Btwt

Genomics 73, 66–76 (2001)doi:10.1006/geno.2000.6467, available online at http://www.idealibrary.com on

Human and Mouse ABCA1 Comparative Sequencing andTransgenesis Studies Revealing Novel Regulatory Sequences

Yang Qiu, Lucia Cavelier, Sally Chiu, Xinli Yang, Edward Rubin,1 and Jan-Fang Cheng1

Genome Science Department, Lawrence Berkeley National Laboratory, Berkeley, California 94720

Received October 3, 2000; accepted December 1, 2000

The expression of ABCA1, a major participant inapolipoprotein-mediated cholesterol efflux, is regu-lated by a variety of factors, including intracellularcholesterol concentration. To identify sequences in-volved in its regulation, we sequenced and comparedapproximately 200 kb of mouse and human DNA con-taining the ABCA1 gene. Furthermore, expression ofthe human gene containing different 5* ends was ex-amined in transgenic mice. Sequence comparison re-vealed multiple conserved noncoding sequences. Thetwo most highly conserved noncoding elements (CNS1,88% identity over 498 bp; CNS2, 81% identity over 214bp) were also highly conserved in other organisms.Mice containing the human ABCA1 gene, 70 kb of up-stream DNA, and 35 kb of downstream DNA expressedthe transgene similarly to endogenous Abca1. A sec-ond transgene beginning 3* to exon 1 was expressedonly in liver, providing strong evidence of an unsus-pected liver-specific promoter. The identified con-served noncoding sequences invite further investiga-tion to elucidate ABCA1 regulation. © 2001 Academic Press

INTRODUCTION

Reverse cholesterol transport is a process that re-turns cholesterol from peripheral cells to the liver,where lipids are catabolized and excreted (Fielding andFielding, 1995). This process is regulated by a rate-limiting step of exporting cellular cholesterol and phos-pholipids across the plasma membrane, a processknown as cholesterol efflux. Recently, the ABCA1 genewas found to encode a protein that mediates cholesterolefflux through the apolipoprotein AI (ApoA1)-associ-ated pathway in humans and mice (Lawn et al., 1999;

rooks-Wilson et al., 1999; Orso et al., 2000). Muta-ions of the ABCA1 gene have been found in patientsith Tangier disease, in which the lack of ABCA1 leads

o impairment of cellular cholesterol removal, fast

Sequence data from this article have been deposited with theEMBL/GenBank Data Libraries under Accession Nos. AF287262 andAF287263.

1 To whom correspondence should be addressed. Telephone: (510)

486-6590. Fax: (510) 486-6635. E-mail: jfcheng@lbl.gov.

660888-7543/01 $35.00Copyright © 2001 by Academic PressAll rights of reproduction in any form reserved.

clearance of ApoA1, and the absence of high-densitylipoprotein cholesterol in plasma (Bodzioch et al., 1999;Rust et al., 1999; Remaley et al., 1999). This disorder isfrequently associated with premature coronary arterydisease due to the massive accumulation of tissue cho-lesterol.

ABCA1 gene expression is finely modulated by thecholesterol status of the cell. The gene is highly in-duced during cholesterol loading and repressed duringApoA1-mediated efflux, in macrophages and fibro-blasts (Lawn et al., 1999; Langmann et al., 1999). Sev-eral transcription factors that regulate sterol-modu-lated gene expression have been reported (Brown andGoldstein, 1997; Lopez and McLean, 1999; Lehmann etal., 1997), possibly playing a role in ABCA1 regulation.These include the sterol regulatory binding proteins(SREBPs), the orphan nuclear receptor liver X receptor(LXR), and the retinoid X receptor (RXR). SREBPs areactivated by cholesterol starvation, and the amino-terminal portion of the protein translocates to the nu-cleus where it activates the transcription of the genesinvolved in the maintenance of cholesterol homeostasisand synthesis of cholesterol and fatty acids (Brown andGoldstein, 1997). Two genes involved in the reversecholesterol transport pathways, cholesterol 7-hydroxy-lase and cholesterol ester transfer protein have beenreported to be up-regulated by a RXR/LXR heterodimer(Peet et al., 1998; Luo et al., 2000). A recent study hasshown that ABCA1-mediated efflux of cholesterol isalso regulated by RXR/LXR heterodimers (Repa et al.,2000). The immediate 469 bp 59 upstream of the tran-scribed ABCA1 sequence has been shown to containthe binding site for the LXR/RXR, and ABCA1 is up-regulated by oxysterols and 9-cis-retinoic acid actingthrough the LXR/RXR (Costet et al., 2000; Schwartz etal., 2000). However, a search for regulatory elements indistant 59 and 39 flanking regions and intronic se-quences is still lacking. Among many issues that needto be examined is the presence of transcription factorbinding sites flanking the ABCA1 gene and their rolein the regulation of ABCA1.

