Hepatitis Delta Virus Minimal Substrates Competent for ...jvi.asm.org/content/75/18/8547.full.pdf · (U4-D5) were made by deleting antigenomic sequences from 1004 to 586 from FIG

JOURNAL OF VIROLOGY,0022-538X/01/$04.0010 DOI: 10.1128/JVI.75.18.8547–8555.2001

Sept. 2001, p. 8547–8555 Vol. 75, No. 18

Copyright © 2001, American Society for Microbiology. All Rights Reserved.

Hepatitis Delta Virus Minimal Substrates Competent forEditing by ADAR1 and ADAR2

SHUJI SATO,1 SWEE KEE WONG,1,2 AND DAVID W. LAZINSKI1,2*

Department of Molecular Biology and Microbiology1 and the Raymond and Beverly Sackler Research Foundation Laboratory,Sackler School of Graduate Biomedical Sciences,2 Tufts University School of Medicine, Boston, Massachusetts 02111

Received 12 April 2001/Accepted 5 June 2001

A host-mediated RNA-editing event allows hepatitis delta virus (HDV) to express two essential proteins, thesmall delta antigen (HDAg-S) and the large delta antigen (HDAg-L), from a single open reading frame. Oneor several members of the ADAR (adenosine deaminases that act on RNA) family are thought to convert theadenosine to an inosine (I) within the HDAg-S amber codon in antigenomic RNA. As a consequence ofreplication, the UIG codon is converted to a UGG (tryptophan [W]) codon in the resulting HDAg-L message.Here, we used a novel reporter system to monitor the editing of the HDV amber/W site in the absence ofreplication. In cultured cells, we observed that both human ADAR1 (hADAR1) and hADAR2 were capable ofediting the amber/W site with comparable efficiencies. We also defined the minimal HDV substrate required forhADAR1- and hADAR2-mediated editing. Only 24 nucleotides from the amber/W site were sufficient to enableefficient editing by hADAR1. Hence, the HDV amber/W site represents the smallest ADAR substrate yetidentified. In contrast, the minimal substrate competent for hADAR2-mediated editing contained 66 nucleo-tides.

Hepatitis delta virus (HDV) is a human subviral pathogenthat exists as a satellite of hepatitis B virus (24). Its genomeconsists of a single-stranded negative-sense circular RNA ofapproximately 1.7 kb that is 70% self-complementary and thatcan form a rod-like structure (11). HDV replicates via a roll-ing-circle mechanism in which a host-encoded RNA-directedRNA polymerase transcribes the circular genome to generatemultimeric products (12). Within each monomeric unit of themultimer, a ribozyme self-cleaves, thereby releasing unit-length linear RNAs (12). The two termini of the linear mono-mer are joined by a host-encoded RNA ligase to create acircular replication intermediate referred to as the antigenome(23). Genome amplification occurs by analogous rolling-circletranscription of the antigenome, followed by self-cleavage andligation (12).

In addition to serving as template for the antigenome, thegenome is also the template for an mRNA that encodes es-sential viral proteins (8). In this case, transcription is termi-nated after less than one-half of the genome is transcribed. Acanonical AAUAAA polyadenylation signal mediates thisevent and is required for mRNA synthesis (8).

HDV is capable of producing its two viral proteins, the smalldelta antigen (HDAg-S) and the large delta antigen (HDAg-L), from a single open reading frame (29). These two proteinsare identical in sequence except that the larger form containsan additional 19 amino acids at its C terminus (11, 27); yet eachprotein has distinct and essential functions in the viral lifecycle. Initially, following infection, only HDAg-S is expressed,and this protein is required for replication (10). Later,HDAg-L is also expressed and is required for virion assembly

(4). The ultimate conversion of the HDAg-S UAG (amber)stop codon to a UGG (tryptophan [W]) codon enables theexpression of HDAg-L (16), and this occurs as a result of RNAediting. Thus, amber/W editing is an essential step in the virallife cycle.

Editing occurs on rod-structured antigenomic RNA (3) andnot on mRNA which lacks such a structure. It is not knownwhether nascent antigenomic RNA or the mature circular an-tigenome or both are substrates for editing. A host-encodednuclear enzyme is thought to deaminate the adenosine of thestop codon, creating an inosine (I) at that position. Duringreplication, the inosine is presumably recognized as aguanosine by the transcriptional machinery. Thus, the genomecopied from the edited antigenome contains a 39-ACC-59 an-ticodon instead of 39-AUC-59. mRNA synthesized from thisedited genome contains a UGG (tryptophan) codon and ex-presses HDAg-L (Fig. 1A.)

A member of the ADAR family is thought to be responsiblefor editing the HDV antigenomic amber/W site. These en-zymes have been well studied in the context of GluR-B andserotonin 2C receptor hnRNA editing (9). ADAR1 andADAR2 are the only two human adenosine deaminases shownto be competent for mRNA editing (9). Each contains a do-main in its carboxyl terminus that has homology with otherdeaminases, as well as a series of double-stranded RNA bind-ing motifs in its amino terminus (9). ADARs target imperfectdouble-stranded RNA and edit specific adenosines in the sub-strate. The GluR-B hnRNA is edited by ADARs at a fewspecific sites, and, as a consequence of editing, codon changesthat alter the ion permeability and kinetics of the encoded ionchannel result (7, 15). Similarly, the editing of HDV RNA isvery specific and is almost completely restricted to the am-ber/W site (21).

Although the identity of the ADAR that edits HDV duringhuman infection is still unknown, in vitro studies have shown

* Corresponding author. Mailing address: Department of MolecularBiology and Microbiology, Tufts University School of Medicine, 136Harrison Ave., Boston, MA 02111-1817. Phone: (617) 636-3671. Fax:(617) 636-0337. E-mail: [email protected].

8547

on October 12, 2018 by guest

http://jvi.asm.org/

Dow

nloaded from

http://jvi.asm.org/

that Xenopus laevis ADAR1 can efficiently and specifically editthe HDV amber/W site (20). In addition, HeLa nuclear extractand Drosophila melanogaster embryo nuclear extract are alsocompetent for this process (3).

