Upload
lytu
View
219
Download
0
Embed Size (px)
Citation preview
JOANA MARQUES DA CUNHA
Host-parasite interactions in leishmaniasis
In vitro and in vivo study of Leishmania infantum strains isolated from
different human patients
Interações hospedeiro-parasita na leishmaniose
Estudo in vitro e in vivo de estirpes de Leishmania infantum isoladas
de diferentes doentes humanos
Tese de Candidatura ao grau de Doutor em
Patologia e Genética Molecular submetida ao
Instituto de Ciências Biomédicas Abel Salazar e
Faculdade de Medicina da Universidade do Porto
Orientador: Doutora Anabela Cordeiro da Silva
Categoria: Professor Associado com Agregação
Afiliação: Faculdade de Farmácia e Instituto de
Biologia Molecular e Celular, Universidade do
Porto, Portugal
Co-orientador: Doutor Javier Moreno
Categoria: Investigador titular
Afiliação: Centro Colaborador da OMS para a
Leishmaniose, Centro Nacional de Microbiologia,
Instituto de Salud Carlos III, Espanha
iii
Author’s declaration
The author of this thesis declares that she afforded a major contribution to the conceptual
design and technical execution of the work, interpretation of the results and manuscript
preparation of the accepted and submitted articles included in this dissertation.
Additionally, she hereby declares that the following original articles/communications were
prepared in the scope of this dissertation.
The candidate was supported by a doctoral fellowship (SFRH/BD/48626/2008) given by
the “Fundação para a Ciência e a Tecnologia” (FCT; Portugal). The Parasite Disease
Group at IBMC - Instituto de Biologia Molecular e Celular (Portugal) and the WHO
Collaborating Center for Leishmaniasis at Centro Nacional de Microbiologia, Instituto de
Salud Carlos III (Spain) provided the facilities, reagents and logistical supports.
v
Scientific publications
ARTICLES IN INTERNATIONAL PEER-REVIEWED JOURNALS
In the scope of this dissertation
1. Cunha J, Carrillo E, Sánchez C, Cruz I, Moreno J and Cordeiro-da-Silva A:
Characterization of the biology and infectivity of Leishmania infantum
viscerotropic and dermotropic strains isolated from HIV+ and HIV- patients in
the murine model of visceral leishmaniasis. Parasites and Vectors 2013, 6:122
2. Santarém N and Cunha J, Silvestre R, Silva C, Moreira D, Ouellette M and Cordeiro-
da-Silva A: The impact of distinct culture media in Leishmania infantum biology
and infectivity. In press in Parasitology 2013
Participation in other publications in related fields
3. Lima SC, Silvestre R, Cunha J, Barros D, Baltazar MT, Dinis R, Cordeiro-da-Silva A:
Crucial CD8+ T lymphocyte cytotoxic role in amphotericin B nanospheres
efficacy against experimental visceral leishmaniasis. Submitted to Small 2013
4. Carrillo E, Jimenez MA, Sánchez C, Cunha J, Seva AP, Moreno J: Protein energy
malnutrition weakens the immune response and favors the progression of
visceral leishmaniasis in hamsters. Submitted to PLOS Negl Trop Dis 2013
5. Santos AC, Cunha J, Veiga F, Cordeiro-da-Silva A, Ribeiro AJ: Ultrasonication of
insulin microgel particles: impact on particle's size and insulin bioactivity.
Accepted in Carbohydrate Polymers 2013
6. Resende M, Moreira M, Cunha J, Augusto J, Neves B, Cruz MT, Estaquier J,
Cordeiro-da-Silva and Silvestre R: Leishmania-infected MHC-IIhigh dendritic cells
polarize CD4+ T cells towards a non-protective T-bet+INFγ+IL10+ phenotype.
Journal of immunology 2013, 191(1):262-73
7. Neves BM, Silvestre R, Resende M, Ouaissi A, Cunha J, Tavares J, Loureiro I,
Santarem N, Silva AM, Lopes MC et al: Activation of phosphatidylinositol 3-
kinase/Akt and impairment of nuclear factor-kappaB: molecular mechanisms
behind the arrested maturation/activation state of Leishmania infantum-infected
dendritic cells. The American journal of pathology 2010, 177(6):2898-2911.
vi
PUBLICATIONS OF SCIENTIFIC MEETINGS
In the scope of this dissertation
1. Cunha J (presenting author), Carrillo E, Sánchez C, Tavares J, Moreno J and
Cordeiro-da-Silva A: Characterization of the virulence of Leishmania infantum
isolates from human patients. Immunology 2012, 137, Issue Supplement s1
(Special Issue: Abstracts of the European Congress of Immunology, 5-8 September
2012, Glasgow, Scotland):555.
2. Cunha J (presenting author), Moreno J and Cordeiro-da-Silva A: Comparative study
between naturally attenuated and virulent strains of Leishmania infantum:
culture conditions and infectiveness. Acta Parasitológica Portuguesa 2010, 17(2;
Congresso Português de Parasitologia, 8-10 September 2010, Porto, Portugal):97.
Participation in other publications in related fields
3. Hanniffy S (presenting author), Sánchez C, Cunha J, Carrillo, Cañavate C, Moreno J:
Mucosal vaccination using non-pathogenic lactic acid bacteria as a strategy to
prevent morbidity and mortality caused by visceral Leishmaniasis European
Journal TM&IH Tropical Medicine & International Health 2011, 16 (Supplement 1 -
Special Issue: Abstracts of the 7th European Congress on Tropical Medicine and
International Health 3-6 October 2011 Barcelona, Spain.):198.
4. Neves B, Silvestre R, Cunha J, Tavares J, Resende M, Ouaissi A, Lopes MC, Cruz MT
& Cordeiro-da-Silva A: Immunomodulation of dendritic cells by virulent and
attenuated Leishmania infantum strains. European journal of immunology 2009,
39(Supplement 1/09 - Abstracts of the 2nd European Congress of Immunology,
September 13-16 2009, Berlim, Germany):365.
vii
POSTER COMMUNICATIONS
In the scope of this dissertation
1. Cunha J (presenting author), Carrillo E, Sánchez C, Tavares, J, Moreno J and
Cordeiro-da-Silva A: Characterization of the virulence of Leishmania infantum
isolates from human patients. 3rd European Congress of Immunology, September
5-8, 2012, Glasgow, Scotland, Poster 1168
2. Santarém N and Cunha J (presenting authors), Silva C, Moreira D, Silvestre R and
Cordeiro-da Silva A: The development of a semi-defined medium for growth of
Leishmania infantum. 3rd I3S Scientific Retreat, May 10-11, 2012, Póvoa de Varzim,
Portugal, Poster 14
3. Cunha J (presenting author), Moreno J, Cordeiro-da-Silva A: In vitro comparative
study between naturally attenuated and virulent strains of Leishmania
infantum. 2nd I3S Scientific Retreat, May 5-6, 2011, Póvoa de Varzim, Portugal,
Poster 12
4. Cunha J (presenting author), Moreno J, Cordeiro-da-Silva A: Comparative study
between naturally attenuated and virulent strains of Leishmania infantum:
culture conditions and infectiveness. XIV Congresso Português de Parasitologia
2010, Porto, Portugal, Poster P-31
Participation in other communications in related fields
5. Resende M (presenting author), Moreira D, Cunha J, Neves B, Lima SC, Cruz MT,
Cordeiro-da-Silva A & Silvestre R: Infected but not Bystander Dendritic Cells
polarize CD4+ T cells towards a non-protective T-bet+ INFγ+ IL10+ phenotype.
XXXVII Annual Meeting of the Portuguese Society for Immunology, November 29-
30, 2011, Oeiras, Portugal
6. Robalo AL (presenting author), Pereira JA, Resende M, Moreira D, Cunha J, Costa-
Lima S, Cordeiro-da-Silva A & Silvestre R: Activation of IL-27 p28 gene
transcription on antigen presenting cells infected with Leishmania infantum.
XXXVII Annual Meeting of the Portuguese Society for Immunology, November 29-
30, 2011, Oeiras, Portugal
viii
7. Hanniffy S (presenting author), Sánchez C, Cunha J, Carrillo, Cañavate C, Moreno
J: Mucosal vaccination using non-pathogenic lactic acid bacteria as a strategy
to prevent morbidity and mortality caused by visceral Leishmaniasis. 7th
European Congress on Tropical Medicine and International Health, October 3-6,
2011, Barcelona, Spain, Poster 1.3-106
8. Resende M, Cunha J, Costa-Lima S, Moreira D, Cordeiro-da-Silva A and Silvestre R
(presenting author): Early stages of visceral Leishmania infection. 2nd I3S
Scientific Retreat, May 5-6, 2011, Póvoa de Varzim, Portugal, Poster 23
9. Resende M (presenting author), Silvestre R, Neves B, Cunha J, Cruz MT &
Cordeiro-da-Silva A: Differential effect of Leishmania infantum on infected and
bystander dendritic cells. XXXVI Annual Meeting of the Portuguese Society for
Immunology, September 20-11, 2010, Braga, Portugal
10. Neves B, Silvestre R, Cunha J (presenting author), Tavares J, Resende M, Ouaissi
A, Lopes MC, Cruz MT & Cordeiro-da-Silva A: Immunomodulation of dendritic
cells by virulent and attenuated Leishmania infantum strains. 2nd European
Congress of Immunology 2009, Berlin, Germany, Poster PA11/60
ix
Acknowledgments
I am very grateful to everyone who directly or indirectly made this thesis possible to be
developed and concluded. During these more than five years I have worked with amazing
people that taught me everything I know in Science, helped me to be more critical about
what is known and more curious about the unknown. With all of you I grew up and
became the Scientist which I expect to have accurately transposed in this thesis.
To Professor Anabela I thank the opportunity for accepting me in her lab many years ago
where I gave my first steps in Science. Thank you for guiding me in the road that led me
to the accomplishment of this work.
To Javier I thank for his kindness when I first arrived to his lab, receiving me as part of
his family. It was just a first demonstration of the good heart he has. Thank you for
showing me that sometimes I just have to look at things in a more relaxed way.
Eugenia, what a friend and an inspiration you became to me! Thank you for listen to me,
think with me and work along me. Your support and open mind were essential. And if we
join Carmen “San”, no one can stop us! Carmen, tu alegría es contagiosa! Soy una persona
diferente después de haberte conocido.
To Isra, the “master of the Molecular Biology”, thank you for sharing your knowledge (but
never your primers or pipettes… ). To Sean, our Scottish “Clark Kent”, for making me
feel so well organized . Thanks for your company in some of the working weekends. To
Javier Nieto for first introduce me to Madrid. To Carmen Cañavate, Emi, Carmen
Chicharro, Maria Flores y las chicas del laboratório. To all of you in the Parasitology
Department for the several farewell parties you organized for me. Thank you all for your
kindness, especially Espe, Carolina, José and Chus.
To Ramona, “mi abuelita gallega”, thank you for making me feel at home in your home.
You truly represented my family in Madrid. Te echaré de menos.
I thank Mariana for the company in the late hours. When it was needed we did it. Thanks
for the chocolates and for our nice lunches outside IBMC. Sofia and Diana, thanks for
giving me a hand taking care of the cell cultures when I was in vacations. Ricardo, thanks
for your expertise in almost every subject. You rock! And Nuno, I still remember that it
was you who taught me how to do ELISAS. No one understands your music taste as I do… I
thank Joana Tavares for her dedication. Back in the old days you were an example to me.
x
To Lúcia, Inês, Vasco, Ana Luísa, Daniela and Patrícia, thanks for being part of this
journey at some point.
To my very best friends, Pi e Sarocas, I thank you both for always being there. We grew
up, we don’t have the time to be together as before, but I love when me manage to have
lunch just us 3 or to do a 6-pack program. I LUV U, girls!
I also thank Joaninha and Bárbara. We are such different 3 Pharmacists… Thanks for
presenting me your reality and helping me doing my choices.
I am very grateful to my family that gave me unconditional love and support. You taught
me to never give up and to fight for my goals. Mum, thanks for being my mumi. You try
your best, and I don’t know if you know, but you are the best! Dad, thank you for always
being there for me. I am so proud of being your daughter. I thank you both for raising me
and letting me fulfilled whatever dreams I had.
To Sérgio, my beautiful husband, I cannot express how grateful I am for your love,
support and patience. I am sorry for making you feel alone when I was gone, or tired of
waiting for me in “big experiment days”. Thank you so much for having me. We are now
ready to move one step forward in our lives. I love you very much. You’re everything…
I also thank to João Leandro for treating me as a daughter. Thanks to your lovely family
for being part of my family too. I appreciate your support. You’re great! Thanks to
Cristina and João for being part of my life too.
And to all the other members of my family, I thank for your love, support and wise
advices.
Finally, I would like to officially thank to FCT for believing in me and financing me with a
personal scientific grant and to IBMC and ISCIII for making available all the facilities that
made my work possible.
xi
Summary
Leishmania spp. are protozoan parasites responsible for a group of clinical manifestations
collectively known as leishmaniasis. The parasite is transmitted to the mammalian host by
the bite of an infected female phlebotomine sand fly where it exists as promastigote forms.
The metacyclic promastigote is the infective stage for the mammalian host but it must
rapidly convert into the intracellular amastigote form to survive inside the host’s
macrophages.
Leishmaniasis are zoonotic or anthroponotic diseases spread over the Mediterranean,
tropic and subtropic regions worldwide. They are considered neglected infectious
diseases and the emergence of HIV/Leishmania co-infections in developed countries
brought new interest on the disease. Anti-Leishmania drugs are efficient but treatment is
highly toxic and associated with elevated cost, not only because of the price of the
treatment itself but also due to mandatory hospitalization in most of the cases.
The search for the human vaccine against visceral leishmaniasis, the most severe form of
the disease, for long has been attempted but without positive results. However, there are
three licensed vaccines for canine leishmaniasis, an important factor in the epidemiology
of leishmaniasis in Brazil and Southern Europe, where dogs are the main domestic
reservoir for the parasite.
Few years ago our group described the efficacy of the live attenuated sir2 single knockout
Leishmania infantum in the protection from the wild type virulent challenge in the murine
model of visceral leishmaniasis. With the knowledge that advent from that work and
maintaining the interest on the research for a vaccine for visceral leishmaniasis, we
wanted to experimentally explore the possibility of the naturally attenuated strains in the
protection from a secondary virulent infection.
In some cases, HIV+ patients have been revealing to be infected by Leishmania parasites
with rare zymodemes that have never been described in immunocompetent persons or
dogs. This fact supports the hypothesis that those strains are only pathogenic in
conditions of immunosuppression and, therefore, are less virulent than those found in
immunocompetent hosts. Nevertheless, very little is known about the infective,
pathogenic, immunogenic and protective capabilities of these naturally attenuated strains
in an immunocompetent host. Therefore, experimental confirmation of the non-
pathogenicity of these Leishmania attenuated strains would promote its interest as live
attenuated vaccines.
To study Leishmania biology a reliable source of parasites is needed. Many are the
options available of semi-define and complete define culture media for the in vitro culture
of Leishmania promastigotes. However, the choice of the culture medium to use should be
xii
a rational decision since it influences the growth, the development and, ultimately, the
infectivity of the parasites.
This thesis starts with a systematic analysis of the morphology, viability, cell cycle
progression, metacyclic profile, capacity to differentiate into axenic amastigotes and
infectivity of L. infantum promastigotes when cultivated in different well-established culture
media. Indeed, the different media revealed to leave an imprint in the infectivity of the
parasite. Furthermore, using a rational approach from the evaluated media, it was
developed a simple serum free culture medium that showed to be useful for long-term
low-cost maintenance of L. infantum or studies requiring the production of promastigotes
in the absence of proteins.
Four L. infantum strains responsible for cutaneous or visceral leishmaniasis in
immunocompetent or immunosuppressed patients were studied in the scope of
understanding their infective, pathogenic, immunogenic and protective capabilities in an
immunocompetent host. To avoid any biased results, the establishment of the culture
settings for the four studied strains that allow the generation of similar promastigotes was
successfully done. The murine model of visceral leishmaniasis used in this thesis put on
evidence the inherent infectivity of each one of the four L. infantum strains and their
potential and differential immunomodulatory capacities.
Finally, for the first time it was evaluated the impact of infection-induced immunity on a
secondary homologous or heterologous infection with L. infantum strains in the murine
model of visceral leishmaniasis. The two most infective strains were used to assess the
cellular innate and adaptive immune responses generated 6 weeks after infection and
their efficacy in protecting against subsequent challenge. The high infective strain showed
partial protection against re-infection due to the expansion of central and effector memory
T cell populations and also by the production of IFNγ by both CD4+ and CD8+ T cells and
double producers CD4+IFNγ+IL-10+ and CD8+IFNγ+TNFα+. No protection upon virulent
challenge was observed when a strain with lower infectivity was used as imprinting,
revealing the need of a virulent infection to generate and maintain appropriate immunity.
With the work performed within this thesis it was concluded that inherent characteristics of
each infective L. infantum strain are responsible for the tropism and memory generation
mechanisms, two processes that remarkably influence the outcome and progression of
leishmaniasis. These findings contribute to the general acceptance that leishmaniasis is a
multifactorial disease with the clinical outcome being highly dependent on the infectivity of
the strain and the susceptibility of the host.
xiii
Keywords
Leishmania infantum, visceral leishmaniasis, clinical isolates, culture media, infectivity,
tropism, infection-induced immunity, memory, protection.
xiv
Resumo
Leishmania spp. são parasitas protozoários responsáveis por um grupo de manifestações
clínicas designadas de leishmaniose. O parasita é transmitido ao mamífero hospedeiro
pela picada de uma mosca da areia infetada com forma promastigota. O promastigota
metacíclico é a forma infeciosa para o mamífero, mas para sobreviver no interior dos
macrófagos do hospedeiro o promastigota tem rapidamente de converter-se na forma
amastigota intracelular.
A leishmaniose é uma doença zoonótica e antroponótica dispersa mundialmente pelas
regiões mediterrânica, tropicais e subtropicais. Desde sempre tem sido considerada uma
doença infeciosa negligenciada, mas a emergência de co-infeções HIV/Leishmania em
países desenvolvidos trouxe um novo interesse à doença. Os fármacos anti-Leishmania
apesar de eficazes constituem um tratamento altamente tóxico e que está associado a
custos elevados, não só pelo preço do tratamento em si mas também devido à
hospitalização requerida na maioria dos casos.
A procura da vacina humana para a leishmaniose visceral, a forma mais grave da
doença, remonta há várias décadas mas sem nunca alcançar resultados positivos. No
entanto, há três vacinas licenciadas para a leishmaniose canina, um fator importante na
epidemiologia da leishmaniose no Brasil e sul da Europa onde os cães são o principal
reservatório doméstico.
Há alguns anos atrás o nosso grupo descreveu a eficácia de uma estirpe viva de
Leishmania infantum geneticamente atenuada pela remoção de um dos alelos do gene
sir2 na proteção contra uma infecção com a estirpe selvagem no modelo de leishmaniose
visceral murina. Com o conhecimento adquirido nesse trabalho e mantendo o interesse
na investigação da vacina para a leishmaniose visceral, quisemos explorar a
possibilidade de estirpes naturalmente atenuadas induzirem proteção contra uma infeção
virulenta.
Nalguns casos, os doentes HIV+ co-infetados têm demonstrado ser infetados por estirpes
de Leishmania com zimodemos pouco frequentes que nunca foram descritos em pessoas
imunocompetentes ou em cães. Este facto suporta a hipótese de estas estirpes serem
patogénicas apenas em condições de imunossupressão e, por isso, serem menos
virulentas do que aquelas encontradas em hospedeiros imunocompetentes. No entanto,
pouco se sabe sobre a infetividade, patogenicidade, imunogenicidade e capacidade
protetora destas estirpes naturalmente atenuadas num hospedeiro imunocompetente. Por
isso, a confirmação experimental da não-patogenicidade destas estirpes atenuadas de
Leishmania iria levar ao seu interesse como vacinas vivas atenuadas.
xv
Para estudar a biologia da Leishmania é necessária uma fonte confiável de parasitas.
Muitas são as opções disponíveis de meios de cultura semi-definidos e totalmente
definidos para a cultura in vitro de promastigotas de Leishmania. No entanto, a escolha
do meio de cultura a usar deve ser uma decisão racional uma vez que influencia o
crescimento, o desenvolvimento e, consequentemente, a infetividade dos parasitas.
Esta tese inicia-se com a análise sistemática da morfologia, viabilidade, progressão
durante o ciclo celular, perfil de metaciclogénese, capacidade de diferenciação em
amastigotas axénicos e infetividade de promastigotas de L. infantum em diferentes meios
de cultura bem caracterizados na área. Efetivamente, a escolha do meio de cultura
revelou-se determinante na infetividade do parasita. Além disto, usando uma abordagem
racional a partir dos meios avaliados, desenvolveu-se um meio de cultura simples sem
soro que mostrou ser interessante para a manutenção de L. infantum por longos períodos
de tempo de forma económica ou para aplicação em estudos que exijam a produção de
promastigotas na ausência de proteínas.
Quatro estirpes de L. infantum agentes de leishmaniose cutânea ou visceral em doentes
imunocompetentes ou imunodeprimidos foram estudadas no sentido de compreender as
suas capacidades de infeção, patogénicas, imunogénicas e protetoras num hospedeiro
imunocompetente. Para evitar resultados tendenciosos, o estabelecimento das condições
de cultivo para as quatro estirpes em estudo que permitem a geração de promastigotas
semelhantes foi conseguido com sucesso. O modelo murino de leishmaniose visceral
usado nesta tese evidenciou a infetividade intrínseca de cada uma das quatro estirpes de
L. infantum e as suas diferentes capacidades potencialmente imunomodulatórias.
Finalmente, pela primeira vez foi avaliado o impacto da imunidade induzida pela infeção
na infeção secundária homóloga ou heteróloga com estirpes de L. infantum no modelo
murino de leishmaniose visceral. As duas estirpes com maior infetividade foram usadas
para determinar as respostas celulares inata e adaptativa geradas 6 semanas após
infeção bem como a sua eficácia na proteção contra uma infeção subsequente. A estirpe
com maior infectividade mostrou proteção parcial contra re-infeção devido à expansão
das células T de memória central e efetora e também pela produção de IFNγ pelas
células T CD4+ e CD8+ e duplas produtoras CD4+IFNγ+IL-10+ e CD8+IFNγ+TNFα+. No
entanto, não foi observada proteção quando se usou a estirpe com menor infetividade na
primo-infeção, revelando a necessidade de uma infeção virulenta para a geração e
manutenção de imunidade adquirida eficaz contra uma re-infeção virulenta.
Com o trabalho realizado nesta tese foi concluído que as características intrínsecas de
cada estirpe de L. infantum são responsáveis pelo tropismo e mecanismos de
desenvolvimento de memória imunológica, dois processos que influenciam
marcadamente a manifestação e a progressão da leishmaniose. Estes dados reforçam a
xvi
corrente da leishmaniose ser uma doença multifatorial cuja manifestação clínica é
altamente dependente da capacidade de infeção da estirpe e da suscetibilidade do
hospedeiro.
Palavras-chave
Leishmania infantum, leishmaniose visceral, isolados clínicos, meio de cultura,
infetividade, tropismo, imunidade induzida pela infeção, memória, proteção.
xvii
Resumen
Leishmania spp. son parásitos protozoarios responsables de un grupo de enfermedades
que se conocen de forma conjunta como leishmaniasis. El parásito es trasmitido al
hospedador mamífero por la picadura de un flebótomo infectado donde existe en la
forma promastigote. El promastigote metacíclico es la forma infecciosa para el mamífero,
pero para sobrevivir dentro de los macrófagos hospedadores el promastigote tiene que
convertirse rápidamente en la forma amastigote intracelular.
Las leishmaniasis son enfermedades zoonóticas o antroponóticas que se distribuyen por
las regiones mediterráneas, tropicales y subtropicales. Se considera una enfermedad
infecciosa desatendida, aunque la emergencia de co-infecciones HIV/Leishmania en
países desarollados ha generado un nuevo interés por esta enfermedad. Los fármacos
anti-Leishmania son eficaces pero el tratamiento es altamente tóxico y está asociado a
costes elevados, no sólo por el precio del tratamiento en sí pero también debido a la
hospitalización requerida en la mayoría de los casos.
La búsqueda de la vacuna humana para la leishmaniasis visceral, la forma más grave de
la enfermedad, se remonta a varias décadas pero sin alcanzar nunca resultados positivos
completos. En este momento, hay tres vacunas licenciadas para la leishmaniasis canina,
lo que constituye una herramienta importante en el control epidemiológico de la
leishmaniasis en Brasil y sur de Europa, donde el perro constituye el principal reservorio
doméstico del parásito.
Hace algunos años nuestro grupo describió la eficacia de una cepa viva de Leishmania
infantum atenuada genéticamente por la deleción de uno de los alelos del gen sir2 en la
protección contra un desafío con la cepa salvaje en el modelo murino de leishmaniasis
visceral. Con el conocimiento adquirido de ese trabajo y manteniendo el interés en la
investigación de una vacuna para la leishmaniasis visceral, hemos querido explorar la
posibilidad de utilizar cepas naturalmente atenuadas en la protección contra una segunda
infección virulenta.
Se ha confirmado que parte de los enfermos VIH+ coinfectados estaban infectados por
cepas de Leishmania con zimodemas poco frecuentes que no habían descritos en
personas inmunocompetentes o en perros. Este hecho apoya la hipótesis de estas cepas
sean patógenas sólo en condiciones de inmunossupressión y, por eso, sean menos
virulentas que aquellas encontradas en hospedadores inmunocompetentes. Sin embargo,
se sabe poco sobre la infectividad, patogenicidad, inmunogenicidad y capacidad
protectora de estas cepas naturalmente atenuadas en un hospedador
inmunocompetente. Por eso, la confirmación experimental de la no-patogenicidad de
xviii
estas cepas atenuadas de Leishmania llevaría a platear su interés como vacunas vivas
atenuadas.
Para estudiar la biología de Leishmania es necesaria una fuente de parásitos de
confianza. Muchas son las opciones disponibles de medios de cultivo semi-definidos y
totalmente definidos para el cultivo in vitro de promastigotas de Leishmania. Sin embargo,
la elección del medio de cultivo a usar debe ser una decisión racional ya que afecta el
crecimiento, el desarrollo y, consecuentemente, la infectividade de los parásitos.
Esta tesis se inicia con el análisis sistemático de la morfología, viabilidad, progresión
durante el ciclo celular, perfil de metaciclogenesis, capacidad de diferenciación en
amastigotes axénicos y infectividad de promastigotes de L. infantum en diferentes medios
de cultivo bien caracterizados en este campo. Efectivamente, la elección del medio de
cultivo se reveló determinante en la infectividad del parásito. Además, usando un
abordaje racional a partir de los medios evaluados, se desarrolló un medio de cultivo
simple sin suero que demostró ser particularmente útil para el mantenimiento de L.
infantum por periodos largos de tiempo de forma económica o para su aplicación en
estudios que exijan la producción de promastigotes en ausencia de proteínas.
Se estudiaron cuatro cepas de L. infantum causantes de leishmaniosis cutánea o visceral
en enfermos inmunocompetentes o inmunodeprimidos, con el fin de comprender sus
capacidades de infección, patogénicas, inmunogénicas y protectoras en un hospedador
inmunocompetente. Para evitar resultados sesgados, se establecieron con éxito
condiciones de cultivo para las cuatro cepas en estudio que permitieron la generación de
promastigotes similares. El modelo murino de leishmaniasis visceral usado en esta tesis
evidenció la infectividad intrínseca de cada una de las cuatro cepas de L. infantum y sus
diferentes capacidades potencialmente inmunomoduladoras.
Finalmente, se evaluó por primera vez el impacto de la inmunidad inducida por la
infección en la infección secundaria homóloga o heteróloga con cepas de L. infantum en
el modelo murino de leishmaniasis visceral. Las dos cepas con mayor infectividade fueron
usadas para determinar las respuestas celulares innatas y adaptativas generadas 6
semanas después de infección así como su eficacia en la protección contra un nuevo
desafío. La cepa con mayor infectividad mostró protección parcial contra reinfección
debido a la expansión de las células T de memoria central y efectora y también por la
producción de IFNγ por las células T CD4+ y CD8+ y dobles productoras CD4+IFNγ+IL-10+
y CD8+IFNγ+TNFα+. No se observó protección contra un desafío virulento cuando se usó
la cepa con menor infectividad en la primo-infección, revelando la necesidad de una
infección virulenta para la generación y mantenimiento de inmunidad adecuada.
Con el trabajo realizado y los resultados obtenidos en esta tesis se puede concluir que las
características intrínsecas de cada cepa de L. infantum son responsables del tropismo y
xix
los mecanismos de desarrollo de memoria inmunológica, dos procesos que influyen de
forma decisiva en la aparición y la progresión de la leishmaniasis clínica. Estos datos
refuerzan la idea de que la leishmaniasis es una enfermedad multifactorial cuya
manifestación clínica es altamente dependiente de la capacidad de infección de la cepa y
de la susceptibilidad del hospedador.
Palabras clave
Leishmania infantum, leishmaniasis visceral, aislados clínicos, médio de cultivo,
infectividad, tropismo, inmunidad inducida por la infección, memoria, protección.
xxi
Table of Contents
AUTHOR’S DECLARATION iii
SCIENTIFIC PUBLICATIONS v
Articles in international peer-reviewed journals v
Publications of scientific meetings vi
Poster communications vii
ACKNOWLEDGMENTS ix
SUMMARY xi
RESUMO xiv
RESUMEN xvii
ABBREVIATIONS LIST xxvii
INTRODUCTION 1
THE DISEASE 3
HIV/AIDS and leishmaniasis 5
Canine leishmaniasis 6
LEISHMANIA BIOLOGY AND TRANSMISSION 7
IMMUNOBIOLOGY OF LEISHMANIASIS 8
Parasite’s strategies 8
Host defense 9
MEMORY DEVELOPMENT 10
Memory in leishmaniasis 12
PROPHYLAXIS AND TREATMENT 14
Vaccines 14
Drugs 16
TRANSFERRING LEISHMANIA SP. LIFE CYCLE TO THE LABORATORY 19
Promastigotes cultivation 19
Amastigotes cultivation 21
WHAT’S LEFT TO BE DONE? 23
OBJECTIVES 25
AIMS OF THE THESIS 27
xxii
RESULTS 29
THE IMPACT OF DISTINCT CULTURE MEDIA IN LEISHMANIA INFANTUM BIOLOGY AND
INFECTIVITY 31
Abstract 34
Background 35
Materials and methods 37
Results 41
Discussion 49
Supplemental data 55
References 59
CHARACTERIZATION OF THE BIOLOGY AND INFECTIVITY OF LEISHMANIA INFANTUM
VISCEROTROPIC AND DERMOTROPIC STRAINS ISOLATED FROM HIV+ AND HIV- PATIENTS
IN THE MURINE MODEL OF VISCERAL LEISHMANIASIS 63
Abstract 66
Background 67
Materials and methods 69
Results and Discussion 75
Conclusions 86
Supplemental data 88
References 93
Related unpublished data 98
HIGH INFECTIVE LEISHMANIA INFANTUM STRAIN INDUCES STRONG CENTRAL AND EFFECTOR
MEMORY CD4+ AND CD8+ IMMUNITY REQUIRED FOR PARTIAL PROTECTION AGAINST RE-
INFECTION 99
Abstract 102
Background 103
Materials and methods 106
Results and discussion 109
Conclusions 117
References 118
xxiii
DISCUSSION & CONCLUSIONS 123
ON THE IMPORTANCE OF ESTABLISHING THE CULTURE CONDITIONS FOR THE IN VITRO
GROWTH OF LEISHMANIA SP. PARASITES 125
ON THE STRAIN-SPECIFIC CHARACTERISTICS THAT LEAD TO DIFFERENTIAL INFECTIVITY
AND TROPISM 127
ON THE PROTECTIVE ROLE THAT A HIGH INFECTIVE L. INFANTUM STRAIN DISPLAY AGAINST
RE-INFECTION 130
FINAL REMARKS 132
BIBLIOGRAPHY 135
xxiv
Index of Figures
INTRODUCTION
Figure I. Worldwide distribution of VL and CL 4
Figure II. Worldwide distribution of HIV/Leishmania co-infections 6
Figure III. Zoonotic and anthroponotic Leishmania spp. transmission cycles 7
Figure IV. Differentiation progress of CD4+ and CD8+ effector and memory cells 11
Figure V. Leishmania spp. development in the insect vector and in the mammalian host 20
RESULTS
THE IMPACT OF DISTINCT CULTURE MEDIA IN LEISHMANIA INFANTUM BIOLOGY AND INFECTIVITY
Figure 1. Parameters of in vitro development of L. infantum in the different culture media 41
Figure 2. Dominant morphology of logarithmic and stationary-phase L. infantum 42
Figure 3. In vitro and in vivo virulence of promastigotes grown in different culture media 43
Figure 4. Relative expression of metacyclogenesis-related genes in L. infantum
promastigotes grown in the different media
44
Figure 5. Development of a protein-free medium for the growth of L. infantum
promastigotes
45
Figure 6. Biology of L. infantum promastigotes in cRPMI 47
Figure 7. Overtime virulence loss 48
Figure S1. Adjustment of initial inoculum for SDM and Schneider media 55
Figure S2. Histogram of cell cycle analysis of parasites in different media 55
Figure S3. Cell cycle analysis of parasites in different media 56
Figure S4. Dot plot of bone marrow-derived macrophages infected with CFSE-labeled
parasites
56
Figure S5. Relative gene expression of metacyclogenesis-related genes of promastigotes
cultivated in the different media
57
Figure S6. Dominant promastigote morphology during the process of development of the
protein-free media
57
Figure S7. Growth curves of L. infantum in cRPMI after 4 or 20 in vitro passages 58
Figure S8. Influence of different FCS lots on the growth of L. infantum cultivated in RPMI 58
xxv
CHARACTERIZATION OF THE BIOLOGY AND INFECTIVITY OF LEISHMANIA INFANTUM
VISCEROTROPIC AND DERMOTROPIC STRAINS ISOLATED FROM HIV+ AND HIV- PATIENTS
IN THE MURINE MODEL OF VISCERAL LEISHMANIASIS
Figure 1. Molecular characterization of L. infantum isolates 75
Figure 2. Growth of L. infantum in different culture medium 77
Figure 3. Indirect measurement of metacyclogenesis 78
Figure 4. In vitro differential infectivity of L. infantum strains 79
Figure 5. Quantitative distribution of L. infantum in BALB/c mice 2 and 6 weeks after
infection
81
Figure 6. Cell populations in spleens of naive and Leishmania-infected mice in the acute
and chronic phases
84
Figure 7. Leishmania-specific humoral response 85
Additional figure 1. Validation of the qPCR methodology for quantification of the parasite
loads in murine tissues
89
Additional figure 2. K26 gene alignment 90
Additional figure 3. Cell cycle analysis 91
Additional figure 4. Variation of the transcription of metacyclogenesis-dependent genes 92
Additional figure 5. Organ weight 2 and 6 weeks post-infection 92
Figure VI. RFLP patterns of mixed infections 98
HIGH INFECTIVE LEISHMANIA INFANTUM STRAIN INDUCES STRONG CENTRAL AND EFFECTOR
MEMORY CD4+ AND CD8+ IMMUNITY REQUIRED FOR PARTIAL PROTECTION AGAINST
RE-INFECTION
Figure 1. Parasite load after infection and challenge with L. infantum strains
with different infectivity
109
Figure 2. Splenic cellular populations after infection and challenge with highly and low
infective L. infantum strain
111
Figure 3. Expression of CCR2 on splenic macrophages, neutrophils and dendritic cells 112
Figure 4. T cell memory repertoire 114
Figure 5. Intracellular cytokines of CD4+ and CD8+ lymphocytes 115
xxvi
Index of Tables
INTRODUCTION
Table I. Main disease manifestations of leishmaniasis and the Leishmania species
frequently associated with the disease
4
RESULTS
THE IMPACT OF DISTINCT CULTURE MEDIA IN LEISHMANIA INFANTUM BIOLOGY AND INFECTIVITY
Table S1. Comparative cost of the culture media used in the study 58
CHARACTERIZATION OF THE BIOLOGY AND INFECTIVITY OF LEISHMANIA INFANTUM
VISCEROTROPIC AND DERMOTROPIC STRAINS ISOLATED FROM HIV+ AND HIV- PATIENTS
IN THE MURINE MODEL OF VISCERAL LEISHMANIASIS
Table 1. Estimated overall parasite load of L. infantum-infected BALB/c mice 2 and 6
weeks post-infection
82
xxvii
Abbreviations list
AIDS Acquired Immunodeficiency Syndrome
BMMo Bone marrow-derived macrophages
CCR CC chemokine receptor
CD Cluster of differentiation
Challg Challenge
CL Cutaneous leishmaniasis
DCs Dendritic cells
FBS Fetal bovine serum
FCS Fetal calf serum
HIV Human immunodeficiency virus
IL Interleukin
IFNγ Interferon-γ
ITS Ribosomal internal transcribed spacer
IVDUs Intravenous drug users
MCL Mucocutaneous leishmaniasis
MLEE Multilocus enzyme electrophoresis
MLMT Multilocus microsatellite typing
NK Natural killer
NNN Novy-McNeal-Nicolle medium
PCR Polymerase chain reaction
PKDL Post kala-azar dermal leishmaniasis
qPCR Quantitative real time polymerase chain reaction
Re-Inf Re-infection
RFLP Restriction fragment length polymorphism
RT-PCR Reverse transcriptase - polymerase chain reaction
SHERP Small Hydrophilic Endoplasmic Reticulum-associated Protein
TCM Central memory T cells
TEM Effector memory T cells
TGFβ Transforming growth factor-β
Th Helper T lymphocyte
TNFα Tumor necrosis factor-α
VL Visceral leishmaniasis
WHO World Health Organization
INTRODUCTION
3
The disease
Leishmaniasis designate a group of parasitic diseases caused by the infection of the
Leishmania spp. protozoa in humans and several domestic and sylvatic animals. In
humans, four main clinical forms of the disease can be identified according to the clinical
manifestations:
Cutaneous leishmaniasis (CL) comprises cutaneous lesions that are more or
less difficult to heal (depending on the species involved) and leave visible scars
when cured, many times in exposed areas like the face or the arms which can
be socially stigmatizing [1].