ABCA1 gene regulation is likely to be complex since

the gene has been reported to have functions related to

Lotvc

ct

t(dttsetlspam

G

67COMPARISON OF HUMAN AND MOUSE ABCA1

processes other than cholesterol efflux. Several lines ofevidence have shown that ABCA1 is functionally asso-ciated with the engulfment of apoptotic cells (Lucianiand Chimini, 1996). In macrophages, inhibition ofABCA1 function by antibody greatly reduces its abilityto phagocytose cell corpses. A homologue of the ABCA1gene in Caenorhabditis elegans is able to complementmutants of cell corpse engulfment (Wu and Horvitz,1998). Although ABCA1 is expressed in many tissues,high levels of expression are found in uterus, liver,adrenals, and fetal tissues (Langmann et al., 1999;

uciani et al., 1994; Broccardo et al., 1999). High levelsf expression of the ABCA1 gene in uterus and fetalissue are consistent with the notion that ABCA1 in-olves clearance of corpses derived from programmedell death (Langmann et al., 1999).

Because gene structure and regulatory regions tendto be highly conserved among mammals, we sequencedthe entire mouse/human ABCA1 containing ortholo-gous genomic intervals and compared sequences tocharacterize gene structure and identify regulatory se-quences in the ABCA1 gene. The analysis of 200 kb ofgenomic sequence spanning the human and mouseABCA1 genes identified many large (.120 bp), highlyonserved (.75% identity) noncoding elements. One of

TAB

Primers Used

Primer Sequence

D9S53.for GCTGCATACTTTAAACTAGCD9S53.rev GGAATATGTTTTTATTAGCTTGWI-11742.for TTATATGCTGAGGAGAAGAATCWI-11742.rev GCCCCAAGCAAAGACAACBAC2312A17S.for TGCATACTTTGGACACAGTGGTBAC2312A17S.rev GACACTGCGCAGAAGACATTTExon2.for AGTCACAGCTCTGTGCTCTGGExon2.rev GTTTGTCTCCTTCGAAATGTCAExon50.for GTGAACTTTGCCAAGGACCAExon50.rev AGGCTACAAAGGCACTGCCM13.for GTAAAACGACGGCCAGTGM13.rev CAGGAAACAGCTATGACCACNS2.for CCACGTGCTTTCTGCTGAGTCNS2.rev TGCCGGGACTAGTTCCTTTTExon37.for TgAAgCCTgTCATCTACTggCTExon38.rev ACTTCTgCTggAAgCAgATgAANCNS1_KpnI.for AGggtaccACTGAGGCAGAGCCCTCNS1_XhoI.rev GTctcgagGCTAGCACAGGCAGAThABCA1.1.for CAACATGTCAGCTGTTACTGGAhABCA1.211.rev GAGCCTCCCCAGGAGTCGmAbc1.446.for CATTAAGGACATGCACAAGGTCmAbc1.527.rev CAGAAAATCCTGGAGCTTCAAAExon2.for GTT GCT GCT GTG GAA GAA CExon2.rev GCT GCA GCA AAA GGA AAA AExon3.for GGA TTT CCC AGA TCC CAG TGExon3.rev TGA GTC TCA GGC AAC ATC CAExon6.for TTT CCT GGT GGA CAA TGA AAExon6.rev GAG AAT GAC ATC AGC CCT CAExon34.for TGC CAA CAT TTA GAG GAA GCExon34.rev ATC CGT TTA ACC TGC CAA CT39UTR.for CAA CTC CTT ACT TCG GTT CC39UTR.rev GTT TTC TGA GGT GTC CCA AA

he elements, CNS2, has been recently demonstrated

o function in vitro as a sterol response promoterCostet et al., 2000; Schwartz et al., 2000), which vali-ates the use of comparative sequence analysis to iden-ify regulatory sequences. Through human ABCA1ransgenesis studies, we demonstrated that the humanequences studied contain the appropriate regulatorylements required for a tissue distribution similar tohat of the endogenous mouse ABCA1. Expression of aiver-specific transgene from a second transgenic con-truct with a shorter 59 region that lacks the ABCA1romoter and exon 1 (Costet et al., 2000; Schwartz etl., 2000) suggests the existence of a liver-specific pro-oter.