Studies of tissue culture have shown that HDV RNA can beedited in both the presence and absence of replication (3). Inthe latter case, approximately one-third of the antigenomicrod-like structure was deleted such that HDAg was not ex-pressed. Thus, neither replication nor HDAg expression isrequired for editing (2, 3). Furthermore, expression ofHDAg-S has been shown to reduce, but not abolish, editing atthe amber/W site (21). Studies carried out in vitro and in vivoshowed that point mutations near the editing site that disruptbase pairing decrease editing efficiency, while compensatorymutations that restore base pairing are found to complementthe editing defect (3, 20). Thus, the secondary structure imme-diately around the edited adenosine plays a critical role indefining the substrate.

Protein kinase R (PKR), a double-stranded RNA (dsRNA)binding protein that shares homology in its dsRNA bindingdomain with ADAR1, binds to a particular region of genomicHDV RNA in vitro (6). Since a similar structure is thought toform in the analogous region of the antigenome, it can bespeculated that such a region might be important for ADAR-mediated editing. However, this model has not been tested,and the minimal sequence and structure required for editinghave not been determined. To that end, we created an editing-competent, nonreplicating reporter to assay editing in tissueculture. The reporter consists of an HDAg-S message in whichthe rod-like structure of antigenomic RNA is created. Editingis therefore detected by HDAg-L expression.

We found that the editing of the reporter was greatly en-

hanced upon coexpression of either human ADAR1 (hA-DAR1) or hADAR2, indicating that both enzymes are capableof editing the HDV amber/W site. Using deletion analysis, wefound that the region on the antigenome complementary to thePKR binding site was not required for editing by either en-zyme. In addition, a mere 24 nucleotides of HDV sequencewere sufficient to enable editing by ADAR1.

MATERIALS AND METHODS

Construction of plasmids. pKW42, the mammalian expression vector forHDAg-S, was constructed by subcloning cDNA of the antigenomic HDV se-quence from position 1625 to 782 downstream of the cytomegalovirus (CMV)promoter on a pUC vector. Full-length, or wild-type, editing reporter pSS74(U369) contains antigenomic HDV cDNA sequences from 1625 to 211, wherethe polyadenylation signal and the ribozyme were mutated by PCR using Oli087(59GAGTTGTCGACCCCAGTGAATCCCGCGGGTTTCCACTCACAGGT39)and Oli033 (59ATCTCTCTAGATTCCGATAGAGAATCGAGAGAAAAGTGGCTCTCCCTTTACCATCCGAGTGGACCTGC39). The PCR product was di-gested with SalI and XbaI to replace the same region on pKW42. The followingplasmids were made identically to how pSS74 was made except for the downstreamjunction of the antigenomic HDV sequence noted: pSS72 (U101), from 1625 to 479;pSS98 (U48), to 529; pSS102 (U23), to 557; pSS103 (U13), to 567; pSS131 (U4), to576; pSS105 (U[24]), to 586; pSS143 (U0), to 580. pSS122 expresses the D89-145reporter and was made by inserting the 149-bp EcoRI/XmaI fragment into the samesites in the HDAg open reading frame of pSS74. The M39 reporter is expressed frompSS140, where in a pSS74 backbone the mutations were introduced by PCR usingOli397 (59CCCTCGAAGCTTAGTACTGAGGACTGCCGCCTCTAGCCGAGGCGAGCCGGTCC39) and Oli398 (59TTCCGAGAATTCCTTTGATGTTCCCCAGCCAGGGATTTTCGTCCTCTATCTTCTTGAGTTTCATCTTTGTCTTCCGG39). The PCR product was digested with EcoRI and HindIII and used toreplace the same region on pSS74.

All downstream deletions were derived from pSS74, where deletions weremade in the following antigenomic sequences by PCR: pSS99 (D103), from 894to 695; pSS106 (D54), from 954 to 634; pSS107 (D18), from 994 to 593; pSS127(D5), from 1004 to 586. PSS130 (U23-D5), pSS128 (U13-D5), and pSS133(U4-D5) were made by deleting antigenomic sequences from 1004 to 586 from

FIG. 1. Diagram of HDV replication and the nonreplicating HDV editing reporter. (A) RNA editing and delta antigen expression during HDVreplication. (B) The nonreplicating reporter, consisting of a message that encodes HDAg-S with additional antigenomic sequence downstream ofthe message, is shown. The ribozyme and the poly(A) signal (X) were mutated. A functional poly(A) signal was added to the 39 end of the message.The HDAg-S open reading frame is terminated at the UAG termination codon (horizontal line), which, upon editing, is extended to produceHDAg-L.

8548 SATO ET AL. J. VIROL.


http://jvi.asm.org/

Dow

nloaded from

http://jvi.asm.org/

pSS102, pSS103, and pSS131, respectively. pSS92 (pSS74 carrying the A1014Gmutation) was made by replacing the 145-bp region between the SalI and XmaIsites of pSS74 with the PCR product generated using Oli008 (59CTCAAGAAGATAGAGGACGAAAAT39) and Oli189 (59CTGGGGTCGACAACTCTGGGGAGAAAAGGGCGGATCGGCTGGGAAGAGTATATCCTACGGAAATCCCTGGTTT39) digested with the same restriction enzymes. pSS96 (pSS74 car-rying the U578C mutation) was made from pSS74 by replacing the 254-bp regionbetween XbaI and BstBI by the PCR product generated using Oli008 and Oli193(59CTGGGGTCGACAACTCTGGGGAGAAAAGGGCGGATCGGCTGGGAAGAGTATATCCTACGGAAATCCCTGGTTT39). pSS115 (pSS74 carryingboth A1014G and U578C mutations) was made by combining the two mutationsin one construct.

pSS148 expresses the heterologous message containing the minimal ADAR1substrate HDV sequence. To construct this plasmid, a PCR fragment of pMS40(described below) with Oli399 (59AAAAAATCCGGATTGAATTCATATCCTTACGACGTAC39) and Oli400 (59AAAAAACCGCGGGGTACCGTCGACCATGGGATGCGTATATCCTATGGACCGGTGTGGTGGTGGTGGTGGTGG39) digested by BspEI and SacII was ligated to the NgoMIV and SacII sitesof pSS15 to insert in frame the two-hemagglutinin (HA) epitope tag followed bythe minimal ADAR1 substrate HDV sequence. Then the PstI/NotI fragment ofthis resulting plasmid was inserted between the NotI and PstI sites of pEGFP-N1(Clontech), after which the region between BglII and BamHI sites was deleted toproduce pSS148. pSS149, the preedited version of pSS148, is identical to pSS148except for a single nucleotide change in the HDV sequence, where the ambercodon is converted to a TGG (tryptophan) codon. pSS15, used to monitortransfection efficiency, expresses a C-terminal truncation of the human placentalalkaline phosphatase under the control of the CMV immediate-early promoter.