Mucocutaneous leishmaniasis (MCL) affects the mucous layers of the nose,
mouth, throat and surrounding tissues, many times leading to mutilating
lesions, which can lead to social exclusion. In contrast to CL, treatment is
always required because the disease can be life-threatening [1].
Visceral leishmaniasis (VL), also known as kala-azar, is the most severe form
of the disease, since it affects the spleen, liver and bone marrow, producing
hepatosplenomegalia, weight loss, pancytopenia, hypergammaglobulinemia
and intermittent low-grade fever. Is fatal if untreated due to severe cachexia
and bleeding (owing to thrombocytopenia that installs with time) [2].
Post kala-azar dermal leishmaniasis (PKDL) is a manifestation that can appear
weeks to years after cure of VL by L. donovani infection [1]. It consists of skin
papules and hypopigmented macules dispersed through the skin. It is frequent
in African and Indian patients but its emergence is not well understood [2].
Up to date, 30 species of Leishmania were described, 20 of them are pathogenic for the
humans [3]. In Table I are depicted the main species that affect humans and the related
disease manifestation.
INTRODUCTION
4
Table I. Main disease manifestations of leishmaniasis and the Leishmania species frequently
associated with the disease
Main type of the disease Species
Old World, subgenus Leishmania
Visceral leishmaniasis Leishmania donovani and Leishmania infantum
Cutaneous leishmaniasis Leishmania major, Leishmania tropica and Leishmania aethiopica
Post kala‐azar dermal leishmaniasis Leishmania donovani
New World, subgenus Leishmania
Visceral leishmaniasis Leishmania infantum
Cutaneous leishmaniasis Leishmania infantum, Leishmania mexicana, Leishmania pifanoi and Leishmania amazonensis
New World, subgenus Viannia
Cutaneous leishmaniasis Leishmania braziliensis, Leishmania guyanensis, Leishmania panamensis and Leishmania peruviana
Mucocutaneous leishmaniasis Leishmania braziliensis and Leishmania panamensis
Adapted from [4]
Leishmaniasis is endemic in 98 countries and 3 territories ranging the Mediterranean
Basin, the Middle East, the Indian sub-continent, and the tropical regions from America
and Africa [5] (Figure I). The last WHO report on the epidemiology of leishmaniasis
estimates that every year 0.7 to 1.2 million new cases of CL are mounted and 0.2 to 0.4
million people develop VL which, in turn, is responsible for 20 000 to 40 000 deaths [5].
Nevertheless, in endemic countries most of the L. infantum- or L. donovani- infected
people are asymptomatic carriers or self-healers [6, 7].
Figure I - Worldwide distribution of VL and CL
Adapted from [8].
INTRODUCTION
5
The relation of leishmaniasis with poverty catalogues it as a neglected tropical disease. In
fact, 72 of the endemic countries are developing nations with a burden of 90% of the VL,
CL and MCL [9]. In these regions, the majority of the population lives in rural areas, where
higher densities of sand flies are found, and are malnourished, a condition that leads to
immunosuppression. In addition, HIV concomitant infection is frequent, contributing to a
severe state of immunodeficiency [10].
However, leishmaniasis is nowadays an important issue in developed countries due to
coinfection cases with HIV where Leishmania arises as an opportunistic infectious agent,
the third of the parasitic infections, after Toxoplasma gondii and Cryptosporidium spp.
[10]. Indeed, 90% of the reported HIV/Leishmania cases are from Southern European
countries, namely Spain, Portugal, Italy and France [11].
HIV/AIDS AND LEISHMANIASIS
HIV/Leishmania co-infections correspond to 2-9% of all the VL cases in endemic countries
(Figure II) [12]. The close geographical overlap of Leishmania and HIV infections promote
the concomitant infection of both pathogens. In fact, HIV infection increases in 100-2320
times the risk of developing VL in the endemic regions. Intravenous drug users (IVDUs)
are an important group in the epidemiology of HIV/Leishmania co-infections. Indeed,
IVDUs have contributed for 76% (between 1990 and 1998) to 67% (between 2000 and
2006) of the HIV/Leishmania co-infected cases [12]. Also, 10% of the overall HIV
infections are transmitted by the use of intravenous drugs; in some regions of Eastern
Europe and Central Asia this number rises to 80% [13]. However, data mainly from the
Southern Europe revealed that since the introduction of the HAART regimes routinely the
number of co-infection cases has dropped [12].
Both diseases present synergistic detrimental effects on the cellular immune response
because they infect similar target cells (macrophages and dendritic cells). Leishmania
induces the secretion of tumor necrosis factor-α (TNFα) and IL-1α which upregulate HIV
gene expression by NF-κB, while HIV-dependent immunosuppression promotes
Leishmania multiplication [14]. VL promotes the progression of HIV infection leading to the
clinical manifestation of AIDS, whereas HIV+ patients present repetitive relapses of
leishmaniasis and, frequently, amastigotes are found in unusual locations, such as the
lungs, tonsils or intestinal tract [12].
INTRODUCTION
6
Figure II. Worldwide distribution of HIV/Leishmania co-infections
Adapted from [14].
CANINE LEISHMANIASIS
In the veterinary field, dogs are a main concern, not only because of the disease itself, but
also because of their importance as reservoir for human transmission. Canine
leishmaniasis (CanL) is endemic in 70 countries of the same affected regions as human
leishmaniasis, including also the United States of America. In non-endemic countries,
however, imported sick dogs constitute an important veterinary and public health problem
[15]. CanL is associated to L. infantum infection and, being a systemic disease, clinical
manifestations are unspecific. Nonetheless, the existence of skin ulcers, onychogryphosis
and marked cachexia are common visible signs in sick dogs. Renal disease is frequently
the only symptom in dogs with CanL and chronic renal failure is often the cause of death
[15].
INTRODUCTION
7
Leishmania biology and transmission
Leishmania spp. are trypanosomatid parasites with a digenetic life cycle that is required
for the perpetuation of the species. The promastigote is a flagellated motile form that
develops in the sand fly vector (Phlebotomus spp. in the Old World or Lutzomyia spp. in
the New World). In the digestive tract of the insect, promastigotes multiply and evolve
through sequential stages until they differentiate in the final infective form, the metacyclic
promastigote [16, 17]. Upon a blood meal on a susceptible mammalian host, metacyclic
promastigotes are deposited in the skin and rapidly captured by neutrophils [18], dendritic
cells (DCs) [19] and macrophages [20]. To survive inside these cells, a dramatic
differentiation step occurs and promastigotes develop into amastigotes, non-motile
intracellular forms which are able to resist and multiply inside the aggressive milieu of the
phagocytes phagolysosomes [21]. Intracellular amastigotes are spread throughout the
organism reaching distant locations from bitten sites, whether residing in the skin or being
capable to enter the viscera and bone marrow.
Leishmania spp. can be transmitted by zoonotic or anthroponotic cycles. L. major [22,23]
and L. infantum are usually of zoonotic transmission, with dogs as the main reservoir,
while L. donovani and L. tropica are generally of anthroponotic origin [24]. A segregation
of the different clinical manifestations related with its reservoir host can, then, be made as
follows: zoonotic VL (by L. infantum), zoonotic CL (by L. major), anthroponotic VL (by L.
donovani) and anthroponotic CL (by L. tropica). In addition to these natural cycles, an
important alternative artificial anthroponotic cycle has been revealed more than one
decade ago with the analysis of blood remnants in syringes discarded by IVDUs [25]
(Figure III).
Figure III. Zoonotic and anthroponotic Leishmania spp. transmission cycles [26]
INTRODUCTION
8
Immunobiology of leishmaniasis
PARASITE’S STRATEGIES
The diversity of clinical manifestations expressed in leishmaniasis derives from a complex
interaction between the parasite and the host’s immune system. In fact, the outcome of
the disease is strongly influenced not only by inherent characteristics of the infective strain
but also by the fitness of the immune system in generating a protective response.
Leishmania spp. are masters at disguising their entry into the host as they downregulate
the activation signals that otherwise would prompt an effective immune response.
Promastigote antigens from the surface glycocalix like gp63 protease (leishmanolysin) or
the lipophosphoglycans (LPG) are known to provide specific resistance to complement-
mediated lysis, the first attack to pathogens that reach the blood, and to participate in the
silent entry of the parasite into the phagocytes [27]. On their hand, amastigotes released
from disrupted macrophages use opsonization with IgG’s Fcγ moiety to enter in new
macrophages without triggering their activation through ligation to Fcγ receptor [27]. A
more elegant approach relies on the “Trojan horse” strategy, where Leishmania takes
advantage of the rapid arrival of neutrophils to the inoculation site and uses them to
blindly enter the macrophages as they phagocyte apoptotic infected neutrophils [28].
However, this mechanism has not yet been demonstrated to occur in vivo and in situ
studies failed to prove it, though the involvement of neutrophils in the early steps of
infection is undoubtable [4].
Once inside the phagocyte, Leishmania is able to downregulate the co-stimulatory
molecules CD40 and CD86 on DCs [29] and CD40 and MHC class II on macrophages
[30] that are needed for the proper activation of T cells. Also, it induces the establishment
of a more favorable anti-inflammatory milieu by increasing IL-10 and diminishing IL-12, IL-
6 and TNFα secretion by those cells [29, 30]. This immunomodulation arrests the
maturation process that is usually driven by the interaction of a pathogen-associated
molecular pattern (PAMP) with Toll-like receptors (TLRs) and interferes with the cross-
talking between innate and acquired immune responses, allowing the parasite to favorably
infect the spleen, liver, lymph nodes and bone marrow in VL [27].
One of the hallmarks in leishmaniasis immunobiology is the hypergammaglobulinemia due
to polyclonal expansion of B cells. In CL a clear segregation of IgG2/IgG1 antibodies in
the dichotomy of Th1/ Th2 responses is related to protection/progression of the disease
[31, 32]. In VL this is not the case and, in general terms, a strong humoral response is
detrimental and increases the severity of the disease [33, 34]. However, the appearance
of IgG2 after vaccination is usually considered a good marker of protection [35].
INTRODUCTION
9
HOST DEFENSE
The primary strategy that the host presents to fight against Leishmania is non-specific and
relies on innate mechanisms of the immune response. As mentioned above, complement-
mediated lysis is the first trap that promastigotes must circumvent to succeed in infection
and, in fact, “the messers become the messies” since Leishmania cleave the C3b factor
transforming it in a C3b1-like molecule that is used by the parasite to enter unnoticeably in
macrophages [27]. Also, Leishmania takes advantage of the C5a cleaved fragment since
it has a negative impact on the TLR4-induced synthesis of IL-12 family of cytokines [27].
Even so, activation of DCs upon contact with Leishmania still occurs in those cells that did
not engulf parasites - the so called bystander cells - leading to the secretion of IL-12
[33,37].
IL-12 is considered a key cytokine in the early development of the effective immune
response due to its requirement for the activation of NK cells and T lymphocytes [38].
Activation of these cells leads to the secretion of interferon-γ (IFNγ), another commander
cytokine.
Both in mice as in humans, macrophages are classically activated by IFNγ. This leads to
the transcription of inducible nitric oxide synthase (iNOS) and phagocyte NADPH oxidase
(phox) that produce nitric oxide (NO) and reactive oxygen species (ROS), respectively,
specimens generally considered indispensable for macrophage-direct killing of
Leishmania [27]. Macrophages activated by IL-12-driven IFNγ secretion by Th1
lymphocytes - M1 macrophages - also produce TNFα, IL-1β and IL-6, pro-inflammatory
cytokines that favor the protective response against Leishmania infection. These
macrophages are, then, both effectors and inducers of the Th1 polarized immune
response [39]. Nevertheless, the strong Th1 pro-inflammatory response must be balanced
with the secretion of IL-10 and transforming growth factor-β (TGFβ) to avoid
immunopathology through excessive tissue damage [40].
However, depending on the Leishmania species involved and the fitness of the host’s
immune system, an alternative activation of the macrophages, through IL-4 and IL-13
secretion by Th2 lymphocytes, can command an immune response favoring the
progression of the infection. These so-called M2 macrophages upregulate arginase 1
which promotes the biosynthesis of polyamines that Leishmania can take up and use for
proliferation [40].
INTRODUCTION
10
Memory development
Effector CD4+ and CD8+ T cells that were activated by the recognition of Leishmania
antigens on the cognate T cell receptor (TCR) and expanded to respond to infection will
face a massive contraction on their numbers of about 90% after the elimination of the
parasite, leaving a subset of experienced cells that constitute the memory pool. Memory
cells are long-lived cells that rapidly expand in response to a secondary challenge with the
priming antigen [41]. They form a heterogeneous pool with distinct abilities in proliferation,
migration and cytokine production that can be easily identified by the differential
expression of some surface molecules, usually CD44 and CD62L in mice [42] or
CD45RA/RO and CD62L or CCR7 in humans [43].
CD44 is the most widely marker for selecting antigen-exposed T cells as, after it has been
upregulated on activated lymphocytes, its expression is sustained on effector and memory
murine cells. Through the interaction with its major ligand, the hyaluronic acid, CD44
regulates cell adhesion and migration, critical phenomena for the recruitment and function
of effector and memory cells. Besides increasing T cell activation and promoting T cell
survival, CD44 also contributes to the regulation of the contraction phase that takes place
after the elimination of the pathogen and the maintenance of tolerance [44]. In humans,
CD45RA is expressed in naïve cells, whereas memory cells upregulate CD45RO in
response to antigen priming [45].
CD62L (L-selectin) is a transmembrane protein with cell adhesion properties and receptor
signaling functions. Both in mice and in humans, it is expressed in the surface of the
majority of circulating leukocytes contributing to their regulated recruitment to the lymph
nodes and inflamed tissues [46, 47]. In the lymph nodes, CD62L+ T cells become
activated by the interaction with antigen presenting cells, which leads to its cleavage.
CD62L shedding from the surface of activated T cells allows them to re-enter circulation
and be directed to target sites where they are needed to employ their effector functions
[48]. The surface expression of CD62L allows, then, and in coordination with CD44
expression to differentiate the two main memory populations, both in CD4+ and in CD8+ T
cells: central memory T cells (TCM) are CD44hiCD62L+ while effector memory T cells
(TEM) are CD44hiCD62L- [42].
The CCR7 surface expression is another segregation marker for effector and central
memory cells. Although it is usually synchronized with CD62L, some heterogeneity on its
expression has been found in murine memory cells, making CD62L a more reliable
indicator of memory populations in mice [48].
The divergent expression of CD62L translates into different trafficking and tissue
predominance of TCM and TEM cells, as well as cytokine production and proliferative
INTRODUCTION
11
capacities. TCM cells are found principally in the lymph nodes and spleen where they
secrete high amounts of IL-2 and exhibit high proliferation. TEM cells, on the contrary, are
found mainly in the blood, peripheral organs and also in the spleen, show low proliferative
capacity and strong effector function due to immediate ability of IFNγ secretion and
accumulation of granzyme B and perforine in granules characteristic of CD8+ T cells [42,
48].
Antigen-specific TCM cells develop in the presence of the pathogen, though after its
elimination they endure and are the ones that support the rapid response mounted upon
challenge [47, 49]. On the contrary, TEM cells are strong effectors but are eliminated in
the absence of the antigen [47, 49]; when needed to face a challenge they are provided
by the TCM experienced pool [50]. This is in accordance with the linear model of
differentiation observed in mice, humans and non-human primates in which cells
progressively gain function from TCM to TEM to terminal effectors [48], as shown in
Figure IV. In this figure the relation of the memory phenotype and the cytokines these
cells produce is well discriminated.
Figure IV. Differentiation progress of CD4+ and CD8+ effector and memory cells [51].
INTRODUCTION
12
In CD4+ T cells TNFα is the most common cytokine to be detected when a Th1 milieu is
developed [51]. Also IL-2 is found very often in conjunction with TNFα and, although it has
no major effector function, IL-2 promotes lifelong memory cells (even in the absence of
TNFα). These highly sustainable cells can further secrete IFNγ upon another activation
signal, eventually becoming short-lived terminal effector IFNγ single producers cells if the
antigen persists (Figure IV-a) [51]. CD8+ T cells follow a linear progression similar to the
CD4+ T cells trajectory, though TEM cells are able to regain IL-2 expression and revert to
TCM state that concomitantly produce IFNγ, TNFα and IL-2. The fixed lineage model is
also depicted in Figure IV-b showing that TEM cells can be directly originated from
effector cytotoxic CD8+ T cells [51]. The desirable memory phenotype is, then, to have
multifunctional effector cells that concomitantly produce IFNγ and TNFα along with IL-2
that enhances the expansion of the memory pools, contributing to a better effector
response [51].
MEMORY IN LEISHMANIASIS
Memory cells were demonstrated to have great importance in the control of leishmaniasis,
with distinct roles described for TCM and TEM cells. Zaph et al. have shown that in mice
both TCM and TEM CD4+ cells require parasite presence to be developed, though
maintenance of TCM is independent of antigen persistence [49]. This achievement,
however, seems highly dependent on the initial overall T cell response, since in some
immunization experiments that used low dose of parasites protection was lost after the
elimination of the parasites, possibly due to insufficient expansion of the TCM pool [52].
Adoptive transfer of TCM from L. major-infected mice to naïve animals conferred
protection upon a challenge. When facing the antigen, TCM expanded in the lymph
nodes, acquired effector functions, including CD62L downregulation which allowed their
migration to the infection site and effective protection [49].
Nevertheless, concomitant immunity, i.e. efficient protection upon a challenge due to the
long-term and simultaneous persistence of the pathogen, seems to be a hallmark in
leishmaniasis [53]. Studies using mice models have shown that a small numbers of
parasites restricted to the inoculation site, without causing clinical manifestations, are
essential for protection from a virulent challenge [52]. In fact, this is the concept behind
the leishmanization strategy applied in humans, discussed below, where a small amount
of Leishmania virulent parasites are inoculated in a hidden location of the skin with the
objective of protection from a real challenge [54].
INTRODUCTION
13
The regulation of the effector responses prone to Leishmania elimination to avoid the
development of the disease but still leaving a restricted parasite population that maintains
the lifelong memory is done by the CD4+CD25+FoxP3+ regulatory T cells [53]. However,
these cells are also responsible for the reactivation of the persistent parasites in mice [55],
so a tight balance between effector and regulatory T cells must be achieved in order to
retrieve efficient recall responses.
INTRODUCTION
14
Prophylaxis and treatment
VACCINES
Until date, the only successful, long-lasting strategy for human immunization against
leishmaniasis was the leishmanization process. It consists on the inoculation of live
virulent parasites in a hidden area of the skin of healthy people with the purpose of
development of immunity when challenged by a natural infection. Leishmanization showed
100% protection when used as prophylaxis for cutaneous leishmaniasis (CL) throughout
the ex-Soviet Union, Asia, and the Middle East [56]. Due to risk of complications in healthy
people and difficult standardization of the live L. major inoculum, this procedure was
mostly abandoned. However, this is still a current practice in Uzbekistan [56] and a few
years ago it was reported to be applied in the evaluation of the efficacy of new vaccines
[57].
A “natural” form of leishmanization may be the reason why in Sri Lanka so many cases of
CL by L. donovani are reported while VL is rare [8]. McCall et al. have recently reproduced
this scenario in the BALB/c model, immunizing the mice subcutaneously with a
dermotropic L. donovani strain from Sri Lanka followed by intravenous challenge with a
viscerotropic autochthonous strain, and indeed, partial protection was obtained in the liver
of the infected mice [58]. The authors attributed the ability of the cutaneous strain to
protect against the challenge with the visceral strain to a probable great similarity between
the two L. donovani strains, to justify the opposing phenotype observed by others [59].
Also, an epidemiological study in Sudan indicated that only individuals previously negative
for leishmanin (Montenegro skin test) developed VL, thus, though without scientific
evidences, the leishmanin-positive individuals that were possibly formerly infected with L.
major were protected against the visceral disease [60].
First generation vaccines comprise killed parasites and live attenuated parasites. They
were primarily developed to overcome one of the major concerns related to
leishmanization: the risk of disease development in immunocompetent persons and the
total improperness for immunosuppressed patients for this same reason.
With more or less success, some examples of killed vaccines include L. braziliensis crude
antigens tested in dogs [61] and trivalent (L. braziliensis + L. guayanensis + L.
amazonensis) phenol-killed whole Leishmania promastigotes with bacille Calmette-Guérin
(BCG) as adjuvant in Ecuadorian children [62]. According to a meta-analysis conducted in
2009 by Noazin et.al. to evaluate the efficacy of the clinical trials performed with whole
killed parasites in endemic areas since 1970s, with the exception of this latter in Ecuador,
INTRODUCTION
15
none of the other eight clinical trials (based on autoclaved L. major with BCG tested
against CL in the Old World and L. amazonensis or multivalent preparations inactivated
with merthiolate used against CL in the New World) showed significant protection against
natural infection [63]. A new option was tested recently: a killed but metabolically active
(KBMA) L. infantum. This vaccine showed partial protection in spleen and liver of BALB/c
mice 2 and 8 weeks after challenge triggering a mixed Th1/Th2 response but the authors
claim that improving results could be obtained by adding TLR agonists and Th1 adjuvants
[64].
For the live attenuated parasites many are the works reported whether using physical,
chemical or genetic manipulation for reducing the virulence of the strains or even naturally
attenuated strains, like the non-pathogenic L. tarentolae [65]. Some of the most
successful vaccine candidates for VL based on genetically altered live parasites were L
donovani biopterin transporter gene knockout (KO) (BT1−/−) [66], L donovani replication
deficient centrin gene KO (Cen−/−) [67], L donovani cytochrome c oxidase complex
component p27 gene KO (Ldp27−/−) [68], L. infantum silent information regulatory 2 single
KO (SIR2+/−) [69] and L. tarentolae expressing L. donovani A2 antigen [70]. Despite
showing hopeful efficiency in murine models, the promising candidates that were tested in
human and canine diseases failed to protect (reviewed in [71]).
A different approach relies on recombinant proteins, polyproteins, DNA vaccines,
liposomal formulations and dendritic cell vaccine delivery systems [56]; these constitute
the second generation vaccines. A variety of antigens have been tested, though only few
in the scope of VL. These include rgp63, rHASPB1, rA2 and the polyprotein rLeish-111f in
the group of the recombinant proteins; LiESA, FML and amastigote P8 as purified
antigens; LACK and KMP-11 in DNA vaccines (all reviewed in detail in [72]).
For VL, the best vaccine candidate so far tested is the Leish-111f Leishmania
recombinant antigen combined with MPL-SE adjuvant. After having proved to protect in
murine CL [73] and VL [74] it has also demonstrated to be safe and well tolerated in
humans [75]. Clinical trials in dogs have resulted in disparate conclusions about the
efficacy of the vaccine in the prophylaxis of CanL [76, 77], though survival of infected dogs
was increased after vaccination and treatment with glucantime [78].
In canine vaccinology, however, authorized vaccine options are available. Leishmune®
was the first vaccine licensed for the prevention of CanL but is authorized only in Brazil. It
consists of L. donovani purified fuccose-mannose ligand (FML antigen) in combination
with a saponin adjuvant. Clinical trials have showed that Leishmune® reduces the risk of
infection but also prevents disease progression in already infected dogs, though the
INTRODUCTION
16
manufacturer does not recommend the vaccine as immunotherapy. A transmission-
blocking activity was also attributed to this vaccine, making it highly appealing for the
control of the zoonosis [79].
Some years later, Leish-Tec® was released, also only in Brazil. The recombinant A2
protein is the antigen that constitutes the vaccine along with saponin adjuvant. Protection
was found to be related to high levels of IgG and IgG2 anti-A2 antibodies, without the
presence of IgG1, and high amounts of IFNγ with low levels of IL-10 [80].
Recently, a new vaccine, CaniLeish®, the only authorized in Europe, has entered the
market for the prophylaxis of CanL. The manufacturer claims that vaccinated dogs reduce
the risk of developing the disease in 4 fold compared to non-vaccinated animals [81]. The
use of L. infantum excreted/secreted proteins associated to QA-21 adjuvant (LiESP/QA-
21) leads to the increase of IgG2 specific antibodies, stronger Leishmania-specific
lymphoproliferation with increased IFNγ-producing T cell population that is able to activate
a significant leishmanicidal macrophage ability in vitro due to NO production [35].
DRUGS
According to WHO guidelines, treatment should be given only after confirmation of the
disease and following national and regional recommendations. In some cases supportive
treatment, like rehydration, nutritional supplementation or blood transfusions might be
needed before starting the therapy to improve prognosis [24].
Currently six drugs are available for the treatment of VL: pentavalent antimonials (sodium
stibogluconate and meglumine antimoniate), the antifungal amphotericin B (AmpB in the
deoxycholate form and the lipid formulation), the anticancer drug miltefosine and the
antibiotics paramomycin and pentamidine. Pentavalent antimonials are the first line
treatment, followed by AmpB and miltefosine [24]. The treatment is usually prolonged and
requires parenteral (intravenous or intramuscular) administration, with the exception of
miltefosine that is available in oral formulation. All six drugs present high toxicity which
increases the treatment cost due to the necessary monitoring to control the adverse
reactions.
Adverse reactions of pentavalent antimonials include nausea and vomiting, headache,
myalgia and arthralgia, pancreatitis, cardiotoxicity, pancytopenia and peripheral
neuropathy. Following AmpB administration it is frequent to observe thrombophlebitis of
the injected vein, high fever, rigor and chills; hypokalemia and myocarditis are less
common but serious, making hospitalization mandatory during AmpB treatment. Lipid
formulations of AmpB allow the reduction of some side-effects though maintaining the
INTRODUCTION
17
high efficacy of the free compound; nevertheless, back pain and transient nephrotoxicity
or thrombocytopenia are occasionally seen. Miltefosine is potentially teratogenic, thus
should be avoided in pregnant women. Besides this, most frequent side effects related to
miltefosine administration are gastrointestinal manifestations, which are usually resolved
with continuous treatment, and, occasionally, skin allergy and hepatotoxicity; rarely, renal
insufficiency can be observed. Paramomycin is probably the less toxic drug with mild pain
in the injection site being the most frequent adverse reaction; renal and hepatic toxicity
are rarely described. On its turn, however, the severe toxic effects associated to
pentamidine (diabetes mellitus, severe hypoglycemia, shock, myocarditis and renal
toxicity) limit its use [24].
Treatment of CL is usually based on intralesional injection of pentavalent antimonials or
AmpB. Because it is painful and associated with side effects in the surrounding areas of
the wound, topical formulations are also available and can be useful for patients that
cannot tolerate the pain associated to the parenteral administration. However, this
approach raises some controversies due to unclear results concerning its efficacy.
Ointments, solutions or gels are available formulations to vehiculate the antifungal
imidazoles, paramomycin, AmpB or sitamaquine (analogue of the anti-malaric primaquine)
[82].
Non-chemical alternatives have also been tested like thermotherapy using radiofrequency
waves with 50°C temperature for 30 seconds, cryosurgery in combination with drug
therapy, photodynamic therapy with photosensitizers that mediate cytolysis of Leishmania
and CO2 laser. And, finally, honey was shown to ameliorate scaring due to its
antimicrobial properties and increased wound healing [82].
Treatment should cure the patient, reduce the risk of relapse and development of PKDL
and avoid the transmission of resistant parasites [24]. Especially concerning this latter
objective, combination therapies are now highly recommended, the exception being for
lipid formulations of AmpB that could be taken in monotherapy. Combination therapy
shows the same or increased efficacy compared with the drugs alone but using lower
doses of each drug, which decreases the therapy cost and the related adverse reactions.
This, in turn, increases the patients’ compliance in completing the treatment, which
reduces the possibility of generation of resistant parasites, therefore prolonging the
effective life of the available drugs [24].
In the case HIV/Leishmania co-infections, the first line treatment is AmpB (deoxycholate
form or lipid formulations), since pentavalent antimonials present increased toxicity in
INTRODUCTION
18
immunosuppressed patients. In the case of cutaneous manifestations, only parenteral
therapy should be provided (topic administrations are discouraged). If the patient is not
already being treated in a highly active antiretroviral therapy (HAART) regime, VL is an
inclusion criteria even if the CD4+ counts are >200. Despite few information is available
about anti-Leishmania combination therapies, they are recommended to be tested in
HIV/Leishmania co-infected patients, though implemented sequentially instead of
simultaneously, to improve efficacy and reduce toxicity [12].
Treatment for CanL is based on three molecules: meglumine antimoniate, miltefosine and
allopurinol, usually in monotherapy. The responsiveness of the dogs to the treatment is
highly dependent on the initial clinicopathological status. Therapy often leads to clinical
cure, but sterile cure is not achieved, thus treated animals still harbor parasites in their
skin and blood that can be transmitted to the sand flies. Preventive measures are, then,
extremely important in endemic areas and they comprise the use of collars with repellent
compounds to sand flies and topic application of insecticides [15].
INTRODUCTION
19
Transferring Leishmania sp. life cycle to the laboratory
As it has been stated, the completion of Leishmania sp. life cycle requires the passage of
the parasite in two hosts: the insect vector and the mammalian host. In nature,
Leishmania prospers mainly by the maintenance of the sylvatic life cycle. For
xenodiagnosis or to study the parasite-host interaction or the biology of Leishmania it is
mandatory to develop colonies of both the sand flies and the mammalian host (usually
mice, hamsters, dogs or monkeys) and also to provide the means for the development of
both the promastigotes and the amastigotes forms.
PROMASTIGOTES CULTIVATION
Sand fly colonies are difficult to rear. From the 700 species known, less than 60 were ever
colonized in the laboratory, but only few can be maintained and produce large numbers of
individuals to allow their experimental use. Phlebotomus papatasi and Lutzomyia
longipalpis are considered “easy” species to colonize and breed [83]. Entomologists are
encouraged to start new colonies from endemic areas, though this is far more difficult than
to routinely maintain well adapted colonies that are reared for many generations in the
laboratory [83].
The use of infected sand flies as a breeding source of promastigotes is, then,
unreasonable especially because the in vitro culture is very easy and returns large
numbers of parasites. Novy-McNeal-Nicolle (NNN) medium [84] was the first culture
medium described for the in vitro isolation, maintenance and expansion of promastigotes
of several Leishmania species. Diphasic media like NNN are recommended for the
isolation of the parasites from lesions or biopsies, to establish cultures and to routinely
maintain them with yields in the order of 107-108 parasites/mL [85].
An essential component of these media is blood, preferably rabbit blood, that must be
heat inactivated and collected with anticoagulant [85]. However, many other culture media
that do not use blood have been developed over the years. In liquid media, much easier to
prepare and less susceptible to unwanted contaminations, a source of proteins, like fetal
calf/bovine serum (FCS/FBS) or bovine serum albumin (BSA), and a source of heme [86],
usually hemin, fulfill some of the nutritional requisites that blood provides for Leishmania.
Other essential components, like folic acids, vitamins and amino acids must be added to
the media. FCS is also a source of growth factors that enhance the yield of the cultures
[85]. Other growth-stimulatory agents comprise human urine in concentrations from 2 to
INTRODUCTION
20
5%, granulocyte-macrophage colony-stimulating factor (GM-CSF) and insulin-like growth
factors [85].
Thus, in general terms, in vitro culture of Leishmania promastigotes consists in choosing
an adequate culture medium from the many available, transfer a pure inoculum, incubate
over approximately a week at 26-28ºC and recover great numbers of viable
promastigotes. The objective is that inside the flask the developmental steps that naturally
occur in the gut of the sand fly be reproduced [87]. The proliferative procyclic forms will
predominate in the first days of culture and will progressively develop into the stationary
steady-state forms. The continued nutrient consumption will lead to the acidification of the
medium promoting the differentiation of the infective metacyclic forms (Figure V). Before
the culture shows signs of aging, a subpassage of few parasites (~105-106/mL) to new
culture medium should be done in order to maintain the culture with good viability.
Figure V. Leishmania spp. development in the insect vector and in the mammalian host
The shaded area is mimicked by in vitro cultivation of promastigotes and the light area
by axenic cultivation of amastigotes. Adapted from [87].
INTRODUCTION
21
Many are the options available of semi-defined and complete defined culture media for the
in vitro culture of promastigotes. The choice of the culture medium to use should be a
rational decision since it influences the final infectivity of the parasites [88]. Moreover, the
continuous in vitro subpassage of promastigotes leads to loss of virulence overtime.
However, transformation into amastigotes by macrophage or mice/hamster infection was
shown to revert promastigotes’ infectivity [30].
AMASTIGOTES CULTIVATION
Concerning the mammalian branch of Leishmania life cycle, amastigotes can be obtained
by the purification of promastigotes-infected cells, whether from in vitro macrophage
infection or from in vivo infections in mice or hamster [89]. However, besides expensive
(especially because of the maintenance of the animal colonies), this process implies 1)
the production of large volumes of promastigote culture, 2) the incubation time needed for
the development of the intracellular amastigotes and subsequent multiplication and 3)
many purification steps to extract the amastigotes from the phagolysosomes and to clean
host cell debris, yielding acceptable numbers of live pure amastigotes. Achieving the
axenic cultivation of amastigotes was, then, a great advance in the in vitro culture of
Leishmania spp.
The first step is to induce the transformation of the promastigotes into amastigotes. This is
done in vitro by mimicking the phagolysosome physical milieu and must be adjusted
depending on Leishmania species. For a better success in the development of
amastigotes from promastigotes, metacyclic-enriched cultures should be used as
metacyclic promastigotes are considered a pre-adaptive form to the mammalian host [85,
90].
Once amastigotes are differentiated they can be subpassaged in vitro similarly to the
promastigotes. However, amastigotes are quite more exquisite in the nutritional
requirements for growth. Higher percentages of FCS are normally needed [85] and
different lots may have obvious impact in the growth (personal observations). Also, the
culture media with all its supplements should be freshly prepared [91], which may
complicate the management of the laboratory settings.
