to fishermen. In case of

sighting a whale shark, the details will be entered

and posted, providing us with a sighting record.

The exercise will be done in all fish landing

centres (Plate 36).

Mobile campaign

A vehicle dedicated for the campaign will travel

all along the west coast, spreading awareness

on whale sharks. It will hold collaterals, video

projectors and the whale shark inflatable which

shall be used in targeted area for spreading

awareness.

11.2. Anticipated benefits and output

Ecological database on whale shark: Marine

habitat use, seasonal movement and migratory

patterns of whale sharks in west coast will be

established.

Origin traced: Genetic studies will trace the

genealogy of the whale sharks in the Indian

Plate 36. Setting up a whale shark information network

84

waters and compare with other whale shark

populations in the world, to end speculation

and hypothesis on the whale shark population

of India.

Migration mystery revealed : The reasons behind

the migration and habitat use of the whale shark

to Gujarat will be revealed.

Community involved conservation : Involving

the fishing communities for tagging will help

bring a sense of ownership of the conservation

programme, and also help identify the species as

an individual.

Ensure a safe future : A conservation effort

leading to the species emerging as one of the

flagship species will seal a safe future for the

whale sharks not just in Gujarat, but in the

whole country.

11.3. Monitoring and evaluation

The Project Investigator and researchers shall

review the progress of the project every month.

WTI also has a standardised reporting structure

followed by the field staff. Activities for the

various components of the project are listed as

targets for the staff. They are evaluated twice

a year to assess the performance of the staff,

which is also an indication of success of the

project. The Project Investigator and Officer visit

the areas of work on a regular basis. An annual

report will also be prepared. The field staff are in

touch with the concerned representative of TCL,

who also evaluate the success of the programme

Compilation and analyses of data is carried out

every six months. The findings of the project will

be submitted for publication in relevant peer-

reviewed journals. The publications can serve

as scientific and conservation evaluations of the

project.

85

APPENDIX I

Region-wise list of landing centres surveyed

during the whale shark historical occurrence

survey along the Gujarat coast

REGION LANDING CENTERS SURVEYED

Reg

ion

– I

1. Salaya

2. Sikka

3. Bedi

4. Tuna

5. Badreswar

6. Mundra

7. Mandvi

8. Jakau

Reg

ion

– I

I

9. Rupen

10. Okha

11. Muldwaraka

12. Damlej

13. Veraval

14. Jaleswar

15. Sutrapada

16. Hirakot

17. Phera

18. Mahuva

19. Vanakbara

20. Goghla

21. Jafrabad

22. Mangrol

23. Madhavpur

24. Porbander

Reg

ion

– I

II

25. Dahej

26. Nargol

27. Hajira

28. Umarsadi

29. Ojhal

30. Ubhrat

31. Dumas

86

APPENDIX II

87

March 2011

The whale shark (Rhincodon typus) is a

relatively recent addition to the human record

of the ocean and its inhabitants. However, the

ancestry of this shark goes back to the Jurassic

and Cretaceous periods 245-65 million years

ago, when the present groups of sharks began

to appear. It was not until 1828 when the first

whale shark specimen known to science was

discovered off the South African coast. Like

many other shark species, the whale shark has

innate biological characteristics, such as large

size, slow growth, late maturation and extended

longevity, which probably limit recruitment and

make it particularly susceptible to exploitation.

International conservation status of the species

is unclear - it is listed as having an 'Indeterminate'

status on the World Conservation Union's Red

List of Threatened Animals. This category

applies to animals known to be 'Endangered',

'Vulnerable' or 'Rare', but there is not enough

information available to say which of these three

categories is appropriate.

The accessibility of the seasonal aggregation

of whale sharks in the Veraval regions provide

an excellent opportunity for researchers to

undertake studies of this rarely encountered and

poorly understood shark. Initial research efforts

lacked clearly defined objectives and were often

hampered by limited scientific research of whale

shark biology and ecology. Some aspects of this

research should seek to provide information

to environmental management bodies in order

to minimize possible detrimental impacts. In

general, occurrences of whale sharks appear to

be sporadic and unpredictable, which is partly

a reflection of the lack of knowledge about the

animal's habitat and ecology.

In order to study the habitat and ecology of whale

shark in the Veraval region the present study

has been designed (Site selection and Sample

collection were carried out by WTI, Sample

analysis and data compilation were carried out

by Regional Center of CMFRI, Veraval). Three

experimental sites were selected based on the

information available on the whale shark citation.

The experimental sites include 1.Veraval- A

(0Km), B (5km), C (10Km), D (20Km), 2. Diu-

A (0Km), B (5km), C (10Km), D (20Km) and 3.

Mangrol- A (0Km), B (5km), C (10Km), D (20Km).

All the sampling stations were clearly plotted in

the map (Fig.1). All the water sampling, water

quality analyses were carried out according

to the standard sea water analyzing protocols

(Strickland & Parsons, 1968). The methods

used for the analysis of various parameters were

tabulated in Table-1. The parameters like Sea

surface temperature, Salinity, pH, Visibility, DO,

Gross and Net Primary Productivity, Ammonia,

Nitrate, Phosphate, Silicate, Chlorophyll

concentration, Photo and Zooplankton biomass

and diversity were recorded in Veraval for a

period of January-2010 to December-2010. The

same parameters were started to analyses in the

sites of Diu and Mangrol from October-2010 to

December-2010.

Result of the analysis is given in Table-2 to

Table-51 and Figure-4 to Figure-51. During the

sample collection hydrological parameters of

the selected sits were also recorded. Sea surface

water temperature in the selected study areas

were fluctuated with seasons and between

stations, it’s ranging form 20.50C to 31.0C. The

highest temperature during the study period was

recorded in Diu and the lowest was recorded in

Veraval (Table-2, 13, 24; Fig. 4, 15, 26). Sea water

pH in the study areas ranged from 7.11 to 8.65.

Except Madhavpur site the level of pH showed

a normal trend of fluctuations with very miner

changes in all the study areas. During the study

period the highest pH level of 8.3 was recorder

in Mangrol and lowest pH level was recorded in

Diu site during (Table-3, 14, 25; Fig. 5, 16, 27).

The salinity in the study areas were ranged from

33.6ppt to 36.3ppt. Fluctuation in salinity level

was noticed between stations to station. This

deviation from normal pattern can be attributed

to the de-linking of the water flow from the sea

and the absence of freshwater outflow during

the summer period (May, 2010). But this highest

deviation in salinity level in this region occurred

during October 2010 is due to the mixing of

huge volume of fresh water resulted during the

88

monsoon period. But this case was not occurred

in all other sampling location is due to the high

mixing rate of sea water with rainy water and

also the buffering activity of sea water.

Whale sharks appear to prefer locations with

surface water temperatures between 21 -25

degrees, where cool nutrient-rich upwelling

mingle with warm surface waters of salinities

between 34-34.5%. These conditions may well

be optimal for the production of the planktonic

and nektonic prey upon which the sharks feed.

The level of Dissolved Oxygen (DO) content during

the study period was ranging from 2.13ml/L

to 6.27ml/L. In DO level high fluctuation was

noticed in the area of Veraval when compare to

all other sites ((Table-5, 16, 27; Fig.7, 18, 29)).

The high amount of DO level recorded in this

site is may resulted due to the activities of Ship

breaking yard. In the present investigation

the Gross productivity level was ranged from

(Table-8, 19, 30; Fig.10, 21, 32) 0.01mg C/L/Hr

to 0.22mg C/L/Hr. The productivity level was

very low in all the selected study areas except

the control site. The Net productivity level was

ranged from 0.01 mg C/L/Hr to 0.22 mg C/L/

Hr (Table-8, 19, 30; Fig.10, 21, 32). The highest

Gross productivity level of 0.22 mg C/L/Hr was

recorded in the control site. This results show

that the site is fully free from pollution and

having enormous primary producers.

In concerned with the nutrient level, the amount

of ammonia was ranged from 0.000µg atom to

12.318µg atom. A high value of 12.318µg atom

was recorded in the area of Veraval (Table-9, 20,

31; Fig.11, 22, 33). The value was unusual, this

may be resulted by the anthropogenic activities

leading to discharge of industrial effluents,

fertilizers from agricultural farms and domestic

sewage causing increase in organic load in the

waters have a major influence on the levels of

ammonia in this water body. In the present study

period, nitrate levels were found to be higher in

the areas of Veraval site when compare to all

other sites (Table-11, 22, 33; Fig. 13, 24, 35). The

domestic sewage mixing in this region is the most

important source of nitrates. Phosphate level

was varying with 0.001µg atom to 0.217µg atom

(Table-10, 21, 32; Fig. 12, 23, 34). Phosphorus

particularly in the form of phosphates is an

important component of domestic and industrial

wastes and is cycled within the environment

through aquatic transport. Poor flushing and

increased accumulation of industrial, agricultural

and domestic wastes in this area results in an

imbalance in the relative nutrient levels.

Zooplankton samples were collected from

surface hauls by employing standard plankton

net. The plankton net is towed horizontally

from the boat for 10 minutes using three bridles

(suspension lines), which are tied to the ring at

equidistance from each other. While making the

collections the speed of the vessel is maintained

at 1 to 2 nautical miles per hour. After the 10

minutes haul, the net is taken out of water and is

washed from outside by jetting seawater to bring

down all the plankton into the collecting bucket.

After all the excess water is drained off from the

net and through the window of the collecting

bucket, the bucket is carefully removed from

the net and the plankton, along with the water

is poured into wide mouthed polythene bottle

of 500 ml capacity. The collected sample was

preserved in 5% formaldehyde solution. With

regard to phytoplankton, one litre of water from

each station is collected in wide mouthed 1000

ml capacity polythene bottle and preserved in 5%

formaldehyde solution.

The gross and net primary production rate, by the

light and dark bottle oxygen technique (Grarder

& Gran, 1927). The value of chlorophyll contents

of the water studied following the methods of

Strickland & Parsons (1968). For the studying

phytoplankton , one litre of the water sample

were collected from surface of stations studied.

The phytoplankton organisms were enumerated

by the settling method and qualitative and

quantitative evaluation of the flora. For the

quantitative estimation of zooplankton in the

samples, displacement method was used and

the zooplankton volume was determined. As it

is not possible to analyze the entire zooplankton

89

sample collected during a haul, sub sample of

the minimum 2 ml of zooplankton was used

for qualitative analysis of plankton groups. The

sub-sampled plankton was fully analyzed by

counting in a plankton counting chamber under

a microscope. The results of diversity and density

of Phytoplankton were provided in Table- 35 to

37 and 38 (a), (b), (c), and Fig. 37 to 39 .The

results of zooplankton Group vise density were

provided in the Table- 39 to 50 and Fig.40 to

51. Whale shark rescue data during the study

period of February-2010 to February -2011 was

provided in Table-51 (a) and (b).

The whale shark is reported as a filter feeder.

Although passive filter feeding has been

documented and was previously considered

characteristic behavior, recent studies now

indicate that whale sharks feed primarily at

night and at depth. It is under cover of darkness

that the deep scattering layer of planktonic and

nektonic prey moves up the water column in the

densest concentrations. For most of the year, at

least during the day, the amount of food taken

in during subsurface cruising is equivalent to

snacking, while the main meal comes after dark

in deeper water.

Comparison of various habitat parameters with

the Zooplankton and Phytoplankton biomass

and diversity will help in identification of high

productive zones with the seasonal Whale shark

catch location. Further deep assessment is

required to understand the seasonal changes in

the nutrient levels and it affect on the primary and

secondary productivity in particular attention on

the Whale shark arrival in the selected places

(Veraval, Diu and Mangrol). Further in-depth

study is very essential to predict the seasonal

shifts in the productive zones in relation with

the whale shark appearance.

Table 1. Methods of analysis of various parameters.

SL. NO. PARAMETER METHOD INSTRUMENT

1. Temperature - Thermometer

2. pH - pH meter

3. Salinity - Salinometer

4. Dissolved Oxygen Winkler’s -

5. Visibility - Secchi Disk

6. Nitrate Strickland & Parsons (1968) Spectrophotometer

7. Phosphate Strickland & Parsons (1968) Spectrophotometer

8. Ammonia Strickland & Parsons (1968) Spectrophotometer

9. Silicate Strickland & Parsons (1968) Spectrophotometer

10. Chlorophyll Strickland & Parsons (1968) Spectrophotometer

11. Primary productivity Gaarder & Gran, 1927 (Light & Dark

Bottle)

-

12. Phyto and Zooplankton

analyses

Standard phyto and zooplankton

sample collection and analysis

method

Hemocytometer,

Microscope

90

Fig. 1. Map showing the sampling and whale shark rescued locations.

91

A (0 Km) B (5Km) C (10Km) D (20Km)

Feb_2010 25.20 25.7 25.3 25.5

Mar_2010 26.6 25.60 25.90 25.70

Apr_2010 26.60 26.9 27.8 27.8

May_2010 27.20 28.4 28.6 29.1

Oct_2010 30.00 30.9 30.7 31.1

Dec_2010 24.10 24.9 25.1 25.6

Table- 2. Temperature (°C) flux in selected sites of Veraval during the Study period

January-2010 to December-2010.

