Poster Session - Cartilage Matrix Biology - Hall E 47th Annual Meeting, Orthopaedic Research Society, February 25 - 28, 2001, San Francisco, California 0389

HOMOLOGY OF MSF/CACP/LUBRICIN EXPRESSION BY HUMAN ARTICULAR CHONDROCYTES AND SYNOVIALFIBROBLASTS

+*Jay, G D. (A-National Institute on Aging); *Cha, C+*Brown University School of Medicine and Rhode Island Hospital, Providence, RI. Department of Emergency Medicine, 401-444-6656, Fax: 401-444-6662,

gregory_jay_MD@brown.edu

Lubricin, the classical boundary lubricating glycoprotein present in synovialfluid has recently been linked to megakaryocyte stimulating factor (MSF;GenBank U70136) gene expression by human synoviocytes. MSF iscomprised of 12 exons resulting in a polyprotein with mulifunctional domains.Superficial zone protein (SZP), secreted by superficial zone chondrocytes, hasalso been shown to be a product of MSF. On the basis of SDS-PAGE, purifiedlubricin (280 kDa) and SZP (340 kDa) differ in apparent molecular weight.The small difference in molecular weight is due to either a different primarystructure or in the amount and type of post-translational glycosylation. Theformer possibility was examined in this study by performing RT-PCR againstboth cell types with different cDNA primer pairs across the MSF gene. Thepossibility that both cell types express a lubricating protein with similarstructure is intriguing since MSF has been linked by yet another laboratory tothe locus responsible for camptodactyl-arthropathy-coxa vara-pericarditissyndrome (CACP). The phenotype of which includes non-inflammatory largejoint arthropathy.

Methods:Isolation and Culture of Human Synovial FibroblastsHuman synovium with a normal macroscopic appearance was obtained from a30 year old white male undergoing knee arthroscopy for a damaged meniscus.Within 1 hr after surgery, the tissue was washed three times with Dulbecco's

saline (GIBCO). Pieces 2 mm3 in size were divided and placed in Dulbecco'smodified Eagle's medium (DMEM) (GIBCO), supplemented with 100 U ofpenicillin and 100 µg of streptomycin per ml (GIBCO), containing 4 mg/ml ofClostridiopeptidase A 125-200 U/mg (Worthington) and incubated for 4 hrs in20 ml of medium at 37° in a moist atmosphere of 5% carbon dioxide. Anequal volume of 0.05% trypsin and 0.02% EDTA in modified Puck's Saline A(GIBCO). The suspension was centrifuged and the pellet suspended inmodified Eagle's medium (20 ml) supplemented with 10% fetal bovine serum(FBS) (Flow Laboratories). Synovial fibroblasts were grown to confluenceand by P5 cells were harvested.Isolation and Culture of Human Articular ChondrocytesCartilage from the femoral condyles and tibial plateaus of human knee jointswas obtained at autopsy from donors without known history of joint disease orfrom healthy organ donors from tissue banks. Full thickness slices of cartilagewere harvested at autopsy from knee joints that had a macroscopically normalcartilage surface. Cartilage slices were cut into 2-3mm3 pieces, washed withDMEM (Whittaker MAB Bioproducts) and treated for 15 min with trypsin10% (w/v) in a 37°C waterbath. The tissues were transferred to DMEM, 5%FBS, penicillin-streptomycin-fungizone, and 2 mg/ml C. perfringenscollagenase type IV (Sigma) and digested overnight on a gyrorotary shaker.The cells were washed 3 times with DMEM and cultured in DMEMcontaining 5% FBS in a 60 mm plastic petri dish (Falcon). After 24 hrs, P0cells were harvested.RNA Extraction and RT-PCR AnalysesRNA from human synovial fibroblasts and articular chondrocytes werepurified by RNeasy mini-columns and reagents (Qiagen). Contaminatinggenomic DNA was removed by DNAshredder and DNase (RNase free)(Qiagen). Complimentary DNA synthesis was done by incubating at 25ºC for10 min for extension of hexameric primers (Table) followed by reversetranscriptase (RT) at 42°C for 12 min. Polymerase chain reaction (PCR) wasinitiated by Ampli Taq/denaturation of RNA-cDNA complex at 95°C for 10min. Thermal cycling condition was 43 cycles of 94°C, 20 secs fordenaturation and 62°C, 60 secs, and a final extension at 72°C for 7 mins (PEApplied Biosystems). RT-PCR products were analyzed by 3% NuSieve GTGagarose (FMC) gel electrophoresis stained with ethidium bromide. Bands ofinterest and those not corresponding to expected RT-PCR product sizes wereexcised and extracted from agarose (Qiagen). Template sequencing wasperformed on a PE Applied Biosystems 377 DNA Sequencer. Backward andforward exon 6 primers were 5’-GGGTCTGGGATTTATTGGTTTTGC-3’and 5’-GGCATTATCATCAATCCCATGC-3’ respectively in addition to thefollowing:

Primer (5’ – 3’) Forward Primer1 – 6 TTGTTGCTGCTGTCTGTTTTCG2 – 6 GGAGATGTGGGGAAGGGTATTC4 – 6 CACCATCTTCAAAGAAAGCACCTC5 – 6 CCTCCTCTTCCTCTTCTTCTTCAAC

(5’ – 3’) Backward Primer6 – 11 CACATTTGGAAGTCCTCTCCACAG6 – 12 TTGCTCTTGCTGTTCTACTAGGCAC

Results:RT-PCR Analysis of Synovial Fibroblast and Articular Chondrocyte RNART-PCR products of the predicted size in addition to others that were smallerthan predicted were observed for both cell types (Fig. A & B).

The primer pair spanning from exon 1 to exon 6 failed to singularly generatethe predicted product size of 756 bp. Instead three smaller sized (350, 450 and490bp) bands were observed for both cell types (Fig. A). The primer pairspanning from exon 2 to the 5’-terminus of exon 6 produced a productroughly 420bp (Fig. A, arrow) in size for both cell types and was 272bp

(692bp -420bp) shorter than its predicted size. The predicted RT-PCR 692 bpproduct was faintly observed for chondrocytes and less so for synovialfibroblasts. The exon 2 to 6 primer pair 420bp product was excised andsequenced which revealed the absence of exons 4,5. Sequencing of the 490and 450bp products from the exon 1 to 6 primer pair identified the samedeletions. Sequencing of the smaller 350bp product from the exon 1 to 6primer pair revealed these same deletions in addition to exon 2. The primerpair of exon 4 and 6 produced the expected RT-PCR product of 449bp forboth cell types and a smaller 340bp product (Fig. B) missing exon 5. Theprimer pair of exon 5 and 6 produced the expected RT-PCR product of 278bpfor both cell types (Fig. B). The primer pair spanning the 3’-terminal end ofexon 6 to the 5’-end of exon 12 was observed to be 769bp, its predictedlength, for both cell types. The primer pair spanning the same position in exon6 to exon 11 produced an expected product of 654bp (data not shown).Discussion:Based on these results it was predicted that alternative splicing wasresponsible for generating 4 different phenotypical isoforms of MSF fromboth synovial fibroblasts and chondrocytes. Phenotype V0 consists of all 12exons, V1 missing exon 5, V2 missing exons 4,5, and V3 missing exons 2,4and 5. Each isoform contains exons 1, 3 and 6-12. Lubricin and SZP appearto share the same primary structure but differences in post-translationalmodifications may exist.