pSS151 was used to overexpress untagged ADAR1. It was constructed bysubcloning the XhoI/XbaI fragment of the hADAR1 sequence, a gift from AndreGerber and Walter Keller (University of Basel), into the polylinker region ofpSS43. PSS43 is a pUC-based plasmid containing a CMV promoter and theHDV polyadenylation signal-flanking polylinker sequence. PSKW005, which en-codes untagged ADAR2, pDL700, which encodes ADAR1-HA, and pMS40,which encodes ADAR2-HA, have been described previously (30).

Transfection and sample harvest. HEK293 cells were cultured in 35-mm-diameter wells with Dulbecco’s modified Eagle medium (Cellgro; with 4.5 mg ofglucose/liter and without L-glutamine) supplemented with 10% fetal bovine se-rum, nonessential amino acids (100 mM), 584 mg of L-glutamine/liter, and pen-icillin (100 U/ml)-streptomycin (100 mg/ml). Cells were transiently transfected24 h after plating at approximately 80% confluence with 3 mg of sample DNA(reporter plus ADAR vector plus pSS43) supplemented with 0.3 mg of pSS15(secreted alkaline phosphatase [SEAP] vector) using Lipofectamine-plus (GibcoBRL). A total of 0.17 mg of DNA was used for reporters expressing HDAg, and1.5 mg was used for pSS148 and pSS149. Additionally, 1.5 mg of ADAR1 vectorsand 0.38 to 0.75 mg of ADAR2 vectors were used. Total sample DNA wasadjusted to 3 mg with pSS43. At 3 days posttransfection, the supernatant wastested for alkaline phosphatase activity by colorimetric assay to measure trans-fection efficiency (1) and cells were harvested in lysis buffer containing 2%sodium dodecyl sulfate and 1% b-mercaptoethanol for protein analysis.

Immunoblot analysis. Protein samples were subjected to electrophoresis on12% polyacrylamide gels for analyses of HDAg and the non-HDV reportercontaining the HDV minimal site and on 7% polyacrylamide gels for ADARexpression analyses. They were then electrophoretically transferred to nitrocel-lulose membranes. HDAg was detected using rabbit polyclonal antiserum (1:2,000 dilution) raised against recombinant six-His-tagged HDAg expressed andpurified from Escherichia coli as the primary antibody and then probed withNEN9s 125I-labeled recombinant protein A (1:1,000 dilution). HA-tagged ADARproteins and the non-HDV reporter containing the HDV minimal site weredetected by incubating samples with BabCo’s affinity-purified monoclonal anti-body against the HA.11 epitope (1:1,000 dilution) and then probing them withNEN9s 125I-labeled anti-mouse immunoglobulin G (1:300 dilution). ADAR1 andADAR2 were detected by incubating samples with rabbit polyclonal antiserumraised against a recombinant six-His-tagged polypeptide of amino acids 1054 to1226 of ADAR1 and amino acids 543 to 701 of ADAR2 (both used at 1:100dilution) and then probing them with protein A (1:1,000 dilution). All primaryantibodies, antiserum, and secondary detection agents were diluted in 0.25%nonfat powdered milk in 13 phosphate-buffered saline. The blots were thenexposed on a phosphor screen and quantified using a phosphorimager (StormImager; Molecular Dynamics). Signals obtained for the ADAR proteins werenormalized against aliquots of a single master sample of ADAR1-HA, which wasrun on all blots and given a value of 10. The experiments yielding results, shownin Fig. 2 through 8, were repeated at least three times.

RESULTS

Experimental design. During HDV replication, HDAg-Lexpression is dependent on editing and its level of expressionreflects the level of editing in antigenomic RNA (2, 31). Rep-lication is also required for the production of HDAg-L, due tothe fact that rod-structured antigenomic RNA is the substratefor editing. Since HDV replication can be sensitive to evensmall deletions, the minimal HDV amber/W site cannot bedefined in the context of replication. Here, we used deletionanalysis of a nonreplicating rod-structured HDAg-S message,shown in Fig. 1B, to define the minimal editing site. Thisediting reporter includes antigenomic sequences, not presentin the natural message, which can form the rod-like structure.Two processing sites were mutated to prevent cleavage of themessage in order to preserve its structure. The consensus se-quence AAUAAA of the polyadenylation signal was mutatedto AAUCCC, and a C-to-U substitution mutation at position825 that was previously shown to inactivate the antigenomicribozyme (26) was also introduced. A functional polyadenyla-tion signal was then added to the 39 terminus of the message toenable its export and translation.

The level of expression of HDAg-L from the reporter shouldquantitatively reflect the level of RNA editing. However, sev-eral events must occur for HDAg-L to be made from thismessage. Following transient transfection of HEK293 cellswith the reporter cDNA, the resulting message must be rec-ognized as a substrate by an ADAR, and the amber/W sitemust then be edited. This should occur prior to export of themessage from the nucleus, since ADARs preferentially localizeto that organelle. In addition, ribosomes must be able to meltthe rod-like secondary structure of the message so that it canbe translated.

Unlike the natural HDV message, the HDAg-L-expressingreporter would contain at least one inosine that should berecognized as a guanosine by the ribosome. In this sense, theediting reporter resembles the GluR-B message, which alsocontains inosines that are translated as guanosines. Our initialreporter construct contained antigenomic sequences from po-sition 1624 to 211. HDV sequences not present in this reporterhad already been shown to be dispensable for amber/W siteediting (3).