MATERIALS AND METHODS

Mapping and sequencing of bacterial artificial chromosome (BAC)clones containing human and mouse ABCA1 sequences. BAC clonescontaining the human ABCA1 gene were identified by PCR screeningof the human CTC and CTD libraries. The first screen was per-formed using primer sets for STS D9S53 and WI-11742 (Table 1)using the human CTC library. The positive clones identified weresearched against the BAC-end database (http://www.tigr.org/tdb/humgen/bac_end_search/bac_end_search.html) for the BAC-end se-quences. The second screen was performed using primer sets fromthe BAC-end sequences for 2312A17 (Table 1) using the human CTDlibrary. The positive clones from the two screens were assembled

1

This Study

Hybridization region Orientation

D9S53 SenseD9S53 AntisenseWI-11742 SenseWI-11742 AntisenseBAC2312A17 SenseBAC2312A17 AntisenseMouse Abca1 exon 2 SenseMouse Abca1 exon 2 AntisenseMouse Abca1 exon 50 SenseMouse Abca1 exon 50 Antisense

CNS2 SenseCNS2 AntisenseABCA1 exon 37 SenseABCA1 exon38 Antisense

AG ABCA1 intron 37 SenseGT ABCA1 exon 38 Antisense

ABCA1 exon2–3 SenseABCA1 exon 4 AntisenseMouse Abca1 exon 5 SenseMouse Abca1 exon 6 AntisenseABCA1 exon 2 SenseABCA1 exon 2 AntisenseABCA1 exon 3 SenseABCA1 exon 3 Antisense

C ABCA1 exon 6 SenseC ABCA1 exon 6 Antisense

ABCA1 exon 34 SenseT ABCA1 exon 34 Antisense

ABCA1 39UTR SenseABCA1 39UTR Antisense

LE

in

CA

GTTGAG

CTTTCG

CG

A CT C

to a contig by restriction digest. Two overlapping clones, 2274F21

b

cst9(q

RttbT(ttrto(

w1aa

mcfaachSw

n4Tstqefmpea

68 QIU ET AL.

(from the CTD library) and 264C20 (from the CTC library), werechosen for sequencing.

BAC clones containing the mouse ABCA1 gene were identified byPCR screening of the mouse RPCI-23 BAC library using primer setscomplementary to exon 2 and exon 50 (Table 1). Three positive overlap-ping clones, 142M4, 129K10, and 197F14, were chosen for sequencing.

BAC DNA was purified using the Qiagen Large-Construct Kit(Qiagen, Valencia,CA). The isolated DNA was then mechanicallysheared with a Hydroshear device (GeneMachines, San Carlos, CA).The resulting fragments were end repaired with T4 DNA polymeraseand Klenow fragment. The fragments larger than 1350 bp wereselected using Chroma Spin-1000 Columns (Clontech Laboratories,Inc., Palo Alto, CA) and ligated to SmaI/BAP-treated pUC18 vector(Amersham Pharmacia Biotech Inc.) to create the subclone libraries.Individual clones were arrayed in 96-well plates, and plasmid DNAswere prepared using a Qiagen R.E.A.L. Prep 96 Plasmid Kit(Qiagen). Each clone was sequenced from both ends using M13forwarding and reverse primers (Table 1). Fluorescence sequencingwas performed with dye-terminator (BigDye Terminator Cycle Se-quencing Ready Reaction Kit, Perkin–Elmer/Applied Biosystems Di-vision, Foster City, CA) chemistry using 377 automated DNA se-quencing instruments (Perkin–Elmer/Applied Biosystems Division).Each BAC was sequenced to a final estimate of sixfold redundancy.

Sequence analysis. Sequences from each BAC clone were assem-led using the Phrap/Phred/Consed suite program (Ewing et al.,

1998; Ewing and Green, 1998; Gordon et al., 1998) to a final esti-mated error rate of less than 1 in 104 bp. Assembly accuracy wasconfirmed by alignment with human and mouse ABCA1 cDNA se-quences (AF165281 and X75926).