Despite more comfortable to handle and to be maintained, some questions about the
equivalence of axenic amastigotes to bona fide intracellular amastigotes have been raised
[92, 93]. However, it is of general scientific consensus, based on morphological,
biochemical, molecular and antigenic criteria [89], that axenic amastigotes can be used for
INTRODUCTION
22
the understanding of amastigote-specific biological processes [94], infection studies [95]
and in vitro drug screening assays [96], among other applications, similarly to the “real”
amastigotes.
INTRODUCTION
23
What’s left to be done?
Despite Leishmania and leishmaniasis are very active fields in terms of generation of
new knowledge (1449 original papers in the last year and 10 582 in the past decade
indexed in PubMed to both terms), many questions remain unsolved. These are some
of the questions related with the biology of the disease raised by some authors [97, 98]
that remain without a definitive answer:
1) What is the relative importance of each of the numerous evasion strategies that
have been identified in vitro for long-term parasite persistence in vivo?
2) What are the key immunological events that switch the spleen of an infected
animal into a state of chronic inflammation?
3) How does the mechanism of visceralization occur?
4) Do free parasites or infected cells migrate via blood or lymph?
5) Is the mechanism of visceralization similar for spleen, liver and bone marrow?
6) What is the role of Leishmania species-specific genes in determining the
tropism?
7) What are the factors that allow L. donovani to switch from a visceral parasite
(in VL) to a cutaneous parasite (in PKDL)?
In addition to these, other concerns justify future funding for research on leishmaniasis.
New therapeutic alternatives are needed with less toxic effects, dispensing parenteral
administration and presenting high efficacy against resistant parasites. Moreover, the
reality of the vaccine against CL and principally VL is an urgent necessity to control this
disease that globally is the third cause of death among the neglected tropical diseases
[99]. To achieve these important goals, further knowledge in the interaction of the parasite
with its host, in the development of more representative models of human VL and in the
dependence of Leishmania inoculum (number of parasites, developmental stage, route of
administration) in the generated experimental data are required.
OBJECTIVES
27
Aims of the thesis
Few years ago our group described the efficacy of the live attenuated sir2 single knockout
Leishmania infantum in the protection to the wild type virulent challenge in the murine
model of visceral leishmaniasis (VL) [69]. With the knowledge that advent from that work
and maintaining the interest on the search for a vaccine for VL, we wanted to explore the
possibility of the naturally attenuated strains in protecting from a secondary virulent
infection.
With the emergence of HIV/Leishmania co-infections, new Leishmania zymodemes are
being identified that have never been described in immunocompetent humans and dogs
[100,101]. This fact supports the hypothesis that those strains are only pathogenic in
conditions of immunosuppression and, therefore, are less virulent than those found in
immunocompetent hosts. Nevertheless, very little is known about the infective,
pathogenic, immunogenic and protective capabilities of these naturally attenuated strains
in an immunocompetent host. Therefore, experimental confirmation of the non-
pathogenicity of these L. infantum attenuated strains would promote its interest as live
attenuated vaccine candidates and constitutes the general objective of this thesis.
This was the starting point that led to the elaboration of this thesis. However, because
Leishmania virulence is modulated by the in vitro culture conditions, a special concern
about this matter lead us to develop some work exploring the differences in the infectivity
of several strains according to the culture media used for their growth before starting to
evaluate the inherent infectivity, pathogenicity, immunogenicity and protective ability of
each strain in the context of murine VL.
With this, we planned to follow three lines of work as specific objectives:
1. To study the impact of distinct culture media in L. infantum biology and infectivity.
The morphology, viability, cell cycle progression, metacyclic profile, capacity to
differentiate into axenic amastigotes and infectivity will be analyzed using several
established culture media.
2. To characterize the biology and infectivity of L. infantum viscerotropic and dermotropic
strains isolated from HIV+ and HIV- patients in the murine model of visceral leishmaniasis.
Four strains of L. infantum will be evaluated in terms of molecular typing, in vitro
cultivation and differentiation and in vitro and in vivo infectivity in a murine model of
visceral leishmaniasis. Two strains were isolated from HIV+ patients with visceral
leishmaniasis, one strain was isolated from a cutaneous lesion in an immunocompetent
OBJECTIVES
28
patient and other strain causative of visceral leishmaniasis, also from an
immunocompetent patient, was used for comparison.
3. To understand the influence of two virulent L. infantum strains on the modulation of the
outcome of a de novo infection.
In order to establish the mechanism underlying protection, two of the previously
characterized L. infantum strains will be used to analyze the ability of a very infective and
an intermediate infective strain in the generation of infection-induced immunity and its
efficacy on protection to a subsequent homologous or heterologous challenge in the
murine model of VL.
RESULTS - SECTION 1
31
SECTION 1
The impact of distinct culture media in Leishmania infantum biology and infectivity
In press in Parasitology, 2013
Main findings
Cultivation of Leishmania infantum promastigotes in several media led to the production of
parasites with distinct growing kinetics that present different biological characteristics and
in vitro and in vivo infectivities. Our data prove that media-specific phenomena are
sufficient to induce biological bias with consequences in infectivity and general parasite
biology. Also, we developed a FCS-free medium, named cRPMI. This medium is a cost
effective alternative for promastigote in vitro cultivation in conditions that require the
absence of proteins or for long-term maintenance of infective L. infantum.
RESULTS - SECTION 1
33
The impact of distinct culture media in Leishmania infantum biology and infectivity
Nuno Santarém1,2*, Joana Cunha1,3*, Ricardo Silvestre1, Cátia Silva1, Diana Moreira1, Marc
Ouellette2 and Anabela Cordeiro-da-Silva1,4#
1 Parasite Disease Group, Unit of Infection and Immunity, IBMC - Instituto de Biologia
Molecular e Celular, Universidade do Porto, Portugal 2 Centre de Recherche en Infectiologie du Centre de Recherche du CHUL, Québec,
Canada 3 Instituto de Ciências Biomédicas Abel Salazar e Faculdade de Medicina, Universidade
do Porto 4 Departamento de Ciências Biológicas, Faculdade de Farmácia, Universidade do Porto,
Portugal
* These authors contributed equally for this work.
# Corresponding author
Anabela Cordeiro da Silva, Parasite Disease Group, Unit of Infection and Immunity,
IBMC - Instituto de Biologia Molecular e Celular, Universidade do Porto, Rua do Campo
Alegre, 823, 4150-180 Porto, Portugal
Tel.: +351 226 074 949; Fax: +351 226 099 15; e-mail: [email protected]
Short title
Experimental bias induced by Leishmania culture
Keywords
Infectivity, Leishmania infantum, culture media, promastigote cultivation.
RESULTS - SECTION 1
34
ABSTRACT
An ideal culture medium for Leishmania promastigotes should allow the display of the
basic characteristics of promastigotes found in sandflies (morphology and infectivity).
Furthermore, the media should not be a bias in experimental settings enabling the proper
extrapolation of results. To assess the influence of the culture media on Leishmania
biology we studied several established media for promastigote growth. We analyzed
morphology, viability, cell cycle progression, metacyclic profile, capacity to differentiate
into axenic amastigotes and infectivity. Furthermore, using a rational approach from the
evaluated media we developed a simple serum free medium (cRPMI). We report that
parasites growing in different media present different biological characteristics and distinct
in vitro and in vivo infectivities. The developed medium cRPMI, proved to be a less
expensive substitute of traditional serum-supplemented media for the in vitro maintenance
of promastigotes. In fact, cRPMI is ideal for the maintenance of parasites in the laboratory,
diminishing the expected overtime loss of virulence typical of the parasite cultivation.
Ultimately this report is a clear warning that the normalization of culture media should be a
real concern in the field as media specific phenomena are sufficient to induce biological
bias with consequences in infectivity and general parasite biology.
RESULTS - SECTION 1
35
BACKGROUND
The biology of clinically important flagellated protozoan parasites from the genus
Leishmania has been a subject of increasing academic interest. These parasites have a
life cycle with two distinct forms: extracellular promastigotes that proliferate within the
digestive tract of hematophagous female sandflies and intracellular amastigotes that thrive
in the phagolysosomes of macrophages [1, 2]. Within susceptible mammalian hosts, the
parasite proliferation and associated immune response originate a group of diseases
known as leishmaniasis. Human leishmaniasis is characterized by different clinical
presentations ranging from self-healing cutaneous manifestations to fatal visceralizing
ailments [3]. Yearly, among a risk population of 350 million people, two million new cases
are reported. As there is no vaccine, the disease control relies on effective medical care.
Although several therapeutic options are available, problems related to toxicity and
resistance prevent adequate control and disease eradication [3]. In consequence, a better
understanding of these protozoa is urgent to enable the development of safer and
affordable therapeutic approaches.
A stable and reproducible source of microorganisms is essential to study Leishmania. In
the wild a steady population of Leishmania is maintained by the sylvatic life cycle. In
laboratorial settings, promastigotes can be obtained from infected sandflies or from axenic
cultivation. Biosecurity related problems and the lack of adequate facilities negate the
generalized use of sand flies to study promastigotes [4, 5]. Notwithstanding, the axenic
promastigotes are considered similar to those found in sandflies [6]. On the other hand,
axenic amastigotes are not considered biological surrogates for the intracellular
amastigotes [7, 8]. As consequence, the bulk of the available information about
Leishmania has been obtained from axenic promastigotes.
Novy-MacNeal-Nicolle (NNN) was the first medium used for the in vitro growth of
Leishmania promastigotes [9]. Afterwards, several media were developed in a continuous
effort to create more affordable and defined options for the growth of Leishmania [10-21].
The most common options used for cultivation are semi-defined media supplemented with
fetal calf serum (FCS) in concentrations varying between 5-20% [14]. The FCS is
expensive and highly variable in composition. Its replacement has for long been
considered an advance towards the standardization of in vitro cultivation. Some FCS
substitutes such as milk [21] or urine [10, 22] have been proposed but their used is
limited. Years of axenic culture refinement enabled the definition of generalized nutritional
requirements permitting the creation of completely defined media [16, 20]. The main
nutritional requirements of Leishmania include: heme [23]; 6-hydroxymethylpterine and
related pteridines [24]; high levels of folic acid [25]; the vitamins thiamine, nicotinic acid,
RESULTS - SECTION 1
36
pantothenate, riboflavin, and biotin [14] and also several essential amino acids [14]. As
consequence, the production of completely defined media is normally cumbersome
requiring more than thirty individual components [16, 20].
The traditional requisites for the development of new media for Leishmania spp. culture
are sustained growth and infectivity of the parasites. Nonetheless, promastigote
development in the insect vector involves several stages regulated by genetic and
environmental factors [2]. The assumption that all developed media enable biologically
identical promastigotes is therefore a dangerous oversimplification. In consequence, it is
of crucial importance to evaluate if media can influence and modify promastigote biology.
It is already known that the in vitro maintenance of Leishmania parasites rapidly leads to a
decrease of virulence [26-28]. This phenotype has been related to a mounting incapacity
to differentiate in the amastigote stage [27] or the loss of virulence factors through
hypothetical medium adaptations [8, 26]. Overall, an ideal culture media should not induce
any bias capable of influencing experimental data leading to experimental conclusions
only valid for a specific combination of parasite and media. Human urine is a clear
example of a media component with a specific biological imprint. When used as a medium
supplement it increases parasite proliferation [29] and infectivity [30].
Here, we evaluated the morphologic, biologic and immunological characteristics of L.
infantum promastigotes maintained in four conventional culture media, RPMI [31], SDM
79 [32], Schneider and NNN. Our approach enabled us to clearly assess significant
alterations of relevant promastigotes’ biological parameters in each medium. Furthermore,
we used the biological information obtained to develop a simple serum free media named
cRPMI. The cRPMI retains the biological characteristics required for becoming a medium
of choice in the maintenance of parasites.
RESULTS - SECTION 1
37
MATERIALS AND METHODS
Parasites and cell culture
A cloned line of virulent L. infantum (MHOM/MA/67/ITMAP-263) was maintained at 27°C
in different culture media. SDM-79 [32] (bSDM) was supplemented with 10% fetal calf
serum (Lonza), 5 μg/mL hemin (Sigma), and 5 μM biopterin (Sigma) - SDM. RPMI 1640
medium (Lonza) (bRPMI) was supplemented with 10% FCS, 2 mM L-glutamine (Lonza),
100 U/mL penicillin (Lonza), 100 mg/mL streptomycin (Lonza) and 20 mM HEPES buffer
(Lonza) - RPMI. Schneider’s Insect Medium (Sigma) was supplemented with 10% FCS,
200 units/mL penicillin, 200 units/mL streptomycin, 5mM HEPES buffer, 2.5 g/mL Phenol
Red (Sigma) - Schneider. Novy-MacNeal-Nicolle medium consists of 1.4% agar (Sigma),
0.6% NaCl (Merck), 31% defibrinated rabbit blood, 625 units/mL penicillin, 625 units/mL
streptomycin and RPMI as liquid phase - NNN. Parasites were subcultured every 4 days
with an initial inoculum of 106 parasites/mL, except for SDM and Schneider in which the
initial inoculum was 2.5x105 parasites/mL. Promastigote to amastigote differentiation was
achieved by culturing 107 stationary phase promastigotes/mL in a cell free culture medium
at an acidic pH and 37ºC (MAA20) [33]. To minimize the possibility of clonal bias, we have
performed three independent experiments each one started with a distinct promastigote
clone recovered from experimentally infected BALB/c mice.
Development of protein-free medium
FCS was passed through a centriprep Ultracel YM-3 filtering unit (Millipore) to remove the
bulk of the protein content from the filtrate. The filtrate was then passed through the
filtering device once again and then sterilized through a 0.2 µm filter (Millipore) and stored
at 4ºC until use (this fraction will be herein referred as <3 kDa). The retentate was
dialyzed twice against phosphate buffer saline (PBS) to completely remove the low
molecular weight components and stored at 4ºC until use (this fraction will be herein
referred as >3 kDa). For the complementation experiments, L. infantum promastigotes
growing in RPMI or SDM were washed twice in PBS and transferred for two days at a
density of 106/mL in the respective base medium (bRPMI or bSDM) complemented with
one or combinations of the following supplements: 10% FCS; 10% >3kDa; 10% <3kDa or
2.5 µg/mL hemin. After two days, parasites were transferred again at a density of 106/mL
and evaluated for growth after 4 days counting on a Neubauer chamber. To boost the
growth obtain on bRPMI we added bSDM in defined percentages. For this, L. infantum
promastigotes grown in RPMI were washed twice in PBS and used at a density of 106/mL
in bRPMI supplemented with 2.5 µg/mL of hemin and one or none of the following bSDM
supplements: 10% bSDM, 20% bSDM, 50% bSDM or 100% bSDM. After 4 days of
RESULTS - SECTION 1
38
culture, the growth was determined using a Neubauer chamber. Morphology of the
parasites were imaged using a Spinning Disk Confocal System Andor Revolution XD
(ANDOR Technology, UK) using the 67X oil objective and treated using open source
ImageJ software.
Growth curves
Promastigotes in bRPMI supplemented with 10% bSDM (cRPMI), RPMI, SDM, NNN or
Schneider were grown for 24 hours in a startup culture with the above defined initial
inocula. These cultures were used as starter for the growth curves and followed for 7
days. At defined time points the parasites were counted using a Neubauer chamber.
Cell cycle analysis
Promastigotes were recovered from cultures in specific media at defined time points.
Subsequently, parasites were washed twice and resuspended at a density of 2x106 in 1
mL of PBS 2% FCS. This was followed by the addition of 3 mL of cold absolute ethanol
(Panreac) with continuous vortexing. Cells were then fixed for at least 1 hour at 4ºC and
washed twice in PBS. Before analysis, cells were resuspended in 50 μg/mL propidium
iodide staining solution (Sigma) with 0.5 ng/mL RNase A (Sigma) and incubated 30 min at
4ºC. Data was collected in a BD FACSCalibur cytometer (20000 gated events) and
analyzed by FlowJo software (Tree Star).
Viability analysis
Promastigotes were washed and resuspended at a density of 106/mL in Annexin V binding
buffer (BD Pharmingen). Parasites were then incubated at room temperature for 15
minutes with AnnexinV-Cy5 (BD Pharmingen) and 7-AAD (Sigma). Parasites subjected to
ultra violet light during 30 minutes and kept in culture for 4 hours were used as a positive
control. Data were collected in a BD FACSCalibur cytometer (20000 gated events) and
analyzed by FlowJo software.
Real time RT-PCR
Total RNA from 1x107 promastigotes was purified with TRIzol® reagent (Invitrogen),
according to the manufacturer's instructions and resuspended in 10 μL RNase free water.
RNA concentration was determined by using a Nanodrop spectrophotometer (Wilmington)
and quality was inspected for absence of degradation or genomic DNA contamination,
using the Experion RNA StdSens Chips in the ExperionTM automated microfluidic
electrophoresis system (BioRad Hercules, CA, USA). RNA was stored at -80ºC until use.
RT was performed with equal amounts of total extracted RNA (1 μg) obtained from
RESULTS - SECTION 1
39
parasites recovered from different experimental conditions by using Superscript II RT
(Gibco BRL) and random primers (Stratagene). Real-Time quantitative PCR (qPCR)
reactions were run in duplicate for each sample on a BioRad My iCycler iQ5 in a 20 µL
volume containing 4 µL of cDNA (diluted 25 x), iQ SYBR Green Supermix (BioRad) and
500 nM (histone H4 and Meta1) or 250 nM (rRNA45 and SHERP) of primers. Specific
primers for histone H4 (forward: 5’-ACACCGAGTATGCG-3’; reverse: 5’-
TAGCCGTAGAGGATG-3’) [27], meta1 (forward: 5’-GGGCAGCGACGACCTGAT-3’;
reverse: 5’-CGTCAACTTGCCGCCGTC-3’) [34], Small Hydrophilic Endoplasmic
Reticulum-associated Protein (SHERP) (forward: 5’-CAATGCGCACAACAAGATCCAG-3’;
reverse: 5’-TACGAGCCGCCGCTTATCTTGTC-3’) [27] and rRNA45 (forward: 5’-
CCTACCATGCCGTGTCCTTCTA -3’; reverse: 5’-AACGACCCCTGCAGCAATAC-3’) [35]
were obtained from Stabvida (Portugal), thoroughly tested and used for amplification.
After amplification, a threshold was set for each gene and cycle threshold-values (Ct-
values) were calculated for all samples. Gene expression changes were analyzed using
the built-in iQ5 Optical system software v2.1 (Bio-Rad laboratories, Inc). The results were
normalized using as reference rRNA45 sequence [35].
Staining of parasites with CFSE
Stationary-phase promastigotes (with 4 days of culture) were diluted to a concentration of
1.2x107/mL were used for carboxyfluorescein succinimidyl ester (CFSE, Invitrogen)
labeling. Promastigotes were washed two times with PBS and labeled with 5 µM of CFSE
for 10 minutes at 37ºC shaking every 3 minutes. Then, 9 mL of complete Dulbecco’s
modified Eagle’s medium (DMEM, Lonza) was added and tubes were centrifuged for 10
minutes at 1200g. The supernatant was discarded and the parasites were resuspended in
5 mL of complete DMEM and incubated at 4ºC for 5 minutes. After a final centrifugation
for 10 minutes at 1200g, the promastigotes were resuspended in complete DMEM before
proceeding to macrophage infections.
In vitro macrophage infection
Cell suspensions of bone marrow were obtained by flushing the femurs and tibiae of 10-
12 week-old BALB/c mice. The resulting cell suspension was cultured in DMEM
supplemented with 10 % heat-inactivated FCS, 2 mM L-glutamine, 100 U/mL penicillin,
100 U/mL streptomycin and 1 mM sodium pyruvate (Lonza). After overnight incubation at
37ºC, non-adherent cells were recovered (300g for 10 min at room temperature) and
cultured in 24-well culture dishes at a density of 106 cells/mL. For macrophage
differentiation, 10% L-929 cell conditioned medium was added to complete DMEM at days
0 and 4. At day 7 of culture, CFSE labeled promastigotes were incubated with the
RESULTS - SECTION 1
40
adherent bone-marrow derived macrophages (BMMø) at a 10:1 ratio. After 4 hours,
infection was stopped by washing the cells twice with PBS and further incubated for 24
and 48 hours or immediately scrapped. The infection rates were determined at 4, 24 and
48 hours post-infection by a BD FACSCalibur cytometer and analyzed by FlowJo software
as the percentage of CFSE+ cells.
Animal experiments and parasite quantification
Eight to twelve week-old female BALB/c mice obtained from Instituto de Biologia
Molecular e Celular (IBMC, Porto, Portugal) animal facilities were maintained in sterile
cabinets and allowed sterile food and water ad libitum. Animal care and procedures were
in accordance with institutional guidelines. All experiments were approved by and
conducted in accordance with the IBMC.INEB Animal Ethics Committee and the
Portuguese National Authority for Animal Health (DGAV – Direcção-Geral de Alimentação
e Veterinária) guidelines. RS, JC and ACS have accreditations for animal research given
by DGAV (Ministerial Directive 1005/92). Promastigotes recovered from stationary culture
with 4 in vitro passages were collected, washed and suspended in sterile PBS. A volume
of 200 µl of PBS containing 108 parasites was injected intraperitoneally. Mice of each
group were sacrificed at 56 days post-infection. The parasite burden in the spleen and
liver was determined by limiting dilution as previously described [36].
Statistical analysis and division time calculations
The data was analyzed using the one-way Anova followed by Bonferroni’s post-test for
multiple comparisons when necessary. Minimum doubling time was calculated from
experimental data using the algorithm provided by http://www.doubling-time.com.
RESULTS - SECTION 1
41
RESULTS
In vitro characterization of promastigotes grown in distinct media
We started by evaluating the biological characteristics of L. infantum promastigotes grown
in different culture media. We performed daily evaluations of parasite number, viability and
cell cycle analysis (Figure 1A-C). Promastigote culture in SDM, Schneider and NNN
enabled a rapid parasite growth that peaked at day 4 (from 1.0x108-1.3x108 parasites/mL)
followed by a steep decrease (Figure 1A). This decrease in parasite numbers was
concomitant with a significant diminution in viability and multiplicative parasites (Figure 1
A-C).
Figure 1. Parameters of in vitro development of L. infantum in the different culture media
Promastigotes were cultured with an initial concentration of 1x106/mL in RPMI and NNN or 2.5x105
parasites/mL in SDM and Schneider. (A) The growth curve was done by counting the parasites at different
time points in a hemocytometer. (B) Promastigote viability was determined at the defined time points by
quantifying the percentage of Annexin V (Ann V) and 7-aminoactinomycin D (7-AAD) negative promastigotes.
(C) The percentage of S/G2 parasites was determined at different days. (D) Promastigote minimum division
time calculated from the growth curves. *P < 0.05; **P < 0.01; ***P < 0.001 as calculated by One-way ANOVA
followed by Bonferroni’s post-test analyzed in Graph Pad Prism. The cell cycle and viability analysis was done
using FACSCalibur cytometer and analyzed by FlowJo software. The average of at least three experiments is
shown.
RESULTS - SECTION 1
42
In fact, the steep decrease in viability for SDM and Schneider required an adjustment of
the starting inoculum to enable synchronous passages for all media (Figure S1). In
opposition, the promastigotes cultured in RPMI presented a different growth profile with
lower parasite densities (3x107 parasites/mL) that were sustained for more than 10 days
(data not shown). The maintenance of parasite density in RPMI was accompanied by high
viability throughout the growth curve (>90%) and low numbers of multiplicative parasites
(Figure 1B-C).
Concerning the cell cycle analysis, promastigotes in RPMI, SDM and NNN followed a
trend of overtime percentage decrease of S/G2 parasites (Figures 1C, S2 and S3). In all
these media, 40-50% of the parasites presented an S/G2 phenotype up to 2 days of
growth. This was followed by a time dependent decrease until less than 20% of the
parasite population presented this phenotype. The only exception was the in Schneider
medium where more than 50% of the population displayed a S/G2 cell cycle profile for all
the days tested.
The conjugation of growth curve and cell cycle analysis enabled the determination of
minimum division time (Figure 1D). The SDM and Schneider media enabled smaller
division times with an average of 6.56h ± 0.89 and 5.89h ± 0.90, respectively. The
calculated division times for parasites in RPMI (9.74h ± 0.65) and NNN (8.14h ± 0.27)
were significantly higher.
To better integrate the biological information we also registered the dominant
promastigote morphology at specific time points (Figure 2).
Figure 2. Dominant morphology of logarithmic and stationary-phase L. infantum
Promastigotes were cultured with previously established initial inoculum for each medium. After 1 or 4 days of
culture CFSE-labeled parasites were mounted on CyGelTM and live confocal microscopy images were taken.
RESULTS - SECTION 1
43
The first two days of culture were dominated by parasites with rounded bodies and flagella
shorter than the body length. In fact, these represented the only detected form in the first
day of culture. Cultures with four days displayed promastigotes with the traditional needle
shape morphology (Figure 2). The RPMI originated uniform promastigotes with long
flagellum while the other media presented stationary cultures with mixed morphology. The
NNN grown parasites had a different growth phenotype with consistently smaller bodies
than all the other media.
Evaluation of promastigotes infectivity
The evaluation of the in vitro infectivity was done with stationary phase-parasites using
bone marrow derived macrophages as target cells (Figures 3A and S4). Similar
percentages of infected cells were found after 4 hours irrespective of the medium used for
promastigote maintenance (Figure 3A). At 48h post-infection, the SDM grown parasites
consistently presented a significantly higher level of infectivity (Figure 3A). This increased
in vitro infectivity did not translate in higher parasite burden in BALB/c mice (Figure 3B-C).
On the contrary, the visceral parasite load induced by Schneider cultivated parasites were
significantly lower than the other tested media.
Figure 3. In vitro and in vivo virulence of promastigotes grown in different culture media
Parasites with 4 successive in vitro passages in SDM, RPMI, NNN or Schneider were used to perform in vitro
and in vivo infections. (A) Bone marrow-derived macrophages were infected at a 1:10 (cell/parasite) ratio with
CFSE-labeled promastigotes. Data was acquired in FACSCalibur cytometer and analyzed by FlowJo software.
Three independent experiments were performed and mean and standard deviation are shown. (B,C) BALB/c
mice were infected with stationary phase-promastigotes. After 6 weeks of infection, the parasite load was
determined in spleen (B) and liver (C) by limiting dilution. The mean and standard deviation are shown. Two
independent experiments were performed; one representative experiment is shown. *P < 0.05; **P < 0.01;
***P < 0.001 as calculated by One-way ANOVA followed by Bonferroni’s post-test analyzed in Graph Pad
Prism.
Hours post-infection
RESULTS - SECTION 1
44
The presence of metacyclic parasites and the capacity to differentiate into amastigotes
have been described as important elements in virulence [27, 36]. Therefore, to better
understand the differences in infectivity, we evaluated two parameters indicative of
metacyclogenesis and the capacity to differentiate into axenic amastigotes. We analyzed
the expression of two metacyclogenesis-related genes META1 and SHERP and also
Histone H4 (Figures 4 and S5) [35, 37, 38]. A time dependent fold increase in the relative
expression of the above mentioned genes relative to Histone H4 was detected. The
greatest increase was detected for promastigotes in RPMI with a 40-fold increase for
META1. In agreement with the in vivo data, Schneider grown parasites presented no time
dependent variation in these genes. To confirm the possible enrichment of metacyclic
parasites we segregated the promastigotes by Ficoll gradients [39]. These gradients
originated poor yields of metacyclic parasites, less than 6% of the original cultures, with
no specific trend (data not shown). We also evaluated the differentiation into axenic
amastigotes using MAA20 [33]. All media were capable of originating similar numbers of
axenic amastigotes that were able to be sub-cultured (data not shown).
Figure 4. Relative expression of metacyclogenesis-related genes in L. infantum
promastigotes grown in the different media
Promastigotes relative gene expression of (A) META1 and (B) SHERP determined by qPCR at the defined
time points, when compared to Histone H4. Basic normalizations for the three genes were made using the
reference gene rRNA45. Three independent experiments were done, each performed in duplicate; the mean
of the three experiments is shown with SD.
Development of a FCS free medium
After the initial analysis of general biological properties of the parasites grown in different
media we develop a protein free medium with a specific biological phenotype requisite:
the conjugation of infectivity with long lasting stationary cultures. Among the media
evaluated, SDM and RPMI enabled the combination of these characteristics. The former
allowed high yields of more infective but fast dying parasites while the latter enabled long
RESULTS - SECTION 1
45
lasting cultures. Although the media have different composition, the 10% FCS
complementation was a common feature. Therefore, we evaluated the contribution of the
FCS complementation. To achieve this, we used ultracentrifugation devices with 3kDa
membranes to separate the FCS into two distinct fractions: the retentate, composed of
protein associated components with a molecular weight higher than 3 kDa (>3 kDa) and
the filtrate, composed of components with less than 3 kDa (<3 kDa). These two distinct
fractions were then used to complement the defined SDM and RPMI bases (bSDM and
bRPMI). Parasite growth in these complemented media was evaluated after 4 days of
culture (Figure 5 A-B).
Figure 5. Development of a protein-free medium for the growth of L. infantum promastigotes
Relative growth of L. infantum promastigotes (compared to SMD or RPMI) after four days of culture in (A)
bSDM or (B) bRPMI complemented with: no supplement (NS); 10% of the lower fraction of serum (<3 kDa);
10% of high molecular components of serum (>3kDa); 2.5 µg/mL hemin (Hem) and 10% of lower molecular
components of serum with 2.5 µg/mL hemin (Hem; <3 kDa); 10% of high molecular components of serum with
2.5 µg/mL hemin (Hem; > 3 kDa). One representative experiment of five (A) or three (B) is shown. (C) Growth
of L. infantum promastigotes after four days of culture in bRPMI complemented with 2.5 µg/mL of hemin and
different percentages of bSDM. The average of at least three independent experiments is represented.
The parasites were adapted for two days in the tested media to assess the real capacity
for sustaining parasite growth. In all growth capable conditions the parasite viability was
higher than 90% allowing at least two subsequent passages (data not shown). Neither the
bSDM nor bRPMI were able to promote growth even when complemented with <3kDa. In
contrast, the complementation with >3kDa enabled total growth recovery for both media.
In the latter, the parasites were indistinguishable from those in standard media (Figures 1
and S6). The bSDM and bRPMI, alone or upon complementation with <3kDa presented
limited growth, which was partially recovered by the addition of hemin, an essential
component for Leishmania development [23]. The concentration of hemin was adjusted to
2.5µg/mL as lower amounts were growth limiting (data not shown). Hence, hemin
complementation in bSDM enabled 60% of normal growth (Figure 5A), while in bRPMI did
RESULTS - SECTION 1
46
not contribute towards significant growth (Figure 5B). The complementation of both bases
with <3kDa and hemin induced distinct relative growths, 58% for bSDM and 27% for
bRPMI. Significantly, the complementation of bRPMI with hemin and <3kDa or hemin
alone induced morphological features similar to RPMI grown parasites (Figure S6B). The
same complementation for bSDM originated higher parasite yields with morphology that
was different from SDM. To take advantage of the superior yield of bSDM and
morphological characteristics provided by bRPMI, we combined bRPMI and bSDM (Figure
5C). The combination that enabled the highest parasite yield with indistinguishable
morphology from RPMI was obtained complementing bRPMI with 10% bSDM. This
specific ratio of bSDM and bRPMI was called cRPMI. Also, the growth of other strains and
species like L. tarentolae was achieved upon adjustment of the bRPMI/bSDM ratio (data
not shown).
Another important characteristic for media development is the final cost. Thus, we
compared the production cost of cRPMI with other standard media. cRPMI was the least
expensive with half the cost of standard SDM (Table S1) being ideal for parasite
maintenance.
In vitro characterization of promastigotes grown in cRPMI
The cRPMI enabled a continuous and reproducible growth with a maximum density of
≈1.2x107 parasites/mL (Figure 6A). No growth defect was observed in long term parasite
maintenance (Figure S7). The cRPMI enabled up to 12 days of continuous culture with
>90% viability, maintaining the subculture’s multiplicative capacity until the 9th day of
culture (Figure 6A).
Cell cycle analysis demonstrated that promastigotes grown in cRPMI also followed the
general trend of decreasing the percentage of S/G2 parasites with less than 5% at day 5
(Figure 6A). The division time for cRPMI was 12.09h ± 0.41. The morphology in cRPMI
was indistinguishable from RPMI (Figures 2 and 6B). The fold increase of metacyclic
genes was the highest among all tested media with more than 20-fold increase at day 5
for SHERP and 60-fold increase for META1. The cRPMI grown parasites were also able
to differentiate into axenic amastigotes in MAA20.
RESULTS - SECTION 1
47
Figure 6. Biology of L. infantum promastigotes in cRPMI
Promastigotes were cultured in cRPMI with an initial concentration of 1x106/mL. (A) The growth curve (solid
line), percentage of S/G2 parasites (dark dashed line) and viability (light dash line) where determined at
different time points. Parasite number was determined using a hemocytometer. Promastigote viability was
determined by the percentage of Annexin V (Ann V) and 7-aminoactinomycin D (7-AAD) negative
promastigotes. The capacity of the parasites to originate effective inoculates (grey bars) was determined as
follows: in each day of culture, an aliquot of parasites was recovered and used as inoculum to initiate new
subpassages with 1x106/mL. The number of parasites present in culture 2 days after was counted with a
hemocytometer. The cell cycle and viability analysis were done using FACSCalibur cytometer and analyzed
by FlowJo software. The average of three independent experiments is shown. (B) After 1 or 4 days of culture
live confocal microscopy images were taken from the cRPMI grown parasites stained with CFSE and mounted
on CyGelTM. (C) Promastigote relative gene expression of META1 and SHERP compared to histone H4 was
determined by qRT-PCR at the defined time points. Normalizations for the three genes were made using the
reference gene rRNA45. Three independent experiments were done, each performed in duplicate; the mean
of the three experiments is shown with SD. (D) Bone marrow-derived macrophages were infected at a 1:10
(cell/parasite) ratio with CFSE-labeled promastigotes submitted to 4 successive in vitro passages in cRPMI.
Data were acquired by FACSCalibur cytometer and analyzed by FlowJo software. The mean and standard
deviation of duplicates are shown. Three independent experiments were performed; one representative
experiment is shown. (E) BALB/c mice were infected with stationary phase-promastigotes. After 6 weeks post-
infection, the parasite load was determined in spleen and liver by limiting dilution. The mean and standard
deviation are shown. Two independent experiments were performed; one representative experiment is shown.
*P < 0.05; **P < 0.01; ***P < 0.001 as calculated by One-way ANOVA followed by Bonferroni’s post-test
analyzed in Graph Pad Prism.
RESULTS - SECTION 1
48
Promastigotes grown in cRPMI maintained in vitro and in vivo infectivity without
significant loss of virulence
The in vitro infectivity of promastigotes grown in cRPMI was evaluated as above. (Figure
6D). The infection profile was similar to the one obtained with RPMI grown parasites with
the number of infected cells dropping to less than 20% at 48h. The in vivo infectivity was
similar to RPMI, SDM e NNN parasites (Figures 3 and 6E). We also evaluated the short
term loss of infectivity associated with continuous subculture [27]. For this, we have made
infections with promastigotes that were maintained in SDM, RPMI or cRPMI for 20
passages. The predicted number of generations for each passage (using 5 days of
subculture) is higher in SDM (9 generations) when compared to RPMI (5 generations) and
cRPMI (3.5 generations). Promastigotes subcultured in cRPMI medium maintained
infectivity to similar levels as P4 promastigotes (Figure 7). In opposition, all promastigotes
grown in other tested media had a significant loss of infectivity after 20 in vitro successive
passages. This loss was more evident in SDM grown promastigotes that presented the
most significant drop in infectivity (more than 50% - Figure 7). A similar time dependent
loss of infectivity was already reported for RPMI [27].