Effect of overexpression of tagged and untagged ADAR1 andADAR2 on the editing of the reporter. To study the ability ofADAR1 and ADAR2 to edit the HDV amber/W site, wetransiently cotransfected HEK293 cells with vectors that ex-press the editing reporter and either ADAR. To directly com-pare the levels of ADAR1 and ADAR2 expression, we alsoconstructed expression vectors in which two HA epitope tagswere fused to the extreme carboxyl-terminal sequences en-coded by the respective open reading frames. Figure 2A showsthe expression of HDAg-S and HDAg-L in the absence ofADAR overexpression as well is in the presence of tagged anduntagged forms of each protein. In the absence of ADARoverexpression, 6% editing was observed, indicating thatHEK293 cells naturally express an activity(s) capable of editingthe reporter. Upon overexpression of both hADAR1 and hA-DAR2, dramatic increases in editing levels of the reporterwere observed, demonstrating that both proteins can edit theHDV amber/W site.

VOL. 75, 2001 HDV MINIMAL SUBSTRATES COMPETENT FOR EDITING 8549


http://jvi.asm.org/

Dow

nloaded from

http://jvi.asm.org/

We also probed the same samples with antibodies specificfor either the HA tag, the C terminus of ADAR1, or the Cterminus of ADAR2 (Fig. 2B to D, respectively). With both theHA and ADAR1 antibodies, we observed that the ADAR1vectors express two forms of that protein, one whose mobilityis consistent with that predicted for the full-length protein andanother whose size is consistent with a protein initiated fromthe second methionine at position 296. Both of these forms hadpreviously been observed in a number of different tissues andcell lines (18, 28). Visualized in lanes 6 and 7 of Fig. 2C are thetwo forms of ADAR1 endogenously expressed in HEK293cells and in Huh7 cells, a human hepatoma cell line commonlyused to study HDV replication. The ratio of the two forms of

ADAR1 expressed by these cells was similar to that resultingfrom vector-driven overexpression.

By quantifying the signals from Fig. 2B to D, we were able tocompare the levels of expression of both tagged and untaggedforms of ADAR1 and ADAR2. We found that, for bothADAR1 and ADAR2, addition of the HA tag did not signifi-cantly alter the activity of the resulting protein. Since the levelsof expression of hADAR1-HA and hADAR2-HA could bedirectly compared using a single blot, those two proteins wereused in the subsequent assays.

Effects of substitution mutations on the editing of the re-porter. The editing reporter contains a naturally contiguousself-complementary antigenomic sequence; however, it alsocontains mutations in two processing sites. The ribozyme mu-tation is very close to the region that is complementary to thePKR binding site in the genome; thus, if this region of theantigenome were involved in recognition by ADARs, then themutation could potentially inhibit editing. We tested the effectof the two processing-site mutations on editing by using threeconstructs: a reporter with a wild-type polyadenylation signaland a wild-type ribozyme, one with a mutated polyadenylationsignal and a wild-type ribozyme, and a third with both sitesmutated.

Figure 3A shows the editing levels obtained with these re-porters. The construct with a wild-type polyadenylation signalproduced a large amount of HDAg-S but almost no HDAg-L,even when ADAR1 or ADAR2 were overexpressed, indicatingthat, as expected, little or no editing occurred with this re-FIG. 2. Western blot analyses of the editing reporter and the ex-

pression levels of ADARs. Lanes: 1, reporter (U369); 2, reporter plusuntagged ADAR1; 3, reporter plus ADAR1-HA; 4, reporter plus un-tagged ADAR2; 5, reporter plus ADAR2-HA; 6, untransfectedHEK293 cells harvested 12 days after plating; 7, untransfected Huh7cells harvested 12 days after plating. (A) Western blot analysis ofHDAg expressed in HEK293 cells harvested 3 days posttransfectionand probed with rabbit polyclonal anti-HDAg antiserum. In this andsome of the subsequent figures, we observed a band migrating betweenHDAg-S and HDAg-L. We also observed this band when usingHDAg-L expression vectors in the absence of ADARs (data notshown). Since we are not certain of the origin of this species, itsquantitation is not included in this analysis, and hence we may beunderestimating editing. However, since this band typically represents5% or less of the total HDAg signal, this underestimation would besmall. (B) Same as in panel A except that cells were probed with anaffinity-purified monoclonal anti-HA antibody. (C) Same as panel Aexcept that cells were probed with rabbit polyclonal anti-ADAR1 an-tiserum. (D) Same as panel A except that cells were probed with rabbitpolyclonal anti-ADAR2 antiserum. FL, full-length; M296, internallyinitiated at methionine position 296.

FIG. 3. Western blot analyses showing the effects of mutations inthe processing sites of the reporter. (A) Western blot analysis ofHDAg expressed in HEK293 cells transfected with cDNA constructsof reporters with mutated (Mut.) poly(A) signal plus mutated ri-bozyme (Rz), mutated poly(A) signal plus wild-type (WT) ribozyme, orwild-type poly(A) signal plus wild-type ribozyme harvested 3 daysposttransfection. The blot was probed with anti-HDAg antiserum. —,no ADAR coexpressed; 1, ADAR1 coexpressed; 2, ADAR2 coex-pressed. (B) Western analysis showing the expression levels of HA-tagged ADAR1 and two of the same samples as in panel A probed withthe anti-HA antibody.



http://jvi.asm.org/

Dow

nloaded from

http://jvi.asm.org/

porter. Processing at the first polyadenylation site is expectedto cause termination (22) and should thereby prevent tran-scription of distal sequences needed to form the rod-like struc-ture. The construct with a mutated polyadenylation signal anda wild-type ribozyme expressed less HDAg and was edited withslightly lower efficiency than was the reporter with both pro-cessing sites mutated. We therefore conclude that the ri-bozyme mutation did not inhibit the editing of the amber/Wsite and that it increased total HDAg expression.

Substitution mutations that alter the secondary structurenear the editing site have been shown to decrease editing in thecontext of HDV replication (3). It was previously demon-strated that mutations A1014G and U578C (Fig. 4A), whichindividually disrupt base pairing, have a negative effect onediting, but, when these are combined to restore base pairing,nearly wild-type levels of editing result. We tested these mu-tations in our reporter, and Fig. 4B shows the editing levelsassociated with each mutant. Both A1014G and U578C dis-played decreases in endogenous editing as well as in editing byhADAR1-HA and hADAR2-HA. When the two mutationswere combined to produce the compensatory construct,ADAR-enhanced editing was restored to nearly wild-type lev-els. These results are in qualitative agreement with previouslyreported studies and indicate that the structural requirementsneeded for editing the reporter are equivalent to those neededfor editing HDV antigenomic RNA during replication.