The human ABCA1 region covered by two BACs, 2274F21 and264C20, was assembled into four contigs of the following sizes: 98.1,80.8, 38.2, and 16.8 kb. The total sequence is 201 kb and contains33.9 kb 59 and 19.7 kb 39 of the ABCA1 gene.

Mouse ABCA1 regions are covered by three overlapping BAClones: 129K10 (114 kb), 142M4 (160 kb), and 197F14 (120 kb). Theequences were assembled to the following contigs (given the direc-ion of the Abca1 gene): 22.8 kb, 8.6 kb, 3.0 kb, 4.2 kb, 8.0 kb, 26.6 kb,.6 kb, 11.7 kb (exon 1), 10.5 kb (exon 2), 26.6 kb (exons 3–5), 68.3 kbexons 6–40), 14.5 kb (exons 41–50), and 63.5 kb. The mouse se-uence contains 87.2 kb 59 and 63.5 kb 39 of the ABCA1 gene.The human and mouse repetitive elements were masked usingepeatMasker (http://www.genome.washington.edu/uwgc/analysis-

ools/repeatmask.htm). The masked sequences were blasted againsthe National Center for Biotechnology Information (NCBI) data-ases and human or mouse EST databases for sequence annotation.he potential coding sequences were analyzed using GeneScan

Burge and Karlin, 1997). The alignment between the human andhe mouse genomic sequences was computed with a global alignmentool called GLASS (Pachter, 1999; Batzoglou et al., 2000). The algo-ithm in GLASS can align hundreds of kilobases quickly, by itera-ively aligning matching segments from the two sequences. Theutput from GLASS is passed to a plotting program called VISTAMayor et al., submitted for publication), which scans the alignment

with a sliding window of 100 bp and determines the identity withinthat window for one point of the plot. The plotter then moves downa set number of basepairs and takes the next sampling of the align-ment within the window and plots that point. The plotter also colorsthe regions that are over the percentage identity cutoff specified byusers. We used 100 bp as the sliding window for the plotting. Wedefined our conserved regions as greater than 75% identity and 120bp as the length cutoff.

Analysis of the CNS elements. Genomic DNAs from human,mouse, dog, rabbit, rat, porcine, and bovine were purchased fromClontech Laboratories. PCR amplifications were performed usingdegenerate primers for CNS1 and CNS2 elements (Exon37.for/Exon38.rev to amplify intron 37, which contains CNS1, andCNS2.for/rev to amplify CNS2; Table 1). PCR was performed asfollows: 100 ng of genomic DNA from each species was mixed with a200 mM concentration of each deoxyribonucleoside triphosphate, a 1

mM concentration of each oligonucleotide primer (5 mM for degener- a

ate primers), 5 ml of 103 PCR buffer (Perkin–Elmer), and 5 units ofAmpliTaq DNA polymerase (Perkin–Elmer) in a 50-ml volume. Thesamples were amplified under standard PCR conditions in an auto-mated thermal cycler (Perkin–Elmer 9700) for a total of 35 cycles.

Construction of a reporter plasmid and transient transfection as-says. A 700-bp fragment containing human CNS1 was PCR ampli-fied using primers CNS1_KpnI.for and CNS1_XhoI.rev (Table 1).The amplified product was digested with KpnI and XhoI and ligatedinto the pSEAP-enhancer plasmid (Clontech) at the KpnI and XhoIsites in front of the SV-40 promoter. The plasmid was named CNS-1-pSEAP-promoter. All the plasmids used in transfection assayswere extracted using an EndoFree Plasmid Maxi Kit from Qiagen.

RAW cells (ATCC, Rockville, MD) were grown in minimum essen-tial medium with Earle’s salts supplemented with 10% fetal calfserum. Approximately 1.1 3 105 cells were plated in 12-well plates(2.5 cm), grown overnight to 50–70% confluency, and cotransfectedwith 0.4 mg of CNS-1-pSEAP promoter and 0.1 mg of pBETAgalvector (Clontech). The pSEAP-basic (without SV-40 promoter andenhancer), pSEAP-promoter (with SV-40 promoter), and pSEAP-control (with both SV-40 promoter and enhancer) were also cotrans-fected with pBETAgal vector as negative and positive controls. Thetransfection was performed in triplicate using FuGENE TransfectionReagent from Roche (Indianapolis, IN). Twenty-four hours later, thecells were re-fed with fresh DMEM (Dulbecco’s minimal essentialmedium), DMEM supplemented with 50 mg/ml cholesterol (Sigma,Catalog No. C-8667), or DMEM supplemented with 0.23 mg/ml 8-Br-cAmp (Sigma, Catalog No. B-7880). All media were also supple-mented with 0.2% BSA. The cells were harvested 24 h later. Themedium was assayed for secreted alkaline phosphatase (SEAP) ac-tivity, and the cells were lysed for b-galactosidase assay (Clontech).The SEAP value for each well was normalized by the b-galactosidasevalue to correct the transfection efficiency in different wells.

