Upload
lindsay-mcdonald
View
217
Download
0
Tags:
Embed Size (px)
Citation preview
GIST Research Updates: May 2012
• Corless– Will discuss new technologies for DNA sequencing– The goal is to further subclassify GISTs and better
understand the genes that contribute to malignancy
• Heinrich– Will discuss studies aimed at understanding how
to kill persistent GIST cells that imatinib and sunitinib cannot always control
‘Next Generation’ DNA Sequencing
• Traditional DNA sequencing is limited to just one part of one gene at a time
• Second- and third-generation DNA sequencers are now available at OHSU
• We have been using these new technologies to study GISTs
Sequencing GIST ‘Exomes’
• Human genome consists of 3.2 billion letters (A, C, T, G)
• Genes comprise only ~2% of our DNA (about 64 million letters)
• We ‘pre-select’ the genes, so that only the 64 million letters of interest get sequenced – this is the ‘exome’
• Cost: $2,000 per sample
GIST Exome SequencingSpecimen Summary
Genotype Sequencing completed Sequencing in progress AvailablePatients Specimens Patients Specimens Pts Specimens
KIT exon 9 5 8 1 1
KIT exon 11 9 13 4 6
PDGFRA 3 3 1 1
Wildtype 1 1 3 3
BRAF 1 3
unknown 1 1
TOTAL 18 25 5 11 8 10
Additional matched normal specimens: 19 completed; 5 in progress; 8 available
Sequencing results: Mutant genes by group
• 25 specimens from 18 patients• 285 non-synonymousmutations• 276 unique genes
Apoptosis, autophagy , 6
Cell adhesion, 5 Cell cycle, 1 DNA damage response, 4
Epigenetic regulation, 8
GTPase regulation (Ras family) , 6
Golgi, intracellular transport , 7
Kinase, adaptor, RTK regulation , 15
Ribosome biogenesis, RNA Polymerase, RNA
splicing, 13Transcription
factor, 15
Tumor suppressor, TP53-related , 6
Ubiquitin , 9
Misc potentially interesting , 8
unknown, analysis in progress, 173
GIST AnalysisUsing Third-Generation DNA Sequencing
• The Knight Labs have partnered with Ion Torrent/Life Tech on the development of genotyping panels using third-generation DNA sequencing technology
• Sequencing is performed on a semiconductor chip
Traditional Sequence
ACTGGTCCTGCTGGTTAGACTGGTCCTGCTGGTTAGACTGGTCCTGCTGGTTAGACTGGTCCTGCTGGTTAGACTGGTCCTGCTGGTTAGACTGGTCCAGCTGGTTAGACTGGTCCAGCTGGTTAGACTGGTCCAGCTGGTTAGACTGGTCCAGCTGGTTAGACTGGTCCAGCTGGTTAG
3rd Generation Sequence