In 1998, Polson et al. (21) showed that, in the presence ofHDAg-S, the editing of nonreplicating HDV antigenomicRNA is greatly reduced (from 41.6 to 3.0%). It is thought thatHDAg-S might bind at or near the amber/W site and therebydecrease ADAR accessibility to that site. Since our editingreporter is structurally very similar to the RNA tested by Pol-son et al. (21), we wondered whether the HDAg expressedfrom this reporter might reduce reporter editing. We testedthis possibility by constructing two different reporters, each ofwhich expresses HDAg defective in RNA binding.

In the first construct, M39, the reporter was mutated suchthat the initiator methionine codon of HDAg was changed toalanine and K39 was changed to an initiator methionine. Thisreporter preserves the complete rod-like structure but ex-presses HDAg in which the first 39 amino acids are deleted.

Others have shown that regions within the first 39 amino acidsof HDAg possess RNA binding activity (5, 19). Furthermore, acoiled-coil domain resides in this region, and its deletion isexpected to preclude stable multimeric assembly on RNA (33).In the second mutant, D89-145, amino acids 89 to 145 fromHDAg were deleted (13). This reporter has a deletion of partof its rod-like structure and expresses a protein that lacks twocritical arginine-rich motifs needed for RNA binding (14).

In three separate experiments, the editing of the D89-145reporter was compared to that of the wild-type reporter. In theabsence of transfected ADAR, a significant fourfold differencein editing of the two reporters was observed (approximately5% for the wild type versus almost 20% for the mutant; datanot shown). However, when ADARs were overexpressed, thisdifference was reduced to 1.5-fold (40 to 50% for the wild typeversus 60 to 80% for the mutant; data not shown). The M39mutant yielded results very similar to those obtained with D89-145. We conclude that, with the level of expression used in thisstudy, HDAg has only a modest inhibitory effect on editingwhen ADARs are overexpressed.

Deletion analysis. We constructed variants of the reporterhaving progressive deletions that reduce the rod-like structureupstream of the editing site. This was accomplished by deletingHDV sequences in the 39 untranslated region, and the con-structs are shown in Fig. 5A. The number after U (for up-stream) designates the number of nucleotides of the HDVantigenomic sequence upstream of the editing site, where U0indicates the cytidine at position 580 (C580) just opposite theadenosine that is deaminated. For example, U369 contains 369nucleotides upstream of the editing site, which are 39 of C580.U(24) lacks base pairing at the editing site since all of theupstream base pairing was deleted as well as four nucleotides59 of C580.

U369, U101, and U48 were edited at comparable levels byeach enzyme (data not shown). Figure 5B shows editing levelsof the other constructs. A decrease in editing by hADAR2-HAwas noticeable in U13, and U4 was edited poorly by this en-zyme. In contrast, hADAR1-HA was able to edit U4 efficiently.Expression of either enzyme did not enhance editing of U0 andU(24). We conclude that HDV amber/W editing by ADAR1and ADAR2 requires base pairing immediately upstream of

FIG. 4. Western analyses of substitution mutation constructs. (A) Diagram of substitution mutations introduced to disrupt base pairing nearthe editing site of the reporter. Editing site 1012A is in boldface. (B) Western analysis of HDAg expressed in HEK293 cells harvested 3 daysposttransfection and probed with anti-HDAg antiserum showing editing of reporters containing the wild-type (WT) sequence and mutationsA1014G, U578C, and A1014G and U578C combined. (C) Western analysis of samples from panel B probed with the anti-HA antibody.



http://jvi.asm.org/

Dow

nloaded from

http://jvi.asm.org/

the editing site and that ADAR1 is more tolerant of upstreamdeletions than is ADAR2.

Reporters with progressive deletions of rod-like structuredownstream of the editing site, shown in Fig. 6A, were madeusing the U369 construct as the starting vector. Similar toupstream deletion construct designations, the number after D(downstream) designates the number of HDV antigenomicnucleotides below position 580. The natural stop codon forHDAg-L was deleted in D18 and D5; hence translation ofthese edited messages is predicted to terminate at stop codons

35 and 29 codons downstream of the amber/W site, respec-tively. Consistent with these predictions, the larger proteinsexpressed upon editing D18 and D5 display retarded mobilitycompared to wild-type HDAg-L (Fig. 6B). Though there was aslight decrease in editing levels, both ADARs efficiently editedall three constructs. We conclude that, for sequences down-stream of the editing site, only 14 nucleotides predicted toform a four-nucleotide stem and six-nucleotide loop are suffi-cient for editing by both ADAR1 and ADAR2.

To determine the minimal rod-like structure required in an

FIG. 5. Western analyses of upstream deletion reporter constructs. (A) Upstream deletion constructs and the predicted secondary structuresof the five smallest constructs. The editing site adenosine at position 1012 is in boldface. (B) Western blot analysis of HDAg expressed in HEK293cells transfected with cDNA constructs U369, U23, U13, U4, U0, and U(24) and harvested 3 days posttransfection. Relative editing efficiency isdefined as (percent editing of a given mutant)/(percent editing of U369 under the same condition). The relative editing efficiencies (6 standarddeviations) of each reporter were calculated from four (three for U0) independent experiments and are as follows. U101: ADAR1, 0.9 6 0.1;ADAR2, 1 6 0.3; U48: ADAR1, 0.9 6 0.3; ADAR2, 1 6 0.3; U23: ADAR1, 0.8 6 0.2; ADAR2, 0.9 6 0.3; U13: ADAR1, 1 6 0.2; ADAR2, 0.5 60.1; U4: ADAR1, 0.8 6 0.2; ADAR2, 0.1 6 0.05; U0: ADAR1, 0.02 6 0.005; ADAR2, 0.04 6 0.02; U(24): ADAR1, 0.02 6 0.02; ADAR2, 0.03 60.02. (C) Western analysis of samples from panel B probed with anti-HA.