Fig. 4. Temperature (°C) flux in selected sites of Veraval during the Study period


92

Fig. 5. pH flux in selected sites of Veraval during the Study period


A (0 Km) B (5Km) C (10Km) D (20Km)

Feb_2010 6.70 7.40 8.10 7.90

Mar_2010 6.7 6.60 6.70 6.60

Apr_2010 6.70 6.9 7.2 7.1

May_2010 7.60 6.9 7.6 7.3

Oct_2010 7.80 8.2 8.2 8.3

Dec_2010 8.00 8.3 8.3 8.4

Table-3. pH flux in selected sites of Veraval during the Study period


93

A (0 Km) B (5Km) C (10Km) D (20Km)

Feb_2010 35.30 35.8 35.6 35.4

Mar_2010 34.6 34.8 34.5 34.8

Apr_2010 34.60 35.2 37.1 36.6 error/see hard copy

May_2010 34.10 36.2 36.6 35.4 error/see hard copy

Oct_2010 34.40 34.2 35.2 35.2

Dec_2010 34.90 34.9 34.7 34.7

Table-4. Salinity (ppt) flux in selected sites of Veraval during the Study period


Fig. 6. Salinity (ppt) flux in selected sites of Veraval during the Study period


94

A (0 Km) B (5Km) C (10Km) D (20Km)

Feb_2010 2.430 5.31 6.33 6.39

Mar_2010 3.51 4.89 4.89 4.56

Apr_2010 3.510 4.64 5.26 4.81

May_2010 4.300 5.26 5.71 5.88

Oct_2010 6.440 7.18 7.35 7.46

Dec_2010 5.310 5.71 5.43 5.37

Table-5. Dissolved Oxygen (ml/L) flux in selected sites of Veraval during the Study period


Fig. 7. Dissolved Oxygen (ml/L) flux in selected sites of Veraval during the Study period


95

A (0 Km) B (5Km) C (10Km) D (20Km)

Feb_2010 0.186 0.0986 0.0863 0.0643

Mar_2010 0.2076 0.0512 0.0679 0.0339

Apr_2010 0.208 1.7068 0.2196 0.3124

May_2010 2.887 0.2686 2.2844 1.4196

Oct_2010 1.080 3.0164 1.1476 2.0058

Dec_2010 1.317 3.1592 4.5072 2.0082

Table-6. Chlorophyll (mg m-3) flux in selected sites of Veraval during the Study period


Fig. 8. Chlorophyll (mg m-3) flux in selected sites of Veraval during the Study period


96

A (0 Km) B (5Km) C (10Km) D (20Km)

Feb_2010 1.10 1.10 1.23 1.20

Mar_2010 1.40 1.15 1.22 1.21

Apr_2010 1.40 2.15 4.10 5.85

May_2010 1.87 8.45 10.05 8.05

Oct_2010 1.16 4.85 9.25 10.35

Dec_2010 3.25 4.50 3.12 6.45

Table-7. Visibility (m) flux in selected sites of Veraval during the Study period January-2010 to

December-2010.

Fig. 9. Visibility (m) flux in selected sites of Veraval during the Study period January-2010 to

December-2010.

97

A (0 Km) B (5Km) C (10Km) D (20Km)

GPP NPP GPP NPP GPP NPP GPP NPP

Feb_2010 0.080 0.060 0.17 0.07 0.01 0.02 0.06 0.05

Mar_2010 0.04 0.03 0.03 0.02 0.02 0.01 0.02 0.01

Apr_2010 error 0.040 0.030 0.09 0.08 0.05 0.04 0.03 0.02

May_2010 error 0.030 0.020 0.04 0.07 0.12 0.09 0.11 0.09

Oct_2010 0.270 0.010 0.08 0.03 0.09 0.03 0.08 0.03

Dec_2010 0.080 0.070 0.05 0.1 0.08 0.1 0.03 0.03

Table-8. Gross and Net Primary Productivity (mg C/L/Hr) flux in selected sites of Veraval

during the Study period January-2010 to December-2010.

Fig. 10. Gross and Net Primary Productivity (mg C/L/Hr) flux in selected sites of Veraval

during the Study period January-2010 to December-2010.

98

A (0 Km) B (5Km) C (10Km) D (20Km)

Feb_2010 0.189 0.098 0 0

Mar_2010 0.013 0.221 0.183 0.186

Apr_2010 error 0.013 0.105 0 0

May_2010 error 0.011 0.009 0 0.002

Oct_2010 0.235 0.102 0.057 0.11

Dec_2010 0.086 0.018 0.004 0.071

Table-9. Ammonia concentration flux in selected sites of Veraval during the Study period


Fig. 11. Ammonia concentration flux in selected sites of Veraval during the Study period


99

A (0 Km) B (5Km) C (10Km) D (20Km)

Feb_2010 0.071 0.056 0.088 0.005

Mar_2010 0.099 0.007 0.005 0

Apr_2010 0.099 0.047 0.001 0.039

May_2010 0.071 0.031 0.112 0.051

Oct_2010 0.136 0.057 0.054 0.059

Dec_2010 0.048 0.052 0.05 0.039

Table-10. Phosphate concentration flux in selected sites of Veraval during the study period


Fig. 12. Phosphate concentration flux in selected sites of Veraval during the study period


100

A (0 Km) B (5Km) C (10Km) D (20Km)

Feb_2010 6.181 4.655 2.327 4.655

Mar_2010 5.189 4.112 3.123 5.021

Apr_2010 5.189 4.12 4.731 4.159

May_2010 4.230 4.165 3.118 3.126

Oct_2010 7.886 6.914 8.11 6.391

Dec_2010 5.681 5.793 3.438 2.728

Table-11. Nitrate concentration flux in selected sites of Veraval during the study period


Fig. 13. Nitrate concentration flux in selected sites of Veraval during the study period


101

A (0 Km) B (5Km) C (10Km) D (20Km)

Feb_2010 0.359 0.302 0.331 0.302

Mar_2010 0.735 0.184 0.183 0.189

Apr_2010 0.735 0.504 0.591 0.619

May_2010 0.639 0.622 0.461 0.342

Oct_2010 0.974 0.729 0.81 0.77

Dec_2010 0.729 0.892 0.729 0.157

Table-12. Silicate concentration flux in selected sites of Veraval during the study period


Fig. 14. Silicate concentration flux in selected sites of Veraval during the study period


102

A (0 Km) B (5Km) C (10Km) D (20Km)

Oct_2010 30.9 31.4 30.6 31

Dec_2010 23.6 23.9 24.9 24.8

Table-13. Temperature (°C) flux in selected sites of Diu during the Study period

October -2010 to December-2010.

Fig. 15. Temperature (°C) flux in selected sites of Diu during the Study period


103

A (0 Km) B (5Km) C (10Km) D (20Km)

Oct_2010 8.2 8.2 8.4 8.4

Dec_2010 7.9 8.2 8.2 8.3

Table-14. pH flux in selected sites of Diu during the Study period


Fig. 16. pH flux in selected sites of Diu during the Study period


104

A (0 Km) B (5Km) C (10Km) D (20Km)

Oct_2010 32.2 34.1 33.4 35

Dec_2010 35.1 36.2 36.6 35.7

Table-15. Salinity (ppt) flux in selected sites of Diu during the Study period


Fig. 17. Salinity (ppt) flux in selected sites of Diu during the Study period


105

A (0 Km) B (5Km) C (10Km) D (20Km)

Oct_2010 8.7 8.7 8.4 7.86

Dec_2010 5.2 5.2 5.48 5.31

Table-16. Dissolved Oxygen (ml/L) flux in selected sites of Diu during the Study period October

-2010 to December-2010.

Fig. 18. Dissolved Oxygen (ml/L) flux in selected sites of Diu during the Study period October


106

A (0 Km) B (5Km) C (10Km) D (20Km)

Oct_2010 1.5942 0.8864 0.8632 1.0154

Dec_2010 0.474 0.4016 0.4016 0.197

Table-17. Chlorophyll (mg m-3) flux in selected sites of Diu during the Study period October


Fig. 19. Chlorophyll (mg m-3) flux in selected sites of Diu during the Study period October


107

A (0 Km) B (5Km) C (10Km) D (20Km)

Oct_2010 2.97 3.15 3.8 3.33

Dec_2010 0.87 0.57 1.57 1.62

Table-18. Visibility (m) flux in selected sites of Diu during the Study period October -2010 to

December-2010.

Fig. 20. Visibility (m) flux in selected sites of Diu during the Study period


108

A (0 Km) B (5Km) C (10Km) D (20Km)


Oct_2010 0.02 0.02 0.08 0.11 0.01 0 0.01 0.05

Dec_2010 0.05 0.04 0.02 0.02 0.08 0.02 0.04 0.01

Table-19. Gross and Net Primary Productivity (mg C/L/Hr) flux in selected sites of Diu during

the Study period October -2010 to December-2010.

Fig. 21. Gross and Net Primary Productivity (mg C/L/Hr) flux in selected sites of Diu during

the Study period October -2010 to December-2010.

109

A (0 Km) B (5Km) C (10Km) D (20Km)

Oct_2010 0 0.158 0.089 0.052

Dec_2010 0 0 0.01 0.02

Table- 20. Ammonia concentration flux in selected sites of Diu during the Study period October


Fig. 22. Ammonia concentration flux in selected sites of Diu during the Study period October


110

A (0 Km) B (5Km) C (10Km) D (20Km)

Oct_2010 0.048 0.081 0.068 0.054

Dec_2010 0.074 0.065 0.057 0.072

Table-21. Phosphate concentration flux in selected sites of Diu during the study period October


Fig. 23. Phosphate concentration flux in selected sites of Diu during the study period October


111

A (0 Km) B (5Km) C (10Km) D (20Km)

Oct_2010 4.373 4.448 4.448 3.663

Dec_2010 6.952 9.194 5.158 5.083

Table-22. Nitrate concentration flux in selected sites of Diu during the study period October


Fig. 24. Nitrate concentration flux in selected sites of Diu during the study period October


112

A (0 Km) B (5Km) C (10Km) D (20Km)

Oct_2010 0.566 0.443 0.157 0.402

Dec_2010 1.055 1.178 0.892 0.974

Table-23. Silicate concentration flux in selected sites of Diu during the study period October


Fig. 25. Silicate concentration flux in selected sites of Diu during the study period October


113

A (0 Km) B (5Km) C (10Km) D (20Km)

Oct_2010 29.46 29.3 29.5 30.9

Dec_2010 24.4 24.6 24.9 25.7

Table-24. Temperature (°C) flux in selected sites of Mangrol during the Study period October


Fig. 26. Temperature (°C) flux in selected sites of Mangrol during the Study period


114

A (0 Km) B (5Km) C (10Km) D (20Km)

Oct_2010 7.4 7.9 7.8 7.3

Dec_2010 7.9 7.9 8 8.2

Table-25. pH flux in selected sites of Mangrol during the Study period


Fig. 27. pH flux in selected sites of Mangrol during the Study period


115

A (0 Km) B (5Km) C (10Km) D (20Km)

Oct_2010 33.6 33.8 34.7 35.3

Dec_2010 34.4 34.3 35.1 35.3

Table-26. Salinity (ppt) flux in selected sites of Mangrol during the Study period


Fig. 28. Salinity (ppt) flux in selected sites of Mangrol during the Study period


116

A (0 Km) B (5Km) C (10Km) D (20Km)

Oct_2010 5.15 5.54 5.77 4.81

Dec_2010 5.31 5.15 4.97 4.75

Table-27. Dissolved Oxygen (ml/L) flux in selected sites of Mangrol during the Study period


Fig. 29. Dissolved Oxygen (ml/L) flux in selected sites of Mangrol during the Study period


117

A (0 Km) B (5Km) C (10Km) D (20Km)

Oct_2010 1.9402 0.183 0.657 0.149

Dec_2010 1.7912 1.9774 1.051 0.943

Table-28. Chlorophyll (mg m-3) flux in selected sites of Mangrol during the Study period


Fig. 30. Chlorophyll (mg m-3) flux in selected sites of Mangrol during the Study period October


118

A (0 Km) B (5Km) C (10Km) D (20Km)

Oct_2010 5.25 7.25 7.25 10.3

Dec_2010 3.05 3.07 3.05 6.05

Table-29. Visibility (m) flux in selected sites of Mangrol during the Study period October -2010

to December-2010.

Fig. 31. Visibility (m) flux in selected sites of Mangrol during the Study period


119

A (0 Km) B (5Km) C (10Km) D (20Km)


Oct_2010 0.12 0.06 0.06 0.02 0.11 0.04 0.11 0.09

Dec_2010 0.07 0.13 0.29 0.03 0.11 0.03 0.08 0.06

Table-30. Gross and Net Primary Productivity (mg C/L/Hr) flux in selected sites of Mangrol

during the Study period October -2010 to December-2010.

Fig. 32. Gross and Net Primary Productivity (mg C/L/Hr) flux in selected sites of Mangrol

during the Study period October -2010 to December-2010.

120

A (0 Km) B (5Km) C (10Km) D (20Km)

Oct_2010 0.37 0.116 0.171 0.065

Dec_2010 0 0 0.015 0

Table-31. Ammonia concentration flux in selected sites of Mangrol during the Study period

October - October -2010 to December-2010.

Fig. 33. Ammonia concentration flux in selected sites of Mangrol during the Study period


121

A (0 Km) B (5Km) C (10Km) D (20Km)

Oct_2010 0.061 0.052 0.048 0.046

Dec_2010 0.052 0.043 0.054 0.032

Table-32. Phosphate concentration flux in selected sites of Mangrol during the study period


Fig. 34. Phosphate concentration flux in selected sites of Mangrol during the study period


122

A (0 Km) B (5Km) C (10Km) D (20Km)

Oct_2010 6.129 3.85 4.485 5.345

Dec_2010 0 0 0.822 0.822

Table-33. Nitrate concentration flux in selected sites of Mangrol during the study period


Fig. 35. Nitrate concentration flux in selected sites of Mangrol during the study period October


123

A (0 Km) B (5Km) C (10Km) D (20Km)

Oct_2010 0.647 0.647 0.321 0.296

Dec_2010 0.402 0.402 0.525 0.28

Table-34. Silicate concentration flux in selected sites of Mangrol during the study period


Fig. 36. Silicate concentration flux in selected sites of Mangrol during the study period October


124

Month A (0 Km) B (5Km) C (10Km) D (20Km)

Feb_2010 54300 53800 53700 43400

Mar_2010 44300 33800 23700 13400

Apr_2010 5300 38000 37000 30400

May_2010 33300 13800 9700 84400

Oct_2010 55300 33800 23700 12600

Dec_2010 36400 13800 3700 3400

Table-35. Abundance (in no of cells l-1) and pattern of monthly variations of phytoplankton in

the selected sites of whale shark habituate at Veraval coast.