Figure 7. Overtime virulence loss
Bone marrow-derived macrophages were infected at a 1:10 (cell/parasite) ratio with CFSE-labeled
promastigotes submitted to 4 or 21 successive in vitro passages in SDM, RPMI or cRPMI. Data were
acquired by FACSCalibur cytometer and analyzed by FlowJo software. Bars represent the percentage of
infected cell by promastigotes with 21 passages in relation to the infection by parasites with 4 passages
(dashed line); the mean and standard deviation of duplicates are shown. Three independent experiments were
performed; one representative experiment is shown.
RESULTS - SECTION 1
49
DISCUSSION
Ideally the use of distinct media should not be a determining factor in Leishmania biology
enabling comparison of experimental results obtained with promastigotes grown in
different media. To evaluate the potential bias induced by distinct media, we analyzed
several promastigote characteristics in four distinct commonly used media. In a simplistic
perspective, the development of promastigote forms can be divided in logarithmic
(procyclic) and stationary stages. The correct definition of these stages is pivotal because
the characteristics of multiplicative and stationary phase-parasites are distinct. In fact,
several studies are supported by the correct definition of these stages [40, 41]. Therefore,
we started to define these two basic promastigote stages in the context of different media.
All the promastigote growth curves were characterized by a phase of active increase in
parasite number followed by a slower growth or stationary phase (Figure 1A). The
promastigote division time calculated for each individual media during the first two days
was remarkably constant (data not shown). Still, inter-medium variations were detected
ranging from 5.89h ± 0.90 (Schneider) to 9.74h ± 0.65 (RPMI) (Figure 1D). This media
dependency of the average division time was already reported [42] and will have an
immediate impact in any study that evaluate cell cycle progression. As example, full cell
cycle progression in L. mexicana using M199 based medium was shown to take 7.1 hours
[43]. This value is similar to the division times for our strain in SDM (6.56h ± 0.89),
Schneider (5.89h ± 0.90) but significantly different from the values obtained for RPMI
(9.74h ± 0.65) and NNN (8.14h ± 0.27). The use of minimum division time to define the
logarithmic phase suggests that the parasites are dividing with unrestrained speed for the
first two days of culture. This is supported by cell cycle analysis as for the first two days
more than 40% of parasites were in S/G2 phase (Figure 1C). Nonetheless, the use of the
growth curve to define the time frame for recovery of stationary phase-parasites can be
misleading. Considering exclusively the promastigotes growth curve profile, for SDM,
NNN and Schneider the logarithmic phase will be limited to the first two days while the
stationary phase will be between day 3 and 5. Notwithstanding, cell cycle profile of
Schneider grown parasites does not support this assumption. Promastigotes in Schneider
presented an atypical behavior with more than 50% being in a stable S/G2 phase
throughout the culture span. This S/G2 profile suggests continuous division with the
absence of a defined stationary phase as it is traditionally characterized. The overtime
increase in the theoretical division time indicates that cells take a longer time to complete
the cell cycle - considering that cell death is negligible until day 4 (more than 90% viability)
(Figure 1B). The possibility of reduced/absent stationary phase in Schneider parasites
was reinforced by: morphological information that supported the existence of multiplicative
RESULTS - SECTION 1
50
parasites even at later stages of culture, no increase in metacyclic specific genes and
lower in vivo infectivity in BALB/c mice (logarithmic parasites are known to be less
infective [44]). The RPMI grown parasites present a distinct growth behavior from the
other media evaluated with a long stationary phase and high viability lasting until day 10.
The cell cycle profile fully supports this assumption (Figure 1C). Interestingly, the general
characteristics of the parasites are maintained overtime with no significant change in
infectivity (data not shown). In consequence, simple generalizations of the growth phase
of Leishmania cultures must be avoided. The proper definition of the time frame
dominated by logarithmic or stationary phase-parasites must be supported by cell cycle
and growth curve derived information (including minimum division time and viability).
The capacity to infect and originate productive infections is a characteristic of stationary
phase-parasites. The SDM grown parasites presented significantly higher infection levels
after 48 hours than the other tested media (Figure 3). A higher number of
immunomodulatory metacyclic parasites could explain these differences [27]. However,
neither the metacyclic specific gene expression nor the recovery from ficoll gradient
supported this possibility. Indeed, the SDM grown parasites present similar metacyclic
gene expression as RPMI parasites (Figures 4 and S5). Other factors can be accountable
for these differences in infection. Apoptotic parasites have been shown to be relevant for
the infectious process [45]. The level of apoptotic parasites was distinct among the
cultures evaluated (Figure 1B), with a steep increase in apoptotic cells after day 4 (except
for RPMI). This might contribute to the differences found in SDM as it was shown for L.
braziliensis that apoptotic parasites inhibit the inflammatory response [45]. In fact, at day 4
the percentage of apoptotic parasites in SDM culture is higher, although not statistically
significant, than RPMI. Therefore, a significant experimental bias may be induced if
promastigotes with 5 days were used, as parasite viability is significantly decreased in
NNN, Schneider and SDM. Also, the promastigotes from Schneider presented a specific
phenotype related to infection as they are significantly less infective in vivo. The lower
expression of metacyclic specific genes hints at the possibility of having less metacyclic
parasites. Still, we cannot infer that the differences in in vivo infectivity are directly related
with a possible reduced metacyclogenesis. The attempts to recover metacyclic parasites
from each media did not give additional significant information. Moreover, promastigotes
cultivated in SDM, which are more resistant to macrophage-specific killing (Figure 3A), do
not express higher levels of those genes. These facts reinforce the importance of solid
parasite characterization before the intended use. Interestingly, the reported differences
for in vitro infections did not translate into significantly different in vivo infections for SDM,
RESULTS - SECTION 1
51
RPMI and NNN. The high number of parasites used and the infection route might account
for the lack of differences between infections.
A possible explanation for the significant biological differences reported here might be the
existence of different promastigotes forms [46]. In the sandfly, the promastigotes follow a
specific developmental process encompassing the differentiation from amastigotes to
metacyclic promastigotes. This process involves successive promastigote stages:
procyclic, nectomonads, leptomonads and metacyclic [46]. These forms have distinct
predicted biological roles and morphology [47]. The latter allows their distinction by simple
microscopic analysis [46]. Interestingly, it was proposed that starting from amastigotes,
one can find all these proposed developmental stages in vitro [6]. The mechanisms
responsible for these changes are not clear, although some facts related to the metacyclic
development are known. Culture at low pH was associated with increased
metacyclogenesis in L. mexicana [48]. Glucose consumption in Trypanosomatids induces
a decrease of environmental pH due to the production of oxidized intermediates and
organic acids [49]. Therefore, it is clear that the media content can influence not only the
density of parasites but also the population composition. Interestingly, the dominant
parasite morphology in the different media could be fitted in distinct morphological groups
[46]. On the first day all cultures presented procyclic parasites with cell bodies bigger than
flagella and of variable width (Figure 2). After 4 days of culture the panorama was distinct.
RPMI presented very homogeneous cultures of needle shaped parasites longer than 12
µm and possessing long flagella that resemble nectomonads. Interestingly, the
nectomonads are not multiplicative forms. This fact might explain the abnormal time span
of the RPMI cultures (more than 10 days) compared to all other tested media (5 days). It
is possible that RPMI promastigotes are mostly arrested in the nectomonads stage with
very few advancing to the leptomonads stage. This would explain the low numbers of
metacyclic parasites found for this strain in RPMI on previous works [27]. All the other
media promote cultures with mixed morphology at the 4th day of culture. The NNN grown
parasites were visibly smaller than all the other parasites (Figure 2). This was an intriguing
fact that reinforces the importance of media selection. Noteworthy was the continuous
presence of multiplicative promastigotes in Schneider medium. The parasites with 4 days
are also multiplicative but distinct from day one with longer flagella and slower division
times. These might represent the second promastigote multiplicative form, the
leptomonads. It is possible that Schneider grown parasites are not able to pass this last
developmental stage failing to originate metacyclic promastigotes. Cultures with 4 days in
SDM presented a mixture of promastigotes with morphologies similar to nectomonads,
leptomonads and metacyclic parasites. It is still unclear whether these distinct
RESULTS - SECTION 1
52
morphological forms are associated with relevant biological phenomena in vitro, although
further studies must be done to evaluate this. Still, the distinct biological properties of the
cultures point to the pressing necessity for standardization of culture conditions. In fact,
the use of clonal populations, as a result of parasite genetic modifications, might
exacerbate the potential of the media to induce significant biological imprint on the
parasites [50].
Taking in consideration the different growth profiles induced by the media and the
associated costs (Table S1) one can think on specific media applications. For example,
SDM is the most cost efficient media, therefore should be the best option to produce
parasite mass for DNA extraction. Furthermore, if swift and continuous parasite growth is
required, like limiting dilution assays for parasite load quantification, Schneider should be
a solid choice as it enables fast growth, allowing rapid and easy to read results (the media
changes color due to acidification induced by parasite multiplication). However, for
application requiring protein recovery or other biological determinations there is a strong
possibility of media-induced phenotypes, as parasite growth and infectivity can be media
specific.
The evaluation of the biological characteristics of the distinct media enabled the creation
of a simple FCS free media for the routine culture of L. infantum. The convenience of
removing FCS from the media is clearly shown using RPMI. Other groups reported
different parasite densities and smaller division times [17, 20, 42]. These growth variations
described for the RPMI might be due to FCS intrinsic heterogeneity. In fact, our personal
observations support this hypothesis. We detected a density variation of 1x107 resulting
from a change on the FCS lot (Figure S8). Therefore, we pursued the creation of a
medium that enabled the growth of virulent parasites with uniform stationary morphology
and long lasting viability. These attributes are important for long term protein-free studies,
like exoproteome recovery, where reduced cell death is an essential requisite. The RPMI
media was the media that enabled this phenotype. In the absence of FCS the RPMI base
(bRPMI) did not sustained any parasite growth. Therefore, it required a supplement to be
added to the bRPMI. From the other studied media, only SDM conjugated a protein-free
base (bSDM) with highly infective parasites. The SDM medium enabled short lived
cultures with mixed morphology reaching more than twice the culture density of RPMI. As
both media were complemented with 10% FCS, the differences in culture profile must
originate in the composition of the base media. Leishmania spp. are auxotrophic for heme,
therefore they require an exogenous heme source [23]. The removal of the serum leads to
the loss of hemoglobin as the main usable iron/heme source [51, 52]. To overcome this
limitation we used hemin [53, 54]. The complementation experiments using fractionated
RESULTS - SECTION 1
53
FCS confirm that both bases were unable to promote parasite growth or survival in the
absence of hemin (Figure 5A-B). The fractionation of FCS suggests that the protein
fraction (>3kDa) is required for culture density. This is not unexpected because bovine
serum albumin can be added as a media supplement improving parasite doubling times
[14]. The incapacity of the <3kDa fraction to promote growth restoration in bSDM
suggested that bSDM contains all the nutrients (or equivalent) existing in the <3kDa
fraction. The morphology of the parasites was also used also as quality control, as
parasites with abnormal morphology are usually in stress conditions [55]. We used as
criteria of normal morphology the elongated and pointed promastigotes with an anterior
flagellum exceeding the body length. Parasites in bSDM presented abnormal morphology
in the absence of protein supplementation (Figure S6A). On the contrary, parasites in
bRPMI presented the classical morphology of stationary phase-promastigotes irrelevantly
of the complementation (Figure S6B). Remarkably, it seemed to be medium specific
elements that enabled acquisition and maintenance of the traditional stationary forms. As
the essential nutrients in FCS could be substituted by bSDM, we used it to complement
bRPMI boosting the culture density (Figure 5C). Indeed, 10% bSDM complementation of
bRPMI enabled the growth of promastigotes morphologically indistinguishable from
parasites cultivated in RPMI (Figure 2 and 6B). The proportion of both bases was strain
and species specific, since we were able to cultivate the non-pathogenic L. tarentolae,
which presented optimal growth with 20% bSDM in cRPMI (data not shown). The cRPMI
enabled lower parasite densities with longer division times of 12.9h ± 0.41. The viability,
cell cycle and infectivity retained the characteristics of RPMI. This was expected because
the bRPMI fraction accounts for 90% of cRPMI. Significantly, the high viability sustained
over time lead to a longer life span similar to RPMI. This culture longevity is significant,
enabling studies with long term growth of promastigotes. Prolonged viability also
minimizes the number of passages required for parasite maintenance. Indeed, this is
highly relevant for in vitro culture of Leishmania, as virulence loss results from continuous
cultivation [27]. This loss of virulence reported is consistent with the number of
generations passed since the recovery of parasites from the mammalian host [27]. In fact,
in our sub-culture settings, twenty passages enable at least 80, 120 and 200 generations
for parasites cultivated in cRPMI, RPMI and SDM, respectively. It would be expected that
the effects of virulence loss might be diminished in cRPMI when compared to the other
two media. In fact, twenty passages in SDM induced a significant infectivity loss at 48h
after in vitro infection when compared to parasites grown in RPMI and cRPMI. The only
medium without significant virulence loss was cRPMI, confirming the effect of the
passages in infectivity. Moreover, parasites in cRPMI could be successfully passed until
the 9th day of culture (Figure 6A). Therefore, the number of generations should decrease
RESULTS - SECTION 1
54
dramatically if we subculture the parasites at the 9th day (≈ 40 generations). This would
result in an expected significant increase in the usable life span of the parasites between
their recovery from mice and intended elimination due to virulence loss. The low cost
associated to cRPMI also supports its use for culture maintenance. Still, the lower yield
associated transforms it in the least cost effective media. This is not a significant limitation
of cRPMI; nonetheless it is not the best option for producing large numbers of parasites.
Therefore in this work, we clearly demonstrated that axenic cultivation of promastigotes
induces specific biological, morphological and immunological biases in a media-specific
manner. This fact will inherently influence experimental interpretation and warrants further
investigation. We also developed a serum free semi-defined medium, cRPMI, which
sustain the growth of promastigotes biologically indistinguishable from parasites cultivated
in RPMI. This medium enables the affordable maintenance of infective parasites for longer
times, increasing the sub-culturing time.
FINANCIAL SUPPORT
This work was funded by FEDER funds through the Operational Competitiveness
Program – COMPETE and by National Funds through FCT – Fundação para a Ciência e
a Tecnologia under the projects FCOMP-01-0124-FEDER-011054 (PTDC/SAU-
FCF/100749/2008), FCOMP-01-0124-FEDER-011058 (PTDC/SAU-FCF/101017/2008),
FCOMP-01-0124-FEDER-019648 (PTDC/BIA-MIC/118644/2010) and CIHR operating
grants to MO. NS, JC and DM were supported by fellowships from FCT code
SFRH/BD/37352/2007, SFRH/BD/48626/2008 and SFRH/BD/91543/2012, respectively.
RS was supported by Programa Ciência – financed by Programa Operacional Potencial
Humano POPH – QREN– Tipologia 4.2 – Promoção do Emprego Científico, co-funded by
Fundo Social Europeu and National funding from Ministry of Science, Technology and
Higher Education (MCTES). MO holds the Canada Research Chair in Antimicrobial
Resistance.
RESULTS - SECTION 1
55
SUPPLEMENTAL DATA
Figure S1. Adjustment of initial inoculum for SDM and Schneider media
Promastigotes with 4 passages were cultured with a variable initial concentration in (A) SDM or (B)
Schneider. The average of two independent experiments is shown.
________________________________________________________________________
Figure S2. Histogram of cell cycle analysis of parasites in different media
Representative histograms for cell cycle analysis of parasites with 1 to 5 days of culture in RPMI, SDM,
NNN, Schneider and cRPMI. The cell cycle analysis was done with a FACSCalibur cytometer and
FlowJo software’s built-in tool for cell cycle analysis. One out of at least three experiments is shown.
RESULTS - SECTION 1
56
Figure S3. Cell cycle analysis of parasites in different media
The percentage of parasites in G1, S or G2 was determined at days 1 to 5 of culture in SDM, RPMI, NNN,
Schneider and cRPMI. The cell cycle analysis was done using FACSCalibur cytometer and analyzed by
FlowJo software. One out of at least three experiments is shown.
________________________________________________________________________
Figure S4. Dot plot of bone marrow-derived macrophages infected with CFSE labeled parasites
Promastigotes used were grown for 4 days in RPMI, SDM, NNN, Schneider and cRPMI and labeled with
CFSE. The percentage of infected cells was determined with a FACSCalibur cytometer and FlowJo software.
One out of at least three experiments is shown.
RESULTS - SECTION 1
57
Figure S5. Relative gene expression of metacyclogenesis-related genes of
promastigotes cultivated in the different media
Promastigote relative gene expression of (A) META1, (B) SHERP and (C) histone H4
determined by qRT-PCR at the defined time points. Normalizations for the three genes were
made using the reference gene rRNA45. Three independent experiments were executed, each
performed in duplicate; one representative experiment is shown.
________________________________________________________________________
A
B
Figure S6. Dominant promastigote morphology during the process of
development of the protein-free media
Live confocal images from dominant morphology of L. infantum promastigotes after four
days of culture in (A) bSDM or (B) bRPMI supplemented with: (a) no supplement; (b) 10%
of <3 kDa; (c) 10% of >3kDa; (d) 2.5 µg/mL hemin; (e) 10% of <3 kDa with 2.5 µg/mL
hemin; (f) 10% of >3kDa with 2.5 µg/mL hemin.
RESULTS - SECTION 1
58
Figure S7. Growth curves of L. infantum in cRPMI after 4 or 20 in vitro passages
Promastigotes with 4 or 20 passages were cultured with an initial concentration of 1x106 /mL
parasites in cRPMI. The growth curve was done by counting the parasites at different time points in
a hemocytometer. One out of at least three independent experiments is shown.
________________________________________________________________________
Figure S8. Influence of different FCS lots on the growth of L. infantum cultivated in RPMI
Promastigotes were cultured with an initial concentration of 1x106 /mL parasites in RPMI using
FCS from two distinct lots. The growth curve was done by counting the parasites at different time
points in a hemocytometer. One out of at least three independent experiments is shown.
________________________________________________________________________
Table S1. Comparative cost of the culture media used in the study
Cost/L (€) Cost (€)/109 promastigotes
SDM 60.2 4.52
RPMI 38.53 12.72
cRPMI 32.87 17.71
Schneider 58.18 5.21
NNN 74.52 6.18
RESULTS - SECTION 1
59
REFERENCES
1. Mougneau E, Bihl F, Glaichenhaus N: Cell biology and immunology of Leishmania. Immunological
reviews 2011, 240(1):286-296.
2. Bates PA: Transmission of Leishmania metacyclic promastigotes by phlebotomine sand flies. Int J
Parasitol 2007, 37(10):1097-1106.
3. Kedzierski L: Leishmaniasis Vaccine: Where are We Today? J Glob Infect Dis 2010, 2(2):177-185.
4. Volf P, Volfova V: Establishment and maintenance of sand fly colonies. Journal of vector ecology :
journal of the Society for Vector Ecology 2011, 36 Suppl 1:S1-9.
5. Freitas VC, Parreiras KP, Duarte AP, Secundino NF, Pimenta PF: Development of Leishmania
(Leishmania) infantum chagasi in its natural sandfly vector Lutzomyia longipalpis. Am J Trop Med
Hyg 2012, 86(4):606-612.
6. Gossage SM, Rogers ME, Bates PA: Two separate growth phases during the development of
Leishmania in sand flies: implications for understanding the life cycle. International journal for
parasitology 2003, 33(10):1027-1034.
7. Rochette A, Raymond F, Corbeil J, Ouellette M, Papadopoulou B: Whole-genome comparative RNA
expression profiling of axenic and intracellular amastigote forms of Leishmania infantum.
Molecular and biochemical parasitology 2009, 165(1):32-47.
8. Pescher P, Blisnick T, Bastin P, Spath GF: Quantitative proteome profiling informs on phenotypic
traits that adapt Leishmania donovani for axenic and intracellular proliferation. Cellular
microbiology 2011, 13(7):978-991.
9. Nicolle C: Culture du parasite du bouton d’Orient. C R Acad Sci 1908(146):842–843.
10. Singh S, Mohapatra DP, Sivakumar R: Successful replacement of fetal calf serum with human urine
for in vitro culture of Leishmania donovani. J Commun Dis 2000, 32(4):289-294.
11. Grekov I, Svobodova M, Nohynkova E, Lipoldova M: Preparation of highly infective Leishmania
promastigotes by cultivation on SNB-9 biphasic medium. J Microbiol Methods 2011.
12. Rodrigues Ide A, da Silva BA, dos Santos AL, Vermelho AB, Alviano CS, Dutra PM, Rosa Mdo S: A new
experimental culture medium for cultivation of Leishmania amazonensis: its efficacy for the
continuous in vitro growth and differentiation of infective promastigote forms. Parasitology
research 2010, 106(5):1249-1252.
13. Sharief AH, Khalil EA, Omer SA, Abdalla HS: Innovative serum-free medium for in vitro cultivation
of promastigote forms of Leishmania species. Parasitol Int 2008, 57(2):138-142.
14. Schuster FL, Sullivan JJ: Cultivation of clinically significant hemoflagellates. Clinical microbiology
reviews 2002, 15(3):374-389.
15. Tasew G, Kebede A, Wolday D, Gadisa E, Britton S, Eidsmo L, Akuffo H: Low-cost liquid medium for
in vitro cultivation of Leishmania parasites in low-income countries. Glob Health Action 2009, 2.
16. Steiger RF, Black CD: Simplified defined media for cultivating Leishmania donovani
promastigotes. Acta Trop 1980, 37(2):195-198.
RESULTS - SECTION 1
60
17. Limoncu ME, Balcioglu IC, Yereli K, Ozbel Y, Ozbilgin A: A new experimental in vitro culture medium
for cultivation of Leishmania species. J Clin Microbiol 1997, 35(9):2430-2431.
18. Palomino JC: Peptone-yeast autolysate-fetal bovine serum 10, a simple, inexpensive liquid
medium for cultivation of Leishmania spp. J Clin Microbiol 1982, 15(5):949-950.
19. Hendricks LD, Wood DE, Hajduk ME: Haemoflagellates: commercially available liquid media for
rapid cultivation. Parasitology 1978, 76(3):309-316.
20. Merlen T, Sereno D, Brajon N, Rostand F, Lemesre JL: Leishmania spp: completely defined medium
without serum and macromolecules (CDM/LP) for the continuous in vitro cultivation of infective
promastigote forms. Am J Trop Med Hyg 1999, 60(1):41-50.
21. Muniaraj M, Lal CS, Kumar S, Sinha PK, Das P: Milk of cow (Bos taurus), buffalo (Bubalus bubalis),
and goat (Capra hircus): a better alternative than fetal bovine serum in media for primary
isolation, in vitro cultivation, and maintenance of Leishmania donovani promastigotes. J Clin
Microbiol 2007, 45(4):1353-1356.
22. Armstrong TC, Patterson JL: Cultivation of Leishmania braziliensis in an economical serum-free
medium containing human urine. J Parasitol 1994, 80(6):1030-1032.
23. Chang CS, Chang KP: Heme requirement and acquisition by extracellular and intracellular stages
of Leishmania mexicana amazonensis. Molecular and biochemical parasitology 1985, 16(3):267-276.
24. Bello AR, Nare B, Freedman D, Hardy L, Beverley SM: PTR1: a reductase mediating salvage of
oxidized pteridines and methotrexate resistance in the protozoan parasite Leishmania major.
Proc Natl Acad Sci U S A 1994, 91(24):11442-11446.
25. Kar K: Folic acid the essential supplement to brain heart infusion broth for cultivation and cloning
of Leishmania donovani promastigotes. Parasitology 1997, 115 ( Pt 3):231-235.
26. Mitchell GF, Handman E, Spithill TW: Vaccination against cutaneous leishmaniasis in mice using
nonpathogenic cloned promastigotes of Leishmania major and importance of route of injection.
Aust J Exp Biol Med Sci 1984, 62 ( Pt 2):145-153.
27. Moreira D, Santarem N, Loureiro I, Tavares J, Silva AM, Amorim AM, Ouaissi A, Cordeiro-da-Silva A,
Silvestre R: Impact of continuous axenic cultivation in Leishmania infantum virulence. PLoS
neglected tropical diseases 2012, 6(1):e1469.
28. Nolan TJ, Herman R: Effects of long-term in vitro cultivation on Leishmania donovani
promastigotes. J Protozool 1985, 32(1):70-75.
29. Shamsuzzaman SM, Furuya M, Korenaga M, Imamura K, Hashiguchi Y: Use of urine samples from
healthy humans, nephritis patients or other animals as an alternative to foetal calf serum in the
culture of Leishmania (L.) donovani in vitro. Ann Trop Med Parasitol 1999, 93(6):613-620.
30. Allahverdiyev AM, Bagirova M, Elcicek S, Koc RC, Oztel ON: Effect of human urine on cell cycle and
infectivity of Leismania species promastigotes in vitro. The American journal of tropical medicine
and hygiene 2011, 85(4):639-643.
31. McCarthy-Burke C, Bates PA, Dwyer DM: Leishmania donovani: use of two different, commercially
available, chemically defined media for the continuous in vitro cultivation of promastigotes. Exp
Parasitol 1991, 73(3):385-387.
RESULTS - SECTION 1
61
32. Brun R, Schonenberger: Cultivation and in vitro cloning or procyclic culture forms of Trypanosoma
brucei in a semi-defined medium. Short communication. Acta Trop 1979, 36(3):289-292.
33. Sereno D, Lemesre JL: Axenically cultured amastigote forms as an in vitro model for investigation
of antileishmanial agents. Antimicrob Agents Chemother 1997, 41(5):972-976.
34. Soto M, Quijada L, Alonso C, Requena JM: Molecular cloning and analysis of expression of the
Leishmania infantum histone H4 genes. Molecular and biochemical parasitology 1997, 90(2):439-447.
35. Santos MG, Silva MF, Zampieri RA, Lafraia RM, Floeter-Winter LM: Correlation of meta 1 expression
with culture stage, cell morphology and infectivity in Leishmania (Leishmania) amazonensis
promastigotes. Memorias do Instituto Oswaldo Cruz 2011, 106(2):190-193.
36. Ouakad M, Bahi-Jaber N, Chenik M, Dellagi K, Louzir H: Selection of endogenous reference genes
for gene expression analysis in Leishmania major developmental stages. Parasitology research
2007, 101(2):473-477.
37. Silvestre R, Cordeiro-Da-Silva A, Santarem N, Vergnes B, Sereno D, Ouaissi A: SIR2-deficient
Leishmania infantum induces a defined IFN-gamma/IL-10 pattern that correlates with protection.
Journal of immunology 2007, 179(5):3161-3170.
38. Yao C, Chen Y, Sudan B, Donelson JE, Wilson ME: Leishmania chagasi: homogenous metacyclic
promastigotes isolated by buoyant density are highly virulent in a mouse model. Exp Parasitol
2008, 118(1):129-133.
39. Holzer TR, McMaster WR, Forney JD: Expression profiling by whole-genome interspecies
microarray hybridization reveals differential gene expression in procyclic promastigotes, lesion-
derived amastigotes, and axenic amastigotes in Leishmania mexicana. Mol Biochem Parasitol
2006, 146(2):198-218.
40. McNicoll F, Drummelsmith J, Muller M, Madore E, Boilard N, Ouellette M, Papadopoulou B: A combined
proteomic and transcriptomic approach to the study of stage differentiation in Leishmania
infantum. Proteomics 2006, 6(12):3567-3581.
41. Fritsche C, Sitz M, Weiland N, Breitling R, Pohl HD: Characterization of the growth behavior of
Leishmania tarentolae: a new expression system for recombinant proteins. J Basic Microbiol 2007,
47(5):384-393.
42. Wheeler RJ, Gluenz E, Gull K: The cell cycle of Leishmania: morphogenetic events and their
implications for parasite biology. Mol Microbiol 2011, 79(3):647-662.
43. Alvarez-Rueda N, Biron M, Le Pape P: Infectivity of Leishmania mexicana is associated with
differential expression of protein kinase C-like triggered during a cell-cell contact. PLoS One
2009, 4(10):e7581.
44. Wanderley JL, Pinto da Silva LH, Deolindo P, Soong L, Borges VM, Prates DB, de Souza AP, Barral A,
Balanco JM, do Nascimento MT et al: Cooperation between apoptotic and viable metacyclics
enhances the pathogenesis of Leishmaniasis. PLoS One 2009, 4(5):e5733.
45. Rogers ME, Chance ML, Bates PA: The role of promastigote secretory gel in the origin and
transmission of the infective stage of Leishmania mexicana by the sandfly Lutzomyia longipalpis.
Parasitology 2002, 124(Pt 5):495-507.
RESULTS - SECTION 1
62
46. Bates PA: Leishmania sand fly interaction: progress and challenges. Curr Opin Microbiol 2008,
11(4):340-344.
47. Bates PA, Tetley L: Leishmania mexicana: induction of metacyclogenesis by cultivation of
promastigotes at acidic pH. Exp Parasitol 1993, 76(4):412-423.
48. Van Hellemond JJ, Opperdoes FR, Tielens AG: Trypanosomatidae produce acetate via a
mitochondrial acetate:succinate CoA transferase. Proc Natl Acad Sci U S A 1998, 95(6):3036-3041.
49. Carvalho S, Cruz T, Santarem N, Castro H, Costa V, Tomas AM: Heme as a source of iron to
Leishmania infantum amastigotes. Acta Trop 2009, 109(2):131-135.
50. Krishnamurthy G, Vikram R, Singh SB, Patel N, Agarwal S, Mukhopadhyay G, Basu SK, Mukhopadhyay
A: Hemoglobin receptor in Leishmania is a hexokinase located in the flagellar pocket. J Biol Chem
2005, 280(7):5884-5891.
51. Srivastava P, Sharma GD, Kamboj KK, Rastogi AK, Pandey VC: Heme metabolism in promastigotes
of Leishmania donovani. Mol Cell Biochem 1997, 171(1-2):65-68.
52. Gholamhosseinian A, Vassef A: Superiority of hemoglobin to hemin for cultivation of Leishmania
tropica promastigotes in serum-free media. J Protozool 1988, 35(4):446-449.
53. Zangger H, Mottram JC, Fasel N: Cell death in Leishmania induced by stress and differentiation:
programmed cell death or necrosis? Cell Death Differ 2002, 9(10):1126-1139.
RESULTS - SECTION 2
63
SECTION 2
Characterization of the biology and infectivity of Leishmania infantum viscerotropic
and dermotropic strains isolated from HIV+ and HIV- patients in the murine model
of visceral leishmaniasis
Parasites and Vectors 2013, 6:122
Main findings
Molecular typing unraveled a new k26 sequence attributed to MON-284 zymodeme and
allowed the generation of a molecular signature for the identification of each L. infantum
strain. In vitro cultivation enabled the production of promastigotes with comparable growth
curves and metacyclogenesis development. Differences in in vitro and in vivo infectivity
and immunogenicity between strains were found and attributed to intrinsic characteristics
of each strain. Strains isolated from HIV+ patients demonstrated to be less resistant to
host defense.
RESULTS - SECTION 2
65
Characterization of the biology and infectivity of Leishmania infantum viscerotropic
and dermotropic strains isolated from HIV+ and HIV- patients in the murine model
of visceral leishmaniasis
Joana Cunha1,2, Eugenia Carrillo3, Carmen Sánchez3, Israel Cruz3, Javier Moreno3 and
Anabela Cordeiro-da-Silva1,4,*
1 Parasite Disease Group, IBMC - Instituto de Biologia Molecular e Celular, Universidade
do Porto, Portugal 2 Instituto de Ciências Biomédicas Abel Salazar and Faculdade de Medicina,
Universidade do Porto, Portugal 3 WHO Collaborating Center for Leishmaniasis, Centro Nacional de Microbiologia, Instituto
de Salud Carlos III, Spain 4 Laboratório de Microbiologia, Departamento de Ciências Biológicas, Faculdade de
Farmácia, Universidade do Porto, Portugal
* Corresponding author
Anabela Cordeiro da Silva, Parasite Disease Group, Unit of Infection and Immunity,
IBMC - Instituto de Biologia Molecular e Celular, Universidade do Porto, Rua do Campo
Alegre, 823, 4150-180 Porto, Portugal
Tel.: +351 226 074 949; Fax: +351 226 099 15; e-mail: [email protected]
Keywords
Leishmania infantum, clinical isolates, visceral leishmaniasis, molecular typing,
metacyclogenesis, infectivity, tropism.
RESULTS - SECTION 2
66
ABSTRACT
Background: Leishmaniasis are a group of diseases with a variety of clinical
manifestations. The form of the disease is highly dependent on the infective Leishmania
species and the immunological status of the host. The infectivity of the parasite strain also
plays an important role in the progression of the infection. The aim of this work is to
understand the influence of the natural infectivity of Leishmania strains in the outcome of
visceral leishmaniasis.
Methods: In this study we have characterized four strains of L. infantum in terms of
molecular typing, in vitro cultivation and differentiation. Two strains were isolated from
HIV+ patients with visceral leishmaniasis (Bibiano and E390M), one strain was isolated
from a cutaneous lesion in an immunocompetent patient (HL) and another internal
reference strain causative of visceral leishmaniasis (ST) also from an immunocompetent
patient was used for comparison. For this objective, we have compared their virulence by
in vitro and in vivo infectivity in a murine model of visceral leishmaniasis.
Results: Molecular typing unraveled a new k26 sequence attributed to MON-284
zymodeme and allowed the generation of a molecular signature for the identification of
each strain. In vitro cultivation enabled the production of promastigotes with comparable
growth curves and metacyclogenesis development. The HL strain was the most infective,
showing the highest parasite loads in vitro that were corroborated with the in vivo assays,
6 weeks post-infection in BALB/c mice. The two strains isolated from HIV+ patients, both
belonging to two different zymodemes, revealed different kinetics of infection.
Conclusion: Differences in in vitro and in vivo infectivity found in the murine model were
then attributed to intrinsic characteristics of each strain. This work is supported by other
studies that present the parasite’s inherent features as factors for the multiplicity of clinical
manifestations and severity of leishmaniasis.
RESULTS - SECTION 2
67
BACKGROUND
Parasites from the Leishmania genus are trypanosomatid protozoans responsible for a
group of diseases with a broad range of clinical manifestations collectively known as
leishmaniasis (reviewed in [1-3]). The emergence of leishmaniasis as an opportunistic
infection in HIV+ patients in areas where both pathogens are endemic [4] has generated
new interest in leishmaniasis.
It is well known that species such as L. major and L. mexicana are usually exclusively
dermotropic, while L. infantum and L. donovani are responsible for both cutaneous and
visceral leishmaniasis [5]. Apart from a general species-specific organ tropism of
Leishmania, intraspecies intrinsic characteristics are also a relevant factor to consider.
According to Maia et al. [6], dermotropic and viscerotropic L. infantum strains modulate
the sand fly biting time on the host leading to the delivery, respectively, of a high or low
dose of metacyclic promastigotes into the skin which will impact on the parasite tropism
and manifestation of the disease. Even strains belonging to the same zymodeme have
been associated to differential infectivity [7].
In experimental infections, however, another parasite-related feature is of major
importance. In vitro cultivation of Leishmania is a subject open to wide variation between
laboratories, making the comparison of similar experiments ambiguous. Depending on the
culture medium (Santarém, N. and Cunha, J., submitted results and [8]), the duration of
the culture [9] and the number of axenic passages performed [9], the promastigotes
generated will be differentially enriched in metacyclic forms [9], which will condition the
success of the infection. Nonetheless, the genetics and the immune status of the host play
a similarly important role in the tropism and severity of the disease [10]. In the murine
models, L. major was only found in the infection site of the resistant C57BL/6 mice after
subcutaneous injection, whereas the same experimental protocol followed in the
susceptible BALB/c strain allowed visceralization [11]. Also, high and low infective strains
maintained their profile (visceralizing or regulatory, respectively) in BALB/c and C.B-17
SCID mice, although with higher parasite loads in the T and B cell-dysfunctional SCID
animals [12].