FIG. 6. Western analyses of downstream deletion reporter constructs. (A) Downstream deletion constructs. The numbers of amino acids (aa)added to HDAg-S when D18 and D5 are edited are shown in parentheses. (B) Western blot analysis of HDAg expressed in HEK293 cellstransfected with cDNA constructs of D203 (same as U369), D103, D54, D18, and D5, harvested 3 days posttransfection, and probed withanti-HDAg antiserum. Relative editing efficiency is as defined for Fig. 5. The relative editing efficiencies (6 standard deviations) for each reporterwere calculated from three independent experiments and are as follows. D103: ADAR1, 1.3 6 0.2; ADAR2, 1 6 0.2; D54: ADAR1, 1 6 0.2;ADAR2, 1 6 0.2; D18: ADAR1, 0.7 6 0.2; ADAR2, 0.6 6 0.1; D5: ADAR1, 0.8 6 0.2; ADAR2, 0.6 6 0.2. (C) Western analysis of samples frompanel B probed with the anti-HA antibody.



http://jvi.asm.org/

Dow

nloaded from

http://jvi.asm.org/

HDV substrate for editing by ADAR1-HA and ADAR2-HA,D5 was combined with U23, U13, and U4 as shown in Fig. 7A.The natural HDAg-L stop codon was deleted in D5; thustranslation of the edited message should terminate beyond theamber/W codon after an additional 23 codons for U23-D5, 16codons for U13-D5, and 13 codons for U4-D5. Figure 7Bshows that ADAR1-HA edited all three constructs with at least20% efficiency, while ADAR2-HA could not edit U13-D5 orU4-D5 efficiently. We conclude here that ADAR1 only re-quires the predicted structure of 4 bp upstream and 4 bpdownstream of the editing site, while ADAR2 requires a morerod-like structure upstream of the editing site.

Editing of the minimal ADAR1 substrate within a heterol-ogous message. Since all of our reporters consist of a messageencoding HDAg, we could not rule out the possibility that theHDV antigenomic sequence in the message itself played a rolein substrate recognition by ADARs. To ascertain whether the24 nucleotides in U4-D5 are the sole HDV sequence neededfor editing by ADAR1, we created a non-HDV message re-porter into which we inserted the 24-nucleotide amber/W sub-strate. As shown in Fig. 8A, this reporter carries part of thehuman placental alkaline phosphatase gene fused to a repeatof the HA epitope, followed by the U4-D5 structure where theamber codon is in frame with the upstream gene. The unedited

FIG. 7. Western analyses of upstream-downstream combination deletion reporter constructs. (A) D5 was combined with U23, U13, and U4 asshown. The adenosine to be edited is in boldface. (B) Western analysis of HDAg expressed in HEK293 cells transfected with cDNA of U369,U23-D5, U13-D5, and U4-D5, harvested 3 days posttransfection, and probed with anti-HDAg antiserum. The proteins produced from the editedmessages in U23-D5, U13-D5, and U4-D5 contain an additional 23, 16, and 13 amino acids, respectively, at the C terminus of HDAg-S. Relativeediting efficiency is as defined for Fig. 5. The relative editing efficiencies (6 standard deviations) for each reporter were calculated from fourindependent experiments and are as follows. U23-D5: ADAR1, 0.5 6 0.2; ADAR2, 0.5 6 0.2; U13-D5: ADAR1, 0.4 6 0.09; ADAR2, 0.1 6 0.05;U4-D5: ADAR1, 0.4 6 0.1; ADAR2, 0.08 6 0.07. (C) Western analysis of the samples from panel B probed with the anti-HA antibody.

FIG. 8. Western analyses of a heterologous reporter containing minimal HDV editing sequence. (A) The heterologous reporter with anin-frame insertion of an epitope tag and the minimal HDV editing sequence is shown. The stop codon of the unedited reporter is in boldface, andthe conversion of adenosine to inosine upon editing is indicated. The unedited and edited messages produce proteins of 121 and 168 amino acids,respectively. Alkal., alkaline; SV40, simian virus 40. (B) Western analysis of HEK293 cells transfected with cDNA encoding the heterologousreporter harvested 3 days posttransfection and probed with the anti-HA antibody. Lanes: 1, reporter plus vector; 2, preedited reporter (shown asa size marker for the edited product); 3, reporter plus untagged ADAR1; 4, reporter plus ADAR1-HA. (C) Expression levels of both forms ofADAR1 as determined by Western analysis of the samples from panel B probed with rabbit polyclonal anti-ADAR1 antiserum.



http://jvi.asm.org/

Dow

nloaded from

http://jvi.asm.org/

message is translated into a 121-amino-acid protein that can bedetected using an anti-HA antibody, and when the stop codonin the HDV sequence is edited, a 168-amino-acid proteinshould be expressed.

We overexpressed untagged and HA-tagged hADAR1 tostudy their ability to edit this heterologous reporter in HEK293cells. Lanes 3 and 4 in Fig. 8B show editing of the reporter byboth versions of ADAR1. Though endogenous editing wasalmost undetectable in our assay, overexpression of ADAR1dramatically increased editing levels of the reporter, shown bythe presence of the larger species, which comigrates with theband expressed by the “preedited” UGG construct in lane 2.Thus, we conclude that the 24 HDV antigenomic nucleotidesare both necessary and sufficient for editing by ADAR1 in vivo.

DISCUSSION

We observed that a nonreplicating reporter designed tomimic the structure of HDV antigenomic RNA was competentfor amber/W editing. Furthermore, editing of this reporter wassensitive to the same mutations that inhibit HDV editing dur-ing replication (shown in Fig. 3). Therefore, in the region thatincludes the amber/W site, the reporter is likely to adopt astructure equivalent to that of the natural substrate.

Although HEK293 cells express relatively modest levels ofADAR1 and no detectable ADAR2 (Fig. 2, lanes 1 to 3), therewas sufficient activity in these cells to edit roughly 5% of thereporter messages. This level of editing is comparable to thatobserved during HDV replication in a study by Polson et al.(21), when cells were harvested 5 days posttransfection. How-ever, it is also known that much higher levels of edited RNAcan be observed during HDV replication when cells are har-vested at later times posttransfection: up to 25% at day 13 inone study (21) and exceeding 30% at day 18 in another (32). Incontrast, using the nonreplicating reporter, we saw no signifi-cant change in the extent of editing when cells were harvestedat later times posttransfection (data not shown). This result isnot really surprising, however. When antigenomic RNA is ed-ited during replication, the edited antigenome serves as a tem-plate for genome synthesis and the resulting mutation becomesfixed in the genome. This enables the mutation to accumulateover time. Thus the ratio of amber-encoded to W-encodedRNA observed at 13 days posttransfection represents the in-tegration of all editing events that occurred in the precedingdays. However, our reporter does not replicate; thus past ed-iting events cannot be fixed, and, in this case, the extent ofediting should not increase with time.