Fig. 37. Abundance (in no of cells l-1) and pattern of monthly variations of phytoplankton in the

selected sites of whale shark habituate at Veraval coast.

125


Oct_2010 12000 5000 2500 2500

Dec_2010 9000 5000 1600 2300


the selected sites of whale shark habituate at Diu coast.

Fig. 38. Abundance (in no of cells l-1) and pattern of monthly variations of phytoplankton in

the selected sites of whale shark habituate at Diu coast.

126


Oct_2010 26000 23000 10000 11000

Dec_2010 13000 6000 4500 2100


the selected sites of whale shark habituate at Mangrol coast.

Fig. 39. Abundance (in no of cells l-1) and pattern of monthly variations of phytoplankton in

the selected sites of whale shark habituate at Mangrol coast.

127

Table-38 (a) Diversity of Phytoplankton in the selected sites of whale shark habituate at Veraval,

Diu and Mangrole.

Sl. No. NameVeraval (VRL) Diu (DIU) Mangrole (MGR)

A B C D A B C D A B C D

Diatoms- Centrales

1. Skeletonema costatum + + + + + - - + + - - - - -

2. Thallassiophyxix

palmeriana

- + - + - - + + + + - -

3. Thallassiosira subtilis + + - - + - - + + - - + -

4. Coscinodiscus excentricus + + + + + + + + + + + + + + + + + + + + + + +

5. Planktoniella sol - + + - - - - - + + + - -

6. Rhizosolenia robusta + - + + - + - - + + + + + +

7. Eucampia cornuta - + - - - + - - - - + +

8. Biddulphia mobiliensis + + + + - + - - - + + + - -

9. Ditylum brightwelli - - - - - - + + + + + + -

10. Biddulphia sinensis + + + + - - - - - + +

+

+ + + -

11. Cerataulina bergonii + + + ++ - - - - + + - + + +

12. Cyclotella sp. + + + + + + + + + + - - - - -

13. Chaetoceros sp. + + + + + + + + - - - + + + + +

14. LIthodesmium sp. - - + + - - - + + + + - -

Diatoms- Pennales

1. Grammatophora undulate + + + - - - - - + + + + + -

2. Licmophora delicatula - - + + - - - + + - - +

3. Fragilaria oceanic + + - - - - - + - + + + -

4. Rhaphoneis discoides - - - + + - - - + + - + + + -

5. Thallasiothrix frauenfeldii + + + + + + + + + + + + + + + + + +

6. Asterionella japonica - - - + - - + + - + + -

7. Mastogloia exilis + + + - + + + + - + + + + -

*Abundant = + + +; Average = + +; Less in Number = +; Absent = -

128

Table-38 (b) Diversity of Phytoplankton in the selected sites of whale shark habituate at Veraval,

Diu and Mangrole.

Sl. No. NameVeraval (VRL) Diu (DIU) Mangrole (MGR)


8. Cocconeis littoralis - - + + + - - + + + - - - -

9. Gyrosigma balticum - + + + + - + + + + + + + + -

10. Bacillaria paradoxa + - - - + - - - - - - -

11. Nitzschia closterium + + + + + + + + - + + + + + +

12. Nitzschia sp. + + + + + + + - + + + + + + + + + + + + + +

13. Surirella fluminensis - - + + - - - + - + + - -

14. Campylodiscus

iyengarii

- - - + - - - + - - + + +

15. Navicula sp. - - + + + + + - - - - + + +

16. Thalassionema

nitzschioides

- - - + - - - - + + + + - -

Dinoflagellates

1. Ceratium sp. + + + + + - - + + + + + + + + + +

2. Cochlodinium citron - + - - + + - + - + - - -

3. Amphisolenia

bifurcate

+ + + + - - - - + - + + -

4. Ceratium declinatum - - + - - - + - - - - +

5. Dinophysis caudate + - - - - + + + - - - - +

6. Peridinium claudicans - - - + - - + + + - - + +

7. Podolampas bipes - - - - - - - - - - - -

8. Pyrophacus

horologium

- - - - - - - - - - - -

9. Diplopsalis sp. - - - - - - - - - - - -

10. Ornithocercus

magnificus

+ + + + + - - ++ + - + + + + + + + + +

11. Prorocentrum sp. - - - - - - - - - + + -

Table- 38 (c) Diversity of Phytoplankton in the selected sites of whale shark habituate at Veraval,

Diu and Mangrole.

Sl. No. Name Veraval (VRL) Diu (DIU) Mangrole (MGR)


Silicoflagellates, Blue-Green algae & Nannoplankton

1. Blue green algae + + + + - - + + + - - + + + + - -

2. Spirulina sp. - - - - - - - - - - - -

3. Pavlova sp. - - - - - - - - - - - -

4. Dunaliena sp. - - - - - - - - - - - -

5. Nanno Chloropsis - + - - - - - + - - + -

6. Chlorella sp. + - - - + - - - - - - -

7. Tetraselmis sp. - - - - - - - - - - - -

*Abundant = + + +; Average = + +; Less in Number = +; Absent = -

129

Group Feb_2010 Mar_2010 Apr_2010 May_2010 Oct_2010 Dec_2010

Hydromedusae 0 0 30 0 0 0

Siphonophora 0 0 0 0 0 0

Chaetognatha 0 0 10 2 2 1

Copepod 1.2 1.3 0 3 24 12

Sergestidae 13 3 1.3 13 4 0

Invertebrate

larvae

33 3 0.3 3 12 7

Thaliacea 2 0 0 0 0 0

Fish eggs 23 3 3 4 7 32

Fish larvae 1 2 1.7 7 2 50

Table-39. Group vise zooplankton population density in Station-A of whale shark habituate sites

at Veraval.

Fig. 40. Group vise zooplankton population density in Station-A of whale shark habituate sites

at Veraval.

130


Hydromedusae 12 2 21 0 5 0


Chaetognatha 0 0 7.5 0 3 1

Copepod 11 123 2.2 1 27 25


Invertebrate

larvae

13 3 0 3 17 5


Fish eggs 0 0 2.2 2 0 36

Fish larvae 25 5 2.5 7 0 12

Table-40. Group vise zooplankton population density in Station-B of whale shark habituate sites

at Veraval.

Fig. 41. Group vise zooplankton population density in Station-B of whale shark habituate sites

at Veraval.

131


Hydromedusae 11 1 27.5 0 3 2


Chaetognatha 11 1 5.2 0 2 3

Copepod 14 156 2.5 14 17 22

Sergestidae 0 0 6 0 2 0

Invertebrate

larvae

12 2 1.5 21 13 6

Thaliacea 0 0 0.7 0 0 0

Fish eggs 20 0 1.2 22 4.2 27

Fish larvae 22 2 0 32 1.3 4

Table-41. Group vise zooplankton population density in Station-C of whale shark habituate sites

at Veraval.

Fig. 42. Group vise zooplankton population density in Station-C of whale shark habituate sites

at Veraval.

132


Hydromedusae 0 0 21.3 0 8 0


Chaetognatha 0 0 1 34 1 5

Copepod 42 133 3.1 19 15 23


Invertebrate

larvae

33 3 0.5 32 8 9


Fish eggs 12 2 1 12 0 18

Fish larvae 13 3 0 18 0 7.9

Table-42. Group vise zooplankton population density in Station-D of whale shark habituate sites

at Veraval.

Fig. 43. Group vise zooplankton population density in Station-D of whale shark habituate sites

at Veraval.

133

Group Oct_2010 Dec_2010

Hydromedusae 0 1

Siphonophora 0 0

Chaetognatha 0 0

Copepod 25 26

Sergestidae 0 5

Invertebrate larvae 12 8

Thaliacea 0 0

Fish eggs 7 38

Fish larvae 1 0


at Diu.


at Diu.

134


at Diu.


Hydromedusae 0 0

Siphonophora 0 0

Chaetognatha 0 2

Copepod 17 12

Sergestidae 0 0


Thaliacea 0 0

Fish eggs 8 43

Fish larvae 1 0


at Diu.

135


Hydromedusae 0 0

Siphonophora 0 0

Chaetognatha 1 0

Copepod 21 36

Sergestidae 0 2


Thaliacea 0 0

Fish eggs 4 55

Fish larvae 0 0


at Diu.


at Diu.

136


Hydromedusae 0 1

Siphonophora 0 0

Chaetognatha 0 3

Copepod 22 29

Sergestidae 0 2


Thaliacea 0 0

Fish eggs 13 68

Fish larvae 0 0

Table-46. Group vise zooplankton population density in Station-D of whale shark habituates

sites at Diu.


at Diu.

137


Hydromedusae 11 0

Siphonophora 0 0

Chaetognatha 2 2

Copepod 31 39

Sergestidae 0 1


Thaliacea 3 0

Fish eggs 0 52

Fish larvae 0 0


at Mangrol.


at Mangrole.

138


Hydromedusae 7 0

Siphonophora 0 0

Chaetognatha 2 0

Copepod 23 55

Sergestidae 7 0


Thaliacea 5 0

Fish eggs 16 21

Fish larvae 0 1


at Mangrol.


at Mangrol.

139


Hydromedusae 8 0

Siphonophora 0 0

Chaetognatha 0 2

Copepod 27 59

Sergestidae 3 1


Thaliacea 4 0

Fish eggs 15 52

Fish larvae 0 0


at Mangrole.


at Mangrole.

140


Hydromedusae 6 0

Siphonophora 0 0

Chaetognatha 2 2

Copepod 33 64

Sergestidae 0 0


Thaliacea 4 0

Fish eggs 0 24

Fish larvae 0 1

Table-50. Group vise zooplankton population density in Station-D of whale shark habituate sites

at Mangrole.


at Mangrole.

Sl. No. Date Conducted by Place Sex Length GPS

1. 1/3/2010 FD Veraval M 23 N 20°50'408" E 70°18'134"

2. 1/4/2010 WTI Sutrapada M 23 N 20°47'294" E 70°27'713"

3. 1/4/2010 FD Veraval F 20 N 20°49'100" E 70°24'126"

4. 1/8/2010 WTI Veraval F 15 N 20°51'609" E 70°23'779"

5. 1/11/2010 FD Veraval F 18 N 20°48'100" E 70°24'094"

6. 1/12/2010 WTI Veraval M 15 N 20°52'754" E 70°14'550"

7. 1/12/2010 WTI Veraval M 20 N 20°57'183" E 70°17'807"

8. 1/13/2010 FD Veraval F 18 N 20°48'591" E 70°24'381"

9. 1/21/2010 FD Veraval F 19 N 20°50'255" E 70°18'302"

10. 1/24/2010 FD Veraval F 17 N 20°51'809" E 70°10'910"

11. 2/17/2010 WTI Veraval (Adri) M 21 N 20°52'799" E 70°15'383"

141

12. 3/21/2010 FD Veraval M 15 NA

13. 3/30/2010 FD Veraval F 18 N 20°41'418" E 70° 28'806"

14. 3/31/2010 FD Veraval F 22 NA

15. 04/04/10 FD Veraval F 20 N 20°41'101" E 70°28'406"

16. 4/5/2010 WTI Veraval (Adri) M 16 N 20°50'914" E 70°17'518"

17. 4/5/2010 FD (Jamvala) Muldwarka M 30 NA

18. 4/13/2010 FD (Jamvala) Muldwarka (Madwad) M 17 NA

19. 4/12/2010 WTI Veraval (Near Jaleswar) M 22 N 20°52'986" E 70°19'403"

20. 5/9/2010 FD Veraval F 21 N 20°50'090" E 70°18'113"

21. 5/10/2010 FD Veraval F 16 N 20°43'112" E 70°35'283"

22. 5/11/2010 WTI Veraval (Near Jaleswar) M 16 N 20°49'976" E 70°17'727"

23. 5/11/2010 WTI Veraval (Near Jaleswar) F 22 N 20°52'786" E 70°20'076"

24. 9/22/2010 FD Veraval F 20 NA

25. 9/25/2010 FD/WTI Veraval F 20 N 2052'320" E 7023'537"

26. 10/3/2010 FD Dhamlej F 22 N 2043181 E 7035541

27. 10/9/2010 FD Veraval F 19 N 2041418 E 7028806

Table-51 (a). Whale shark rescue data during the study period of January-2010 to December-2010.

Sl. No. Date Conducted by Place Sex Length GPS

28. 10/12/2010 FD Sutrapada M 15 N 2050089 E 7029036

29. 10/13/2010 FD Veraval F 20 N 205109 E 7026091

30. 10/14/2010 FD Veraval F 18 N 2051079 E 7026091

31. 10/20/2010 FD /WTI Veraval F 14 N 2054'286" E 7015'606"

32. 11/8/2010 FD Dhamlej F 25 NA

33. 11/14/2010 FD Dhamlej F 23 N 2050215 E 7017214

34. 11/28/2010 FD Dhamlej F 22 N 2052028 E 7018581

35. 11/29/2010 FD Sutrapada F 15 N 2049034 E 7027546

36. 11/29/2010 FD Dhamlej F 45 N 205109 E 7026091

37. 11/30/2010 FD Sutrapada F 15 N 2050106 E 7018196

38. 11/30/2010 FD Sutrapada F 25 N 2048050 E 7024021

39. 11/30/2010 FD Sutrapada M 35 N 2048089 E 7024012

40. 11/30/2010 FD/WTI Sutrapada M 23 N 2047'275" E 7027'865"

41. 12/2/2010 FD Sutrapada F 13 N2040297 E 7020715

42. 12/2/2010 FD /WTI Veraval M 17 N 2047235 E 7022539


44. 12/4/2010 FD Dhamlej F 20 NA

45. 12/4/2010 FD Dhamlej M 22 N 2050396 E 70183446

46. 12/5/2010 FD/WTI Sutrapada F 14 N 2047'374" E 7025'882"

47. 12/5/2010 FD Dhamlej F 20 N 2055'210" E 7014'403"

48. 12/12/2010 FD/WTI Veraval M 16 N 2047'235" E 7020'271"


50. 12/13/2010 FD/WTI Sutrapda M 25 N 2046'553" E 7027'844"

51. 12/13/2010 FD/WTI Sutrapada F 22 N 20 45'839" E 7030'106"

52. 12/13/2010 FD/WTI Sutrapada F 18 N 2044'524" E 7030'894"

53. 12/14/2010 FD/WTI Sutrapda NA NA N 2046'377" E 7029'637"

54. 12/15/2010 FD Sutrapada F 40 N2048'109" E 7024'204"

55. 12/16/2010 FD Sutrapada F 22 N 2048'080" E 7024'012"

Table-51 (b). Whale shark rescue data during the study period of January-2010 to December-2010.