The analysis of HIV/Leishmania-coinfected human patients brought important insights into
the role of the immune system on the severity of the disease. On the one hand the
visceralization of dermotropic strains is frequently observed in HIV/Leishmania-
coinfections [13], as well as the regular presence of amastigotes in uncommon locations
such as the lungs or the intestine [14]. On the other, the appearance of unique
Leishmania zymodemes in HIV+ patients has been reported, which may be indicative of
RESULTS - SECTION 2
68
circulating strains normally associated with asymptomatic disease in immunocompetent
patients [13,15]. Some studies have shown that strains originating from HIV+ patients
have low infectivity, which explains its appearance only in immunocompromised
individuals [7,16]. On the contrary, three distinct infective profiles were attributed to strains
responsible for CL or VL (from immunocompetent or HIV+ patients) and no correlation
was made according to the origin of the isolate [17].
In this study, we have focused on four different L. infantum strains isolated from patients
with CL, VL and HIV/Leishmania coinfections. We characterized these strains according
to molecular, biological and infectivity characteristics. We standardized the in vitro culture
to avoid any biased infectivity that was evaluated with macrophage and mouse models.
We have studied the distribution of the strains in acute and chronic infection by qPCR
assessing the parasite load in spleen, liver, bone marrow, blood and lymph nodes and
correlated differences in infectivity with major findings on the molecular typing.
RESULTS - SECTION 2
69
MATERIALS AND METHODS
Parasites
Four L. infantum strains isolated from patients in the Mediterranean basin and Portugal
were used in this study. MHOM/MA/67/ITMAP-263 (ST) is a cloned line derived from a
patient with visceral leishmaniasis [9,18] that was used as an internal and comparative
control in all the experiments performed. HL strain (MHOM/PT/2009/LLM-1708) was
isolated from an immunocompetent patient with cutaneous leishmaniasis. Briefly, a skin
biopsy was dissociated in a cell strainer to isolate the cells and was then transferred into
culture in RPMI. E390M (MHOM/ES/99/LLM-855) and Bibiano (MHOM/ES/01/LLM-1083)
were isolated from bone marrow aspirates of HIV/Leishmania-coinfected patients, this
second one being responsible for recurrent relapses of leishmaniasis. The bone marrow
samples were cultivated in NNN medium at 26–27°C, until the expansion of the
promastigotes. ST, HL and Bibiano strains have been characterized by multilocus enzyme
electrophoresis (MLEE) as MON-1 zymodeme, while E390M is MON-284 (electrophoretic
mobilities for malate dehydrogenase (MDH) and glucose-phosphate isomerase (GPI)
were determined to be of 104 and 105, respectively, in relation to MON-1 zymodeme
[13]).
Molecular typing
L. infantum isolates were subjected to molecular typing by targeting four different regions
of the Leishmania genome. Leishmania DNA was extracted by phenol/chloroform as
described below in more detail and samples were adjusted to a final concentration of 10
ng/μL after measuring DNA content with a Nanodrop ND-1000 spectrophotometer
(Thermo Scientific). A volume of 5 μL of each sample was used in further PCRs. PCR
products were run on 2% agarose gels stained with ethidium bromide and visualized
under UV light. Then they were excised from agarose gels and purified using the QIAquick
Gel Extraction Kit (QIAGEN). First, the species status of the isolates was confirmed by
DNA sequencing of the heat-shock protein 70 (hsp70) gene [19]. Further subtyping was
performed by sequence analysis of the ribosomal internal transcribed spacer 1 (ITS1) and
2 (ITS2) [20] and the hydrophilic acylated surface protein B (haspB) or k26 gene [21]. The
Big-Dye Terminator Cycle Sequencing Ready Reaction Kit V3.1 and the automated ABI
PRISM 377 DNA sequencer (Applied Biosystems) were used for direct sequencing of the
k26, ITS1 and ITS2 PCR products that was performed with the corresponding forward and
reverse primers; internal primers for sequencing were also used for the hsp70 PCR
product, as described by Fraga et al. [19]. The obtained sequences were analyzed and
edited using the software BioEdit Sequence Alignment Editor, version 7.0.9.0 (Ibis
RESULTS - SECTION 2
70
Biosciences) [22]. ClustalW multiple alignment algorithm tool and manual adjustment were
used for comparison of the resulting sequences with the respective published sequences.
The hsp70 sequences were compared with those of the different Leishmania species
generated by Fraga et al. [19]. ITS types were assigned to each isolate according to the
sequence polymorphism of the 12 microsatellite regions included in ITS1 (four sites) and
ITS2 (eight sites), as described by Kuhls et al. [20]. k26 genotypes were assigned
according to the size and sequence of the PCR product, following the criteria previously
described by Haralambous et al. [21].
For the generation of unique patterns that could be used for strain identification, we
amplified a region of the kinetoplast DNA minicircles and evaluated the restriction profile
after HaeIII (Roche Applied Science) endonuclease digestion [23] using DNA extracted
from axenic promastigotes and from experimentally infected murine tissues.
Culture media
Novy-MacNeal-Nicolle medium (NNN) was prepared with a semi-solid phase made of
1.4% agar (Sigma-Aldrich), 0.6% NaCl (Merck), 31% defibrinated rabbit blood, 625
units/mL penicillin, 625units/mL streptomycin and RPMI 1640 medium supplemented with
10% fetal bovine serum (FBS), 2 mM L-glutamine, 100 U/mL penicillin, 100 U/mL
streptomycin and 20 mM HEPES buffer (all from Lonza) as liquid phase.
Growth curves and viability
Parasites were first passed in mice to control their virulence and frozen in vials for future
use until 10 in vitro passages [9]. Promastigotes were cultivated at 26°C with an initial
inoculum of 106 parasites/mL in NNN from a synchronized culture in the same media and
followed for 6 days. In each day, parasites were counted in a hemocytometer and stained
with Annexin V and 7-amino-actinomycin D (7-AAD) for viability analysis as described in
[9]. 10 000 gated events were analyzed in a FACSCanto II (BD Biosciences) and the
percentage of Annexin-/7AAD- cells determined with FlowJo software (TreeStar).
Cell cycle
In each day of culture, promastigotes were recovered and washed in PBS/FBS 2%. 2x106
parasites were resuspended in 1 mL of PBS/FBS 2% and 3 mL of ice-cold absolute
ethanol (Panreac) was carefully added while vortexing. After fixation for 1 hour at 4°C, the
parasites were washed in PBS and resuspended in 1 mL of propidium iodide (PI) staining
solution consisting of citrate buffer 3.8 mM in PBS, 50 μg/mL PI (Sigma-Aldrich) and 0.5
μg/μL RNAse A (Sigma-Aldrich). Following an incubation of 30 minutes at 4°C, 20 000
RESULTS - SECTION 2
71
single live cells were acquired in a FACSCanto II and analyzed with the FlowJo’s cell
cycle built-in tool.
Quantification of metacyclogenesis-dependent gene transcription
107 promastigotes from day 1 to 6 of culture were resuspended in TRIzol reagent
(Invitrogen) and frozen at −80°C. Total RNA was extracted using chloroform and
isopropanol according to the manufacturer’s instructions and solubilized in 10 μL of
nuclease-free water. RNA of high quality was obtained (RQI between 9.0 and 10.0) as
assessed using RNA StdSens Chips of the Experion automated electrophoresis system
(Bio-Rad). RNA concentration was determined using a Nanodrop ND-1000
spectrophotometer. Samples were stored at −80°C until cDNA was synthesised. Reverse
transcription was performed with iScript cDNA synthesis kit (Bio-Rad) according to the
manufacturer’s instructions over 500 ng of total RNA. Meta-1, Small Hydrophilic
Endoplasmic Reticulum-associated Protein (SHERP) and histone H4 transcription was
quantitatively analyzed after normalization with rRNA45 transcription by qPCR using the
iQ SYBR Green Supermix according to the manufacturer’s instructions in a My iCycler iQ5
(Bio-Rad). 4 μL of cDNA (diluted 25×) was used as template that was run in duplicate with
500 nM (Meta-1 and histone H4) or 250 nM (SHERP and rRNA45) of the following primers
(from Stabvida): Meta-1 [GenBank: NC_009401] forward: 5′-GGGCAGCGACGACCTGAT-
3′ and reverse: 5′-CGTCAACTTGCCGCCGTC-3′ (modified from [24]); histone H4
[LinJ35.1400, GenBank: XM_001468907] forward: 5′-ACACCGAGTATGCG-3′ and
reverse: 5′-TAGCCGTAGAGGATG-3′ [9]; SHERP [GenBank: XM_003392466] forward: 5′-
CAATGCGCACAACAAGATCCAG-3′ and reverse: 5′-TACGAGCCGCCGCTTATCTTGTC-
3′ [9]; rRNA45 [GenBank: CC144545] forward: 5′-CCTACCATGCCGTGTCCTTCTA-3′
and reverse: 5′-AACGACCCCTGCAGCAATAC-3′ [25]. Changes in relative gene
expression were determined with ∆∆CT method and results show fold changes
comparative to day 1 calculated by 2-∆∆CT.
In vitro infections
Bone marrow-derived macrophages (BMMo) were produced as described previously [9].
Stationary promastigotes cultivated in NNN for 4 days were washed and put in contact
with the cells in 1:10 ratio (cell:parasites) for 4 h. Extracellular parasites were washed
away with PBS and the cells incubated for more 24, 48, 72 or 96 hours or fixed
immediately with 2% PFA. The macrophages were mounted on Vectashield with DAPI
(Vector Laboratories) and 100 infected cells or 400 total cells were counted in duplicate by
fluorescence microscopy in a Zeiss Axioskop (Carl Zeiss). The percentage of infected
cells and the geometric mean of the number of parasites per infected cell were evaluated.
RESULTS - SECTION 2
72
The infection index was calculated by multiplication of both parameters to account for the
overall parasite load.
In vivo infections
7–8 week-old BALB/c male mice (4–5 animals per group, except in 2-week infections with
E390M strain where only 3 animals were used) were infected via the intraperitoneal route
with 108 promastigotes of each strain cultivated in NNN for four days. After 2 or 6 weeks of
infection mice were anesthetized with isoflurane and sacrificed by cervical dislocation.
Blood, inguinal lymph nodes, spleen, liver and femoral bone marrow were recovered for
quantification of parasite load. Blood and spleen were also used for the evaluation of
humoral and cellular responses.
Parasite load quantification
Parasite load was quantified in samples that were collected and frozen at the time of
animal sacrifice. We used 200 μL of blood collected with EDTA, 10 mg of spleen and liver
(single cell suspensions), 3 × 106 bone marrow cells and the inguinal draining lymph node
to extract DNA. First, 400 μL of a buffer containing 10 mM NaCl, 10 mM EDTA and 10 mM
Tris–HCl with pH 8.0 were added to the samples, which were incubated overnight with 40
μg of proteinase K (Sigma-Aldrich) at 56°C with shaking. Then, the samples were
vortexed and incubated for 20 minutes at 70°C. DNA was extracted using
phenol/chloroform/isoamyl alcohol (all from Merck Millipore). After precipitation with ice-
cold 70% ethanol solution, DNA was dissolved in 100–200 μL of nuclease-free water. We
quantified the total DNA in a Nanodrop ND-1000 spectrophotometer and prepared
dilutions of concentrations adjusted for each tissue. We quantified Leishmania sp. DNA by
qPCR using 1000nM of R223 and 500nM of R333 primers (Sigma-Aldrich) for the small
subunit rRNA (SSUrRNA) [26]. Depending on the tissue, 100 to 400 ng of total DNA
served as a template in a 20 μL reaction using LightCycler FastStart DNA Master SYBR
Green I kit (Roche Applied Science) according to the manufacturer’s instructions, in a
touchdown qPCR performed in a LightCycler 2.0 carousel-based instrument (Roche
Applied Science) with final annealing temperature of 65°C [27]. CTs were extrapolated in
a standard curve constructed with serial dilutions of L. infantum DNA (strain JPC,
MCAN/ES/98/LLM-722) diluted in host DNA (from spleen of naïve mice) to calculate
Leishmania content in parasites/μg DNA. Whenever the qPCR gave a positive (with the
expected melting curve) but unquantifiable value or a doubtable specific product (aberrant
melting curve), we performed a nested PCR [28] that has a higher sensitivity (0.01
parasites) than the qPCR (0.6 parasites) to confirm the positivity of the quantitative result.
300 nM of R221 and R332 primers [26] were used for the first amplification reaction. For
RESULTS - SECTION 2
73
the second reaction, 10 μL of the first PCR product diluted 1:40 served as template with
the same R223 and R333 primers (300 nM and 150 nM, respectively) used for the qPCR.
This molecular quantification was applied after proper validation by comparison with
limiting dilution assay (Additional Methods and Additional figure 1).
Splenic cell populations
5 × 105 splenocytes were surface-stained for 20 minutes at 4°C with saturating
concentrations of monoclonal antibodies (all from Biolegend). After washing twice with
PBS/FBS 2%, the cells were examined by flow cytometry in a FACSCanto (BD
Bioscences) and analyzed with FlowJo software. After acquisition of 50000 cells identified
by FSC and SSC parameters, major populations were identified as follows: CD4+ T
lymphocytes (PerCp.Cy5.5 anti-CD3, clone 17A2; APC.Cy7 anti-CD4, clone GK 1.5),
CD8+ T lymphocytes (PerCp.Cy5.5 anti-CD3; FITC anti-CD8, clone 53–6.7), B cells (FITC
anti-CD19, clone 6D5), monocytes/macrophages (PE.Cy7 anti-CD11b, clone M1/70;
PerCp.Cy5.5 anti-Ly6C, clone HK1.4).
Leishmania-specific immunoglobulins
The specific humoral response was analyzed by ELISA as described elsewhere [18]. In
short, 96-well microtitration plates (Greiner Bio-One) were coated with 10 μg/mL of soluble
Leishmania antigens (SLA) in carbonates buffer pH 8.5 and then blocked with PBS/gelatin
1%. Sera were diluted 1:100 and incubated for 2 hours at 37°C. After washing with
PBS/tween 20 0.1%, HRP-conjugated anti-IgG1 or anti-IgG2a (Southern Biotech) were
added to the wells at a dilution of 1:5000 and incubated for 30 minutes at 37°C. The plates
were revealed with 0.5 mg/mL of o-phenylenediamine dihydrochloride (Sigma-Aldrich) in
citrate buffer pH 4.0 and the reaction was stopped with HCl 3 N. The absorbance was
read at 492 nm in a Synergy 2 microplate reader (Biotek).
Animals and ethics statement
For the in vitro experiments we used 10–12 week-old female BALB/c mice bred and
maintained at IBMC - Instituto de Biologia Molecular e Celular (Portugal) animal facilities.
For the in vivo experiments 7–8 week-old male BALB/c mice were bred and maintained at
the Instituto de Salud Carlos III (Spain) animal facilities. Mice were housed in IVC cabinets
with sterile food and water ad libitum. All experiments conducted were carried out in
accordance with the IBMC.INEB and ISCIII Animal Ethics Committees and the
Portuguese and Spanish National Authorities for Animal Health guidelines that follow the
statements on the directive 2010/63/EU of the European Parliament and of the Council.
RESULTS - SECTION 2
74
JC and ACS have an accreditation for animal research given from Portuguese Veterinary
Direction (Ministerial Directive 1005/92).
Statistical analysis
GraphPad Prism 5 (GraphPad Software) was used to perform all the statistical analysis.
The results are presented as means ± standard deviations (SD). To compare statistical
differences between means two-sided t test or one-way ANOVA followed by Dunnett’s
multiple comparison test were run when comparing 2 or more groups, respectively, unless
otherwise stated. * p < 0.05, ** p < 0.01 and *** p < 0.001.
RESULTS - SECTION 2
75
RESULTS AND DISCUSSION
Molecular characterization of the clinical isolates of L. infantum
To understand the intraspecies polymorphisms and its possible impact on both in vitro and
in vivo infectivity, we characterized certain molecular aspects of these four L. infantum
strains.
A molecular approach was followed by us aiming not only to confirm the identity [19] of
Bibiano, E390M and HL strains, together with the laboratory’s standard L. infantum (ST)
strain, but also to subtype the isolates according to Haralambous et al. [21] and Kuhls et
al. [20]. Molecular genotyping of the strains indicated that all four were 100% consistent
with L. infantum and were clustered in the same ITS type A group (data not shown), which
is the most common in specimens from the Mediterranean area even within different
zymodemes [20]. Moreover, Bibiano, HL and ST were classified in the k26 group 1b, the
most frequent in the Iberian Peninsula [21], while E390M belongs to a new k26 group
reported here for the first time, since it returned an 836 bp amplicon [GenBank:
KC576808] never found before (Figure 1A and Additional figure 2).
Figure 1. Molecular characterization of L. infantum isolates
(A) Amplification of the k26 gene. See additional figure 2 for coding DNA sequences and alignment. (B) RFLP
patterns for L. infantum isolates after HaeIII digestion of an amplified fragment of the minicircles kDNA.
Profiles for DNA extracted from axenic promastigotes are shown, though DNA from experimentally infected
murine tissues delivered comparable restriction patterns. For each strain, left lane corresponds to the digested
DNA and right lane to undigested product. Gels were prepared with 2% (A) or 2.5% (B) agarose and stained
with ethidium bromide. MW - molecular weight marker with bp units assigned in the left of the figure.
RESULTS - SECTION 2
76
PCR-RFLP of kinetoplast DNA minicircles was used as a tool for creating an individual
identity for each strain. Because we were working with L. infantum strains that preferably
could have similar growth and morphology, they would be indistinguishable in in vitro
cultures. In case of cross-contaminations between strains [29,30], we would like to have a
tool for identification of our parasites. All the strains showed very complex profiles (Figure
1B), but each one of the specimens was clearly identifiable by the examination of the most
intense bands.
Characterization of biological features of the promastigotes generated in vitro
In vitro cultivation has a major impact on the virulence of the pathogens due to intrinsic
properties of the culture media that modulate Leishmania infectivity (Santarém, N. and
Cunha, J., submitted results and [8,31]), or to the loss of adaptive capacities to
mammalian host cells resulting from long-term in vitro cultivation of promastigotes. A
relevant experimental bias can be introduced if these factors are not considered. Hence,
the comparison of the infective capacity of distinct strains should take into account the
adaptation to culture conditions and/or the axenic growth behavior [7,32].
We started to characterize the axenic growth of the four L. infantum strains. Aiming to
identify any difference in their infectivity that could justify the dissimilar outcomes of the
disease in the natural infections, we first had to understand what specific nutritional needs
the parasites might have in order to standardize the in vitro culture conditions. Preliminary
experiments with parasites cultivated in RPMI medium exposed remarkable differences
among the growth of each L. infantum strain (data not shown). Attempts to find a culture
medium suitable for the continuous and comparable growth of the four strains included
doubling the FBS content to 20% and adding glucose to RPMI medium, the use of
Schneider’s Insect medium and the preparation of a mixture of RPMI and Schneider
media in equal parts (data not shown; the composition of these culture media is detailed in
Additional file 1: Additional Methods). However, only the use of Novy-MacNeal-Nicolle
medium (NNN) allowed us to guarantee an in vitro homogeneous culture condition where
all four strains could be easily cultivated, maintained and have a similar development that
would allow the direct comparison of strain infectivity. Bibiano, E390M, HL and ST strains
showed perfectly overlapped growth curves in NNN (Figure 2A), with morphologically
indistinguishable promastigotes that maintained high viability (90-95%) at least until the
fourth day of culture (Figure 2B).
RESULTS - SECTION 2
77
Figure 2. In vitro development of L. infantum strains.
(A) Growth curves of Bibiano (light grey), E390M (dark grey), HL (black) and ST (white) L. infantum strains in
NNN. Cultures were started with 106 promastigotes of each strain per mL and growth was followed for a week,
with a daily counting of parasite numbers in a Neubauer chamber. (B) Parasite viability measured by flow
cytometry as percentage of AnnV-/7AAD- cells. The mean of three independent experiments is plotted; bars
represent SD. One-way ANOVA followed by Tukey’s post-test was used to evaluate significant differences
between means of all strains in each time point. * p < 0.05, ** p < 0.01 compared to ST. (C) Cell cycle analysis
of HL during growth period. Data show means of one representative experiment of three independent assays.
(D) Illustrative phenotype of L. infantum promastigotes with 4 days of culture in NNN captured by flow
cytometry.
The culture of all promastigote strains in NNN enabled a rapid exponential parasite growth
that peaked at day 3 (≈108 parasites/mL) after which it stabilized until day 6. These
timings could be confirmed by the analysis of the cell cycle (Figure 2C and Additional
figure 3). On the first day of culture, around 50% of the parasites were in S/G2 phases in a
clear indication of active proliferation. From the third day on, only ≈ 20% of the cells were
found to be in division. Moreover, during the stationary phase promastigotes with small
bodies and large flagella could be clearly identified by optic microscopy (data not shown);
these were confirmed by flow cytometry (Figure 2D) as FSCloPI- cells [33,34]. Based on
this typical morphology of metacyclic promastigotes, we analyzed metacyclogenesis
throughout the 6 days of culture by quantifying the expression of specific genes which are
upregulated (Meta-1 and SHERP) or downregulated (histone H4) during the process
RESULTS - SECTION 2
78
[25,33,35] (Figure 3 and Additional figure 4). Despite the observed interstrain variations on
the fold modifications of each gene, all of the strains showed a dramatic decrease in
histone H4 expression consistent with the cell cycle analysis. For Bibiano, Meta-1 gene
expression significantly increased every day of culture, while for E390M the major fold
changes were detected in the SHERP gene expression. Both Meta-1 and SHERP
increased overtime for HL and ST until day 4 and after that they recovered to levels close
to those of day 1.
Figure 3. Indirect measurement of metacyclogenesis
Quantification of (A) Meta-1, (B) SHERP and (C) histone H4 transcription by RT-PCR over the time of culture
in NNN medium for the four strains. Bars represent the mean fold change relative to day 1 with SD of two
independent experiments. Statistical significant differences between day 1 and the following days were
determined with One-way ANOVA and Dunnett's multiple comparison test.
We cannot directly compare the metacyclogenesis process between the four strains, but
we must take into account the total information available to affirm that these
RESULTS - SECTION 2
79
promastigotes were differentiating into metacyclic forms. The leading factor is that the
overall analysis of the three genes studied pointed towards metacyclogenesis. This trend
could be better understood when calculating the ratio between the up and downregulated
genes (Additional figure 4), as all the strains presented an increase in the ratios over the 6
days of culture.
Evaluation of the infectivity of L. infantum isolates
To evaluate parasite infectivity, we infected macrophages and followed the progression of
the infection for four days (Figure 4).
Figure 4. In vitro differential infectivity of L. infantum strains
BMMo were infected with promastigotes of each strain after 4 days of culture in NNN in a ratio of 10:1
(parasites:macrophage). The kinetic of infection was followed counting (A) the infected cells and (B) the
number of parasites per infected cell on fluorescent microscope. To account to the overall parasite load, an
infection index (C) was calculated multiplying the individual data from (A) by (B). Statistical significant
differences between ST and the other strains were determined with One-way ANOVA followed by Tukey's
multiple comparison test.
RESULTS - SECTION 2
80
At the initial time-point, the four strains infected approximately all the cells without any
differences in the total percentage of infected macrophages (Figure 4A). However, when
evaluating the parasite load in each infected cell, HL promastigotes were more effective in
the invasion of the macrophages with a mean of 12 ± 1.5 parasites in each infected cell
versus 3 to 5 parasites found for the other strains (Figure 4B). After the first 24 hours, an
accentuated reduction in the infection index was detected for the four strains (Figure 4C),
which was maintained, though softened, during the entire period of the assay.
Nevertheless, HL parasites were more resistant to macrophage-specific killing machinery
as displayed by the increased infection index throughout the study. For this reason, this
strain was considered to be more infective than the ST virulent strain [36,37]. Interestingly,
72 and 96 hours post-infection, macrophages could harbor significantly more Bibiano than
ST parasites, though it did not translate into a higher overall parasite load as shown for HL
(Figure 4C) because of the low percentage of infected cells.
As is well known, disease manifestation depends on the virulence of Leishmania strain
[12,17] but also on the genetic background [38] and immune status of the host [14,39].
Hence, the differences in infectivity detected in vitro were explored in the BALB/c model of
visceral leishmaniasis to evaluate the influence of the parasites’ intrinsic characteristics in
the ability to cause the disease. We therefore studied parasitological and immunological
features in the acute and chronic phases of infection. Parasite load was quantified in the
spleen, liver and bone marrow as the main target organs in this model. The presence of
Leishmania in the draining lymph nodes and the blood were also investigated (Figure 5).
In the acute phase, 2 weeks after the infection, no significant differences were calculated
between the four strains in all the five tissues studied. Despite the lack of statistical
significance, important differences could be appreciated between strains. In the visceral
organs (Figures 5A and B), HL and Bibiano showed very similar parasite burden,
representing the most infective strains in these tissues. As compared to ST, they
presented over 1 logarithm higher parasite load in spleen and were ≈ 800 times higher in
the liver. ST was indeed the least efficient strain colonizing these organs, as E390M was
able to infect almost 3 and 15 times more in the spleen and liver of mice. In the inguinal
lymph nodes (Figure 5D) and the blood (Figure 5E), HL was the strain that showed higher
parasitism. Its values surmounted 14, 300 and 1100 times the burden of Bibiano, E390M
and ST, respectively, in the lymph nodes, and 3, 20 and 46 times, respectively, in the
blood. The bone marrow was more infected by ST, though without accentuated
differences between the other strains (Figure 5C). After this analysis one could expect ST
to be the least infective strain in the acute phase of the disease, once HL was the strain
that showed higher infectivity in the majority of the tissues examined, followed close by
RESULTS - SECTION 2
81
Bibiano. Nonetheless, estimating the total number of parasites existing in the whole
animal, we calculated ≈ 5 × 108 ST parasites, approximately double the number estimated
for Bibiano and HL and over a logarithm more than E390M (Table 1).
Figure 5. Quantitative distribution of L. infantum in BALB/c mice 2 and 6 weeks after infection
The parasite burden was quantified on the (A) spleen, (B) liver, (C) bone marrow, (D) lymph node and (E)
blood. Data represent means ± SD of 3-5 animals per group of a representative experiment of two
independent assays. T test was used to determine statistical significant differences between 2 and 6 weeks of
infection with each strain; * p<0.05. With one-way ANOVA followed by Tukey’s multiple comparison test we
calculated statistical significant differences between strains in each time point; # p<0.05. Dashed line indicate
limit of detection for quantification for each tissue.
In the chronic phase, 6 weeks after infection, the four strains showed relative infection
profiles in the spleen (Figure 5A), bone marrow (Figure 5C) and lymph nodes (Figure 5D)
similar to the acute phase. As before, HL was shown to be the most infective strain in
spleen and lymph nodes. In the bone marrow the differences were once more not as
accentuated between strains, although the higher parasite loads were found in HL
infected mice. In the liver (Figure 5B), HL was still the most infective strain, but Bibiano,
which in the other tissues presented comparable parasite loads, was, significantly, the
least infective strain, whereas E390M and ST produced intermediate infections. In the
blood (Figure 5E), the differences observed at 2 weeks post-infection were neutralized, as
the four strains showed similar levels of circulating parasites.
RESULTS - SECTION 2
82
Table 1 - Estimated overall parasite load of L. infantum-infected BALB/c mice 2 and 6 weeks post-
infection
Total
parasite load
2 weeks post-infection 6 weeks post-infection
Bibiano E390M HL ST Bibiano E390M HL ST
Spleen 67.7x104 8.82x104 44.1x104 3.81x104 62.7x104 0.40x104 329x104 18.9x104
Liver 157x106 2.77x106 112x106 0.14x106 0.35x106 2.54x106 86.8x106 2.42x106
Bone marrow 15.0x107 4.49x107 11.9x107 50.9x107 13.9x107 2.29x107 18.1x107 11.7x107
Lymph nodes 4.83x104 0.19x104 67.0x104 0.10x104 1.78x104 0.015x104 10.3x104 0.59x104
Blood 0.97x103 0.42x103 19.4x103 0.32x103 6.54x103 3.12x103 1.95x103 4.53x103
Whole animal 3.08x108 0.48x108 2.32x108 5.09x108 1.40x108 0.25x108 2.71x108 1.19x108
Mean weights of spleen, liver and inguinal lymph nodes of the infected animals (Additional figure 5) were used
in these calculations. Values for total volume of blood (1.8 mL) and total number of bone marrow cells (4.5 ×
108) were estimated as published elsewhere [40,41].
Distribution and compartmentalization throughout the infection
Evaluating the progression of the disease, these four strains depicted very different
trends. In the acute phase of infection, Bibiano and HL were found in very high numbers in
the visceral organs but evolved in the opposite directions with chronicity. Bibiano was
efficiently cleared from the liver, with a 425-fold reduction, though in the spleen the
parasite load did not alter. As to HL, the liver infection was maintained and the splenic
parasite burden increased 5 times from 2 to 6 weeks after infection, which showed not
only high capacity to infect but also to perpetuate in the host. E390M, on the contrary,
showed a low infective phenotype, with the lowest parasite loads in all the tissues
quantified in the acute phase of infection. Through time, this strain was not able to
proliferate in the spleen or in the bone marrow; the parasites resisted in the liver and
showed a 7.4-fold increase in the blood. Despite with disparate initial parasite loads (more
than 6-fold difference), Bibiano and E390M, both isolated from HIV+ patients, followed a
very similar trajectory in the progression of the disease and, eventually, would be
eliminated over time in these immunocompetent BALB/c mice. The high parasitemia
presented by these two strains in the chronic phase may facilitate the anthroponotic
transmission of Leishmania between the intravenous drug users (IVDUs) [42], one of the
populations with highest risk of HIV/Leishmania coinfection [43]. Concerning ST, the
standard virulent strain in our laboratory, showed a clear tropism for the bone marrow in
the acute phase, with the lowest parasite loads in the remaining organs compared to other
strains. However, 6 weeks post-infection, ST dramatically multiplied reaching levels ≈ 6-
and ≈ 17-fold higher in the spleen and liver, respectively.
RESULTS - SECTION 2
83
As a final remark, this study allowed us to verify that bone marrow parasite load is
maintained in a range that does not suffer major alterations either over-time nor is it strain-
dependent. Possibly this is the reason why bone marrow aspirates are the eligible sample
for leishmaniasis diagnosis, either for microscopic analysis, culture or molecular
techniques [4].
Infectivity relates with cell modulation
Along with the differences described in the parasite load, we analyzed the weight of
spleen and liver of the infected animals and compared them with naïve mice (Additional
figure 5A and B). In general, small fluctuations were detected in the weight of the organs,
which followed the trends exposed above for the parasite loads. Indeed, HL infected mice
presented hepatosplenomegaly in the chronic phase of the disease, the pathologic
hallmark of visceral leishmaniasis (reviewed in [44]). We attributed the splenomegaly not
only to the presence of elevated numbers of Leishmania but also to the expansion of the
main cellular populations detected in the spleen (Figure 6). A significant increase in both
CD4+ and CD8+ T cells, B cells and macrophages was quantified in mice infected for 6
weeks with HL, an increment that corresponded to double the numbers found in the naïve
mice. While the expansion of lymphocyte populations are classically linked to cellular and
humoral immune responses, the presence and increase of CD11b+Ly6C+ monocytes were
recently described to play a major role in the architectural remodeling of the spleen during
experimental visceral leishmaniasis, mainly in the vascularization of the red pulp that
accompanies splenomegaly [45].
The enlargement in the B cell population explains the elevated titers of anti-Leishmania
antibodies quantified in the chronic infection by HL (Figure 7). Both IgG2a and IgG1 were
generated in high levels, leading to the exacerbation of the pathology, as described by
others [46-48]. However, in E390M infections we did not detect any B cell expansion, as
measured at 2 weeks post infection and later at 6 weeks, though IgG2a and IgG1 were
significantly increased compared to age-matched naïve mice. We speculate that this
antibody production could be in part related to the k26 gene. Leishmania k26 (also known
as HASPB) protein, as well as SHERP that share the same locus on chromosome 23 [49],
are stage-regulated proteins, expressed only in the mammalian host infective forms
(metacyclic promastigotes and amastigotes) [50]. k26 has a central core composed of a
10–11 amino acid repeats (PKEDGHTQKND/PKEDGRTQKN in Additional figure 2) which
present high inter and intra-specific variability [49,51,52], a feature that makes it an
interesting tool for molecular typing of different Leishmania species and strains [21].
RESULTS - SECTION 2
84
Figure 6. Cell populations in spleens of naive and Leishmania-infected mice in
the acute and chronic phases
(A), (F) Total cells were counted and stained for identification of major splenic populations by flow cytometry.
(B), (G) CD4+ T cells. (C), (H) CD8+ T cells. (D), (I) B cells. (E), (J) Monocytes/macrophages. (A)-(E) Absolute
number of cells per spleen. Data represent means ± SD of 3 to 5 animals per group of one experiment
representative of two. (F)-(J) Fold modification of cell numbers in the infected mice in relation to naïve. Boxes
and whiskers with 5-95 percentile and mean (showed by “+”) of 3 to 5 animals. Dashed and solid lines indicate
a 2- or 4-fold modification, respectively, relative to naïve mice. One-way ANOVA followed by Dunnett's
multiple comparison test was performed to calculate statistical significant differences between naive and
infected mice at 2 and 6 weeks after infection.
RESULTS - SECTION 2
85
Other than this, k26 is a highly immunogenic antigen [49] with proven efficacy as a
vaccine in murine models of visceral leishmaniasis by L. donovani [51,53] and partial
efficacy in canine leishmaniasis by L. infantum [54]. Its immunogenic properties make k26
an interesting antigen that has been studied for diagnostic purposes [55-57]. As we
reported in this work, E390M k26 protein has more repeats than MON-1 strains, which
may influence the type and the strength of the humoral response as those amino acid
repeats were determined to be B cell epitopes [52]. We point towards this argument since
Bibiano and ST strains, that proved to be more infective than E390M, were not able to
produce specific antibodies nor increased splenic cellularity in the acute or the chronic
phases of murine VL.
Figure 7. Leishmania-specific humoral response
Leishmania-specific sera reactivity of naive and infected animals 2 and 6 weeks post-infection was
analyzed by ELISA. Specific (A) IgG2a and (B) IgG1 were quantified and are depicted as means ±
SD of one representative experiment of 2 independents. Statistical significant differences are
pointed out as given by one-way ANOVA followed by Dunnett’s multiple comparison test.
RESULTS - SECTION 2
86
CONCLUSIONS
The molecular typing strategy confirmed the previous zymodeme characterization by
MLEE and provided further knowledge that can be applied to diagnostics and population
genetics studies. In this sense, the k26 sequence for E390M strain generated in this work
adds information for a zymodeme (MON-284) not included in the study by Harambolous
[21], thus contributing to k26 gene-based typing methodology, which is being used
increasingly in population genetics and molecular epidemiology studies related to the L.
donovani complex [58,59]. Laboratory conditions for in vitro culture were set to produce
Bibiano, E390M, HL and ST fit promastigotes in the same developmental stage. In vivo
infections with HL confirmed the in vitro phenotype of the most infective strain as more
parasites were estimated to be present in the whole animal. ST was also considered to be
highly infective though with a slower progression over time. Bibiano and E390M, isolated
from HIV+ patients, showed differential infectivity and immunomodulation that could be
influenced by the initial compartmentalization in host tissues. Interestingly, the most (HL)
and the least (E390M) infective strains were the most immunogenic, revealing high levels
of anti-Leishmania IgG2a and IgG1, especially in the chronic phase of infection.
This work is in line with previous studies [6,7,17,60] that show that leishmaniasis is a
multifactorial disease and the broad spectrum of clinical manifestations depends on the
genetics and inherent characteristics of the parasite coordinated with the susceptibility of
the host.
COMPETING INTERESTS
The authors declare no competing interest.
AUTHOR’S CONTRIBUTIONS
JC designed and performed all the experiments, analyzed data and wrote the manuscript.
EC participated in some of the in vivo experiments, gave valuable input concerning qPCR
for evaluation of the parasite load and helped to draft the manuscript. CS participated in
the in vivo experiments, especially in collecting animal organs, and performed DNA
extractions and qPCRs. IC carried out the molecular typing. JM and ACS conceived the
study, participated in its design and coordination and helped to draft the manuscript. All
authors read, discussed and approved the final manuscript.