This was the first study to test the ability of hADAR1, or anyform of ADAR2, to edit the HDV amber/W site. We foundthat both enzymes could edit this site with roughly comparableefficiencies. Though we have not determined the identity of theenzyme that edits the HDV amber/W site during replication,our results indicate that, in addition to ADAR1, ADAR2should be considered a candidate. Recently, the sole ADARexpressed by Drosophila was cloned and was found to havegreater homology with ADAR2 than with ADAR1 (17). Giventhat hADAR2 is able to edit the HDV amber/W site, perhapsit is not surprising that Drosophila nuclear extracts can alsocarry out this reaction. Even though we did not detect ADAR2expression in two cell lines that support HDV replication, it

remains possible that HDV replication might be required toinduce ADAR2 expression. Of course, it is also formally pos-sible that neither enzyme edits the HDV amber/W site duringhuman infection. More direct evidence is needed to identifythe enzyme that naturally edits the amber/W site during rep-lication.

It was previously reported that the endogenous activity re-sponsible for HDV editing is inhibited by HDAg expression.Here, we provide evidence consistent with that finding sincereporters that expressed RNA-binding-deficient HDAg wereedited at fourfold-higher levels by the endogenous activity thanwas the reporter that expressed wild-type HDAg. Interestingly,when either ADAR1 or ADAR2 was overexpressed, the dif-ference in the editing of the two types of reporters was reducedto 1.5-fold. This observation is consistent with a model in whichHDAg and ADARs compete for binding to the amber/W siteon antigenomic RNA. Through overexpression, an ADARmight be able to compete more effectively, and hence inhibi-tion by HDAg would be reduced.

Results from our extensive deletion analyses indicate thatthe region complementary to the PKR binding site is dispens-able for editing by both ADAR1 and ADAR2. In addition, weobserved that these two enzymes have different minimal sub-strate requirements. For efficient editing, ADAR2 required a66-nucleotide substrate that included 21 predicted base pairsupstream from the site of editing. In contrast, ADAR1 wasable to efficiently edit a 24-nucleotide substrate that containedonly four upstream base pairs, and this represents the smallestADAR substrate yet identified. Such a small substrate may bevery useful for the biophysical study of ADAR1 and its inter-action with RNA.

Like the HDV amber/W site, the GluR-B R/G site can beedited by both ADAR1 and ADAR2. In vitro, ADAR2 canedit a 57-nucleotide R/G substrate that has no base pairs up-stream of the edited adenosine. We have converted theGluR-B R/G site into an amber/W so that we could assayediting by both ADARs in transfected cells as was done pre-viously (30). We found that although ADAR2 was more effi-cient at editing the GluR-B site when it contained five up-stream base pairs, it was still able to edit a substrate with noupstream base pairing (unpublished results). Similar resultshave been obtained in vitro with GluR-B R/G minimal sub-strates (25). In contrast, ADAR1 required five upstream basepairs and was completely unable to edit the substrate thatlacked upstream base pairing (unpublished results). Thus, forthe HDV amber/W site, ADAR1 required less upstream struc-ture than did ADAR2, while for the GluR-B R/G site, theconverse was true. We conclude that the minimal substraterequirements for ADAR1 and ADAR2 vary with each specificediting site and that there are differences in the manner inwhich these two enzymes recognize a given substrate.

ACKNOWLEDGMENTS

We thank Andre Gerber and Walter Keller (University of Basel,Basel, Switzerland) for providing hADAR1 and hADAR2 cDNAs andJohn Coffin (Tufts University), Claire Moore (Tufts University), andAndrew Camilli (Tufts University) for their helpful discussions.

This work was supported by grant RO1-AI40472 from the NationalInstitutes of Health and by the Raymond and Beverly Sackler Re-search Foundation.



http://jvi.asm.org/

Dow

nloaded from

http://jvi.asm.org/

REFERENCES

1. Berger, J., J. Hauber, R. Hauber, R. Geiger, and B. R. Cullen. 1988. Secretedplacental alkaline phosphatase: a powerful new quantitative indicator ofgene expression in eukaryotic cells. Gene 66:1–10.

2. Casey, J. L., K. F. Bergmann, T. L. Brown, and J. L. Gerin. 1992. Structuralrequirements for RNA editing in hepatitis delta virus: evidence for a uridine-to-cytidine editing mechanism. Proc. Natl. Acad. Sci. USA 89:7149–7153.

3. Casey, J. L., and J. L. Gerin. 1995. Hepatitis D virus RNA editing: specificmodification of adenosine in the antigenomic RNA. J. Virol. 69:7593–7600.

4. Chang, F. L., P. J. Chen, S. J. Tu, C. J. Wang, and D. S. Chen. 1991. Thelarge form of hepatitis delta antigen is crucial for assembly of hepatitis deltavirus. Proc. Natl. Acad. Sci. USA 88:8490–8494.

5. Cheng, J. W., I. J. Lin, Y. C. Lou, M. T. Pai, and H. N. Wu. 1998. Local helixcontent and RNA-binding activity of the N-terminal leucine-repeat region ofhepatitis delta antigen. J. Biomol. NMR 12:183–188.

6. Circle, D. A., O. D. Neel, H. D. Robertson, P. A. Clarke, and M. B. Mathews.1997. Surprising specificity of PKR binding to delta agent genomic RNA.RNA 3:438–448.

7. Hollmann, M., M. Hartley, and S. Heinemann. 1991. Ca21 permeability ofKA-AMPA-gated glutamate receptor channels depends on subunit compo-sition. Science 252:851–853.

8. Hsieh, S. Y., M. Chao, L. Coates, and J. Taylor. 1990. Hepatitis delta virusgenome replication: a polyadenylated mRNA for delta antigen. J. Virol.64:3192–3198.

9. Keller, W., J. Wolf, and A. Gerber. 1999. Editing of messenger RNA pre-cursors and of tRNAs by adenosine to inosine conversion. FEBS Lett. 452:71–76.