Creation and analysis of ABCA1 transgenic mice. Human BACs447M11 and 336M11 isolated from the CTD library and RP11,respectively, were selected for transgenesis studies. BAC 447M11contains 70 kb upstream from exon 1 and 35 kb downstream of thegene. BAC 336M11 starts in intron 1 of the ABCA1 gene and con-tains only 13 kb upstream from exon 2 and 35 kb downstream of thegene (Fig. 1). BAC DNA was isolated using the Qiagen Large Con-struct kit (Qiagen Catalog No. 12462). BAC DNA was diluted to 1.5ng/ml and microinjected into fertilized FVB mouse eggs using stan-dard procedures as previously described (Ueda et al., 1999). Mice

ere screened with standard methods using primers in exon 4 (Table), and the presence of the transgene was further confirmed bymplifying with primers for CNS2, exon 2, exon 3, exon 6, exon 34,nd the 39 UTR listed in Table 1.The copy number of the human transgene in the 447M11 founderice was determined using the genomic Southern blot. Twenty mi-

rograms of total genomic DNA from the 447M11 transgenicounders and control mice was digested with EcoRI and run on a 1%garose gel. The DNA from the gel was transferred to a membranend hybridized with exon 4 probe (90 bp). The EcoRI fragmentsontaining exon 4 are different in size for mouse (7256 bp) anduman (4587 bp). The hybridization signals were scanned using aTORM860 densitometer and the band intesities were calculatedith IMAGEQUAT software (Molecular Dynamics).To assess human ABCA1 expression, total RNAs from liver, adre-

al, brain, heart, intestine, and kidney from two independent lines of47M11 and 336M11 transgenic mice were extracted using theRIZOL method. Five micrograms of total RNA was reversed-tran-cribed (Superscript II, Gibco) with random hexamers (Biolabs), andhe expression levels were measured with the TaqMan Syber-greenuantitative PCR assay (Perkin–Elmer). The sequences of the prim-rs used to quantify mRNA are hABCA1.1.for and hABCA1.211.revor amplification of human ABCA1 cDNA and mAbac1.446.for andAbca1.527.rev for amplification of mouse Abca1 cDNA. 18S RNA

rimers were purchased from Ambion, and a ratio of 1:1 competim-rs:primers was used. The amplification conditions were the same forll the primers with 40 cycles and 30-s annealing and extension steps

t 57 and 72°C, respectively.

l(Scbn

patgk36o4eis

69COMPARISON OF HUMAN AND MOUSE ABCA1

RESULTS

Analysis of the 201-kb Human Sequence and 278-kbMouse Sequence Containing the ABCA1 Gene

Human ABCA1 sequence was obtained by analysisof the sequences from two overlapping BACs, 2274F21and 264C20, isolated from the human CTD andCTC libraries, respectively (GenBank Accession No.AF287262). The sequences from the two overlappingBACs were assembled into four contigs of the followingsizes: 98.1 kb (exons 1–5), 80.8 kb (exons 6–24), 38.2 kb(exons 25–50), and 16.8 kb. The human ABCA1 gene is147.5 kb in length and includes 50 exons and 49 in-trons (Fig. 1). Our sequence also includes 33,911 bpupstream of the transcription start site and 19,687 bpdownstream of the polyadenylation site of the ABCA1gene. Base differences resulting in amino acid changeshave been found when comparing our BAC sequenceswith the cDNA sequence from the database(AF165281). These included Arg219Lys, Tyr793Cys,Asp831Asn, Asp1005Lys, Thr1555Ile, Arg1974Lys,and Pro2168Leu.