142

APPENDIX III

Showing whale sharks rescued under self-documentation scheme (2012 - 2014).

S. no Date

Whale Shark

PlaceDirection from

headland

Approximate

distance from

headland

(nautical miles)Sex

Length

(ft)

1 02-10-2012 - 15 Veraval Towards West 5

2 05-10-2012 - 36 Sutrapada Towards South 6

3 10-10-2012 - 15 Sutrapada - -



6 20-10-2012 F 30 Dhamlej Towards South 12

7 22-10-2012 M 20 Dhamlej Towards South 15


9 24-10-2012 F 18 Sutrapada Towards South 6

10 27-10-2012 - 25 Dhamlej Towards South 10



13 05-11-2012 - 17 Veraval Towards South 3


15 07-11-2012 M 25 Veraval Towards West 4








23 19-11-2012 M 18 Sutrapada Towards South 1. 15







143


























55 06-05-2013 - 20 Sutrapada - -

56 07-05-2013 - - Veraval - -

57 03-09-2013 M 10 Sutrapada Towards West 8

58 04-09-2013 M 20 Sutrapada Towards North 8


60 12-09-2013 - 22 Veraval Towards North 8


62 16-09-2013 - 33 Sutrapada Towards West 10


64 12-10-2013 F 30Vadodra

Jala- 10

65 13-10-2013 F - Dhamlej - -

66 14-10-2013 - 18 Veraval Towards North 5

67 16-10-2013 F 26 Sutrapada Towards West 10

144


69 06-11-2013 - - Veraval Towards West 5


71 16-11-2013 - 20 Veraval Opp to Adheri 35

72 22-11-2013 - 22 Veraval - 35

73 25-11-2013 M 30 Sutrapada - -

74 26-11-2013 M 36 Sutrapada Towards West 30


76 05-12-2013 - 24 Veraval - 14


78 16-12-2013 F 20 Sutrapada Towards East 12

79 18-12-2013 - 30 sutrapada Towards South 10

80 20-12-2013 F 22 sutrapada Towards South 22

81 21-12-2013 F 37Veraval-

ChrowadTowards South 5






87 27-12-2013 F 18 Sutrapada Towards South 4.7


89 01-01-2014 F 30 Sutrapada Towards West 23

90 03-01-2014 M 38 Sutrapada Towards East 18

91 09-01-2014 - 40 Sutrapada Towards East 13





96 01-03-2014 - 18 Dhamlej Towards East 12

97 10-03-2014 - 30 Sutrapada Towards East 15


99 11-03-2014 M 25 Sutrapada Towards South 12



102 13-04-2014 F 32 Veraval Towards West 22




145

106 13-05-2014 M 28 Sutrapada Towards North 24

107 13-05-2014 - 20 Sutrapada Towards North 18


109 27-05-2014 M 30 Dhamlej Towards West 10


111 05-06-2014 - 25 Dhamlej Towards West 15

146

Rty 2 CR - mtDNA control region sequence information generated from sample Rty-2

(1397 bp)

TTGGCTCCCAAAGCCAAGATTCTTCCCAAACTGCCCCCTGAGGCATCATGCAAATT-

GCATGGTTTTATGTACGTCAGTATGACATATTAATGATTCAGCCCACATTCCTTA-

ATATACCACATATGACTTACTTTTCTATATCAACTCTAATATACTTTCCACAGGTATATA-

CATACTATGTTTAATACTCATTAATTTACTTGCCACTATATTATTACATTATATGAT-

TAATCCACATTTCTATAACATATTAGACTTTCCTCAACTAGATATTATTTTCGTAAT-

TAATGTACGTCAGTATGACATATTAATGATTCGGCCCACATTCCTTAATATACCA-

CATATGACTTACTTTTCTATATCAACTCTAATATACTTTCCACAGGTATATACATAC-

TATGCTTAATACTCATTAATTTACTTGCCACTATATTATTACATTATATGATTAATC-

CACATTTCTATAACATATTAGACTTTCCTCAACTAGATATTATTTTCGTAATTATTAT-

GCAGGTTTGTAAAAACCTGCATTAATCCATTTAAGTACTAATATTACTGCTATAT-

CATCTATAATTGATTTAAACTGACATTTGATTACTGCTTAAATTCATTTGGTTCTTA-

ATCGTATCAATCATGAATTCACTCTAGTTCCCTTATATTGACATACAGTTCTTAATC-

GTATCAATCATGAATTTACTCTAGTTCCCTTATATTGACATACAGTTCTTAATCGTCT-

CAGAATTTATTTTCCTCCCAGATTTTTTAGTTTCGGCTTGAAGCTCCGACACCT-

GCCCCGGGAAGGCTGAAACCAGGAACAATAAATATTAAGTTAGAACTTTCCACTCGA-

CATCTGCCGTCAATAATCCTCACTACTGCTCATTCGTGGGAAATAGATTGTCAAGTT-

TACCATAACTGAAAGAGATAATAATAATGGAACCATTAAATGACAACAGTATTGAT-

TAATCCAACAATAATTGAAGAGATACATACAAGATTAATCAACAACTTAGGAGATA-

AATATTATTTATGAATGTAAAAAACATACCATTATTTAGCACATTCTTGCTTAGTCG-

GACATACAAGTATTATATATATACCCCCCTCCTTCACAAAAAAAAAACGACAAAATA-

AAAAAAAATTTTTTCCGTAAAAACCCCCCCTCCCCCCTAAATATACAAGGACACCTC-

GAAAAACCCCAAAAACGAGGGCCGTGCGTATATTTATTCTAAAACCATGCATA-

ATTTTTCACTATACATTGTTACACAATATGATGCTAGTGTAGCTTAATTTAAAGTATAG-

CACTGAAAATGCTAAGATGAAAAATAATATTTTTCCGCAAGCATGAAAGGTTTG-

GTCCTAGCCTTAGTGTTAATTGTAACCAAAATTATACATGC

APPENDIX IV

DNA sequence of whale shark in Gujarat water

147

Rty 3CR - mtDNA control region sequence information generated from sample Rty-3

(1404 bp)

TTGGCTCCCAAAGCCAAGATTCTTCCCAAACTGCCCCCTGAGGCATCATGCAAATT-

GCATGGTTTTATGTACGTCAGTATGACATATTAATGATTCAGCCCACATTCCTTA-

ATATACCACATATGACTTACTTTTCTATATCAACTCTAATATACTTTCCACAGGTATATA-

CATACTATGTTTAATACTCATTAATTTACTTGCCACTATATTATTACATTATATGATTA-

ATCCACATTTCTATAACATATTAGACTTTCCTCAACTAGATATTATTTTCGTAATTAG-

TATGACATATTAATGATTCAGCCCACATTCCTTAATATACCACATATGACTTACTTTTC-

TATATCAACTCTAATATACTTTCCATAGGTATATACATACTATGTTTAATACTCATTAATT-

TACTTGCCACTATATTATTACATTATATGATTAATCCACATTATATGATCTTCCACATTTC-

TATAACATATTAGACTTTCCTCAACTAGATATTATTTTCGTAATTATTATGCAGGTTTGTA-

AAATCCTGCATTAATCCATTTAAGTACTAATATTACTGCTATATCATCTATAATTGATTTA-

AACTGACATTTGATTACTGCTTAAATTCATTTGGTTCTTAATCGTATCAATCATGAATT-

TACTCTAGTTCCCTTATATTGACATACAGTTCTTAATCGTATCAATCATGAATTTACTC-

TAGTTCCCTTATATTGACATACAGTTCTTAATCGTCTCAGAATTTATTTTCCTCCCA-

GATTTTTTAGTTTCGGCTTGAAGCTCCGACACCTGCCCCGGGAAGGCTGAAACCAG-

GAACAATAAATATTAAGTTAGAACTTTCCACTCGACATCTGCCGTCAATAATCCT-

CACTACTGCTCATTCGTGGGAAATAGATTGTCAAGTTTACCATAACTGAAAGA-

GATAATAATAATGGAACCATTAAATGACAACAGTATTGATTAATCCAACAATAATT-

GAAGAGATACATACAAGATTAATCAACAACTTAGGAGATAAATATTATTTATGAAT-

GTAAAAAACATACCATTATTTAGCACATTCTTGCTTAGTCGGACATACAAGTATTG-

TATATATACCCCCCTCCTTCACAAAAAAAAAACGACAAAATAAAAAAAAATTTTTTCC-

GTAAAAACCCCCCCTCCCCCCTAAATATACAAGGACACCTCGAAAAACCCCAAAAAC-

GAGGGCCGTGCGTATATTTATTCTAAAACCATGCATAATTTTTCACTATGCATTGTTA-

CACAATATGATGCTAGTGTAGCTTAATTTAAAGTATAGCACTGAAAATGCTAAGAT-

GAAAAATAATATTTTTCCGCAAGCATGAAAGGTTTGGTCCTAGCCTTGGTGTTAATTG-

TAACCAAAATTATACATGC

148

1. Adams, S. M. (1990). Biological indicators of stress in fish. American Fisheries Society Symposium Series 8, Bethesda, Maryland.

2. Aca, E. Q and Schmidt. J.V. (2011). Revised size limit for viability in the wild: neonatal and

young of the year whale sharks identified in the Philippines. Asia Life Sciences. 20: 361–367.

3. Akhilesh, K. V., Shanis, C. P. R., White, W. T., Manjebrayakath, H., Bineesh, K. K., Ganga, U.,

Abdussamad, E. M., Gopalakrishnan, A. and Pillai. N. G. K. (2012). Landing of whale sharks

(Rhincodon typus) smith, 1828 in Indian waters since protection in 2001 through the Indian

wildlife (Protection) Act, 1972. Environmental Biology of Fishes. 96(6): 713-722.

4. Alava, M.N.R., Dolumbalo, E.R.Z., Yaptinchay, A. A and Trono, R. B (2002). Fishery and trade

of whale sharks and manta rays in the Bohol Sea, Philippines. In: Fowler, S.L., Reed, T.M.,

Dipper, F.A. (Eds.), Elasmobranch Biodiversity Conservation and Management: Proceedings of the International Seminar and Workshop, Sabah, Malaysia. July 1997. IUCN, Gland,

Switzerland, Sabah, Malaysia, Pp. 132–147.

5. Alava, M.N.R. (2002). Conservation and management of whale shark in the Philippines. Paper

presented during Shark Conference 2002: Sustainable Utilization and Conservation of Sharks.

Wild Aid - National Taiwan Ocean University. May 13- 16, 2002.Taipei, Taiwan. (Abstract).

6. Alava. M.N.R and Kirit, R. (1994). Larger marine invertebrates (cetaceans, sea turtles and

whale sharks) in Sogod Bay, Southern Leyte. Resource and Ecological Assessment (REA) of

Sogod Bay (Fisheries Component).1993–1994.

7. Alava, M.N.R., E. G. Himoya, R. Merto and Dolar. M. L. L. (1993). Resource utilisation of marine

mammals in communities along Tanon Strait (central Visayas) and in Camiguin I.(Mindanao),

Philippines. Terminal report submitted to the Haribon Foundation.

8. Alava, M.N.R., Yaptinchay,A. A., Acogido, G., Dolar, M. L. L., C.J. Wood and S. Leatherwood.

1997. Fishery and trade ofwhale shark (Rhincodontypus) in the Philippines. Paper presented

during the 13th American Elasmobranch Society (AES) Annual Meeting, Seattle, WA, USA.

9. Alava, M.N.R., Yaptinchay, A.A., E.R.Z. Dolumbal, E.R.Z., and Trono, R.B. In press. Fishery

and trade of whale sharks and manta rays in the Bohol Sea, Philippines. In: Fowler S.L., Reid,

T. and Dipper, F.A. (eds) in press. Elasmobranch Biodiversity, Conservation and Management.

Proceedings international seminar and workshop in Sabah, Malaysia. IUCN, Gland,

Switzerland.

10. Anderson R.C. and Waheed. Z. (1999). Management of shark fisheries in the Maldives. Pp. 367-

401. In: R. Shotton (ed) Case Studies of the Management of Elasmobranches Fisheries. FAO

Fisheries Technical Paper, FAO, Rome, 378(1): Pp. 479.

11. Anderson, R.C. and Ahmed. H. (1993). Shark fisheries of the Maldives. Ministry of Fisheries

and Agriculture, Maldives and FAO, Rome. Pp. 73.

12. Anon. (1999). The Big Three go to CITES. Shark Focus No.6, p. 11. Shark Trust, Plymouth,

UK.

13. Anon. (1998). Whale sharks: the biggest fish. The Economist, July 18t.Pp. 85.

14. Anderson. R. C and Ahmed, H. (1993). The shark fisheries of the Maldives. Ministry of

Fisheries and Agriculture, Republic of Maldives, and Food and Agriculture Organization of

REFERENCES

149

the United Nations. Pp. 74.

15. Aragones, L.V., Jefferson, T.A and Marsh, H. (1997). Marine Mammal Survey Techniques

Applicable in Developing Countries. Asian Marine Biology. 14: 15 – 39.

16. Arnbom. T. (1987 b). Individual photographic identification: a key to the social organization of

sperm whales. M.Sc. thesis, Memorial University of Newfoundland, St. John's, Nfld.