RESULTS - SECTION 2
87
ACKNOWLEDGMENTS
We thank Doctor Maria da Luz Duarte from São Marcos Hospital, Braga, Portugal, for
kindly provide us with the skin sample infected with HL strain of L. infantum and Joana
Tavares from Parasite Disease Group, IBMC, Porto, Portugal, for its isolation and
preparation of stocks. We thank Carmen Chicharro from WHO Collaborating Center for
Leishmaniasis, National Center of Microbiology, Institute of Health Carlos III, Spain, for
analyzing HL strain’s zymodeme. We thank Ricardo Silvestre and Mariana Resende from
Parasite Disease Group, IBMC, Porto, Portugal, for the help in animal experiments and
flow cytometry analysis.
This work was funded by FEDER funds through the Operational Competitiveness
Programme – COMPETE and by National Funds through FCT – Fundação para a Ciência
e a Tecnologia under the project FCOMP-01- 0124-FEDER-019648 (PTDC/BIA-
MIC/118644/2010) and FCOMP-01-0124- FEDER-011054 (PTDC/SAU-FCF/100749/2008
and MICINN project number PIM2010‐ENI00627. JC was supported by fellowship from
FCT code SFRH/BD/48626/2008 and CS by Contratos de Técnicos de apoyo a la
investigación en el SNS code AES‐FIS‐2011.
RESULTS - SECTION 2
88
SUPPLEMENTAL DATA
Additional methods
Culture media referenced in unpublished data
RPMI 20% FBS + glucose medium was produced by enrichment of supplemented RPMI
with an extra 10% of FBS and 2.5 mg/mL of glucose (Sigma-Aldrich). Schneider is
composed of Schneider’s Insect Medium (Sigma-Aldrich) supplemented with 10% FBS,
200 units/mL penicillin, 200 units/mL streptomycin, 5 mM Hepes Buffer, 2.5 g/mL Phenol
Red (Sigma-Aldrich). A mixture of Schneider and RPMI in equal parts (50% SchRPMI)
was also used. Promastigotes were cultivated at 26 ºC with an initial inoculum of 106
parasites /mL (or 105 parasites/mL in Schneider) from a synchronized culture in the same
media and followed for 6 days.
Parasite load quantification by limiting dilution
Spleen and liver of each animal were collected and homogenized into cell suspensions in
50% SchRPMI medium. A fraction of the total organ was plated in a 96-well plate and
submitted to 2-fold serial dilutions in the same culture medium. After 2 weeks of
incubation at 26 ºC, the quantification of the parasite load was carried out as described in
[18] by the integration of the dilution factor of the last well where at least one parasite was
detected with the initial amount of organ plated on the first well and its total weight.
RESULTS - SECTION 2
89
Additional figure 1. Validation of the qPCR methodology for quantification of the
parasite loads in murine tissues.
BALB/c mice were infected for 2 weeks with 108 L. infantum strains (3 mice for each strain) cultivated in an
equivolumetric mixture of RPMI and Schneider for 5 days. (A) Spleen and (B) liver were collected and cell
suspensions were prepared. Parasite loads were quantified by qPCR and compared with the values obtained
by limiting dilution assay.
RESULTS - SECTION 2
90
Additional figure 2. k26 gene alignment
Coding DNA sequences (cds) were translated into aminoacids and aligned with standard sequences
generated by Haralambous et al [22] [GenBank: EF504255 and EF504256]. Complete cds of k26 gene
[GenBank: XM_001465758.2] is aligned in the first row. The four L. infantum isolates are aligned in the bottom
rows. E390M k26 sequence was entered in the GenBank with the access number KC576808.
RESULTS - SECTION 2
91
Additional figure 3. Cell cycle analysis
(A) Representative histograms of PI content in day 1 and 6 of promastigotes culture. (B) Bibiano.
(C) E390M. (D) ST. The percentage of parasites in G1, S or G2 phases of the cell cycle was
determined at days 1 to 6 of culture in NNN medium by flow cytometry after staining the
promastigotes with a PI solution. Three independent experiments were performed, one
representative experiment is shown.
RESULTS - SECTION 2
92
Additional figure 4. Variation of the transcription of metacyclogenesis-dependent genes
Meta-1, SHERP and histone H4 transcription was quantified by RT-PCR over the time of culture in
NNN medium. To evaluate the progression of metacyclogenesis we related the up-regulation of (A)
Meta-1 and (B) SHERP with the down-regulation of histone H4 applying a mathematical ratio. Bars
represent the mean fold change relative to day 1 with SD of two independent experiments.
Statistical significant differences between day 1 and the following days were determined with One-
way ANOVA and Dunnett's multiple comparison test.
________________________________________________________________________
Additional figure 5. Organ weight 2 and 6 weeks post-infection
Mice were sacrificed and (A) spleen, (B) liver and (C) inguinal lymph nodes were collected and weighted. Data
represent means ± SD of 3-5 animals of one experiment representative of two. One-way ANOVA followed by
Dunnett’s multiple comparison test were run for statistical analysis between groups in each time point.
RESULTS - SECTION 2
93
REFERENCES
1. Chappuis F, Sundar S, Hailu A, Ghalib H, Rijal S, Peeling RW, Alvar J, Boelaert M: Visceral
leishmaniasis: what are the needs for diagnosis, treatment and control? Nature reviews
Microbiology 2007, 5(11):873–882.
2. van Griensven J, Diro E: Visceral leishmaniasis. Infectious disease clinics of North America 2012,
26(2):309–322.
3. Goto H, Lauletta Lindoso JA: Cutaneous and mucocutaneous leishmaniasis. Infectious disease
clinics of North America 2012, 26(2):293–307.
4. Alvar J, Aparicio P, Aseffa A, Den Boer M, Canavate C, Dedet JP, Gradoni L, Ter Horst R, Lopez-Velez
R, Moreno J: The relationship between leishmaniasis and AIDS: the second 10 years. Clinical
microbiology reviews 2008, 21(2):334–359. table of contents.
5. WHO: Control of the leishmaniasis: report of a meeting of the WHO Expert Committee on the
Control of Leishmaniases, Geneva, 22–26 March 2010. WHO technical report series 2010(949):xii–
xiii. 1–186, back cover.
6. Maia C, Seblova V, Sadlova J, Votypka J, Volf P: Experimental transmission of Leishmania infantum
by two major vectors: a comparison between a viscerotropic and a dermotropic strain. PLOS
neglected tropical diseases 2011, 5(6):e1181.
7. Baptista-Fernandes T, Marques C, Roos Rodrigues O, Santos-Gomes GM: Intra-specific variability of
virulence in Leishmania infantum zymodeme MON-1 strains. Comparative immunology, microbiology
and infectious diseases 2007, 30(1):41–53.
8. Dey T, Afrin F, Anam K, Ali N: Infectivity and virulence of Leishmania donovani promastigotes: a
role for media, source, and strain of parasite. The jornal of eukaryotic microbiology 2002, 49(4):270–
274.
9. Moreira D, Santarem N, Loureiro I, Tavares J, Silva AM, Amorim AM, Ouaissi A, Cordeiro-da-Silva A,
Silvestre R: Impact of continuous axenic cultivation in Leishmania infantum virulence. PLOS
neglected tropical diseases 2012, 6(1):e1469.
10. Gradoni L, Gramiccia M: Leishmania infantum tropism: strain genotype or host immune status?
Parasitology today 1994, 10(7):264–267.
11. Laskay T, Diefenbach A, Rollinghoff M, Solbach W: Early parasite containment is decisive for
resistance to Leishmania major infection. European jounal of immunology 1995, 25(8):2220–2227.
12. Gangneux JP, Sulahian A, Honore S, Meneceur P, Derouin F, Garin YJ: Evidence for determining
parasitic factors in addition to host genetics and immune status in the outcome of murine
Leishmania infantum visceral leishmaniasis. Parasite immunology 2000, 22(10):515–519.
13. Chicharro C, Jimenez MI, Alvar J: Iso-enzymatic variability of Leishmania infantum in Spain. Annals
of tropical medicine and parasitology 2003, 97(Suppl 1):57–64.
14. Rivas L, Moreno J, Canavate C, Alvar J: Virulence and disease in leishmaniasis: what is relevant for
the patient? Trends in parasitology 2004, 20(7):297–301.
RESULTS - SECTION 2
94
15. Pratlong F, Dereure J, Deniau M, Marty P, Faraut-Gambarelli F, Dedet JP: Enzymatic polymorphism
during Leishmania/HIV co-infection: a study of 381 Leishmania strains received between 1986
and 2000 at the international cryobank in Montpellier, France. Annals of tropical medicine and
parasitology 2003, 97(Suppl 1):47–56.
16. Gramiccia M, Gradoni L, Troiani M: HIV-Leishmania co-infections in Italy. Isoenzyme
characterization of Leishmania causing visceral leishmaniasis in HIV patients. Transactions of the
Royal Society of Tropical Medicine and Hygiene 1992, 86(2):161–163.
17. Sulahian A, Garin YJ, Pratlong F, Dedet JP, Derouin F: Experimental pathogenicity of viscerotropic
and dermotropic isolates of Leishmania infantum from immunocompromised and
immunocompetent patients in a murine model. FEMS immunology and medical microbiology 1997,
17(3):131–138.
18. Silvestre R, Cordeiro-Da-Silva A, Santarem N, Vergnes B, Sereno D, Ouaissi A: SIR2-deficient
Leishmania infantum induces a defined IFN-gamma/IL-10 pattern that correlates with protection.
Journal of immunology 2007, 179(5):3161–3170.
19. Fraga J, Montalvo AM, De Doncker S, Dujardin JC, Van der Auwera G: Phylogeny of Leishmania
species based on the heat-shock protein 70 gene. Infection, genetics and evolution: journal of
molecular epidemiology and evolutionary genetics in infectious diseases 2010, 10(2):238–245.
20. Kuhls K, Mauricio IL, Pratlong F, Presber W, Schonian G: Analysis of ribosomal DNA internal
transcribed spacer sequences of the Leishmania donovani complex. Microbes and infections /
Institute Pasteurs 2005, 7(11–12):1224–1234.
21. Haralambous C, Antoniou M, Pratlong F, Dedet JP, Soteriadou K: Development of a molecular assay
specific for the Leishmania donovani complex that discriminates L. donovani/Leishmania
infantum zymodemes: a useful tool for typing MON-1. Diagnostic microbiology and infectious disease
2008, 60(1):33–42.
22. Hall TA: BioEdit: a user-friendly biological sequence alignment editor and analysis program for
Windows 95/98/NT. Nucleic Acids Symp Ser 1999, 41:95–98.
23. Inocencio da Luz R, Romero GA, Dorval ME, Cruz I, Canavate C, Dujardin JC, Van Assche T, Cos P,
Maes L: Drug susceptibility of Leishmania infantum (syn. Leishmania chagasi) isolates from
Brazilian HIV-positive and HIV-negative patients. The Journal of antimicrobial chemotherapy 2011,
66(3):677–679.
24. Adaui V, Schnorbusch K, Zimic M, Gutierrez A, Decuypere S, Vanaerschot M, De Doncker S, Maes I,
Llanos-Cuentas A, Chappuis F, et al: Comparison of gene expression patterns among Leishmania
braziliensis clinical isolates showing a different in vitro susceptibility to pentavalent antimony.
Parasitology 2011, 138(2):183–193.
25. Ouakad M, Bahi-Jaber N, Chenik M, Dellagi K, Louzir H: Selection of endogenous reference genes
for gene expression analysis in Leishmania major developmental stages. Parasitology research
2007, 101(2):473–477.
26. van Eys GJ, Schoone GJ, Kroon NC, Ebeling SB: Sequence analysis of small subunit ribosomal
RNA genes and its use for detection and identification of Leishmania parasites. Molecular and
biochemical parasitology 1992, 51(1):133–142.
RESULTS - SECTION 2
95
27. Miro G, Oliva G, Cruz I, Canavate C, Mortarino M, Vischer C, Bianciardi P: Multicentric, controlled
clinical study to evaluate effectiveness and safety of miltefosine and allopurinol for canine
leishmaniosis. Veterinary dermatology 2009, 20(5–6):397–404.
28. Cruz I, Chicharro C, Nieto J, Bailo B, Canavate C, Figueras MC, Alvar J: Comparison of new
diagnostic tools for management of pediatric Mediterranean visceral leishmaniasis. Journal of
clinical microbiology 2006, 44(7):2343–2347.
29. Mahmoudzadeh-Niknam H, Abrishami F, Doroudian M, Moradi M, Alimohammadian M, Parvizi P, Hatam
G, Mohebali M, Khalaj V: The Problem of Mixing up of Leishmania Isolates in the Laboratory:
Suggestion of ITS1 Gene Sequencing for Verification of Species. Iranian journal of parasitology
2011, 6(1):41–48.
30. Simpson L, Holz G Jr: The status of Leishmania tarentolae/Trypanosoma platydactyli. Parasitology
today 1988, 4(4):115–118.
31. Neal RA: Leishmania major: culture media, mouse strains, and promastigote virulence and
infectivity. Experimental parasitology 1984, 57(3):269–273.
32. Kebaier C, Louzir H, Chenik M, Ben Salah A, Dellagi K: Heterogeneity of wild Leishmania major
isolates in experimental murine pathogenicity and specific immune response. Infection and
immunity 2001, 69(8):4906–4915.
33. Santos MG, Silva MF, Zampieri RA, Lafraia RM, Floeter-Winter LM: Correlation of meta 1 expression
with culture stage, cell morphology and infectivity in Leishmania (Leishmania) amazonensis
promastigotes. Memorias do Instituto Oswaldo Cruz 2011, 106(2):190–193.
34. Saraiva EM, Pinto-da-Silva LH, Wanderley JL, Bonomo AC, Barcinski MA, Moreira ME: Flow cytometric
assessment of Leishmania spp metacyclic differentiation: validation by morphological features
and specific markers. Experimental parasitology 2005, 110(1):39–47.
35. Soto M, Quijada L, Alonso C, Requena JM: Molecular cloning and analysis of expression of the
Leishmania infantum histone H4 genes. Molecular and biochemical parasitology 1997, 90(2):439–
447.
36. Cortez M, Huynh C, Fernandes MC, Kennedy KA, Aderem A, Andrews NW: Leishmania promotes its
own virulence by inducing expression of the host immune inhibitory ligand CD200. Cell host &
microbe 2011, 9(6):463–471.
37. Gomes IN, Calabrich AF, Tavares Rda S, Wietzerbin J, de Freitas LA, Veras PS: Differential properties
of CBA/J mononuclear phagocytes recovered from an inflammatory site and probed with two
different species of Leishmania. Microbes and infection / Institut Pasteur 2003, 5(4):251–260.
38. Wilson ME, Jeronimo SM, Pearson RD: Immunopathogenesis of infection with the visceralizing
Leishmania species. Microbial pathogenesis 2005, 38(4):147–160.
39. Sacks D, Noben-Trauth N: The immunology of susceptibility and resistance to Leishmania major in
mice. Nature reviews immunology 2002, 2(11):845–858.
40. Colvin GA, Lambert JF, Abedi M, Hsieh CC, Carlson JE, Stewart FM, Quesenberry PJ: Murine marrow
cellularity and the concept of stem cell competition: geographic and quantitative determinants in
stem cell biology. Leukemia 2004, 18(3):575–583.
RESULTS - SECTION 2
96
41. Diehl KH, Hull R, Morton D, Pfister R, Rabemampianina Y, Smith D, Vidal JM, van de Vorstenbosch C,
European Federation of Pharmaceutical Industries A, European Centre for the Validation of Alternative
M: A good practice guide to the administration of substances and removal of blood, including
routes and volumes. J Appl Toxicol 2001, 21(1):15–23.
42. Cruz I, Morales MA, Noguer I, Rodriguez A, Alvar J: Leishmania in discarded syringes from
intravenous drug users. Lancet 2002, 359(9312):1124–1125.
43. Cruz I, Nieto J, Moreno J, Canavate C, Desjeux P, Alvar J: Leishmania/HIV co-infections in the
second decade. The Indian journal of medical research 2006, 123(3):357–388.
44. Stanley AC, Engwerda CR: Balancing immunity and pathology in visceral leishmaniasis.
Immunology and cell biology 2007, 85(2):138–147.
45. Yurdakul P, Dalton J, Beattie L, Brown N, Erguven S, Maroof A, Kaye PM: Compartment-specific
remodeling of splenic micro-architecture during experimental visceral leishmaniasis. The
American journal of pathology 2011, 179(1):23–29.
46. Oliveira DM, Costa MA, Chavez-Fumagalli MA, Valadares DG, Duarte MC, Costa LE, Martins VT,
Gomes RF, Melo MN, Soto M, et al: Evaluation of parasitological and immunological parameters of
Leishmania chagasi infection in BALB/c mice using different doses and routes of inoculation of
parasites. Parasitology research 2012, 110(3):1277–1285.
47. Deak E, Jayakumar A, Cho KW, Goldsmith-Pestana K, Dondji B, Lambris JD, McMahon-Pratt D: Murine
visceral leishmaniasis: IgM and polyclonal B-cell activation lead to disease exacerbation.
European journal of immunology 2010, 40(5):1355–1368.
48. Kaur S, Kaur T, Garg N, Mukherjee S, Raina P, Athokpam V: Effect of dose and route of inoculation
on the generation of CD4+ Th1/Th2 type of immune response in murine visceral leishmaniasis.
Parasitology research 2008, 103(6):1413–1419.
49. Depledge DP, MacLean LM, Hodgkinson MR, Smith BA, Jackson AP, Ma S, Uliana SR, Smith DF:
Leishmania-specific surface antigens show sub-genus sequence variation and immune
recognition. PLOS neglected tropical diseases 2010, 4(9):e829.
50. Sadlova J, Price HP, Smith BA, Votypka J, Volf P, Smith DF: The stage-regulated HASPB and SHERP
proteins are essential for differentiation of the protozoan parasite Leishmania major in its sand
fly vector, Phlebotomus papatasi. Cellular microbiology 2010, 12(12):1765–1779.
51. Maroof A, Brown N, Smith B, Hodgkinson MR, Maxwell A, Losch FO, Fritz U, Walden P, Lacey CN,
Smith DF, et al: Therapeutic vaccination with recombinant adenovirus reduces splenic parasite
burden in experimental visceral leishmaniasis. The journal of infectious diseases 2012, 205(5):853–
863.
52. Zackay A, Nasereddin A, Takele Y, Tadesse D, Hailu W, Hurissa Z, Yifru S, Weldegebreal T, Diro E,
Kassahun A, et al: Polymorphism in the HASPB Repeat Region of East African Leishmania
donovani Strains. PLOS neglected tropical diseases 2013, 7(1):e2031.
53. Stager S, Smith DF, Kaye PM: Immunization with a recombinant stage-regulated surface protein
from Leishmania donovani induces protection against visceral leishmaniasis. Journal of
immunology 2000, 165(12):7064–7071.
RESULTS - SECTION 2
97
54. Moreno J, Nieto J, Masina S, Canavate C, Cruz I, Chicharro C, Carrillo E, Napp S, Reymond C, Kaye
PM, et al: Immunization with H1, HASPB1 and MML Leishmania proteins in a vaccine trial against
experimental canine leishmaniasis. Vaccine 2007, 25(29):5290–5300.
55. Farajnia S, Darbani B, Babaei H, Alimohammadian MH, Mahboudi F, Gavgani AM: Development and
evaluation of Leishmania infantum rK26 ELISA for serodiagnosis of visceral leishmaniasis in
Iran. Parasitology 2008, 135(9):1035–1041.
56. Sundar S, Singh RK, Bimal SK, Gidwani K, Mishra A, Maurya R, Singh SK, Manandhar KD, Boelaert M,
Rai M: Comparative evaluation of parasitology and serological tests in the diagnosis of visceral
leishmaniasis in India: a phase III diagnostic accuracy study. Tropical medicine & international
health: TM & IH 2007, 12(2):284–289.
57. da Costa RT, Franca JC, Mayrink W, Nascimento E, Genaro O, Campos-Neto A: Standardization of a
rapid immunochromatographic test with the recombinant antigens K39 and K26 for the diagnosis
of canine visceral leishmaniasis. Transactions of the Royal Society of Tropical Medicine and Hygiene
2003, 97(6):678–682.
58. Bhattarai NR, Dujardin JC, Rijal S, De Doncker S, Boelaert M, Van der Auwera G: Development and
evaluation of different PCR-based typing methods for discrimination of Leishmania donovani
isolates from Nepal. Parasitology 2010, 137(6):947–957.
59. Gouzelou E, Haralambous C, Amro A, Mentis A, Pratlong F, Dedet JP, Votypka J, Volf P, Toz SO, Kuhls
K, et al: Multilocus microsatellite typing (MLMT) of strains from Turkey and Cyprus reveals a
novel monophyletic L. donovani sensu lato group. PLOS neglected tropical diseases 2012,
6(2):e1507.
60. Wege AK, Florian C, Ernst W, Zimara N, Schleicher U, Hanses F, Schmid M, Ritter U: Leishmania
major infection in humanized mice induces systemic infection and provokes a nonprotective
human immune response. PLOS neglected tropical diseases 2012, 6(7):e1741.
RESULTS - SECTION 2
98
RELATED UNPUBLISHED DATA
With the RFLP paterns generated within this work, we were able to detected concomitant
presence of two L. infantum strains, wether by artificially mixing their individual DNA or by
infecting mice with live promastigotes (for instance in re-infection studies).
Figure VI. RFLP patterns of mixed infections
RFLP patterns representative of mixed infections with E390M and ST (A) or HL and ST strains (B) created
artificially by the mixture in different ratios (100/0; 87.5/12.5; 75/25; 50/50; 25/75; 12.5/87.5; 0/100) of DNA
isolated from infected spleens. (C) Example of mixed infections in the liver of 3 animals infected with HL and
re-infected with ST. In lanes 1 and 2 both patterns can be identified simultaneously, while in lane 3 only ST
pattern was generated. For details on the materials and methods go to Materials and Methods of the section
two of the Results. MW - Molecular weight.
RESULTS - SECTION 3
99
SECTION 3
Highly infective Leishmania infantum strain induces strong central and effector
memory CD4+ and CD8+ immunity required for partial protection against re-infection
Unpublished results
Main findings
The nature of a primary infection resulted in a major influence on the concomitant
protection following a second challenge, as partial protection was only found when the
imprinting was made with the L. infantum highly infective strain. The protection associated
to this strain relied on its ability to induce an effective cellular response after infection that
is recalled through the expansion of effector memory CD4+ and CD8+ T cells and the
production of CD4+IFNγ+IL-10+ and CD8+IFNγ+TNFα+.
RESULTS - SECTION 3
101
Highly infective Leishmania infantum strain induces strong central and effector
memory CD4+ and CD8+ immunity required for partial protection against re-infection
Joana Cunha1,2, Eugenia Carrillo3, Carmen Sánchez3, Ricardo Silvestre1, Mariana
Resende1, Javier Moreno3 and Anabela Cordeiro-da-Silva1,4,*
1 Parasite Disease Group, IBMC - Instituto de Biologia Molecular e Celular, Universidade
do Porto, Portugal 2 Instituto de Ciências Biomédicas Abel Salazar and Faculdade de Medicina,
Universidade do Porto, Portugal 3 WHO Collaborating Center for Leishmaniasis, Centro Nacional de Microbiologia, Instituto
de Salud Carlos III, Spain 4 Laboratório de Microbiologia, Departamento de Ciências Biológicas, Faculdade de
Farmácia, Universidade do Porto, Portugal
* Corresponding author
Anabela Cordeiro da Silva, Parasite Disease Group, Unit of Infection and Immunity,
IBMC - Instituto de Biologia Molecular e Celular, Universidade do Porto, Rua do Campo
Alegre, 823, 4150-180 Porto, Portugal
Tel.: +351 226 074 949; Fax: +351 226 099 15; e-mail: [email protected]
Keywords
Leishmania infantum, infection-induced immunity, memory, protection.
RESULTS - SECTION 3
102
ABSTRACT
Background: Visceral leishmaniasis (VL) is a protozoan infectious disease mainly caused
by Leishmania infantum and L. donovani spread over the tropical and subtropical regions
around the world. Progression of L. infantum infection to clinical disease comprises
multifactorial phenomena. The existence of a previous infection in the host could play an
important role in the course of a following infection due to the downregulation of the
activation signals by Leishmania parasites that otherwise would prompt an effective
immune response.
Aim: To understand the influence of two virulent L. infantum strains on the modulation of
the outcome of a de novo infection, we have studied the ability of a very infective (HL) and
an intermediate infective (ST) strains in the generation of infection-induced immunity and
its efficacy on protection from a subsequent homologous or heterologous challenge in the
murine model of VL.
Results: Partial protection was observed in liver when mice were imprinted and
challenged with HL. In addition, re-infection with ST induced significant reduction in
splenic and hepatic parasite load. However, when the imprinting was made by infection
with ST, high parasite load was found in spleen, liver and bone marrow. Evident
differences between strains were found on memory subsets, as only HL infected mice
presented elevated numbers of CD4+ and CD8+ central memory T cells. Effector memory
sub-populations were also elevated after challenge with HL. Additionally, double
producers CD4+IFNγ+IL-10+ and CD8+IFNγ+TNFα+ were detected upon challenge.
Conclusion: The protection associated with the HL high infective strain relies on its ability
to generate an effective cellular response after infection and that is recalled through
expansion of effector memory CD4+ and CD8+ T cells. The nature of a primary infection is
then a major influence on the concomitant protection following a second challenge, since
it can lead to a milder or more severe disease.
RESULTS - SECTION 3
103
BACKGROUND
Leishmaniasis are an ensemble of diseases with cutaneous, mucocutaneous, visceral and
systemic manifestations that affect many orders of mammals, the main concerning of
them being humans and dogs [1]. They are zoonotic and anthroponotic diseases
transmitted by the bite of a Leishmania sp.-infected female sand fly, endemic in the
Mediterranean Basin, Middle East, Indian sub-continent, and tropical regions from
America and Africa [2]. The most severe form, visceral leishmaniasis (VL), is classically
caused by L. infantum and L. donovani. It can manifest by hepatosplenomegaly, long-term
low-grade fever and weight loss [3], but frequently is asymptomatic, especially in endemic
areas where re-infections are recurrent [4]. The parasite species and the fitness of the
host immune system determine the type and severity of the disease [5].
Leishmania modulates the host’s immune system subverting it to silently enter into the
phagocytes, their target cells. However, pro-inflammatory cytokines, mainly IL-12,
secreted by activated non-infected dendritic cells that act on naïve CD4+ T cells can
polarize a Th1 protective response (Resende et al., submitted and [6]). IL-12-driven IFNγ
secretion by Th1 lymphocytes induces the transcription of the inducible nitric oxide
synthase (iNOS) in macrophages producing high levels of NO, a deadly weapon for the
intracellular amastigotes [7]. Another important role played by IFNγ is on the generation of
cytotoxic CD8+ T cells that are able to directly kill Leishmania-infected phagocytes [8] as
well as influencing the assembly of memory responses [9]. Nevertheless, the secretion of
IFNγ and TNFα that is needed for mounting the effective immunity is also responsible for
disease progression in combination with high levels of IL-10 and also TNFα [10].
It is well accepted that the broad clinical manifestations described in leishmaniasis are
associated with the different cytokine milieu developed in response to the infection, which
is highly dependent on the parasite itself. Accordingly, a diversity of immune responses
have been described for L. major substrains [11] and L. infantum strains from the MON-1
zymodeme [12]. These immune responses may have a pivotal importance if the host
faces a secondary de novo Leishmania infection. In fact, data from endemic countries put
on evidence the reality of resistance to reinfection in visceral leishmaniasis (VL). In one
hand, the predominance of L. infantum infections in children [13] may result from acquired
resistance to reinfection in adulthood and, on the other hand, the examples of fully
recovered patients that showed resistance to re-infection by the same parasite [14].
Some studies on re-infection with the same Leishmania species have been performed in
mice. Streit et al. described a partial level of protection against L. chagasi when mice were
first infected with a high-dose inoculum since it was able to stimulate the immune system
towards a Th1 response for counteracting a subsequent infection. On the contrary, a low-
RESULTS - SECTION 3
104
dose infection suppressed IFNγ production and elicited high levels of TGFβ. Also,
protective immunity was not achieved if an attenuated dhfr-ts knockout strain was used
instead for immunization [15]. However, Oliveira et al. published opposing results as when
they infected mice with a low dose of L. chagasi a protective immune response was
generated, while a high dose contributed to the generation of visceral disease [16].
Several Leishmania species overlap in their geographical distribution. Studies of cross-
infection, using different Leishmania species to immunize and to challenge, have also
shown discrepant results, either conferring protection (with varying degrees of success) or
exacerbating the disease [17].
The existence of infection-induced immunity is indicative of the effective generation of
memory repertoires after a Leishmania sp. infection [18]. Based on the homing
characteristics (dependent on CD62L and CCR7 surface expression), cytokine secretion
and proliferative capacity, two subsets of CD4+ and CD8+ memory cells (CD44hi) can be
defined: central memory (TCM) and effector memory (TEM) T cells. TCM (CD44hiCD62L+)
cells are predominant in secondary lymphoid organs (lymph nodes and spleen), secrete
IL-2 and proliferate extensively. Instead, TEM (CD44hiCD62L-) cells are found principally
in blood, spleen and peripheral organs, have low proliferative capacity but strong
immediate effector function by IFNγ secretion and the pre-expression of granzyme B and
perforin in cytotoxic intracellular granules (in CD8+) [19, 20].
Several studies in the vaccination field, mainly using L. major, have highlighted some
differences in the life span and kinetics of protection between TCM and TEM cells.
Though both subsets are protective, Leishmania-specific TEM cells are lost if the parasite
is eliminated, but TCM are maintained even without antigen persistence and can confer
protection against challenge [21]. Nevertheless, TEM cells mediate rapid protection
whereas TCM-derived protection has a delayed onset [21]. However few studies have
focused on the influence of these four subpopulations (CD4+ and CD8+, TCM and TEM
cells) in the scenario of an infection with live parasites and reinfection with the same or
another strain. Kedzierski et al. have described that the observed protection against a
challenge with Friedlin L. major after immunization with a live attenuated non-persistent L.
major strain was associated with increased numbers of CD44hi CD4+ and CD8+ T cells in
the draining lymph nodes after challenge rather than their memory phenotype (CD62L+ or
CD62L-) [22]. To our knowledge, there is no previous literature about the concomitant
immunity developed with live virulent L. infantum infection followed by homologous or
heterologous re-infection.
In a previous work, we have characterized the HL and ST L. infantum strains according to
their infectivity [23]. In our mouse model of VL, both strains were able to infect and prevail
in the spleen, liver, bone marrow and inguinal lymph nodes after 6 weeks of infection.
RESULTS - SECTION 3
105
However, the HL strain demonstrated to be more infective in vitro and in vivo than ST as
evaluated by parasite load quantification. Since the severity of the infection and the
progression of the disease are strongly determined by the elicited immune response, in
this work we analyzed the ability of these two virulent strains in the generation of an
effective adaptive immunity in the context of experimental chronic infection and in the
induction of a recall response after re-infection in BALB/c model.
RESULTS - SECTION 3
106
MATERIALS AND METHODS
Parasite culture
Two Leishmania infantum strains were previously characterized and used in this study. HL
(MHOM/PT/2009/LLM-1708) and ST (MHOM/MA/67/ITMAP-263) strains demonstrated to
have, respectively, high and intermediate infectivity [23]. Promastigotes were cultivated in
Novy-MacNeal-Nicolle medium prepared with a semi-solid phase made of 1.4 % agar
(Sigma-Aldrich), 0.6 % NaCl (Merck), 31 % defibrinated rabbit blood, 625 units/mL
penicillin, 625 units/mL streptomycin and RPMI 1640 medium supplemented with 10%
fetal bovine serum, 2 mM L-glutamine, 100 U/mL penicillin, 100 U/mL streptomycin and 20
mM HEPES buffer (all from Lonza) as liquid phase. Cultures were initiated with 106
promastigotes that had been previously synchronized in procyclic forms and grown for 4
days at 26 ºC. After expansion, promastigotes were recovered, washed in PBS and used
for infection. To maintain parasite virulence, no more than 10 in vitro sub-passages were
performed.
Infection of the animals and ethics statement
7-8 week-old BALB/c male mice (Harlan Laboratories, United Kingdom) were maintained
at the Instituto de Salud Carlos III (Spain) and IBMC - Instituto de Biologia Molecular e
Celular (Portugal) animal facilities. Animals were housed in IVC cabinets and fed with
sterile food and water ad libitum. All conducted experiments were done in agreement with
the ISCIII and IBMC.INEB Animal Ethics Committees and the Spanish and Portuguese
National Authorities for Animal Health guidelines, according to the statements on the
directive 2010/63/EU of the European Parliament and of the Council. JC, RS and ACS
have an accreditation for animal research given from Portuguese Veterinary Direction
(Ministerial Directive 1005/92). Mice were infected by intraperitoneal route with 108 HL or
ST promastigotes suspended in 200 μL of PBS. After 6 weeks of infection mice were
anesthetized with isoflurane and sacrificed by cervical dislocation. In the re-infection
experiments, animals were infected for 6 weeks with HL or ST strains as before and
challenged intraperitoneally with 108 promastigotes of the same or the other strain; 6
weeks after challenge they were sacrificed. Spleen, liver and femoral bone marrow were
recovered for quantification of the parasite load. Splenocytes were also used for the study
of the cellular immune response.
RESULTS - SECTION 3
107
Parasite load quantification
Spleen, liver and femoral bone marrow were collected and dissociated in single-cell
suspensions and parasite loads quantified by qPCR as described in detail elsewhere [23].
Briefly, the equivalent of 10 mg of spleen and liver and 3x106 bone marrow cells were
digested overnight at 56 ºC by 40 μg of Proteinase K (Sigma) in 400 μL of a buffer
containing 10 mM NaCl, 10 mM EDTA and 10 mM Tris-HCl with pH 8.0. DNA was
extracted by classic phenol/chloroform/isoamyl alcohol protocol, precipitated with ethanol
and dissolved in 150 μL of nuclease free water. Samples were incubated for 1h at 56 ºC
to guarantee complete solubilization of DNA prior to quantification in Nanodrop ND-1000
spectrophotometer (Thermo Scientific). Depending on the tissue, 100 - 400 ng of DNA
were used in a qPCR targeting the small subunit rRNA (SSUrRNA) with the primers R223
and R333 [24], using LightCycler FastStart DNA Master SYBR Green I kit (Roche Applied
Science) according to the manufacturer’s instructions in a LightCycler 2.0 instrument
(Roche Applied Science). Positive but unquantifiable samples were examined by melting
temperature analysis and confirmed by nested PCR with the primers R221 and R332 in
the first reaction and the same R223 and R333 in the second one [25].
Splenic cell populations
5x105 splenocytes were incubated for 20 minutes at 4 ºC with saturating concentrations of
anti-mouse monoclonal antibodies (all from Biolegend, except when noted): FITC anti-
CD8, clone 53-6.7; FITC anti-CD19, clone 6D5; PE anti-NK1.1, clone PK136 (from BD
Pharmingen); APC anti-CD11c, clone N418; PE anti-CCR2, clone 475301 (from R&D); PE
anti-CD44, clone IM7; APC anti-CD62L, clone MEL-14-H2.100 (from MACS Miltenyi);
Alexa Fluor 647 anti-Ly6G, clone 1A8; PerCp.Cy5.5 anti-Ly6C, clone HK1.4; PerCp.Cy5.5
anti-CD3, clone 17A2; APC.Cy7 anti-CD4, clone GK 1.5; PE.Cy7 anti-CD11b, clone
M1/70. After washing twice with PBS/FBS 2 %, the cells were examined by flow cytometry
in a FACSCanto (BD Bioscences). Leukocytes were gated by FSC and SSC parameters
and 50 000 cells were analyzed with FlowJo software (Tree Star).