10. Kuo, M. Y., M. Chao, and J. Taylor. 1989. Initiation of replication of thehuman hepatitis delta virus genome from cloned DNA: role of delta antigen.J. Virol. 63:1945–1950.

11. Kuo, M. Y., J. Goldberg, L. Coates, W. Mason, J. Gerin, and J. Taylor. 1988.Molecular cloning of hepatitis delta virus RNA from an infected woodchuckliver: sequence, structure, and applications. J. Virol. 62:1855–1861.

12. Lazinski, D. W., and J. M. Taylor. 1994. Recent developments in hepatitisdelta virus research. Adv. Virus Res. 43:187–231.

13. Lazinski, D. W., and J. M. Taylor. 1993. Relating structure to function in thehepatitis delta virus antigen. J. Virol. 67:2672–2680.

14. Lee, C. Z., J. H. Lin, M. Chao, K. McKnight, and M. M. Lai. 1993. RNA-binding activity of hepatitis delta antigen involves two arginine-rich motifsand is required for hepatitis delta virus RNA replication. J. Virol. 67:2221–2227.

15. Lomeli, H., J. Mosbacher, T. Melcher, T. Hoger, J. R. Geiger, T. Kuner, H.Monyer, M. Higuchi, A. Bach, and P. H. Seeburg. 1994. Control of kineticproperties of AMPA receptor channels by nuclear RNA editing. Science266:1709–1713.

16. Luo, G. X., M. Chao, S. Y. Hsieh, C. Sureau, K. Nishikura, and J. Taylor.1990. A specific base transition occurs on replicating hepatitis delta virusRNA. J. Virol. 64:1021–1027.

17. Palladino, M. J., L. P. Keegan, M. A. O’Connell, and R. A. Reenan. 2000.dADAR, a Drosophila double-stranded RNA-specific adenosine deaminase,

is highly developmentally regulated and is itself a target for RNA editing.RNA. 6:1004–1018.

18. Patterson, J. B., and C. E. Samuel. 1995. Expression and regulation byinterferon of a double-stranded-RNA-specific adenosine deaminase fromhuman cells: evidence for two forms of the deaminase. Mol. Cell. Biol.15:5376–5388.

19. Poisson, F., P. Roingeard, A. Baillou, F. Dubois, F. Bonelli, R. A. Calogero,and A. Goudeau. 1993. Characterization of RNA-binding domains of hepa-titis delta antigen. J. Gen. Virol. 74:2473–2478.

20. Polson, A. G., B. L. Bass, and J. L. Casey. 1996. RNA editing of hepatitisdelta virus antigenome by dsRNA-adenosine deaminase. Nature 380:454–456. (Erratum, 381:346.)

21. Polson, A. G., H. L. Ley III, B. L. Bass, and J. L. Casey. 1998. Hepatitis deltavirus RNA editing is highly specific for the amber/W site and is suppressedby hepatitis delta antigen. Mol. Cell. Biol. 18:1919–1926.

22. Proudfoot, N. 2000. Connecting transcription to messenger RNA processing.Trends Biochem. Sci. 25:290–293.

23. Reid, C. E., and D. W. Lazinski. 2000. A host-specific function is required forligation of a wide variety of ribozyme-processed RNAs. Proc. Natl. Acad. Sci.USA 97:424–429.

24. Rizzetto, M., B. Hoyer, M. G. Canese, J. W. Shih, R. H. Purcell, and J. L.Gerin. 1980. Delta agent: association of delta antigen with hepatitis B surfaceantigen and RNA in serum of delta-infected chimpanzees. Proc. Natl. Acad.Sci. USA 77:6124–6128.

25. Stephens, O. M., H. Y. Yi-Brunozzi, and P. A. Beal. 2000. Analysis of theRNA-editing reaction of ADAR2 with structural and fluorescent analoguesof the GluR-B R/G editing site. Biochemistry 39:12243–12251.

26. Tanner, N. K., S. Schaff, G. Thill, E. Petit-Koskas, A. M. Crain-Denoyelle,and E. Westhof. 1994. A three-dimensional model of hepatitis delta virusribozyme based on biochemical and mutational analyses. Curr. Biol. 4:488–498.

27. Wang, K. S., Q. L. Choo, A. J. Weiner, J. H. Ou, R. C. Najarian, R. M.Thayer, G. T. Mullenbach, K. J. Denniston, J. L. Gerin, and M. Houghton.1986. Structure, sequence and expression of the hepatitis delta (delta) viralgenome. Nature 323:508–514. (Erratum, 328:456, 1987.)

28. Wang, Q., J. Khillan, P. Gadue, and K. Nishikura. 2000. Requirement of theRNA editing deaminase ADAR1 gene for embryonic erythropoiesis. Science290:1765–1768.

29. Weiner, A. J., Q.-L. Choo, K.-S. Wang, S. Govindarajan, A. G. Redeker, J. L.Gerin, and M. Houghton. 1988. A single antigenomic open reading frame ofthe hepatitis delta virus encodes the epitope(s) of both hepatitis delta anti-gen polypeptides p24d and p27d. J. Virol. 62:594–599.

30. Wong, S. K., S. Sato, and D. W. Lazinski. 2001. Substrate recognition byADAR1 and ADAR2. RNA 7:846–858.

31. Wu, T. T., V. V. Bichko, W. S. Ryu, S. M. Lemon, and J. M. Taylor. 1995.Hepatitis delta virus mutant: effect on RNA editing. J. Virol. 69:7226–7231.

32. Zheng, H., T. B. Fu, D. Lazinski, and J. Taylor. 1992. Editing on the genomicRNA of human hepatitis delta virus. J. Virol. 66:4693–4697.

33. Zuccola, H. J., J. E. Rozzelle, S. M. Lemon, B. W. Erickson, and J. M. Hogle.1998. Structural basis of the oligomerization of hepatitis delta antigen. Struc-ture 6:821–830.



http://jvi.asm.org/

Dow

nloaded from

http://jvi.asm.org/

Documents

Hepatitis Delta Virus Minimal Substrates Competent for ...jvi.asm.org/content/75/18/8547.full.pdf · (U4-D5) were made by deleting antigenomic sequences from 1004 to 586 from FIG