17. Arzoumanian, Z., Holmberg, J. and Norman, B. (2005). An astronomical pattern-matching

algorithm for computer-aided identification of whale sharks (Rhincodon typus). Journal of Applied Ecology.. 42: 999–1011.

18. Avise, C.J. (1994). Molecular Markers, Natural History & Evolution. Chapman & Hall. USA.

511 pp.

19. Baillie, J.E.M., Hilton-Taylor, C. and Stuart, S. (2004). IUCN Red List of Threatened Species:

A Global Species Assessment. IUCN, Gland, Switzerland and Cambridge. http://www.redlist.

org/

20. Barham, W. T. and Schwartz, F. J. (1992). Physiological responses of newborn

i. Smooth dogfish (Mustelus canis), during and following temperature and exercise stress. The

Journal of the Elisha Mitchell Scientific Society, 108: 64–69.

21. Bartel, R., Auvinen, H., Ikonen, E. and Sych, R. (1987). Comparison of six types in sea-trout

tagging experiments in the Baltic area. ICES CM 1987/M: 24.

22. Barut, N and Zartiga, J. In press. Shark fisheries in the Philippines. In: Fowler S.L., Reid, T.

and Dipper, F.A. (eds) in press. Elasmobranch Biodiversity, Conservation and Management.

Proc. Int. Seminar and Workshop in Sabah, Malaysia. IUCN, Gland, Switzerland.

23. Barnes, R. H. (1986). "Educated fishermen: social consequences of development in an

Indonesian whaling community." Bulletin de l’École Française d’Extrême-Orient, 75, 295-

314.

24. Barnes, R. H. (1996). Sea Hunters of Indonesia: Fishers and Weavers of Lamalera, Clarendon

Press, Oxford, 467pp Beaver, K. (unknown). "Seychelles Marine Ecosystem Management

Project: Final Report." GEF/SEYMEMP. Beckley, L. E., Cliff, G., Smale, M. J., and Compagno, L.

J. V. (1997). "Recent stranding and sightings of whale sharks in South Africa. Environmental Biology of Fishes, 50(3): 343-348.

25. Baughman, J.L. (1955). The Oviparity of the Whale Shark (Rhinodon typus) with Records of

This and Other Fishes in Texas Waters. Copeia. 1: 54-55.

26. Beckley. L. E., Cliff. G. M., Smale. M. J and Compagno. L. J. V. (1997). Recent stranding and

sightings of whale sharks in South Africa. Environ Biol Fish . 50: 343–348.

27. Borrell, A., Aguilar, A., Gazo, M., Kumarran, R.P., Cardona, L. (2011). Stable isotope profiles

in whale shark (Rhincodon typus) suggest segregation and dissimilarities in the diet depending

on sex and size. Environ Biol Fish. 92: 559–567

28. Bradshaw, C. J. A., Fitzpatrick, B. W., Steinberg, C. C., Brook, B. W and Meekan, M. G. (In

press). "The world's largest fish is getting smaller." Biological Conservation.

29. Bradshaw, C. J. A., Mollet, H. F., and Meekan, M. G. (2007). Inferring population trends for

the world's largest fish from mark-recapture estimates of survival. Journal of Animal Ecology,

(OnlineEarly Articles).

30. Branstetter. S., Musick. J. A. and Colvocoresses, J. A. (1987). Age and growth estimates of the

tiger shark, Galeocerdo cuvieri from off Virginia and from the northwestern Gulf of Mexico.

Fish. Bull. 85: 269-279.

31. Breuer, J. P. (1954). The littlest biggest fish. Texas Game Fish. 12:29

32. Block B.A., Dewar, H., Farwell, C.A. and Prince, E.D. (1998b). A new satellite technology for

150

tracking the movements of Atlantic Blue fin tuna. Proceedings of the National Academy of Sciences, USA. 95: 9384-9389.

33. Burks, C. M., Driggers, W. B., and Mullin, K. D. (2006). Abundance and distribution of whale

sharks (Rhincodon typus) in the northern Gulf of Mexico. Fisheries Bulletin, 104: 579- 584.

34. Calamia, M. A. (1999). A Methodology for Incorporating Traditional Ecological Knowledge

with geographic information systems for marine resource management in the Pacific. SPC Traditional Marine Resource Management and Knowledge Information Bulletin, #10, 2-12.

35. Campagno, L. J. V. (1984). FAO Species Catalogue. Sharks of the world. An annotated and

illustrated catalogue of sharks’ species known to date. Vol 4. Part 1. Hexanchiformes to

Lamniformes, Food and Agricultural Organization of the United Nations, Rome. Pp. 249.

36. Cardenas, T. N., Enriquez-Andrade, R., and Rodriguez-Dowdell, N. (2007). Community based

management through ecotourism in Bahia de los Angeles, Mexico. Fisheries Research, 84(1)

: 114-118.

37. Carlin, B. (1955). Tagging of salmon Smoltz in the River Lagan. Report of the Institute of

Freshwater Research, Drottningholm. 36: 57-74.

38. Castro, A. L. F and Rosa, R. S (2005). Use of natural marks on population estimates of the

nurse shark, Ginglymostoma cirratum, at Atol das Rocas Biological Reserve, Brazil. Environ Biol Fish .72: 213–221.

39. Castro, C., Acevedo, J., Allen, J.M., Dalla Rosa, L., Flóres-González, L., Aguayo-Lobo, A.,

Rassmusen, K., Llano, M., Garita, F., Forestell, P., Secchi, E.R., García-Godos, I., Ferina, D.,

Kaufman, G., Scheidat, M. and Pastene, L. (2008). Migratory movements of humpback whales

(Megaptera novaeangliae) between Machalilla National Park, Ecuador and southeast Pacific.

6pp. Paper SC/60/SH23 presented to the IWC Scientific Committee, June 2008, Santiago,

Chile. Pp.6..

40. Cliff, G. and Thurman, G.D. (1984). Pathological effects of stress during capture and transport

in the juvenile dusky shark, Carcharhinus obscures. Comparative Biochemistry and Physiology. 78A: 167–173.

41. Chacko, P.I. and Mathew, M.J. (1954). A record of the whale shark (Rhincodon typus Smith)

from the Malabar Coast. J Bombay Nat Hist Soc. 52:623–624

42. Chen, V. Y and Phipps, M. J. (2002). Management and Trade of Whale Sharks in Taiwan.

TRAFFIC East Asia-Taipei.

43. Chen, C.T., Liu .K. M. and Joung. S.J. (1997). Preliminary report on Taiwan’s whale shark

fishery. TRAFFIC Bulletin 17 (1):53–57.

44. Chaudhary, R.G., Joshi. D., Mookerjee. A., Talwar. V and Menon, V. (2008) Turning the Tide—

the campaign to save Vhali, the whale shark in Gujarat. Wildlife Trust of India. Pp. 14.

45. Chang, W. B., Leu, M. Y., and Fang, L. S. (1997). Embryos of the whale shark, (Rhincodon typus,) early growth and size distribution. Copeia. 2: 444–446.

46. Clark., Eugenie and Nelson, D.R. (1997). Young Whale Sharks (Rhincodon typus) Feeding on

a Copepod Bloom Near La Paz, Mexico. Envir. Biol. Fishes, 50: 63-73.

47. Cliff, G., Anderson. R., Aitken A.P., Charter, G.E., Peddemors, V.M. (2007) Aerial census of

whale sharks (Rhincodon typus) on the northern KwaZulu-Natal coast, South Africa. Fish Res

84: 41–46.

48. Cliff, G and Thurman, G.D. (1984). Pathological effects of stress during capture and transport

in the juvenile dusky shark, (Carcharhinus obscures) Comparative Biochemistry and

Physiology. 78(A): 167–173.

49. Colman. J.G. (1997). A review of the biology and ecology of the whale shark. J .Fish Bio. 51:

1219–1234

151

50. Compagno, L. J. V. (2002). Sharks of the world. An annotated and illustrated catalogue of shark

species known to date. Volume 2. Bullhead, mackerel and carpet sharks (Heterodontiformes, Lamniformes and Orectolobiformes). FAO, Rome. 2: Pp. 269.

51. Compagno . L and Fowler. S. D.M. (2005). A field guide to sharks of the world. Harper Collins

Publishing Ltd., London. Pp. 368.

52. Corkeron , P. J. (2004). Whale Watching, Iconography, and Marine Conservation. Conservation Biology, 18(3): 847-849.

53. Costa-Neto, E. M. (2000). Sustainable development and traditional knowledge: a case study in

a Brazilian artisanal fishermen's community. Sustainable Development, 8(2): 89-95.

54. D’Aubrey, D. J. (1964). Preliminary guide to the sharks found off the east coast of South

Africa. South African association for marine biological research. The oceanographic research

institute, 2nd West Street, Durban, Republic of South Africa. Pp. 95.

55. Davies, D. H and Jouberts, L. S. (1967). Tag evaluation and shark tagging in South African

waters, 1964-65. In P.W. Gilbert, R.F Mathewson & D.P. Rall (eds.). Sharks, skates and rays.

Johns hopkins printers. Pp. 111-140.

56. DeSalle. R and Amato. G (2004). The expansion of conservation genetics. Nature Reviews Genetics 5: 702–712.

57. Dela P. V. R., Hueter. R., González. C. J., Tyminski, J., Gregorio. R. J. (2011) An unprecedented

aggregation of whale sharks, Rhincodon typus, in Mexican coastal waters of the Caribbean

Sea. PLoS ONE 6(4):e18994

58. Diaz, A. M. (2005). "Cross-scale institutional arrangements for whale shark (Rhincodon typus)

management and conservation: Opportunities for sustainable livelihoods," Master of Resource

Studies, Lincoln University.

59. Drew, J. A. (2005). Use of Traditional Ecological Knowledge in Marine Conservation.

Conservation Biology, 19(4): 1286-1293.

60. Driedzic, W. R and Hochachka, P. W. (1978). Metabolism in fish during exercise. In Fish

Physiology vol. VII (ed. W. S. Hoar and D. J. Randall), New York: Academic Press. 503-543.

61. Dunning, D.J., Ross, Q.E., Waldman, J.R. and Mattson, M.T. (1987). Tag retention by, and tagging

mortality of Hudson River striped bass. North American Journal of Fisheries Management, 7:

535-538.

62. Duffy, C. A. J. (2002). "Distribution, seasonality, lengths and feeding behavior of Whale Sharks

(Rhincodon typus) observed in New Zealand waters." New Zealand Journal of Marine and Freshwater Research, 36: 565-570.

63. Dwyer, D. (2000). "Two Model Pelédang: A study of lashed lug whaling boats from Lamalera,

Indonesia," BA (Hons), Northern Territory University, Darwin.

64. Eckert. S. A and Stewart. B. S. (2001). "Telemetry and satellite tracking of whale sharks,

Rhincodon typus, in the Sea of Cortez, Mexico, and the North Pacific Ocean." Environmental Biology of Fishes. 60(1-3), 299-308.

65. Eckert, S. A., Dolar, L. L., Kooyman, G. L., Perrin, W., and Rahman, R. A. (2002). Movements

of whale sharks (Rhincodon typus) in South-east Asian waters as determined by satellite

telemetry. Journal of Zoology, 257(1), 111-115.

66. Eckert, S. A., Dolar, L. L., Kooyman, G. L., Perrin, W., and Rahman, R. A. (2002). Movements

of whale sharks (Rhincodon typus) in South-east Asian waters as determined by satellite

telemetry. Journal of Zoology, 257: 111-115.

67. Ellegren, H. (2004). Microsatellites: Simple sequences with complex evolution. Nature Rev. Genet. 5, 435–445.

68. Endicott, K. M. (1970). An Analysis of Malay Magic, Oxford University Press, Singapore, 188pp

152

69. Ferguson. R.A. and Tufts. B.L. (1992). Physiological effects of brief air exposure in exhaustively

exercised rainbow trout (Oncorhynchus mykiss): Implications for “Catch and Release”

Fisheries. Canadian Journal of Fisheries and Aquatic Sciences. 49(6). 1157-1162.

70. Francis M.P. (1989). Exploitation rates of rig (Mustelus lenticulatus) around the South Island

of New Zealand. New Zealand Journal of Marine and Freshwater Research. 23: 239–245.

71. Finley, K. J. (2001). "Natural history and conservation of the Greenland Whale, or Bowhead in

the northwest Atlantic." Arctic, 54(1): 55-76.

72. Fowler. S. (2000). Whale shark (Rhincodon typus) policy and research scoping study. Nature Conservation Bureau, Newbury.

73. Fox, J. J and Sen, S. (2002). "A Study of Socio-Economic issues Facing Traditional Indonesian

Fishers Who Access the MOU Box: A Report for Environment Australia, Research School of

Pacific and Asian Studies." Australian National University and FERM.

74. Fraser, D. J., Coon, T., Prince, M. R., Dion, R. and Bernatchez, L. (2006). Integrating traditional

and evolutionary knowledge in biodiversity conservation: a population level case study.

Ecology and Society [online], 11(2).

75. Gaarder. T. and H. H. Gran. (1927). Investigations of the production of plankton in the Oslo

Fjord. Rapp. Et. Proc.-Verb., Cons. Int. Explor. Mer, 42: l-48.”

76. Gandhi, A. (1997). On a porpoise (Neophocaena phocaenoides) stranded along Palk bay coast,

near Thondi, Tamil Nadu. Mar.Fish. Infor. Serv.,T&E Ser.117: 17.

77. Garrick, J.A.F. (1964). Additional Information on the Morphology of an Embryo Whale Shark.

Proc. U.S. Nat. Mus., 115(3476): 1-7.

78. Gifford, A., Compagno, L. J. V., Levine, M and Antoniou, A. (2007). Satellite tracking of whale

sharks using tethered tags. Fisheries Research, 84(1), 17-24.