Intracellular cytokines
1x106 splenocytes were plated on a 96-well plate and stimulated for 2 hours with 50
ng/mL phorbol 12‐myristate 13‐acetate (PMA) and 500ng/mL ionomycin. Then 10 μg/mL
Brefeldin A was added for another 2 hours. Cells were recovered and surface-stained as
mentioned before for CD4 (FITC anti-CD4, clone GK 1.5) and CD8 (PE anti-CD8, clone
53-6.7) followed by intracellular staining of IFNγ (PE.Cy 7 anti-IFNγ, clone XMG1.2), IL-10
(APC anti-IL-10, clone JES5-16E3) and TNFα (PerCP.Cy5.5 anti-TNFα, clone MP6-XT22)
(all antibodies from Biolegend). Briefly, surfaced stained cells were fixed with
RESULTS - SECTION 3
108
PBS/paraformaldehyde 2% and incubated in the permeabilization buffer (PBS/saponin
0.5%). Antibodies for intracellular cytokines were added to the cells and incubated for 30
minutes at 4 ºC. The cells were washed, first with the permeabilization buffer and then in
PBS/FBS 2 %, and analyzed in a FACS Canto. Lymphocytes were gated according to
FSC and SSC parameters and 10 000 CD4+ and CD8+ cells were acquired and evaluated
with FlowJo software for single or double production of the selected cytokines.
Statistical analysis
All the statistical analysis was done with GraphPad Prism 5 (GraphPad Software). The
results are presented as means ± standard deviations (SD). To compare statistical
differences two-tailed Mann Whitney test was performed unless otherwise stated. 1, 2 or 3
symbols indicate p<0.05, p<0.01 or p<0.001.
RESULTS - SECTION 3
109
RESULTS AND DISCUSSION
Development of protection needs highly infective Leishmania
Many efforts have been made to understand how Leishmania-specific immunity is
generated and maintained over time. Nowadays, it is of scientific consensus that early
activation of the innate immune system is essential for the production of a reliable
adaptive response that leans on CD4+ and CD8+ specific cellular immunity.
To understand the strain-specific immunomodulation mechanisms that lead to protection
to re-infection we used two strains of L. infantum, one dermotropic (HL) and the other
viscerotropic (ST), which presented differential onset and progression of visceral
leishmaniasis (VL) in mice. As previously shown [23], HL is able to colonize the spleen,
liver and bone marrow in higher extent than ST parasites 6 weeks after infection (Figure 1,
Infection bars). We hypothesized that these differences in infectivity could lead to distinct
levels of protection. Thus, we re-infected the mice with homologous or heterologous
strains.
Figure 1. Parasite load after infection and challenge with L. infantum strains
with different infectivity
Mice were infected for 6 weeks with each strain (Infection) and then re-infected independently with both
strains (Re-inf HL and Re-inf ST) for another 6 weeks. At the end of both experiments parasite load was
measured in (A) spleen, (B) liver and (C) bone marrow. Bars represent means ± SD of 5 to 9 animals of one
experiment representative of two independents. Statistical significant differences between HL and ST
infections were calculated with Mann Whitney test and are signed with +. Kruskall-Wallis test followed by
Dunn’s multiple comparison test were used to calculate differences before and after challenge and are
depicted with *. Dashed line indicates the limit of detection for quantification for each tissue.
In our model, mice that were previously imprinted with HL strain and then challenged with
the same high infective strain (Figure 1, Re-inf HL bars) were able to sustain the splenic
parasite load and to decrease in about 1 logarithm the number of parasites colonizing the
RESULTS - SECTION 3
110
liver and bone marrow. On the contrary, HL re-infection after ST imprinting led to a
significant increase of about 3 logarithmic units in all the target tissues. Concomitant
immunity was more pronounced when the animals were infected with the high infective
strain and then challenged with ST due to its lower infectivity (Figure 1, Re-inf ST bars).
As such, the infections in the spleen and liver of HL imprinted mice suffered a significant
reduction of 3 logarithms in the parasite load to levels close to the quantification limit,
and in the bone marrow parasitic presence was detected but not quantifiable. Accordingly,
ST imprinting and consecutive challenge resulted in a 10-fold increase in the splenic and
hepatic parasite burden compared to the primary infection numbers, though no changes
were noticed in the bone marrow parasite load.
Based on the data exposed above, in terms of parasitological analysis we established that
the onset of pathology (set as hepatosplenomegaly (data not shown) and high parasite
loads) by an infective L. infantum strain confers a degree of protection over a re-infection
episode which correlates with the infectivity of both the imprinting and the challenging
strains that are inoculated in the host. Similar findings were reported previously, where a
high-dose of L. chagasi promastigotes was required for the development of protection
against re-infection, whereas a low-dose immunization either had no effect or slightly
exacerbated disease [15].
Infectivity influences downstream adaptive response-triggering events
To understand the immune response behind this protective phenotype, we analyzed the
splenic populations and the T cells functionality.
We observed that infection with HL produced a significant increase in the total cellularity
and major leukocyte populations when compared to naïve animals, which was not noticed
when mice were infected with ST (Figure 2). Interestingly, when the animals were
subjected to a secondary infection by HL, regardless of the infectivity of the imprinting
strain, we detected the same increase in the number of splenocytes while after challenge
with ST there was no change in the cellularity.
Inflammatory macrophages/monocytes and neutrophils, besides its recognition as host
cells [26, 27], have been implicated in the remodeling of the spleen during splenomegaly
in leishmaniasis [28, 29], as well as in the modulation of the specific CD4+ T cells
response in late phases of infection, at least with L. major [30]. Infiltration of neutrophils
[31], dendritic cells (DCs) [32] and macrophages [33] in inflamed tissues is tightly
regulated by the CC chemokine receptor 2 (CCR2) that also participates in important
processes related to anti-Leishmania defense [32, 33].
RESULTS - SECTION 3
111
Figure 2. Splenic cellular populations after
infection and challenge with highly and low
infective L. infantum strains
After infection and consequent challenge with both
HL and ST strains, splenocytes were recovered and
surface-stained for identification of major leukocytes
populations. (A) Total cells were counted and (B)
CD4+ T cells (CD3+CD4+), (C) CD8+ T cells
(CD3+CD8+), (D) B cells (CD19+) and (E)
Macrophages (CD11b+Ly6C+) were evaluated by
flow cytometry. Cell numbers from infected mice
were normalized with respective values from age-
matched naïve mice and results are presented as
log2 (fold change relative to naïve). Dashed and solid
lines indicate 2- and 4-fold difference. Boxes and
whiskers with 5-95 percentile and mean (showed
with +) of 5 to 9 animals of one experiment
representative of two independents. Mann Whitney
test was run to calculate statistical significant
differences between mice infected with HL or ST and
results are depicted with +. Differences before and
after challenge are indicated with * and were
calculated with Kruskall-Wallis test followed by
Dunn’s multiple comparison test.
RESULTS - SECTION 3
112
As these are the first cells that need to be committed, we determined the number of
inflammatory macrophages, DCs and neutrophils by the expression of CCR2 (Figure 3).
Infection and challenge with HL led to the significant increase of these inflammatory cells
in the spleen. Similarly, infection with ST also increased significantly the inflammatory
dendritic cells and neutrophils, but only with a second wave of parasites the CCR2+
macrophages arisen in numbers significantly higher than in uninfected animals. However
this difference in the number of CCR2+ macrophages relates with the total macrophages
present in the spleen, as the relative percentages were similar between HL and ST (data
not shown). These CCR2+ macrophages exert an important role in the defense against
leishmaniasis, since it has been previously described that optimal parasite killing require
the recruitment of CCR2+ macrophages, followed by stimulation with combined MCP-1
and IFN-γ [33].
Figure 3. Expression of CCR2 on splenic macrophages,
neutrophils and dendritic cells
Number of (A) inflammatory macrophages (CD11b+Ly6C+
CCR2+), (B) inflammatory neutrophils (CD11b+Ly6G+CCR2+)
and (C) activated dendritic cells (CD11c+CCR2+) in infected
mice before (Infection bars) and after challenge (Re-inf bars)
with the strain previously used for imprinting. Bars represent
means ± SD of 5 to 9 animals of one experiment
representative of two independents. Statistical significant
differences were calculated with Mann Whitney test between
naïve and infected or challenged animals.
Thus, monocyte and neutrophil activation showed
no major differences between HL and ST strains,
similarly to the findings of Meddeb-Garnaoui et al.
that compared the cytokine profile of human
monocytes infected with dermotropic and
viscerotropic L. infantum strains that presented
respectively high and low infectivity in vitro [34].
RESULTS - SECTION 3
113
In their in vitro setup, no differences were found in the ability of those two strains in the
modulation of monocyte-secreted cytokines [34], indicating that the infectivity of a
Leishmania strain not always produces a direct effect on the innate immune response.
Nonetheless, in vivo, where other factors that influence macrophage function are present,
the effect of the infectivity was not evaluated. We hypothesize that despite monocyte and
neutrophil activation were similar, HL- and ST-activated cells should present divergent
efficiencies when triggering the adaptive immune response, which may be indicative of
intrinsic characteristics of the strains in modulating downstream events.
Highly infective L. infantum triggers memory and effector CD4+ and CD8+ T cells
We have studied the generation of CD4+ and CD8+ memory T cells 6 weeks post-infection
and upon challenge with the same strain by the surface expression of CD44 and CD62L
(Figure 4).
HL infection potentiated the expansion of central memory CD8+ (Figure 4C, TCM bars)
and especially CD4+ T cells (Figure 4A, TCM bars) that doubled in percentage compared
to uninfected mice. These memory populations are probably an important factor in the
control of the parasite load in the spleen, as presented before (Figure 1A), when the
animals were subjected to re-infection. Memory cells constitute a source of experienced-
antigen cells that are able to rapidly respond to face a similar challenge. While TEM cells
respond rapidly with protective effector functions, TCM are thought to replenish the TEM
pool [35].
In fact, after challenge with HL, both CD4+ (Figure 4B) and CD8+ (Figure 4D) TCM pools
remained high and TEM cells also significantly increased compared to naïve mice.
Moreover, taking into account that the total numbers of T lymphocytes in the infected
animals were significantly increased in relation to naïve mice (Figure 2B and C), the
number of memory (CD44hi) T cells is even more expressive in the spleens of those HL-
re-infected animals. On the contrary, ST strain showed no potential in clonal expansion of
memory populations or at least in their maintenance in high number in order to bring
advantage upon re-infection. Neither in the imprinting infection nor after challenge could
we detect CD4+ or CD8+ central or effector memory T cells in a percentage higher than
that of the naïve animals. The decrease in the CD8+ TCM cells 6 weeks after ST infection
(Figure 4C) was considered not to have any biological meaning since, when adjusted to
total number of cells, both naïve and infected mice have similar amounts of that
subpopulation.
RESULTS - SECTION 3
114
Figure 4. T cell memory repertoire
(A, B) CD4+ and (C, D) CD8+ T cells were analyzed according to their surface expression of CD44 and
CD62L. Naïve (CD44loCD62L+), central memory (TCM; CD44hiCD62L+) and effector memory (TEM;
CD44hiCD62L-) subpopulations were quantified before (A, C) and after (B, D) challenge. Bars show means ±
SD of 5 to 9 animals of one experiment representative of two independents and statistical significant
differences between naïve and infected mice are depicted with *.
From the data exposed, we justified the partial protection that a primary infection with HL
L. infantum strain can generate upon an homologous re-infection with the ability of this
strain to activate the innate defenders (DCs, macrophages and neutrophils) for
mobilization to the spleen where they can drive an effective generation and expansion of
memory CD4+ and CD8+ T cell subsets.
Double producers CD4+IFNγ+IL-10+ and CD8+IFNγ+TNFα+ T cells arise after
re-infection
To appreciate the mechanisms underlying the protection observed after re-infection with a
highly infective strain, we have analyzed the magnitude of the developed T cell response
in infected and re-infected mice with HL strain.
After infection, we detected high levels of IFNγ-producing CD4+ and CD8+ T cells (Figures
5A and C, respectively). This finding was anticipated after having noticed the massive
RESULTS - SECTION 3
115
cellular infiltrate of leukocytes in the spleen (Figure 2) and also the existence of
approximately 15 % of effector memory lymphocytes (combined CD4+ and CD8+) that
classically secrete this cytokine [19]. Upon re-infection (Figures 5B and D), however, a
more interesting panel of effector cells has emerged. Along with the same IFNγ+ cells,
detected in both CD4+ and CD8+ lymphocytes, we identified IL-10 in 1.5 % and IFNγ+IL-
10+ double producers in 0.75 % of the CD4+ T cells, which represent an increment of
1.7 and 3.1, respectively, compared to uninfected animals.
Figure 5. Intracellular cytokines of CD4+ and CD8+ lymphocytes
IFNγ, IL10 and TNFα production was analyzed by flow cytometry in CD4+ (A, B) and CD8+ (C, D)
lymphocytes. Splenocytes were stimulated with PMA, ionomycin and brefeldin A and stained for surface and
intracellular molecules. Cytokine single and double producers in each lymphocyte population are depicted
from naïve, infected (A, C) or challenged (B, D) mice. Bars represent means ± SD of 4 to 9 animals of one
experiment with statistical significant differences between naïve and infected mice pointed out with *.
CD4+T-bet+IFNγ+IL-10+ cells were recently described by us and others upon infection of
BALB/c mice with L. infantum [36] or L. donovani [37]. This Th1 population is driven by
CD4+ T cells activation by the infected DCs and leads to an unprotective phenotype that
accentuates the infection. However, a protective role was previously attributed to
RESULTS - SECTION 3
116
CD4+CD25-Foxp3-IFNγ+IL-10+ cells in a vaccination study with L. donovani LdCen1-/- [38]
and in a non-healing model of CL with L. major [39], which were claimed to arise after a
strong inflammatory stimulus as a feedback control of Th1 responses to avoid tissue
damage.
In CD8+ T cells, conversely, cytokine double producing cells were found for IFNγ+TNFα+,
in a representation of 0.86 %, meaning an increase of 3.4 fold compared to naïve mice.
IFNγ and TNFα concomitant production by Th1 and CD8+ T cells has for long proven to be
more efficient in the killing of L. major [40, 41] and other unrelated microorganisms (e.g.
Mycobacterium tuberculosis [42]) than the production of IFNγ or TNFα alone. More
recently, IFNγ+TNFα+ high quality CD4+ and CD8 T+ cells were described to be generated
after several vaccination protocols against L. major and correlate with prognosis of
protection much better than IFNγ single producers [43]. Moreover, those double producers
CD4+ T cells, which can also be IL-2+, were determined to belong to the central memory
subset, providing long-term protection [43, 44]. As for CD8+IFNγ+TNFα+ T cells, they were
described to have enhanced cytolytic activity compared to IFNγ+ single producers cells in
HIV-infected patients [45]. However, in our study, we could not detect any difference in the
cytotoxicity mediated by CD8+ T cells from HL infected and challenged mice compared to
that from naïve animals (data not shown), which may indicate that cytolytic activity of
those cells was not required in the containment of the parasites in the spleen or the
persistence of the splenic parasite load is due to an incomplete effector function of the
CD8+ T cells.
RESULTS - SECTION 3
117
CONCLUSIONS
Taken together, our results show that HL L. infantum strain promotes a robust activation
of the immune system upon infection initiated by a strong recruitment of leukocytes to the
spleen that stimulates the development of an effective adaptive response. This is a mixed
response as considered by the detection of single producers IFNγ+ and IL-10+ CD4+ T
cells that become more evident when the antigen is re-loaded (re-infection). CD8+ T cells
also exert their effector function by the production of IFNγ. After re-infection, double
producers CD8+IFNγ+TNFα+ and CD4+IFNγ+IL-10+ T cells arise, probably from the
expansion of the central and effector memory subsets, to contain the parasites that
colonized the spleen and to efficiently resolve the infection in the liver and bone marrow,
controlling tissue damage by IL-10 production. To confirm this hypothesis, adoptive
transfer of these memory cells produced after re-infection with our highly infective L.
infantum strain could be performed to evaluate the protective phenotype of such pools of
CD4+ and CD8+ T cells in naïve animals challenged with a posterior L. infantum infection.
Taking the fact that HL is a dermotropic strain that caused CL in a human patient, its
tropism is possibly justified by the inflammatory potential of the strain that impedes a silent
entry into the host. A protective response may immediately be mounted in the skin,
abrogating any chance of the parasite to reach internal organs and visceralize [45].
Concerning ST strain, an agent of human VL, despite some activation of the innate
immune system, it does not translate into efficient adaptive immunity as no memory cells
were detected. With this, a primary infection does not serve as imprinting, since a re-
infection with the same strain led to the increase of the parasite load in the spleen and
liver.
With this work we contributed to the better understanding of the complex modulation that
Leishmania parasites do to surmount the protective strategies developed by the host’s
immune system. Much of the knowledge acquired so far by the scientific community was
based on L. major-infection models that have a clear Th1/Th2 dichotomy on
protection/progression of the disease, and more studies with VL models are needed to
clarify the intriguing modulation that viscerotropic strains provide to take advantage of
their host.
RESULTS - SECTION 3
118
REFERENCES
1. WHO: Control of the leishmaniasis: report of a meeting of the WHO Expert Committee on the
Control of Leishmaniases, Geneva, 22-26 March 2010. World Health Organization technical report
series 2010(949):xii-xiii, 1-186, back cover.
2. Ready PD: Leishmaniasis emergence in Europe. Euro surveillance : bulletin europeen sur les
maladies transmissibles = European communicable disease bulletin 2010, 15(10):19505.
3. Kumar R, Nylen S: Immunobiology of visceral leishmaniasis. Frontiers in immunology 2012, 3:251.
4. Michel G, Pomares C, Ferrua B, Marty P: Importance of worldwide asymptomatic carriers of
Leishmania infantum (L. chagasi) in human. Acta tropica 2011, 119(2-3):69-75.
5. Rivas L, Moreno J, Canavate C, Alvar J: Virulence and disease in leishmaniasis: what is relevant for
the patient? Trends in parasitology 2004, 20(7):297-301.
6. De Trez C, Brait M, Leo O, Aebischer T, Torrentera FA, Carlier Y, Muraille E: Myd88-dependent in vivo
maturation of splenic dendritic cells induced by Leishmania donovani and other Leishmania
species. Infection and immunity 2004, 72(2):824-832.
7. Liu D, Uzonna JE: The early interaction of Leishmania with macrophages and dendritic cells and
its influence on the host immune response. Frontiers in cellular and infection microbiology 2012,
2:83.
8. Tsagozis P, Karagouni E, Dotsika E: Function of CD8+ T lymphocytes in a self-curing mouse model
of visceral leishmaniasis. Parasitology international 2005, 54(2):139-146.
9. Stager S, Smith DF, Kaye PM: Immunization with a recombinant stage-regulated surface protein
from Leishmania donovani induces protection against visceral leishmaniasis. Journal of
immunology 2000, 165(12):7064-7071.
10. Stanley AC, Engwerda CR: Balancing immunity and pathology in visceral leishmaniasis. Immunol
Cell Biol{Stanley, 2007 #209} 2007, 85(2):138-147.
11. Tacchini-Cottier F, Weinkopff T, Launois P: Does T Helper Differentiation Correlate with Resistance
or Susceptibility to Infection with L. major? Some Insights From the Murine Model. Frontiers in
immunology 2012, 3:32.
12. Baptista-Fernandes T, Marques C, Roos Rodrigues O, Santos-Gomes GM: Intra-specific variability of
virulence in Leishmania infantum zymodeme MON-1 strains. Comparative immunology, microbiology
and infectious diseases 2007, 30(1):41-53.
13. Chappuis F, Sundar S, Hailu A, Ghalib H, Rijal S, Peeling RW, Alvar J, Boelaert M: Visceral
leishmaniasis: what are the needs for diagnosis, treatment and control? Nature reviews
Microbiology 2007, 5(11):873-882.
14. Selvapandiyan A, Dey R, Gannavaram S, Lakhal-Naouar I, Duncan R, Salotra P, Nakhasi HL: Immunity
to visceral leishmaniasis using genetically defined live-attenuated parasites. Journal of tropical
medicine 2012, 2012:631460.
RESULTS - SECTION 3
119
15. Streit JA, Recker TJ, Filho FG, Beverley SM, Wilson ME: Protective immunity against the protozoan
Leishmania chagasi is induced by subclinical cutaneous infection with virulent but not avirulent
organisms. Journal of immunology 2001, 166(3):1921-1929.
16. Oliveira DM, Costa MA, Chavez-Fumagalli MA, Valadares DG, Duarte MC, Costa LE, Martins VT,
Gomes RF, Melo MN, Soto M et al: Evaluation of parasitological and immunological parameters of
Leishmania chagasi infection in BALB/c mice using different doses and routes of inoculation of
parasites. Parasitology research 2012, 110(3):1277-1285.
17. Nation CS, Dondji B, Stryker GA: Previous exposure to a low infectious dose of Leishmania major
exacerbates infection with Leishmania infantum in the susceptible BALB/c mouse. Parasitology
research 2012, 111(3):1407-1415.
18. Okwor I, Uzonna J: Persistent parasites and immunologic memory in cutaneous leishmaniasis:
implications for vaccine designs and vaccination strategies. Immunologic research 2008, 41(2):123-
136.
19. Mueller SN, Gebhardt T, Carbone FR, Heath WR: Memory T Cell Subsets, Migration Patterns, and
Tissue Residence. Annual review of immunology 2012.
20. Yang S, Liu F, Wang QJ, Rosenberg SA, Morgan RA: The shedding of CD62L (L-selectin) regulates
the acquisition of lytic activity in human tumor reactive T lymphocytes. PloS one 2011,
6(7):e22560.
21. Zaph C, Uzonna J, Beverley SM, Scott P: Central memory T cells mediate long-term immunity to
Leishmania major in the absence of persistent parasites. Nature medicine 2004, 10(10):1104-1110.
22. Kedzierski L, Curtis JM, Doherty PC, Handman E, Kedzierska K: Decreased IL-10 and IL-13
production and increased CD44hi T cell recruitment contribute to Leishmania major immunity
induced by non-persistent parasites. European journal of immunology 2008, 38(11):3090-3100.
23. Cunha J, Carrillo, E., Sánchez, C., Cruz, I., Moreno, J., Cordeiro-da-Silva, A.: Characterization of the
biology and infectivity of Leishmania infantum viscerotropic and dermotropic strains isolated
from HIV+ and HIV- patients in the murine model of visceral leishmaniasis. Parasites & Vectors
2013, 6:122.
24. Miro G, Oliva G, Cruz I, Canavate C, Mortarino M, Vischer C, Bianciardi P: Multicentric, controlled
clinical study to evaluate effectiveness and safety of miltefosine and allopurinol for canine
leishmaniosis. Veterinary dermatology 2009, 20(5-6):397-404.
25. Cruz I, Chicharro C, Nieto J, Bailo B, Canavate C, Figueras MC, Alvar J: Comparison of new
diagnostic tools for management of pediatric Mediterranean visceral leishmaniasis. Journal of
clinical microbiology 2006, 44(7):2343-2347.
26. Peters NC, Egen JG, Secundino N, Debrabant A, Kimblin N, Kamhawi S, Lawyer P, Fay MP, Germain
RN, Sacks D: In vivo imaging reveals an essential role for neutrophils in leishmaniasis transmitted
by sand flies. Science 2008, 321(5891):970-974.
27. Thalhofer CJ, Chen Y, Sudan B, Love-Homan L, Wilson ME: Leukocytes infiltrate the skin and
draining lymph nodes in response to the protozoan Leishmania infantum chagasi. Infection and
immunity 2011, 79(1):108-117.
RESULTS - SECTION 3
120
28. Yurdakul P, Dalton J, Beattie L, Brown N, Erguven S, Maroof A, Kaye PM: Compartment-specific
remodeling of splenic micro-architecture during experimental visceral leishmaniasis. The
American journal of pathology 2011, 179(1):23-29.
29. Smelt SC, Cotterell SE, Engwerda CR, Kaye PM: B cell-deficient mice are highly resistant to
Leishmania donovani infection, but develop neutrophil-mediated tissue pathology. Journal of
immunology 2000, 164(7):3681-3688.
30. Tacchini-Cottier F, Zweifel C, Belkaid Y, Mukankundiye C, Vasei M, Launois P, Milon G, Louis JA: An
immunomodulatory function for neutrophils during the induction of a CD4+ Th2 response in
BALB/c mice infected with Leishmania major. Journal of immunology 2000, 165(5):2628-2636.
31. Souto FO, Alves-Filho JC, Turato WM, Auxiliadora-Martins M, Basile-Filho A, Cunha FQ: Essential role
of CCR2 in neutrophil tissue infiltration and multiple organ dysfunction in sepsis. American journal
of respiratory and critical care medicine 2011, 183(2):234-242.
32. Sato N, Ahuja SK, Quinones M, Kostecki V, Reddick RL, Melby PC, Kuziel WA, Ahuja SS: CC
chemokine receptor (CCR)2 is required for langerhans cell migration and localization of T helper
cell type 1 (Th1)-inducing dendritic cells. Absence of CCR2 shifts the Leishmania major-resistant
phenotype to a susceptible state dominated by Th2 cytokines, b cell outgrowth, and sustained
neutrophilic inflammation. The Journal of experimental medicine 2000, 192(2):205-218.
33. Conrad SM, Strauss-Ayali D, Field AE, Mack M, Mosser DM: Leishmania-derived murine monocyte
chemoattractant protein 1 enhances the recruitment of a restrictive population of CC chemokine
receptor 2-positive macrophages. Infection and immunity 2007, 75(2):653-665.
34. Meddeb-Garnaoui A, Zrelli H, Dellagi K: Effects of tropism and virulence of Leishmania parasites on
cytokine production by infected human monocytes. Clinical and experimental immunology 2009,
155(2):199-206.
35. Liu D, Uzonna JE: The p110 delta isoform of phosphatidylinositol 3-kinase controls the quality of
secondary anti-Leishmania immunity by regulating expansion and effector function of memory T
cell subsets. Journal of immunology 2010, 184(6):3098-3105.
36. Resende M, Moreira D, Augusto J, Cunha J, Neves B, Cruz MT, Estaquier J, Cordeiro-da-Silva A,
Silvestre R: Leishmania-Infected MHC Class IIhigh Dendritic Cells Polarize CD4+ T Cells toward a
Nonprotective T-bet+ IFN-gamma+ IL-10+ Phenotype. Journal of immunology 2013, 191(1):262-273.
37. Owens BM, Beattie L, Moore JW, Brown N, Mann JL, Dalton JE, Maroof A, Kaye PM: IL-10-producing
Th1 cells and disease progression are regulated by distinct CD11c(+) cell populations during
visceral leishmaniasis. PLoS pathogens 2012, 8(7):e1002827.
38. Selvapandiyan A, Dey R, Nylen S, Duncan R, Sacks D, Nakhasi HL: Intracellular replication-deficient
Leishmania donovani induces long lasting protective immunity against visceral leishmaniasis.
Journal of immunology 2009, 183(3):1813-1820.
39. Anderson CF, Oukka M, Kuchroo VJ, Sacks D: CD4(+)CD25(-)Foxp3(-) Th1 cells are the source of IL-
10-mediated immune suppression in chronic cutaneous leishmaniasis. The Journal of experimental
medicine 2007, 204(2):285-297.
RESULTS - SECTION 3
121
40. Bogdan C, Moll H, Solbach W, Rollinghoff M: Tumor necrosis factor-alpha in combination with
interferon-gamma, but not with interleukin 4 activates murine macrophages for elimination of
Leishmania major amastigotes. European journal of immunology 1990, 20(5):1131-1135.
41. Liew FY, Li Y, Millott S: Tumor necrosis factor-alpha synergizes with IFN-gamma in mediating
killing of Leishmania major through the induction of nitric oxide. Journal of immunology 1990,
145(12):4306-4310.
42. Chan J, Xing Y, Magliozzo RS, Bloom BR: Killing of virulent Mycobacterium tuberculosis by
reactive nitrogen intermediates produced by activated murine macrophages. The Journal of
experimental medicine 1992, 175(4):1111-1122.
43. Darrah PA, Patel DT, De Luca PM, Lindsay RW, Davey DF, Flynn BJ, Hoff ST, Andersen P, Reed SG,
Morris SL et al: Multifunctional TH1 cells define a correlate of vaccine-mediated protection against
Leishmania major. Nature medicine 2007, 13(7):843-850.
44. Seder RA, Darrah PA, Roederer M: T-cell quality in memory and protection: implications for
vaccine design. Nature reviews Immunology 2008, 8(4):247-258.
45. Lichterfeld M, Yu XG, Waring MT, Mui SK, Johnston MN, Cohen D, Addo MM, Zaunders J, Alter G, Pae
E et al: HIV-1-specific cytotoxicity is preferentially mediated by a subset of CD8(+) T cells
producing both interferon-gamma and tumor necrosis factor-alpha. Blood 2004, 104(2):487-494.
46. Maia C, Seblova V, Sadlova J, Votypka J, Volf P: Experimental transmission of Leishmania infantum
by two major vectors: a comparison between a viscerotropic and a dermotropic strain. PLoS
neglected tropical diseases 2011, 5(6):e1181.
DISCUSSION AND CONCLUSIONS
125
On the importance of establishing the culture conditions for the in vitro growth of
Leishmania sp. parasites
Leishmania spp. are protozoan parasites transmitted to the mammalian host by the bite of
a female phlebotomine sand fly. Inside the vector, Leishmania exists as promastigote form
that evolves through numerous developing stages inside the intestinal tract of the insect.
The metacyclic promastigote is the infective stage for the mammalian host but once it has
been inoculated in the skin is rapidly converted into the amastigote form to survive in the
aggressive intracellular milieu of the macrophages’ phagolysosomes.
For the kind of studies that we proposed to do, and for experimental conduct in general, a
source of fit infective parasites must be available and easy to maintain, whether retrieving
the promastigote or the amastigote form of the parasite.
The fact that in the insect vector promastigotes grow in an extracellular environment
facilitates the transposition to the in vitro culture. This is one of the major arguments that
make the promastigotes the biological stage of choice in many works with Leishmania
spp. Despite the production of promastigotes in an artificial controlled environment may
seem an easy task, the availability of several culture media offers this process a
magnitude of variables that influence the biological, morphological and immunological
characteristics of the generated parasites [88, 102]. This variability could influence the
existence of some discrepancies on the literature and makes strong conclusions between
similar works difficult. Apart from the animal model, the background and the immune
system of the host, the administration route and the number of parasites inoculated, one
not only has to account for intra-species and intra-strain characteristics that impact on the
end results [103], but also has to consider the influence of the in vitro cultivation on the
infective, secretory or immunomodulatory capacities [30], to name some, of the parasite
that is subject of study.
The influence of the culture media on the biology and infectivity of Leishmania infantum
was evaluated in the first section of the Results. It was shown for the
MHOM/MA/67/ITMAP-263 strain (named ST strain on section two and three of Results)
how the cell cycle, promastigote differentiation stages and, ultimately, infectivity strongly
depend on the culture medium chosen to grow the parasites. If RPMI, SDM and NNN
media proved to be good in producing infective promastigotes, Schneider culture medium
failed on this essential requisite, since procyclic promastigotes predominate in the culture,
translating into low in vitro and in vivo parasite loads. Indeed, logarithmic-phase
promastigotes have been shown to be less infective [104].
DISCUSSION AND CONCLUSIONS
126
Another observation made was that a culture medium that promotes high proliferation is
not indicated for long-term maintenance of Leishmania spp. in vitro cultures, as more
generations occur in short time, which leads to the loss of virulence. In this sense, cRPMI,
the culture medium engineered in this work with the objective of producing infective
promastigotes in a long-term culture without the use of fetal calf serum (or other protein
source), proved to perform the best in maintaining the parasites virulence for longer time.
However, as mentioned, long-time virulent cultures are related with low number of
generations so few parasites can be obtained from this cRPMI medium, making it not the
best choice for the preparation of a high dose inoculum used in infection studies or the
isolation of parasites from biopsies as a diagnosis methodology.
The differences in the infectivity detected for L. infantum cultivated in several culture
media were attributed do the capability of each medium in producing promastigotes in
different stages of development [17, 87] and to the more or less generations that are
produced in the same period of culture, leading to loss of virulence with overtime [30].
DISCUSSION AND CONCLUSIONS
127
On the strain-specific characteristics that lead to differential infectivity and tropism
One of the principal objectives of this thesis was to evaluate the inherent infectivity of L.
infantum strains responsible for cutaneous and visceral leishmaniasis in
immunocompetent and immunocompromised patients. The four L. infantum strains that
are subject of this thesis were isolated from human patients that manifested cutaneous
(CL; HL strain) or visceral leishmaniasis (VL; Bibiano, E390M and ST strains); among the
VL cases, two were from HIV+ patients (Bibiano and E390M). After having understood the
major impact that the culture medium has on L. infantum infective capacity, the
establishment of the culture conditions for the four L. infantum strains was one of the main
focuses. The aim was to find a culture medium where the four strains could grow and
develop from logarithmic to stationary phase promastigotes in similar way so the eventual
differences in the infectivity would resume to inherent characteristics of each strain,
therefore reducing the medium bias. The culture of the four strains in NNN medium
accomplished the objective proposed, as presented in the second section of the Results.
Growth, viability, cell cycle progression and metacyclogenesis within the in vitro culture as
well as infectivity of Bibiano, E390M and HL strain were studied for the very first time
within this thesis; ST was included in the experiments as the standard infective strain in
the laboratory and also as an example of a viscerotropic strain isolated from an
immunocompetent host.
The hallmark characterization in Leishmania epidemiology is the zymodeme analysis.
Bibiano, HL and ST belong to MON-1, the most frequent zymodeme for L. infantum in the
Mediterranean area [100]; E390M was determined to belong to the rare MON-284
zymodeme, so far isolated only from HIV/Leishmania coinfected patients [101].
In the era of molecular tools, molecular typing was performed to further characterize these
strains. The four specimens were clustered in the same ITS type A group and MON-1
strains were further classified in the k26 group 1b. These were the expected results since
those are the most common classifications in the Iberian Peninsula and confirm the MON-
1 characterization by MLEE [105]. However, E390M was determined to belong to a new
k26 group, reported here for the first time, which sequence was made available for the
scientific community by the access number KC576808 in the GenBank, adding new
information concerning the MON-284 zymodeme and k26 analysis. A molecular approach
was also used to create a unique signature that allowed the identification of each strain in
in vitro culture or in vivo infection, or even the detection of mixed infections.
DISCUSSION AND CONCLUSIONS
128
In both in vitro and in vivo models, HL proved to be the more infective strain. When
infecting bone marrow-derived macrophages, HL presented higher number of parasites
per infected cell during the four days that lasted the assay compared to the other strains,
including the laboratory’s standard virulent strain, ST. HL was also able to persist in more
cells over time, leading to the higher infection index.
Using the BALB/c model of VL, along with the differences in infectivity it was also
interesting to analyze the organ tropism of each strain in the onset of the infection (the
acute phase, 2 weeks post-infection) and during chronicity (6 weeks post-infection):
- ST showed an accumulative visceralizing phenotype: in the acute phase it
reached the spleen and liver but targeted specially the bone marrow; however, with time,
the visceral organs revealed to be the safety niche for ST persistence and proliferation,
contrary to the bone marrow where a 5-fold reduction in the parasite load was noticed 6
weeks post-infection.
- HL presented high parasite loads in all the tissues analyzed in the acute phase of
the disease. Over time, a visceral tropism was noticed as the parasite load was reduced in
the peripheral organs, maintained in liver and bone marrow and accumulated in the
spleen (7.5-fold increase). This accession of the parasites to the visceral target organs led
to unchanged parasite numbers in the whole animal from 2 to 6 weeks of infection, which
rendered HL the most infective strain.
- E390M revealed a very low infective capacity with complete inability to resist
inside the mice as, with time, parasites were efficiently eliminated from the spleen (22-fold
reduction), lymph nodes (12-fold reduction) and bone marrow (2-fold reduction). A slight
containment of the parasite load was detected in the liver and, curiously, more parasites
were quantified in the blood in the chronic phase of infection, compared to the acute
phase.
- Bibiano exhibited high infectivity of the visceral organs and bone marrow in the
acute phase of the disease, very similar or even higher than HL, but was unable to
counteract the strong protective response generated in the liver, thus suffering a near
450-fold reduction in this organ 6 weeks post-infection. However, the parasite load in the
spleen and bone marrow maintained the initial levels.
The high parasite load resultant from HL infection led to a massive cellular recruitment to
the spleen, increasing the CD4+ and CD8+ T cells, B cells and macrophages, all
accounting for the splenomegaly observed in HL-infected animals during the chronic
phase of the disease.
DISCUSSION AND CONCLUSIONS
129
Differences in the immunogenicity of the four strains were also perceived. Due to the B
cell proliferation, high titers of anti-Leishmania IgG1 and IgG2a were detected in HL-
infected mice 6 weeks post-infection. However, also E390M revealed some Leishmania-
specific immunogenicity despite the absence of B cell proliferation. This may be related to
k26 protein that is highly immunogenic and, in the scope of the molecular typing done for
E390M, was determined to have more PKEDGHTQKND / PKEDGRTQKN repeats than
the MON-1 strains; these repeats were indeed described as being B cell epitopes [106].
The murine model of visceral leishmaniasis used in this thesis put on evidence the
inherent infectivity of several L. infantum strain and their potential and differential
immunomodulatory capacities. These findings contribute to the general acceptance that
leishmaniasis is a multifactorial disease with the clinical outcome being highly dependent
on the infectivity of the strain and the susceptibility of the host.
DISCUSSION AND CONCLUSIONS
130
On the protective role that a highly infective L. infantum strain display against re-
infection
Leishmania infantum is a magnificent example of a parasite that takes advantage of their
host by modulating the environment on its own benefit. It has “engineered” different ways
of silently entering into the host and installing an infection, most of the time without any
clinical symptoms, allowing the safe transmission to other hosts/reservoirs (when present
in the skin and blood) and, therefore, the perpetuation of the species. This constitutes a
real adversity in the containment of the disease in endemic countries, where L. infantum-
infected asymptomatic people can be as prevalent as 71.3 % (0.6 - 71.3 % depending on
the geographic region and the technique used for detection) and the asymptomatic dog
carriers range from 25 to 80 % [6]. Also in these regions, the concomitant presence of
several species and strains is frequent [107], thus mixed de novo infections or re-
infections are possible.
The preexistence of a Leishmania infection can hence exert important modifications on
what would be the natural course of a primary infection, exacerbating the secondary
disease or leading to some degree of protection. In reverse, the secondary infection may
motivate the clinical manifestation of a primary cryptic infection or promote its progression.
This scenario was explored in this thesis using the HL and ST strains and is discussed in
the third section of the Results. Indeed, infection of BALB/c mice with L. infantum strains
with distinct infectivity and consecutive re-infection (with the same strain) or cross
infection (with a different strain from the imprinting) resulted in different outcomes.
The parasite load quantified in mice who underwent HL imprinting followed by
homologous challenge was decreased (in the liver and bone marrow) or maintained (in
the spleen) compared to the primary infection with HL, indicating a partial protection
against re-infection. This was not the case when repeating the infection and challenge
protocol with ST strain, therefore, no protective role could be assigned to ST against a
secondary infection. This inability was evidenced with cross infections in mice previously
imprinted with either HL or ST strains by the analysis of the parasite loads in the spleen
and liver. HL imprinted mice were less susceptible to a ST secondary infection, whereas
ST imprinted animals suffered disease exacerbation after HL challenge.
Despite the differences in the parasite loads, infiltration in the spleen of inflammatory
neutrophils, macrophages/monocytes and activated dendritic cells (DCs) were similarly
increased in infected and challenged mice with both strains. But, interestingly, only in HL
infected animals CD4+ and CD8+ central memory T cells (TCM) were increased compared
DISCUSSION AND CONCLUSIONS
131
to naïve mice, which is indicative of a HL strain-specific ability to trigger the activation of
the adaptive immune responses. Moreover, re-infection with HL also allowed the
appearance of effector memory T cells (TEM) from CD4+ and CD8+ pools along with the
already expanded TCM.
High levels of IFNγ-producing CD4+ and CD8+ T cells were quantified after infection and
re-infection with HL, probably originated from the TEM subpopulations, which explains the
protection observed against re-infection. Additionally, IL-10-producing CD4+ T cells
increased after challenge, probably to balance IFNγ and TNFα inflammatory potential and
reduce tissue damage. In fact, a CD4+IFNγ+IL-10+ population arose after challenge
possibly in response to the CD8+IFNγ+TNFα+ population. This latter population was also
described in HIV+ patients and presented enhanced cytolytic activity in comparison to
IFNγ-single producers cells [108]. However, cytolysis may not be required for the control
of HL parasites in the spleen, since CD8+ T cells derived from HL-infected mice did not
reveal increased cytotoxicity compared to CD8+ T cells from naïve animals. Or a greater
protection effect is not achieved due to incomplete CD8+ effector functions.
To our knowledge, it was the first time that concomitant immunity was studied in the scope
of live virulent L. infantum infection followed by homologous or heterologous re-infections
with different L. infantum strains. The results obtained contribute to the better
understanding of the complex modulation that Leishmania parasites do to surmount the
protective strategies developed by the host immune system. However, more studies are
required to clarify the intriguing modulation that viscerotropic strains mount to take
advantage of their host, as no clear Th1/Th2 dichotomy on protection/progression of the
disease seems to drive the outcome of leishmaniasis as seen with L. major-infection
animal models and human disease.
DISCUSSION AND CONCLUSIONS
132
Final remarks
With the work performed within this thesis it was concluded that inherent characteristics of
each infective strain are responsible for the tropism and memory generation mechanisms,
two processes that remarkably influence the outcome and progression of leishmaniasis.
A clearer idea on the concept of “virulence” was also developed:
One L. infantum strain is considered more virulent not only because is highly infective (this
is related with the concept of “pathogenicity”) but also because is able to downregulate the
activation signals that would normally fire the innate immune mechanisms and trigger the
adaptive response. A highly virulent strain enters the host silently and reaches the internal
organs where it can multiply, usually due to the induction of Th2 responses or IL-10
secretion [109], leading to a severe form of the disease.
Taking the example of the HL strain, isolated from a cutaneous lesion, it is clear that
dermotropic strains are exuberant in their first contact to the host. However, it is important
to consider that the parasite was delivered by intraperitoneal injection, as a model of VL,
instead of subcutaneous or intradermic inoculation traditionally used in CL models. The
recruitment of inflammatory macrophages/monocytes, neutrophils and DCs to the site of
inoculation (in this case the spleen as the representative of the visceral organs and as a
main organ for the generation of the immune response - but otherwise the skin in natural
infections or CL models) is the alert signal for the implementation of a protective response
that restrains the parasites in the skin, impeding its visceralization. Moreover, there is
evidence that different dermal DCs are involved in the early uptake of L. major and L.
donovani and also that higher numbers of L. donovani-infected DCs and macrophages
migrate to the draining lymph nodes, comparatively to L. major-infected cells, which
condition the visceralization ability of the different species [97].
On the contrary, considering the example of the ST strain, an agent of VL, recruitment of
inflammatory innate cells may happen and will transport the parasites to internal organs.
This allows the viscerotropic strains to gain entry and establish a stable infection in the
spleen and bone marrow.
The susceptibility of the host was another factor that was better understood. Strains like
E390M, with low infectivity and low resistance to elimination may absolutely rely on
immunosuppressed hosts, which lack functional protective mechanisms, to perpetuate.
This can support the contribution of the alternative artificial cycle of anthroponotic
transmission in intravenous drug users (IVDUs) in the maintenance of low virulent strains
DISCUSSION AND CONCLUSIONS
133
and the appearance of rare zymodemes so far detected only in HIV/Leishmania
coinfected patients [110].
All these conclusions could have been biased if an effort on the comprehension of the
dependence of Leishmania infectivity on the in vitro culture conditions would not have
been assessed. It is believed that the establishment of the culture settings that allowed
the generation of similar promastigotes for the four studied strains was a pivotal decision
for the resolution of the proposed objectives.
Finally, for the first time it was evaluated the impact of infection-induced immunity on a
secondary homologous or heterologous infection with L. infantum strains in the murine
model of VL. The highly infective strain showed partial protection against re-infection due
to the expansion of TCM and TEM populations and the production of IFNγ by both CD4+
and CD8+ T cells and double producers CD4+IFNγ+IL-10+ and CD8+IFNγ+TNFα+. No
protection upon virulent challenge was observed if a strain with lower infectivity was used
as imprinting, revealing the need of a virulent infection to generate and maintain
appropriate immunity, in agreement with the findings of Streit et al. [59].
BIBLIOGRAPHY
137
List of references embedded in the Introduction, Objectives and Discussion &
Conclusions
1. David CV, Craft N: Cutaneous and mucocutaneous leishmaniasis. Dermatologic therapy 2009,
22(6):491-502.
2. Kumar R, Nylen S: Immunobiology of visceral leishmaniasis. Frontiers in immunology 2012, 3:251.
3. Hide M, Singh R, Kumar B, Banuls AL, Sundar S: A microculture technique for isolating live
Leishmania parasites from peripheral blood of visceral leishmaniasis patients. Acta tropica 2007,
102(3):197-200.
4. Kaye P, Scott P: Leishmaniasis: complexity at the host-pathogen interface. Nature reviews
Microbiology 2011, 9(8):604-615.
5. Alvar J, Velez ID, Bern C, Herrero M, Desjeux P, Cano J, Jannin J, den Boer M, Team WHOLC:
Leishmaniasis worldwide and global estimates of its incidence. PloS one 2012, 7(5):e35671.
6. Michel G, Pomares C, Ferrua B, Marty P: Importance of worldwide asymptomatic carriers of
Leishmania infantum (L. chagasi) in human. Acta tropica 2011, 119(2-3):69-75.
7. Chappuis F, Sundar S, Hailu A, Ghalib H, Rijal S, Peeling RW, Alvar J, Boelaert M: Visceral
leishmaniasis: what are the needs for diagnosis, treatment and control? Nature reviews
Microbiology 2007, 5(11):873-882.
8. Karunaweera ND: Leishmania donovani causing cutaneous leishmaniasis in Sri Lanka: a wolf in
sheep's clothing? Trends in parasitology 2009, 25(10):458-463.
9. WHO: World Health Organization web page on Leishmaniasis. Burden of the disease. Available at
http://wwwwhoint/leishmaniasis/burden/en/.
10. Ready PD: Leishmaniasis emergence in Europe. Euro surveillance : bulletin europeen sur les
maladies transmissibles = European communicable disease bulletin 2010, 15(10):19505.
11. WHO: Report of the Fifth Consultative Meeting on Leishmania/HIV Co-infection. Addis Ababa,
Ethiopia. World Health Organization 2007:p. 1–38.
12. Alvar J, Aparicio P, Aseffa A, Den Boer M, Canavate C, Dedet JP, Gradoni L, Ter Horst R, Lopez-Velez
R, Moreno J: The relationship between leishmaniasis and AIDS: the second 10 years. Clinical
microbiology reviews 2008, 21(2):334-359, table of contents.
13. WHO: World Health Organization web page on HIV/AIDS. Injecting drug use. Available at
http://wwwwhoint/hiv/topics/idu/about/en/indexhtml.
14. Andreani G, Lodge R, Richard D, Tremblay MJ: Mechanisms of interaction between protozoan
parasites and HIV. Current opinion in HIV and AIDS 2012, 7(3):276-282.
15. Solano-Gallego L, Miro G, Koutinas A, Cardoso L, Pennisi MG, Ferrer L, Bourdeau P, Oliva G, Baneth
G, The LeishVet G: LeishVet guidelines for the practical management of canine leishmaniosis.
Parasites & vectors 2011, 4:86.
BIBLIOGRAPHY
138
16. Dostalova A, Volf P: Leishmania development in sand flies: parasite-vector interactions overview.
Parasites & vectors 2012, 5:276.
17. Rogers M, Chance M, Bates P: The role of promastigote secretory gel in the origin and
transmission of the infective stage of Leishmania mexicana by the sandfly Lutzomyia longipalpis.
Parasitology 2002, 124(05):495-507.
18. Ribeiro-Gomes FL, Sacks D: The influence of early neutrophil-Leishmania interactions on the host
immune response to infection. Frontiers in cellular and infection microbiology 2012, 2:59.
19. Ng LG, Hsu A, Mandell MA, Roediger B, Hoeller C, Mrass P, Iparraguirre A, Cavanagh LL, Triccas JA,
Beverley SM et al: Migratory dermal dendritic cells act as rapid sensors of protozoan parasites.
PLoS pathogens 2008, 4(11):e1000222.
20. Thalhofer CJ, Chen Y, Sudan B, Love-Homan L, Wilson ME: Leukocytes infiltrate the skin and
draining lymph nodes in response to the protozoan Leishmania infantum chagasi. Infection and
immunity 2011, 79(1):108-117.
21. Lodge R, Descoteaux A: Leishmania Invasion and Phagosome Biogenesis. In: Molecular
Mechanisms of Parasite Invasion. Edited by Burleigh B, Soldati-Favre D, vol. 47: Springer New York;
2008: 174-181.
22. Morsy TA, Schnur LF, Feinsod FM, Salem AM, Wahba MM, el Said SM: Natural infections of
Leishmania major in domestic dogs from Alexandria, Egypt. The American journal of tropical
medicine and hygiene 1987, 37(1):49-52.
23. Elbihari S, Cheema AH, el-Hassan AM: Leishmania infecting man and wild animals in Saudi Arabia.
4. Canine cutaneous leishmaniasis in the Eastern Province. Transactions of the Royal Society of
Tropical Medicine and Hygiene 1987, 81(6):925-927.
24. WHO: Control of the leishmaniasis: report of a meeting of the WHO Expert Committee on the
Control of Leishmaniases, Geneva, 22-26 March 2010. World Health Organization technical report
series 2010(949):xii-xiii, 1-186, back cover.
25. Cruz I, Morales MA, Noguer I, Rodriguez A, Alvar J: Leishmania in discarded syringes from
intravenous drug users. Lancet 2002, 359(9312):1124-1125.
26. Alvar J, Canavate C, Gutierrez-Solar B, Jimenez M, Laguna F, Lopez-Velez R, Molina R, Moreno J:
Leishmania and human immunodeficiency virus coinfection: the first 10 years. Clinical
microbiology reviews 1997, 10(2):298-319.
27. Silvestre R, Santarem N, Tavares J, Silva AM, Cordeiro-da-Silva A: Recognition of Leishmania
Parasites by Innate Immunity. Immunology Endocrine & Metabolic Agents - Medicinal Chemistry
(Formerly Current Medicinal Chemistry - Immunology Endocrine & Metabolic Agents) 2009, 9(2):106-
127.
28. van Zandbergen G, Klinger M, Mueller A, Dannenberg S, Gebert A, Solbach W, Laskay T: Cutting
edge: neutrophil granulocyte serves as a vector for Leishmania entry into macrophages. Journal
of immunology 2004, 173(11):6521-6525.
29. Neves BM, Silvestre R, Resende M, Ouaissi A, Cunha J, Tavares J, Loureiro I, Santarem N, Silva AM,
Lopes MC et al: Activation of phosphatidylinositol 3-kinase/Akt and impairment of nuclear factor-
BIBLIOGRAPHY
139
kappaB: molecular mechanisms behind the arrested maturation/activation state of Leishmania
infantum-infected dendritic cells. The American journal of pathology 2010, 177(6):2898-2911.
30. Moreira D, Santarem N, Loureiro I, Tavares J, Silva AM, Amorim AM, Ouaissi A, Cordeiro-da-Silva A,
Silvestre R: Impact of continuous axenic cultivation in Leishmania infantum virulence. PLoS
neglected tropical diseases 2012, 6(1):e1469.
31. Fagundes-Silva GA, Vieira-Goncalves R, Nepomuceno MP, de Souza MA, Favoreto S, Jr., Oliveira-Neto
MP, Da-Cruz AM, Gomes-Silva A: Decrease in anti-Leishmania IgG3 and IgG1 after cutaneous
leishmaniasis lesion healing is correlated with the time of clinical cure. Parasite immunology 2012,
34(10):486-491.
32. Chu N, Thomas BN, Patel SR, Buxbaum LU: IgG1 is pathogenic in Leishmania mexicana infection.
Journal of immunology 2010, 185(11):6939-6946.
33. Oliveira DM, Costa MA, Chavez-Fumagalli MA, Valadares DG, Duarte MC, Costa LE, Martins VT,
Gomes RF, Melo MN, Soto M et al: Evaluation of parasitological and immunological parameters of
Leishmania chagasi infection in BALB/c mice using different doses and routes of inoculation of
parasites. Parasitology research 2012, 110(3):1277-1285.
34. Deak E, Jayakumar A, Cho KW, Goldsmith-Pestana K, Dondji B, Lambris JD, McMahon-Pratt D: Murine
visceral leishmaniasis: IgM and polyclonal B-cell activation lead to disease exacerbation.
European journal of immunology 2010, 40(5):1355-1368.
35. Moreno J, Vouldoukis I, Martin V, McGahie D, Cuisinier AM, Gueguen S: Use of a LiESP/QA-21
vaccine (CaniLeish) stimulates an appropriate Th1-dominated cell-mediated immune response in
dogs. PLoS neglected tropical diseases 2012, 6(6):e1683.
36. Resende M, Moreira D, Augusto J, Cunha J, Neves B, Cruz MT, Estaquier J, Cordeiro-da-Silva A,
Silvestre R: Leishmania-Infected MHC Class IIhigh Dendritic Cells Polarize CD4+ T Cells toward a
Nonprotective T-bet+ IFN-gamma+ IL-10+ Phenotype. Journal of immunology 2013, 191(1):262-273.
37. De Trez C, Brait M, Leo O, Aebischer T, Torrentera FA, Carlier Y, Muraille E: Myd88-dependent in vivo
maturation of splenic dendritic cells induced by Leishmania donovani and other Leishmania
species. Infection and immunity 2004, 72(2):824-832.
38. Liese J, Schleicher U, Bogdan C: The innate immune response against Leishmania parasites.
Immunobiology 2008, 213(3-4):377-387.
39. Tomioka H, Tatano Y, Maw WW, Sano C, Kanehiro Y, Shimizu T: Characteristics of suppressor
macrophages induced by mycobacterial and protozoal infections in relation to alternatively
activated M2 macrophages. Clinical & developmental immunology 2012, 2012:635451.
40. Raes G, Beschin A, Ghassabeh GH, De Baetselier P: Alternatively activated macrophages in
protozoan infections. Current opinion in immunology 2007, 19(4):454-459.
41. Surh CD, Boyman O, Purton JF, Sprent J: Homeostasis of memory T cells. Immunological reviews
2006, 211:154-163.
42. Mueller SN, Gebhardt T, Carbone FR, Heath WR: Memory T Cell Subsets, Migration Patterns, and
Tissue Residence. Annual review of immunology 2012.
BIBLIOGRAPHY
140
43. Sallusto F, Geginat J, Lanzavecchia A: Central memory and effector memory T cell subsets:
function, generation, and maintenance. Annual review of immunology 2004, 22:745-763.
44. Baaten BJ, Tinoco R, Chen AT, Bradley LM: Regulation of Antigen-Experienced T Cells: Lessons
from the Quintessential Memory Marker CD44. Frontiers in immunology 2012, 3:23.
45. Garcia de Tena J, Manzano L, Leal JC, San Antonio E, Sualdea V, Alvarez-Mon M: Distinctive pattern
of cytokine production and adhesion molecule expression in peripheral blood memory CD4+ T
cells from patients with active Crohn's disease. Journal of clinical immunology 2006, 26(3):233-242.
46. Ivetic A: Signals regulating L-selectin-dependent leucocyte adhesion and transmigration. The
international journal of biochemistry & cell biology 2013, 45(3):550-555.
47. Sprent J, Surh CD: T cell memory. Annual review of immunology 2002, 20:551-579.
48. Yang S, Liu F, Wang QJ, Rosenberg SA, Morgan RA: The shedding of CD62L (L-selectin) regulates
the acquisition of lytic activity in human tumor reactive T lymphocytes. PloS one 2011,
6(7):e22560.
49. Zaph C, Uzonna J, Beverley SM, Scott P: Central memory T cells mediate long-term immunity to
Leishmania major in the absence of persistent parasites. Nature medicine 2004, 10(10):1104-1110.
50. Liu D, Uzonna JE: The p110 delta isoform of phosphatidylinositol 3-kinase controls the quality of
secondary anti-Leishmania immunity by regulating expansion and effector function of memory T
cell subsets. Journal of immunology 2010, 184(6):3098-3105.
51. Seder RA, Darrah PA, Roederer M: T-cell quality in memory and protection: implications for
vaccine design. Nature reviews Immunology 2008, 8(4):247-258.
52. Uzonna JE, Wei G, Yurkowski D, Bretscher P: Immune elimination of Leishmania major in mice:
implications for immune memory, vaccination, and reactivation disease. Journal of immunology
2001, 167(12):6967-6974.
53. Belkaid Y, Piccirillo CA, Mendez S, Shevach EM, Sacks DL: CD4+CD25+ regulatory T cells control
Leishmania major persistence and immunity. Nature 2002, 420(6915):502-507.
54. Nadim A, Javadian E, Tahvildar-Bidruni G, Ghorbani M: Effectiveness of leishmanization in the
control of cutaneous leishmaniasis. Bulletin de la Societe de pathologie exotique et de ses filiales
1983, 76(4):377-383.
55. Mendez S, Reckling SK, Piccirillo CA, Sacks D, Belkaid Y: Role for CD4(+) CD25(+) regulatory T cells
in reactivation of persistent leishmaniasis and control of concomitant immunity. The Journal of
experimental medicine 2004, 200(2):201-210.
56. Evans KJ, Kedzierski L: Development of Vaccines against Visceral Leishmaniasis. Journal of tropical
medicine 2012, 2012:892817.
57. Khamesipour A, Dowlati Y, Asilian A, Hashemi-Fesharki R, Javadi A, Noazin S, Modabber F:
Leishmanization: use of an old method for evaluation of candidate vaccines against
leishmaniasis. Vaccine 2005, 23(28):3642-3648.
BIBLIOGRAPHY
141
58. McCall LI, Zhang WW, Ranasinghe S, Matlashewski G: Leishmanization revisited: Immunization with
a naturally attenuated cutaneous Leishmania donovani isolate from Sri Lanka protects against
visceral leishmaniasis. Vaccine 2013, 31(10):1420-1425.
59. Streit JA, Recker TJ, Filho FG, Beverley SM, Wilson ME: Protective immunity against the protozoan
Leishmania chagasi is induced by subclinical cutaneous infection with virulent but not avirulent
organisms. Journal of immunology 2001, 166(3):1921-1929.
60. Zijlstra EE, el-Hassan AM, Ismael A, Ghalib HW: Endemic kala-azar in eastern Sudan: a longitudinal
study on the incidence of clinical and subclinical infection and post-kala-azar dermal
leishmaniasis. The American journal of tropical medicine and hygiene 1994, 51(6):826-836.
61. Giunchetti RC, Correa-Oliveira R, Martins-Filho OA, Teixeira-Carvalho A, Roatt BM, de Oliveira Aguiar-
Soares RD, de Souza JV, das Dores Moreira N, Malaquias LC, Mota e Castro LL et al: Immunogenicity
of a killed Leishmania vaccine with saponin adjuvant in dogs. Vaccine 2007, 25(44):7674-7686.
62. Armijos RX, Weigel MM, Aviles H, Maldonado R, Racines J: Field trial of a vaccine against New
World cutaneous leishmaniasis in an at-risk child population: safety, immunogenicity, and
efficacy during the first 12 months of follow-up. The Journal of infectious diseases 1998,
177(5):1352-1357.
63. Noazin S, Khamesipour A, Moulton LH, Tanner M, Nasseri K, Modabber F, Sharifi I, Khalil EA, Bernal ID,
Antunes CM et al: Efficacy of killed whole-parasite vaccines in the prevention of leishmaniasis: a
meta-analysis. Vaccine 2009, 27(35):4747-4753.
64. Das A, Ali N: Vaccine prospects of killed but metabolically active Leishmania against visceral
leishmaniasis. Expert review of vaccines 2012, 11(7):783-785.
65. Breton M, Tremblay MJ, Ouellette M, Papadopoulou B: Live nonpathogenic parasitic vector as a
candidate vaccine against visceral leishmaniasis. Infection and immunity 2005, 73(10):6372-6382.
66. Papadopoulou B, Roy G, Breton M, Kundig C, Dumas C, Fillion I, Singh AK, Olivier M, Ouellette M:
Reduced infectivity of a Leishmania donovani biopterin transporter genetic mutant and its use as
an attenuated strain for vaccination. Infection and immunity 2002, 70(1):62-68.
67. Selvapandiyan A, Dey R, Nylen S, Duncan R, Sacks D, Nakhasi HL: Intracellular replication-deficient
Leishmania donovani induces long lasting protective immunity against visceral leishmaniasis.
Journal of immunology 2009, 183(3):1813-1820.
68. Dey R, Meneses C, Salotra P, Kamhawi S, Nakhasi HL, Duncan R: Characterization of a Leishmania
stage-specific mitochondrial membrane protein that enhances the activity of cytochrome c
oxidase and its role in virulence. Molecular microbiology 2010, 77(2):399-414.
69. Silvestre R, Cordeiro-Da-Silva A, Santarem N, Vergnes B, Sereno D, Ouaissi A: SIR2-deficient
Leishmania infantum induces a defined IFN-gamma/IL-10 pattern that correlates with protection.
Journal of immunology 2007, 179(5):3161-3170.
70. Mizbani A, Taheri T, Zahedifard F, Taslimi Y, Azizi H, Azadmanesh K, Papadopoulou B, Rafati S:
Recombinant Leishmania tarentolae expressing the A2 virulence gene as a novel candidate
vaccine against visceral leishmaniasis. Vaccine 2009, 28(1):53-62.
BIBLIOGRAPHY
142
71. Selvapandiyan A, Dey R, Gannavaram S, Lakhal-Naouar I, Duncan R, Salotra P, Nakhasi HL: Immunity
to visceral leishmaniasis using genetically defined live-attenuated parasites. Journal of tropical
medicine 2012, 2012:631460.
72. Nagill R, Kaur S: Vaccine candidates for leishmaniasis: a review. International immunopharmacology
2011, 11(10):1464-1488.
73. Coler RN, Skeiky YA, Bernards K, Greeson K, Carter D, Cornellison CD, Modabber F, Campos-Neto A,
Reed SG: Immunization with a polyprotein vaccine consisting of the T-Cell antigens thiol-specific
antioxidant, Leishmania major stress-inducible protein 1, and Leishmania elongation initiation
factor protects against leishmaniasis. Infection and immunity 2002, 70(8):4215-4225.
74. Coler RN, Goto Y, Bogatzki L, Raman V, Reed SG: Leish-111f, a recombinant polyprotein vaccine
that protects against visceral Leishmaniasis by elicitation of CD4+ T cells. Infection and immunity
2007, 75(9):4648-4654.
75. Velez ID, Gilchrist K, Martinez S, Ramirez-Pineda JR, Ashman JA, Alves FP, Coler RN, Bogatzki LY,
Kahn SJ, Beckmann AM et al: Safety and immunogenicity of a defined vaccine for the prevention of
cutaneous leishmaniasis. Vaccine 2009, 28(2):329-337.
76. Trigo J, Abbehusen M, Netto EM, Nakatani M, Pedral-Sampaio G, de Jesus RS, Goto Y, Guderian J,
Howard RF, Reed SG: Treatment of canine visceral leishmaniasis by the vaccine Leish-111f+MPL-
SE. Vaccine 2010, 28(19):3333-3340.
77. Gradoni L, Foglia Manzillo V, Pagano A, Piantedosi D, De Luna R, Gramiccia M, Scalone A, Di Muccio
T, Oliva G: Failure of a multi-subunit recombinant leishmanial vaccine (MML) to protect dogs from
Leishmania infantum infection and to prevent disease progression in infected animals. Vaccine
2005, 23(45):5245-5251.
78. Miret J, Nascimento E, Sampaio W, Franca JC, Fujiwara RT, Vale A, Dias ES, Vieira E, da Costa RT,
Mayrink W et al: Evaluation of an immunochemotherapeutic protocol constituted of N-methyl
meglumine antimoniate (Glucantime) and the recombinant Leish-110f + MPL-SE vaccine to treat
canine visceral leishmaniasis. Vaccine 2008, 26(12):1585-1594.
79. Dantas-Torres F: Leishmune vaccine: the newest tool for prevention and control of canine visceral
leishmaniosis and its potential as a transmission-blocking vaccine. Veterinary parasitology 2006,
141(1-2):1-8.
80. Fernandes AP, Costa MM, Coelho EA, Michalick MS, de Freitas E, Melo MN, Luiz Tafuri W, Resende
Dde M, Hermont V, Abrantes Cde F et al: Protective immunity against challenge with Leishmania
(Leishmania) chagasi in beagle dogs vaccinated with recombinant A2 protein. Vaccine 2008,
26(46):5888-5895.
81. Virbac: CaniLeish® veterinary brochure - Portuguese edition. Available at
http://wwwruminalcomar/sites/default/files/vet%20brochurepdf 2011.
82. Alavi-Naini R, Fazaeli A, O'Dempsey T: Topical treatment modalities for old world cutaneous
leishmaniasis: a review. Prague medical report 2012, 113(2):105-118.
83. Volf P, Volfova V: Establishment and maintenance of sand fly colonies. Journal of vector ecology :
journal of the Society for Vector Ecology 2011, 36 Suppl 1:S1-9.
BIBLIOGRAPHY
143
84. Nicolle C: Culture du parasite du button d'Orient. Comptes Rendus de l'Académie des Sciences 1908,
146:842-843.
85. Schuster FL, Sullivan JJ: Cultivation of clinically significant hemoflagellates. Clinical microbiology
reviews 2002, 15(3):374-389.
86. Chang CS, Chang KP: Heme requirement and acquisition by extracellular and intracellular stages
of Leishmania mexicana amazonensis. Molecular and biochemical parasitology 1985, 16(3):267-276.
87. Gossage SM, Rogers ME, Bates PA: Two separate growth phases during the development of
Leishmania in sand flies: implications for understanding the life cycle. International journal for
parasitology 2003, 33(10):1027-1034.
88. Allahverdiyev AM, Bagirova M, Elcicek S, Koc RC, Oztel ON: Effect of human urine on cell cycle and
infectivity of Leismania species promastigotes in vitro. The American journal of tropical medicine
and hygiene 2011, 85(4):639-643.
89. Gupta N, Goyal N, Rastogi AK: In vitro cultivation and characterization of axenic amastigotes of
Leishmania. Trends in parasitology 2001, 17(3):150-153.
90. Cysne-Finkelstein L, Temporal RM, Alves FA, Leon LL: Leishmania amazonensis: long-term
cultivation of axenic amastigotes is associated to metacyclogenesis of promastigotes.
Experimental parasitology 1998, 89(1):58-62.
91. Pan AA, Duboise SM, Eperon S, Rivas L, Hodgkinson V, Traub-Cseko Y, McMahon-Pratt D:
Developmental life cycle of Leishmania - cultivation and characterization of cultured extracellular
amastigotes. The Journal of eukaryotic microbiology 1993, 40(2):213-223.
92. Pescher P, Blisnick T, Bastin P, Spath GF: Quantitative proteome profiling informs on phenotypic
traits that adapt Leishmania donovani for axenic and intracellular proliferation. Cellular
microbiology 2011, 13(7):978-991.
93. Rochette A, Raymond F, Corbeil J, Ouellette M, Papadopoulou B: Whole-genome comparative RNA
expression profiling of axenic and intracellular amastigote forms of Leishmania infantum.
Molecular and biochemical parasitology 2009, 165(1):32-47.
94. Castanys-Munoz E, Brown E, Coombs GH, Mottram JC: Leishmania mexicana metacaspase is a
negative regulator of amastigote proliferation in mammalian cells. Cell death & disease 2012,
3:e385.
95. Wenzel UA, Bank E, Florian C, Forster S, Zimara N, Steinacker J, Klinger M, Reiling N, Ritter U, van
Zandbergen G: Leishmania major parasite stage-dependent host cell invasion and immune
evasion. FASEB journal : official publication of the Federation of American Societies for Experimental
Biology 2012, 26(1):29-39.
96. Ravinder, Bhaskar, Gangwar S, Goyal N: Development of luciferase expressing Leishmania
donovani axenic amastigotes as primary model for in vitro screening of antileishmanial
compounds. Current microbiology 2012, 65(6):696-700.
97. McCall LI, Zhang WW, Matlashewski G: Determinants for the development of visceral leishmaniasis
disease. PLoS pathogens 2013, 9(1):e1003053.
BIBLIOGRAPHY
144
98. Engwerda CR, Ato M, Kaye PM: Macrophages, pathology and parasite persistence in experimental
visceral leishmaniasis. Trends in parasitology 2004, 20(11):524-530.
99. Lozano R, Naghavi M, Foreman K, Lim S, Shibuya K, Aboyans V, Abraham J, Adair T, Aggarwal R, Ahn
SY et al: Global and regional mortality from 235 causes of death for 20 age groups in 1990 and
2010: a systematic analysis for the Global Burden of Disease Study 2010. Lancet 2012,
380(9859):2095-2128.
100. Pratlong F, Rioux JA, Marty P, Faraut-Gambarelli F, Dereure J, Lanotte G, Dedet JP: Isoenzymatic
analysis of 712 strains of Leishmania infantum in the south of France and relationship of
enzymatic polymorphism to clinical and epidemiological features. Journal of clinical microbiology
2004, 42(9):4077-4082.
101. Chicharro C, Jimenez MI, Alvar J: Iso-enzymatic variability of Leishmania infantum in Spain. Annals
of tropical medicine and parasitology 2003, 97 Suppl 1:57-64.
102. Dey T, Afrin F, Anam K, Ali N: Infectivity and virulence of Leishmania donovani promastigotes: a
role for media, source, and strain of parasite. The Journal of eukaryotic microbiology 2002,
49(4):270-274.
103. Baptista-Fernandes T, Marques C, Roos Rodrigues O, Santos-Gomes GM: Intra-specific variability of
virulence in Leishmania infantum zymodeme MON-1 strains. Comparative immunology, microbiology
and infectious diseases 2007, 30(1):41-53.
104. Alvarez-Rueda N, Biron M, Le Pape P: Infectivity of Leishmania mexicana is associated with
differential expression of protein kinase C-like triggered during a cell-cell contact. PloS one 2009,
4(10):e7581.
105. Kuhls K, Mauricio IL, Pratlong F, Presber W, Schonian G: Analysis of ribosomal DNA internal
transcribed spacer sequences of the Leishmania donovani complex. Microbes and infection /
Institut Pasteur 2005, 7(11-12):1224-1234.
106. Zackay A, Nasereddin A, Takele Y, Tadesse D, Hailu W, Hurissa Z, Yifru S, Weldegebreal T, Diro E,
Kassahun A et al: Polymorphism in the HASPB Repeat Region of East African Leishmania
donovani Strains. PLoS neglected tropical diseases 2013, 7(1):e2031.
107. Talmi-Frank D, Nasereddin A, Schnur LF, Schonian G, Toz SO, Jaffe CL, Baneth G: Detection and
identification of old world Leishmania by high resolution melt analysis. PLoS neglected tropical
diseases 2010, 4(1):e581.
108. Lichterfeld M, Yu XG, Waring MT, Mui SK, Johnston MN, Cohen D, Addo MM, Zaunders J, Alter G, Pae
E et al: HIV-1-specific cytotoxicity is preferentially mediated by a subset of CD8(+) T cells
producing both interferon-gamma and tumor necrosis factor-alpha. Blood 2004, 104(2):487-494.
109. Gradoni L, Gramiccia M: Leishmania infantum tropism: strain genotype or host immune status?
Parasitology today 1994, 10(7):264-267.
110. Cruz I, Nieto J, Moreno J, Canavate C, Desjeux P, Alvar J: Leishmania/HIV co-infections in the
second decade. The Indian journal of medical research 2006, 123(3):357-388.