79. Gill, T. (1905). On the habits of the great whale shark (Rhineodon typus). Science21, 790–791.

80. Gopakumar, G., Ajithkumar, T. T., Krishnapriyan, M. (2003). Juvenile whale shark, Rhinocodon typus (Smith) caught at Vizhinjam. Marine Fisheries Information Service, Technical and Extension Series, 175 p 11

81. Graham R.T. (2003). Behavior and conservation of whale sharks on the Belize barrier reef.

University of York:

82. Graham. R.T. (2007). Whale sharks of the Western Caribbean: an overview of current research

and conservation efforts and future needs for effective management of the species. Gulf .Caribb. Res .19: 149–159.

83. Graham, R. T. and Roberts. C.M. (2007). Assessing the size, growth and structure of a seasonal

population of whale sharks (Rhincodon typus (Smith 1828) using conventional tagging and

photo identification. Fisheries Research 84:71-80.

84. Gruber, D. (1982). Distribution of ichthyoplankton in the Southern California Bight. CalCOFI

Rep. 23:172–179.

85. Gudger, E. W. (1939). The whale shark in the Caribbean Sea and the Gulf of Mexico. Sci.

Monthly. 48: 61-264,

86. Gudger, E. W. (1940). Whale sharks rammed by ocean vessels. How these sluggish leviathans

aid in their own destruction. New England Naturalist, 7 : 1-10.

87. Gunn, J. S., Stevens, J. D., Davis, T. L. O and Norman, B. M. (1999). Observations on the short-

term movements and behaviour of whale sharks (Rhincodon typus) at Ningaloo Reef, Western

Australia. Marine Biology, 135(3), 553-559.

88. Hacohen-Domene, A., Galvan-Magana, F and Ketchum-Mejia, J., (2006). Abundance of whale

shark (Rhincodon typus) preferred prey species in the southern Gulf of California, Mexico.

153

Cybium 30: 99- 102.

89. Haig, S. M. (1998). Molecular contributions to conservation. Ecology.

90. Hanfee , F. (2001). Gentle giants of the Sea, TRAFFIC India, New Delhi.

91. Hall, T. A. (1999). BioEdit: a user-friendly biological sequence alignment editor and analysis

program for Windows 95/98/NT. Nucleic Acids Symposium Series Ser. 41: 95-98.

92. Haq, S. M, Khan, J. A and Chugti, S. (1973). The distribution of zooplankton along the post

monsoon and pre monsoon periods. In: Zeitzschel B (ed) The biology of the Indian Ocean.

Springer Verlag, Berlin. Pp. 257–272

93. Heist. J., Musick, J. A. and Graves, J. E. (1996). Genetic population structure of the short fin

mako (Isurus oxyrinchus) inferred from restriction fragment length polymorphism analysis of

mitochondrial DNA. Can. J. Fish. Aquat. Sci. 53:583-588.

94. Hembree, E. D. (1980). "Biological Aspects of the Cetacean Fishery at Lamalera, Lembata."

World Wildlife Fund Project.

95. Heupel, M. R and Bennett, M. B. (1997). Histology of dart tag insertion sites in the epaulette

shark. Journal of Fish Biology. 50 (5): 1034 – 1041.

96. Heyman, W. D., Graham, R. T., Kjerfve, B and Johannes, R. E. (2001). "Whale sharks, Rhincodon typus aggregate to feed on fish spawn in Belize." Marine Ecology-Progress Series, 215: 275-

282.

97. Hoffmayer, E. R., Franks, J. S. and Shelley, J. P. (2005). Recent observations ofthe whale shark

(Rhincodon typus) in the north central Gulf of Mexico. Gulf and Caribbean Research. 17, 117

– 120

98. Hoffmayer, E. R., Franks, J.S., Driggers, W.B., Oswald, K. J and Quat-tro, J.M. (2007).

Observations of a feeding aggregation of whale sharks (Rhincodon typus) in the north central

Gulfof Mexico. Gulf Caribb Res. 19: 69–73

99. Holeton. G.F. and Heisler. N. (1978). Acid-base regulation by bicarbonate exchange in the gills

after exhausting exercise in the larger spotted dogfish Scyliorhinus stellaris. Physiologist 21:

Pp. 56.

100. Holeton, G.F. and Heisler, N. (1983). Contribution of net ion transfer mechanisms to the acid-

base regulation after exhausting activity in the larger spotted dogfish (Scyliorhinus stellaris).

J. Exp. Biol. 103: 31-46.

101. Hsu, H. H., Joung, S. J., Liao, Y. Y. and Liu, K. M. (2007b). Satellite tracking of juvenile whale

sharks, Rhincodon typus, in the Northwestern Pacific. Fisheries Research, 84(1) : 25-31.

102. Hsu, H.-H., Joung, S.-J., Liao, Y.-Y and Liu, K.-M. (2007a). Satellite tracking of juvenile Whale

Sharks, Rhincodon typus, in the Northwestern Pacific. Fisheries Research, 84(1): 25-31.

103. Hueter, R. E., Heupel, M. R., Heist. E. J and Keeney, D.B. (2004). Evidence of Philopatry in

sharks and Implications for the Management of Shark Fisheries. J. Northw. Atl. Fish. Sci. 35:

239-247.

104. Huntington, H. P. (1998). Observations on the utility of the semi-directive interview for

documenting traditional ecological knowledge. Arctic. 51(3): 237-42.

105. Huntington, H. P., Buckland, C., Elim., Koyuk., PointLay and Shaktoolik. (1999). Traditional

knowledge of the ecology of beluga whales (Delphinapterus leucas) in the Eastern Chukchi

and Northern Bering Seas, Alaska. Arctic, 52(1), 49-61.

106. Huntington, H. P., Suydam, R. S and Rosenberg, D. (2004). Traditional knowledge and

satellite tracking as complementary approaches to ecological understanding. Environmental Conservation, 31(3), 177-180.

107. Hyslop, E. J. (1980). Stomach content analysis—a review of methods and their application.

Journal of Fish Biology. 17: 411–429.

154

108. Jacob, P.K and Ebenezer, M.D. 1994. The piscivorous habits of the rorqual or fin whale

(Balaenoptera sp.). J. Bombay Nat. Hist. Soc. 47: 156–58.

109. Jadhav, D.G., B.B. Chavan, A.D. Sawant and Sundaram. S (2005). On a Whale Shark, Rhinodon typus landed at Versova, Mumbai. Marine Fisheries Information Service, Technical and Extension Series 18(186): 18.

110. Jarman, S. N., and Wilson, S. G. (2004). DNA-based species identification of krill consumed by

whale sharks. Journal of Fish Biology, 65(2): 586-591.

111. Johannes, R. E and Yeeting, B. (2001). I-Kiribati knowledge and management of Tarawa's

lagoon resources. Atoll Research Bulletin, 489: 1-24.

112. Jonahson, M and Harding, S. (2007). Occurrence of whale sharks (Rhincodon typus) in

Madagascar. Fisheries Research, 84(1) : 132-135.

113. Jones, R. (1979). Materials and methods used in marking experiments in fishery research. FAO

Fisheries Technical Paper 190: Pp. 134.

114. Joung, S.-J., Chen, C.-T., Clark, E., Uchida, S and Huang, W. Y. P. (1996). The whale shark,

Rhincodon typus, is a livebearer: 300 embryos found in one 'megamamma' supreme.

Environmental Biology of Fishes, '46(3), 219-223.

115. John, S. (2010). Observation of a whale shark Rhincodon typus (Orectolobiformes: Rhincodontidae) in the offshore waters of Rushikulya, Orissa, India. J Threatened Taxa 2:896–897

116. Joung, S.J., Chen, C.T., Clark, E., Uchida, S and Huang, W. Y. P. (1996). The whale shark,

Rhincodon typus, is a livebearer: 300 embryos found in one ‘megamamma’ supreme. Environ Biol Fish 46: 219–223

117. Kaikini, A. S., Rao, V.R and Dhulkhed, M. H. (1959). A note on the whale shark Rhincodon typus Smith, stranded off Mangalore. J Mar Biol Assoc India 4: 92–93.

118. Karbhari, J. P and Josekutty, C. J. (1986). On the largest whale shark Rhincodon typus Smith

landed alive at Cuffe Parade, Bombay. Mar Fish Inf Serv Tech Ext Ser 66: 31–35.

119. Katona, S. K., Baxter, B., Brazier, O., Kraus, S., Perkins, J and Whitehead. (1979). Identification

of humpback whales by fluke photographs. pp. 33-34 .In: Winn, H.E. and B.Olla (eds.), The Behavior of Marine Mammals, Vol 3, Plenum, New York and London.

120. Kasinathan, C., Sukumaran, S., Ramamoorthy, N., Balachandran, K and Mandapam, R. C.

(2006). Whale shark Rhincodon typus landed at Mandapam, Gulf of Mannar. Mar Fish Inf Serv Tech Ext Ser 187:21

121. Kieffer. D. J. (2000). Review – Limits to exhaustive exercise in fish. Comparative Biochemistry

and Physiology, 126 (a): 161-179.

122. Klimley, A.P.(1996). Residency patterns of white sharks at the South Farallon Islands,

California. In: Klimley, A.P., Ainley, D.A. (Eds.), Great White Sharks: The Biology of Carcharodon carcharias. Academic Press Inc., San Diego, California. Pp. 365–374.

123. Kemparaju, S., Muniyappa, L and Mahadevaswamy, H. S. (2002). On a Whale Shark

Rhiniodon typus landed at Malpe, Udupi district, Karnataka. Marine Fisheries Information Service,Technical and Extension Series 171: 9.

124. Keeney, D. B., Heupel, M., Hueter, R.E and Heist. E.J. (2003). Genetic heterogeneity among

black tip shark, (Carcharhinus limbatus), continental nurseries along the U.S. Atlantic and

Gulf of Mexico. Marine Biology.. 143: 1039-1046.

125. Kohler, N. E., Casey, J.G and Turner, P.A. (1998). NMFS cooperative shark tagging program,

1962–93: An atlas of shark tag and recapture data. Marine Fisheries Review. 60(2): 87.

126. Krishna-Pillai, S. (1998). On a whale shark Rhinodon typus found accompanied by its young.

Mar Fish Inf Serv 152:15

155

127. Kulkarni, C.V. (1948). Outsize whale shark in Bombay waters. J Bombay Nat Hist Soc. 47:

762–763

128. Kumari, B and Raman, M. (2010) Whale shark habitat assessments in the northeastern Arabian

Sea using satellite remote sensing. Int. J. Remote Sens 31: 379–389

129. Kuthalingam MDK, Luther G, Livingston P, Murty VS (1973). Further occurrences of the

whale shark, Rhincodon typus Smith in the Indian coastal waters. Indian J Fish 20:646–651.

130. Kukuyev, E.I. (1996). The New Finds in Recently Born Individuals of the Whale Shark

Rhiniodon typus (Rhiniodontidae) in the Atlantic Ocean. J. Ichthyol. 36(2): 203-205.

131. Lack, M. and Sant, G. (2006). World shark catch, production and trade 1990-2003. Dept. of the

Environment and Heritage, Australian Government and TRAFFIC Oceania, Canberra, A.C.T.

132. Lager, K.F. (1949). Studies in Freshwater Fishery Biology. Ann. Arbor. Michigan.

133. Leu, M., Chang, W. and Fang. L. (1997). The success of keeping a baby whale shark from its

fetal stage in Taiwan. Proceedings of the Fourth International Aquarium Congress, Tokyo.

Pp.109-111

134. Lionnet, G. (1984). Terrestrial testaceous mollusks of the Seychelles Islands; Monographiae Biologicae. The Haugue: Junk.

135. Lopez-Espinosa de los Monteros, R. (2002). Evaluating ecotourism in natural protected areas

of La Paz Bay, Baja California Sur, Mexico: ecotourism or nature-based tourism?. Biodiversity and Conservation, 11(9): 1539-1550.

136. Lukacs, P.M. and Burnham, K.P. (2005-a). Review of capture–recapture methods applicable to

non-invasive genetic sampling. Molecular Ecology 14: 3909-3919

137. Mattson, M.T., Waldman, J.R., Dunning, D.J. and Ross, Q.E. (1990). Abrasion and protrusion of

internal anchor tags in Hudson River striped bass. American Fisheries Society Symposium,

7: 121-126.

138. Maldives Whale Shark Expedition. (2006). South Ari Atoll, Republic of Maldives: Site Fidelity

of Rhicodon typus to the Republic of Maldives. Maldives Whale Shark Expedition 2006 in

Association with the Marine Research Centre Male.

139. Mallory, M. L., Fontaine, A. J., Akearok, J. A., and Johnston, V. H. (2006). Synergy of local

ecological knowledge, community involvement and scientific study to develop marine wildlife

areas in eastern Arctic Canada. Polar Record, 42(222) : 205-216.

140. Manire. C., Heuter. R., Hull. E and Spieler. R. (2001). Serological changes associated with

gillnet capture and restraint in three species of sharks. Trans Am Fish Soc. 130: 1038-1048.

141. Manojkumar, P. P. (2003). An account on the smallest whale shark, Rhincodon typus (Smith

1828). Mar Fish Inf Serv Tech Ext Ser 176: 9–10.

142. Marine Conservation Society Seychelles. (2006). Taiwan Whale Shark Fishery Closed - Official.

SAGREN: Seychelles Whale Shark Monitoring Newsletter. 4: No 4.

143. Martin, R. A. (2007). A review of behavioral ecology of whale sharks (Rhincodon typus).

Fisheries Research, 84(1): 10-16.

144. Maynou. .F, Sbrana. M., Sartor. P., Maravelias. C and Kavadas S. (2011). Estimating Trends of

Population Decline in Long-Lived Marine Species in the Mediterranean Sea Based on Fishers'

Perceptions. PLoS ONE 6(7): e21818. doi:10.1371/journal.pone.0021818

145. McAllister, K.W.,McAllister, P.E., Simon, R.C. and Werner, J.K. (1992). Performance of nine

external tags on hatchery reared rainbow trout. Transactions of the American Fisheries Society, 121: 192-198.

146. McFarlane, G., King, J., Leask, K and Christensen, L. B. (2009). DFO. Can. Sci. Adv. Secr. Res.

Doc. 2008/071. vi + 98 p.

156

147. Meekan, M. G., Bradshaw, C. J. A., Press, M., McLean, C., Richards, A., Quasnichka, S., and

Taylor, J. G. (2006). Population size and structure of whale sharks Rhincodon typus at

Ningaloo Reef, Western Australia. Marine Ecology-Progress Series, 319, 275-285.

148. Meekan, M.G., Jarman, S.N., McLean, C and Schultz, M.B. (2009). DNA evidence of whale

sharks (Rhincodon typus) feeding on red crab (Gecarcoidea natalis) larva eat Christmas

Island. Australia. Mar. Freshw. Res. 60: 607–609.

149. Milligan. C. L and Wood. C.M. (1986). Tissue intracellular acid-base status and the fate of

lactate after exhaustive exercise in the rainbow trout. Journal of Experimental Biology. 123:

123-144.

150. Milligan. L. C. (1996). Metabolic recovery from exhaustive exercise in rainbow trout. Comp.

Biochem. Physiol. 113a (1): 51-60.

151. Miller, R.A., Reimschuessel, R and Carson, M.C. (2007). Determination of ox tetracycline levels

in rainbow trout serum on a biphenyl column using high performance liquid chromatography.

Journal of Chromatography B 852: 655– 658.

152. Morgan. A. and Burgess. G. (2004). Fishery-independent sampling: total catch, effort and

catch composition, pp. 241-263. In: Musick, J.A. and R. Bonfil (eds.), Elasmobranch Fisheries

Management Techniques, APEC Fisheries Working Group, Singapore.

153. Morgan, M.J. and Walsh, S.J. (1993). Evaluation of the retention of external tags by juvenile

American plaice (Hippoglosoides platessoides) using an aquarium experiment. Fisheries Research. 16, 1 – 7.

154. Moller, H., Berkes, F., Lyver, P. O. B and Kislalioglu, M. (2004). Combining Science and

Ecological Knowledge: Monitoring Populations for Co-management. Ecology and Science

[online], 9(3): 2.

155. Mymrin, N. I., The Communities of Novoechaplino., Sireniki., Uelen & Yanrakinnot

and Huntington, H. P. (1999). Traditional Knowledge of the Ecology of Beluga Whales

(Delphinapterus leucas) in the Northern Bering Sea, Chukotka, Russia. Arctic, 52(1): 62-70.

156. Nakashima, B.S. and Winters, G.H. (1984). Selection of external tags for marking Atlantic

herring (Clupea harengus harengus). Canadian Journal of Fisheries and Aquatic Science,

41: 1341-1348.

157. Nelson, J. D. and Eckert, S. A. (2007). Foraging ecology of whale sharks (Rhincodon typus)

within Bahia de Los Angeles, Baja California Norte, Mexico. Fisheries Research, 84(1): 47-64.

158. Nielsen, J. (1988). A review on marking and tagging methods applied to eel (Anguilla anguilla (L.)). Eifac-Occas. Pap. Part 2. Rome, Italy, FAO 1988, no. 21: Pp. 24..

159. NHT. (2005). Whale Shark (Rhincodon typus) Recovery Plan Issues Paper. National Heritage

Trust, Department of the Environment and Heritage, Australian Government.

160. Norman, B.M. (1999). Aspects of the biology and ecotourism industry of the Whale Shark

(Rhincodon typus) in North-Western Australia. M.Phil. Thesis (Murdoch University, Western

Australia).

161. Norman, B. (2000). Rhincodon typus. In: IUCN 2006. 2006 IUCN Red List of Threatened

Species.

162. Norman, B.M. (2004). Review of the current conservation concerns for the Whale Shark

(Rhincodon typus): A regional perspective. Technical Report (NHT Coast & Clean Seas Project

No. 2127). Pp. 74.

163. Norman, B. (2005). Rhincodon typus. In: IUCN 2010. IUCN red list of threatened species.

Version 2010.4. (www.iucnredlist.org).Downloaded on 28 January 2011.

164. Norman, B. M and Stevens, J. D. (2007). Size and maturity status of the whale shark (Rhincodon typus) at Ningaloo Reef in Western Australia. Fisheries Research, 84(1): 81-86.

157

165. Orams, M. B. (2002). Humpback Whales in Tonga: An Economic Resource for Tourism. Coastal

Management, 30(4): 361-380.

166. Parker, P. G. (1998). What molecules can tell us about populations: choosing and using a

molecular marker. Ecology.

167. Pai, M. V., Nandakumar, G and Telang, K.Y. (1983). On a whale shark Rhinodon typus Smith

landed at Karwar, Karnataka. Indian J Fish 30:157–160

168. Paul, S. (2006). Whale Shark Rhiniodon typus landed at Kollam. Marine Fisheries Information Service, Technical and Extension Series 190: 22.

169. Pauly, D. (2002). Growth and mortality in basking shark Cetorhinus maximus, and their

implications for whale shark Rhincodon typus. Elasmobranch biodiversity: conservation

and management. Proceedings of an International Seminar and Workshop held in Sabah,

Malaysia., Sabah, Malaysia. 199-208.

170. Paulinose, V. T., Aravindakshan, P.N. (1977). Zooplankton biomass, abundance and

distribution in the north and northeastern Arabian Sea. Proceedings of the symposium on warm water zooplankton. National Institute of Oceanography, Goa. Pp. 132-136

171. Piiper. J., Meyer. M and Drees. F. (1972). Hydrogen ion balance in the elasmobranch Scyliorhinus

stellaris after exhausting activity. Resp. P. kysiol. 16: 290-303.

172. Pickering. A. D. (ed.). 1981. Stress and fish. Academic Press, New York.

173. Pillai, R. S. (1929). List of fishes taken in Travancore from 1901– 1915. J Bombay Nat Hist Soc 33: 347–379.

174. Pine. R., Alava, M. N. R and Yaptinchay. A.A. (2007). Challenges and lessons learned in setting-

up a community-based whale shark eco-tourism program: The case in Donsol, Philippines.

In: Irvine TR, Keesing JK(eds) The First International Whale Shark Conference: Promoting

International Collaboration in Whale Shark Conservation, Science and Management.

Conference Overview, Abstracts and Supplementary Proceedings. CSIRO Marine and

Atmospheric Research, Australia. Pp. 36–44

175. Prater, S.H. (1941). The whale shark (Rhinodon typus Smith) in Indian Coastal waters. J Bombay Nat Hist Soc 42: 255–279

176. Pravin. P. (2000). Whale shark in the Indian coast—need for conservation. Curr Sci. 79: 310–

315.

177. Pravin, P., Remesan, M.P and Solanki, K. K. (2004). Commercial fishing of whale sharks

(Rhincodon typus Smith) in Gujarat. In: Somvanshi VS (ed) Large marine ecosystem:

exploration and exploitation for sustainable development and conservation of fish. Fishery Survey of India, Mumbai. Pp. 312–318.

178. Quiros, A. (2005). Whale Shark Ecotourism in the Philippines and Belize: Evaluating

conservation and community benefits. Tropical Resources Bulletin, 24: 42-48.

179. Quiros, A. L. (2007). Tourist compliance to a Code of Conduct and the resulting effects on

whale shark (Rhincodon typus) behavior in Donsol, Philippines. Fisheries Research, 84(1):

102-108.

180. Radhakrishnan, E. V., Chakraborty., Rekha, D., Thangaraja, R and Unnikrishnan, C. (2009).

Effect of Nanno chloropsis salina on the survival and growth of phyllosoma of the tropical

spiny lobster, Panulirus homarus L. under laboratory conditions. Journal of Marine Biological Association of India, 51 (1). pp. 52-60

181. Rajapackiam, K. and S. Mohan (2006). A giant Whale Shark (Rhincodon typus) caught at

Chennai fisheries harbour. Marine Fisheries Information Service, Technical and Extension Series 189: 25.

182. Rajapackiam, K. and S. Mohan (2006). A giant Whale Shark (Rhincodon typus) caught at

158

Chennai fisheries harbour. Marine Fisheries Information Service, Technical and Extension Series 189: 25.

183. Ramirez-Macias, D., Vazquez-Juarez, R., Galvan-Magana, F., and Munguia-Vega, A. (2007).

Variations of the mitochondrial control region sequence in whale sharks (Rhincodon typus)

from the Gulf of California, Mexico. Fisheries Research, 84(1): 87-95.

184. Randi, E. (2000). Mitochondrial DNA. En: Molecular Methods in ecology. A.J. Baker (Ed).

Blackwell. Oxford.

185. Rao, C.V.S. (1992). The occurrence of Whale Shark Rhinodon typus along the Kakinada coast.

Marine Fisheries Information Service, Technical and Extension Series. 116: 19.

186. Rao, G.S. (1986). Note on the occurrence of the whale shark Rhincodon typus Smith off

Veraval coast. Mar Fish Inf Serv Tech Ext Ser 66:30

187. Rasmussen, G. (1980). Comparisons of different types of tags from the recaptures of marked

trout (Salmo trutta L.) in Denmark. ICES C.M. 1980/M:35.

188. Rasmussen, G. (1982). A pilot experiment with different types of external tags. ICES CM

1982/M:8.

189. Riley, M. J., Harman, A. and Rees, R.G. (2009). Evidence of continued hunting of whale sharks

Rhincodon typus in the Maldives. Environ Biol Fish 86: 371–374.

190. Reid and George K. (1957). External Morphology of an Embryo Whale Shark, (Rhincodon

typus). Smith. Copeia, 1957(2): 157-158.

191. Riley, M.J., Hale, M.S., Harman, A and Rees, R.G. (2010). Analysis of whale shark Rhincodon typus aggregations near South Ari Atoll, Maldives Archipelago. Aquat Biol 8: 145–150

192. Robertson, D.G. (2005). Metabonomics in Toxicology: A Review. Toxicological Sciences 85:

809–822.

193. Rodriguez-Dowdell, N., Enriquez-Andrade, R and Cardenas-Torres, N. (2007). Property rights

based management: Whale shark ecotourism in Bahia de los Angeles, Mexico. Fisheries Research, 84(1): 119-127.

194. Romanov, E.V. (2002). By catch in the tuna purse-seine fisheries of the western Indian Ocean.

Fish Bull 100: 90–105.

195. Rosel, P. E. and B. A. Block. (1996). Mitochondrial control region variability and global

population structure in the swordfish, Xiphias gladius. Mar. Biol. 125:11-22.

196. Rowat, D. (1997). Seychelles whale shark tagging project – pilot project report. Phelsuma.

Nature Protection Trust of Seychelles. 5: 77–80.

197. Rowat.,D. (2007). Occurrence of whale shark (Rhincodon typus) in the Indian Ocean: a case

for regional conservation. Fish Res. 84: 96–101

198. Rowat, D. (2010). Whale sharks—an introduction to the world’s largest fish from one of the

world’s smallest nations, the Seychelles. Marine Conservation Society Seychelles, Victoria.

199. Rowat, D., Meekan, M.G., Engelhardt, U., Pardigon, B and Vely M (2006) Aggregations of

juvenile whale sharks (Rhincodon typus) in the Gulf of Tadjoura, Djibouti. Environ Biol Fish 80: 465–472.

200. Rowat, D., Gore, M.A., Baloch, B.B,. Islam. Z., Ahmad. E., Ali QM., Culloch, R.M., Hameed.

S., Hasnain, S.A., Hussain. B., Kiani, S., Siddiqui, J., Ormond, R.F., Henn, N. and Khan,

M. (2008). New records of neonatal and juvenile whale sharks (Rhincodon typus) from the

Indian Ocean. Environ Biol Fish 82: 215–219.

201. Rowat, D., Speed, C.W., Meekan, M.G., Gore, M. and Bradshaw, C. J. A. (2009). Population

abundance and apparent survival estimates of the Seychelles whale shark aggregation. Oryx

43: 591–598

159

202. Sajeela, K. A., Rakhee, C., Rekha, J.N., Gopalakrishnan, A., Basheer, V.S., Kizhakudan,

S.J., Kizhakudan, J.K., Vijayan, K.K and Lakra, W.S. (2010). Mitochondrial DNA sequences

for forensic identification of the endangered whale shark, Rhincodon typus (Smith, 1828).

In: Nimis PL, Vignes Lebbe R (eds) Tools for identifying biodiversity: progress and problems.

Edizioni Università di Trieste, Paris. Pp. 353–354

203. Sambrock, L., Fritsch, E.F and Maniatis. T (1989). Molecular cloning: a laboratory manual.

Cold Swing Harbor Laboratory Press, Cold Spring Harbor, N.Y.

204. Samuelsson, L., Forlin, L., Karlsson, G., Adolfssonerici, M. and Larsson D (2006). Using NMR

metabolomics to identify responses of an environmental estrogen in blood plasma of fish.

Aquatic Toxicology 78: 341–349.

205. Schmidt, J.V., Schmidt, C.L., Ozer, F., Ernst, R.E. and Feldheim, K.A. (2009). Low Genetic

Differentiation across Three Major Ocean Populations of the Whale Shark, (Rhincodon typus).

PLoS ONE 4(4):e4988.

206. Schwalme, K and Mackay, W.C.(1985 b).The influence of angling induced exercise on the

carbohydrate metabolism of the northern pike (Esox lucius L.). J.comp.Physiol.156 (B): 67-75.

207. Eckert, S. A., Brent, S and Stewart. (2001). Telemetry and satellite tracking of whale sharks,

Rhincodon typus, in the Sea of Cortez, Mexico, and the North Pacific Ocean. Environmental Biology of Fishes. 60. Pp: 299–308.

208. Skomal, G and Chase, B. (2002). The physiological effects of angling on post-release survivorship

in tunas, sharks, and marlin. In: J.A. Lucy & A.L. Studholme (eds) Catch and Release in Marine Recreational Fisheries. Bethesda, MD, USA: American Fisheries Society Symposium. 30:

Pp. 135–138

209. Skomal. G. (2006). The physiological effects of capture stress on post – release survivorship of

sharks, tunas and marlin. Ph.D. thesis. Boston University. Pp. 312.

210. Sleeman. C. J., Meekan. M. G., Wilson. S. G., Polovina. J. J., Stevens, J. D., Boggs, G. S and

Bradshaw, C. J .A . (2010). To go or not to go with the flow: Environmental influences on

Whale shark movement patterns. Journal of Experimental Marine Biology and Ecology. 390:

84-98.

211. Spargo, A. (2001). The physiological effect of catch and release angling on the post – release

survivorship of juvenile sandbar sharks (Carcharhinus plumbeus). Master thesis. University

of Rhode Island. Pp. 99.

212. Silas, E. G. (1986). The whale shark (Rhincodon typus Smith) in Indian coastal waters: is the

species endangered or vulnerable?. Mar Fish Inf Serv Tech Ext Ser 66:1–19

213. Silas, E. G and Rajagopalan, M.S. (1963). On a recent capture of a whale shark (Rhincodon typus Smith) at Tuticorin, with a note on information to be obtained on whale sharks from

Indian waters. J Mar Biol Assoc India. 5: 153–157.

214. Sims, D.W., Speedie, C.D., Fox, A.M., (2000). Movements and growth of a female basking shark

re-sighted after a three year period. J. Mar. Biol. Assoc. U.K. 80, 1141–1142.

215. Sims, D.W., Southall, E.J., Richardson, A.J., Reid, P.C., Metcalfe, J.D., (2003). Seasonal

movements and behaviour of basking sharks from archival tagging: no evidence of winter

hibernation. Mar. Ecol. Prog. Ser. 248: 187–196.

216. Smith. A. (1829). Descriptions of new or imperfectly known objects of the animal kingdom,

found in the south of Africa. South African Community Advencture. 3:2

217. Sokal, R. R. and Rohlf, F. J. (1994). Biometry: the principles and practice of statistics in

biological research. 3rd edition. New York.

218. Speed, C. W., Meekan, M. G., Russell, B., and Bradshaw, C. J. A. (2000). First records of

stranding of whale sharks (Rhincodon typus) in Australia. Stacey, N. (2000). Pearlers, Planes

160

and People of the Sea: Early Bajo voyages to the north Australian region. Bulletin of the Australian Institute of Maritime Archaeology, 24: 41- 50.

219. Speed, C., Meekan, M., and Bradshaw, C. (2007). Spot the match - wildlife photo-identification

using information theory. Frontiers in Zoology, 4(1).

220. Stacey, N. E., Karam, J., Meekan, M. G., Pickering, S. and Ninef, J. (2012). Prospects for

whale shark conservation in Eastern Indonesia through bajo traditional ecological knowledge

and community-based monitoring. Conservation Soc 2012, 10: 63-75

221. Stacey, N. (2007). Boats to Burn: Bajo fishing activity in the Australian Fishing Zone. Asia- Pacific Environment Monograph Series, ANU E Press, Canberra.

222. Stevens, J. D. (2007). Whale shark (Rhincodon typus) biology and ecology: a review of the

primary literature. Fish Res 84: 4–9.

223. Strickland, J. D. H and T.R. Parsons. (1968). A practical hand book of seawater analysis. Ottawa:

Fisheries research board of Canada. Bulletin 167. Pp. 293.

224. Takahashi, M., Okamura, H., Yokawa, K and Okazaki, M. (2003). Swimming behavior and

migration of a swordfish recorded by an archival tag. Mar. Freshwater Res. 54 (4): 527–534.

225. Taylor and Geoff. (1989). Whale Sharks of Ningaloo Reef, Western Australia: a Preliminary

Report. W. Austr. Nat., 18(1): 7-12.

226. Taylor, J. G. (1994). Whale Sharks, the giants of Ningaloo Reef. Angus & Robertson, Sydney.

Pp. 176.

227. Taylor, J. G. (1996). Seasonal occurrence, distribution and movements of the whale shark,

Rhincodon typus, at Ningaloo Reef, Western Australia. Marine and Freshwater Research, 47:

637-642.

228. Taylor, J. G. (2007). Ram filter-feeding and nocturnal feeding of whale sharks (Rhincodon typus) at Ningaloo Reef, Western Australia. Fisheries Research, 84(1): 65-70.

229. Taylor, J. G and Pearce, A. F. (1999). Ningaloo Reef currents: Implications for coral spawn

dispersal, zooplankton and whale shark abundance. Journal of the Royal Society of Western Australia, 82: 57-65.

230. Theberge, M. M and Dearden, P. (2003). An Approach to an Integrated Marine Fish

Monitoring Program - Mu Koh Surin Marine National Park, Thailand. Making Ecosystem

Based Management Work: Connecting Managers and Researchers, 73 Proceedings of the Fifth International Conference on Science and Management of Protected Areas, 11-16, May 2003,

Neil W.P. Munro, Phil Deardon, Tom B. Herman, Karen Beazley, and S. Bondrup-Nielsen, eds.,

SAMPAA, Wolfville, Nova Scotia, Canada.

231. Theberge, M. M and Dearden, P. (2006). Detecting a decline in whale shark Rhincodon typus sightings in the Andaman Sea, Thailand, using ecotourism operator-collected data. Oryx,

40(3): 337-342.

232. Turnbull. S. D and J. E .Randell . (2006a) Rare occurrence of a Rhincodon typus (Whale

shark) in the Bay of Fundy, Canada. Northeastern Naturalist. 13(1): 57-58.

233. Turnbull, S. D and Randell, J. E. (2006b). Rare occurrence of a Rhincodon typus (Whale

shark) in the Bay of Fundy, Canada. Northeastern Naturalist, 13, 57-58.

234. Viant, M. R. (2003). Improved methods for the acquisition and interpretation of NMR

metabolomic data. Biochemical and Biophysical Research Communications 310: 943–948

235. Vivekanandan, E and Zala, M. S. (1994). Whale shark fishery off Veraval. Indian J Fish, 41:

37–40

236. Walpole, M. J. and Goodwin, H. J. (2001). Local attitudes towards conservation and tourism

around Komodo National Park, Indonesia. Environmental Conservation, 28(2): 160-166.

161

237. Walpole, M. J. and Leader-Williams, N. (2002). Tourism and flagship species in conservation.

Biodiversity and Conservation, 11: 543-547.

238. Weathers, K.C., Morse, S.L., Bain, M.B. and Davies, W.D. (1990). Effects of abdominally

implanted internal anchor tags on largemouth bass. American Fisheries Society Symposium 7:

117-120.

239. Weihs. D. (1981).Effects of swimming path on the energetic of fish motion. Fishery Bull. Fish

Wildl. Serv. (U.S.). 79: 171-176.

240. Wells, R.M.G., McIntyre, R.H., Morgan, A.K and Davie, P.S. (1986). Physiological stress

responses in big game fish after capture: observations on plasma chemistry and blood factors.

Comp. Biochem. Physiol. A. 84, 565

241. Wells, R.M.G., Tetens. V and Devries. A. (1984). Recovery from stress following capture and

anaesthesia of antarctic fish: haematology and blood chemistry. J Fish Biol. 25: 567-576.

242. White. W. T and Cavanagh. R. (2007). Whale shark landings in Indonesian artisanal shark

and ray fisheries. In: Irvine TR, Keesing JK (eds) Whale sharks: science, conservation and

management. Proceedings of the First International Whale Shark Conference, 9–12 May

2005 Australia. Fish Res. 84:128–13.

243. Wilson, S.G., Pauly, T and Meekan, M.G. (2002). Distribution of zooplankton inferred from

hydroacoustic backscatter data in coastal waters off Ningaloo Reef, Western Australia. Mar. Freshw. Res. 53. Pp. 1005.

244. Wilson, S.G. and New bound, D.R. (2001). Two whale shark faecal samples from Ningaloo

Reef, Western Australia. Bull. Mar. Sci. 68: 361–362.

245. Wilson, S.G., Lutcavage, M.E., Brill, R.W., Genovese, M.P., Cooper, A.B. and Everly, A.W. (2005).

Movements of blue fin tuna (Thunnus thynnus) in the northwestern Atlantic Ocean recorded

by pop-up archival tags. Mar. Biol. 146 (2), 409–423.

246. Wood, J. M., Schild. G. C., Newman. R. W. and Seagroatt. V. (1977). An improved single radial

immano diffusion technique for the assay of influenza haemagglutinin antigen: application for

potency determinations of inactivated whole virus and subunit vaccines. Journal of Biological Standardization. 5: 237-247.

247. Wolfson, F. H. (1983). Records of seven juveniles of the whale shark, Rhiniodon typus. Journal Fish Biology. 22(6): 647 – 655.

248. Wood, C. M., Turner, J. D. and Graham, M. S. (1983). Why do fish die after severe exercise?

Journal of Fish Biology. 22 (1). 89-201.

249. Wood, J. and Donna. (1991). Corporate social performance revisited. Academy of Management

review. 16(4): 691-718.

162

OTHER WTI PUBLICATIONS

A. OCCASIONAL REPORTS

Tribal Territories:

Impact assessment around the Jarawa tribal reserve, middle and south Andaman Islands

Captive Concerns:

Health and management of captive elephants in Jaipur

Jumbo Express:

A scientific approach to understanding and mitigating elephant mortality due to train accidents in Rajaji National Park.

Fair Concern:

Health and management of captive elephants in Sonpur

Elephant in Exile:

A rapid assessment of the human-elephant conflict in Chhattisgarh

Ganesha to Bin Laden:

Human-elephant conflict in Sonitpur district of Assam

Healing Touch:

Health and management of captive elephants at Kaziranga elephant festivals

Dog and Bull:

An investigation into carnivore-human conflict in and around Itanagar Wildlife Sanctuary, Arunachal Pradesh

Against the Current:

Otters in the river Cauvery, Karnataka

Making Way

Securing the Chilla-Motichur Corridor to protect elephants of Rajaji National Park

Silent Stranglers:

Eradication of mimosa in Kaziranga National Park, Assam

Living at the Edge:

Rapid survey for the endangered Ladakh urial (Ovis vignei vignei) in Leh district of Ladakh Trans-Himalaya

Search for Spectacle:

A conservation survey of the Phayre’s leaf monkey (Tranchypithecus phayrei) in Assam and Mizoram

Sighting Storks:

Status and distribution of Greater adjutant storks (Leptoptilos dubius) in the Ganga and Kosi river floodplains near

Bhagalpur, Bihar

Bait and Watch:

Popularization of alternatives to dolphin oil among fishermen for the conservation of the Ganges river dolphin

(Plantanista gangetica) in Bihar

No Mast Kalandar:

The beginning to the end of dancing with bears

163

Awaiting Arribadda:

Protection of Olive Ridley turtles (Lepidochelys olivacea) and their nesting habitats at Rushikuliya rookery, Orissa

Living with Giants:

Understanding human-elephant conflict in Maharashtra and adjoining areas

Crane Capital:

Conservation strategy for Sarus Crane (Grus antigone) habitat in Etawah and Mainpuri Districts, Uttar Pradesh

Deadly Tracks:

A scientific approach to understanding and mitigating elephant mortality due to train hits in Assam

Carnivore Conflict:

Support provided to leopards involved in conflict related cases in Maharashtra

India at the International Whaling commission:

A policy document on India’s involvement in the IWC 1981-2003

Hunt for Hangul

Establishing the presence of hangul outside Dachigam National Park, Jammu & Kashmir

Bear Necessities

A swcientific approach to understand and mitigate Human Sloth Bear conflict in Madhya Pradesh

B. CONSERVATION ACTION REPORTS

Beyond the Ban:

A census of Shahtoosh workers in Jammu & Kashmir

Biodiversity, Livelihoods and the Law:

The case of the ‘Jogi Nath’ snake charmers of India

Goats on the Border:

A rapid assessment of the Pir Panjal markhor in Jammu & Kashmir distribution, status and threats

The Ground Beneath the Waves : (2 Volumes)

Post-tsunami impact assessment of wildlife and their habitats in India

Walking the Bears:

Rehabilitation of Asiatic black bears in Arunachal Pradesh

Mountain Migrants:

Survey of Tibetan Antelope (Pantholops hodgsonii) and Wild Yak (Bos grunniens) in Ladakh, Jammu & Kashmir,

India

Predator Alert:

Attacks on humans by leopard and Asiatic black bear in the Kashmir valley – Analysis of case studies and spatial

patterns of elevated conflict

Turning the Tide:

The campaign to save Vhali, the Whale Shark (Rhincondon Typus) in Gujarat

Tiger Country

Helping Save Bhutan’s Natural Heritage

164

Daring to Restore

Coral Reef Recovery in Mithapur

C. CONSERVATION REFERENCE SERIES

Wildlife Law:

A ready reckoner - A guide to the Wildlife (Protection) Act 1972

Back to the Wild:

Studies in wildlife rehabilitation

Right of Passage:

Elephant corridors of India

Poisons and the Pachyderm:

Responding to poisoning in Asian elephants – A field guide

Commentaries on Wildlife Law:

Cases, statutes & notifications

Pakke Pachyderms:

Ecology and conservation of Asian elephants in Kameng elephant reserve, Arunachal Pradesh

Bringing Back Manas:

Conserving the forest and wildlife of the Bodoland Territorial Council

Canopies and Corridors:

Conserving the forest of Garo Hills with elephant and gibbon as flagships

D. OTHERS

Wrap up the trade:

An international campaign to save the endangered Tibetan

Antelope

Tiger Bridge:

Nine days on a bend of the Nauranala

Emergency Relief Network Digest 2005 – 2006

Emergency Relief Network Digest 2006 – 2007

Action Tiger:

Tiger action plans of 12 tiger range countries

National Bear Conservation and Welfare Action Plan 2012

Documents

Gujarat's Gentle Giant- Whale shark final · In 2004, the Gujarat Forest Department joined hands with International Fund for Animal Welfare – Wildlife Trust of India (IFAW—WTI)