There is no gene identified in the 33.9 kb upstream ofthe ABCA1 gene. However, one gene is identified 8,837bp downstream from the polyadenylation site of theABCA1 gene on the basis of GenScan predictions andexact expressed sequence tag (EST; AK002137)matches. The gene is 9.7 kb in length with seven exonsand six introns. It is located on the opposite strand ofthe ABCA1 gene. An open reading frame of 248 aa ispredicted from the 1654-bp cDNA sequence. TheBlastP analysis of the hypothetical protein against theprotein database at NCBI revealed homology matchesto zebrafish NIPSNAP2 protein (AJ249797), mouseNIPSNAP1 protein (AJ001260), C. elegans putativeNIPSNAP protein (AJ001262), and human NIPSNAP1protein (AJ001258). The NIPSNAP protein family isevolutionarily well conserved with unknown functions(Seroussi et al., 1998). Human NIPSNAP1 protein ishighly expressed in liver, and the C. elegans ortho-ogues reside within an operon encoding protein motifsSNAP-25) known to be involved in vesicular transport.NAP-25 is a part of SNARE complex that plays aentral role in vesicle-target recognition and mem-rane fusion (Tsui and Banfield, 2000). We named thisew gene human SNAP.Mouse Abca1 regions are covered by three overlap-

ing BAC clones: 129K10 (114 kb), 142M4 (160 kb),nd 197F14 (120 kb). The sequences were assembled tohe following contigs (given the direction of the Abca1ene): 22.8 kb, 8.6 kb, 3.0 kb, 4.2 kb, 8.0 kb, 26.6 kb, 9.6b, 11.7 kb (exon 1), 10.5 kb (exon 2), 26.6 kb (exons–5), 68.3 kb (exons 6–40), 14.5 kb (exons 41–50), and3.5 kb (GenBank Accession No. AF287263). Previ-usly, the mouse Abca1 gene was identified as having9 exons (Remaley et al., 1999). An additional mousexon 1 was identified in this study based on the newlydentified human exon 1 (Pullinger et al., 2000) and

equence comparison between mouse and human.

Compared with other exons, exon 1 is less conservedbetween human and mouse. This is probably becausethe translation of the ABCA1 gene starts from exon 2,and exon 1 is at a noncoding region. The mouse ABCA1gene is at least 123.6 kb in length including 50 exonsand 49 introns (Fig. 1). Table 2 shows the size of theintrons and exons of the mouse ABCA1 gene. Oursequence also includes 87 kb upstream of the transcrip-tion start site and 67.8 kb downstream of the polyad-enylation site of the ABCA1 gene. Combined GenScanpredictions and NCBI blast search did not reveal anygene at the 87-kb upstream region. However, two geneswere identified in the 67.8-kb region downstream of theABCA1 gene by GenScan and an exact EST match.Both genes show 80% identity with the human ortho-logue SNAP and with each other. Both mSNAP1 andmSNAP2 are located on the opposite strand of theABCA1 gene. mSNAP1 is 8 kb downstream of theABCA1 gene and 11 kb in length. mSNAP2 is 12 kbaway from mSNAP1 and 10.4 kb in length.

Sequence Comparison between Human and MouseABCA1 Region

The alignment between human and mouse genomicsequences at the 201-kb ABCA1 gene region was com-puted with GLASS (Pachter, 1999; Batzoglou et al.,2000), a global alignment tool. The VISTA plottingprogram was used to plot the results of the alignment(Fig. 2). In previous observations, many distant acting

TABLE 2

Mouse ABCA1 Gene Structure

ExonSize ofexon

Size ofintron Exon

Size ofexon

Size ofintron

1 219 .16,149 26 49 1712 149 .11,365 27 114 9573 94 4,030 28 149 15334 142 1,006 29 125 10325 119 .12,997 30 99 33226 122 1,982 31 190 8097 177 11,435 32 95 11228 93 2,616 33 33 9719 241 2,336 34 105 8251

10 140 339 35 75 47711 117 3,609 36 170 115612 198 692 37 178 281113 206 536 38 116 11114 177 445 39 145 153715 223 1,574 40 124 .227316 222 952 41 130 23017 205 1,082 42 121 71218 114 1,457 43 63 71419 172 923 44 107 195920 132 1,302 45 142 32821 143 179 46 135 118122 138 628 47 104 51923 221 1,240 48 93 68224 73 873 49 244 126025 203 1,699 50 1145

regulatory elements identified experimentally when

ags ere

70 QIU ET AL.

subjected to comparative genomic analysis tend to becomposed of long sequences (.100 bp in length) thatare highly conserved among mammals (.70% identity)

FIG. 1. Physical map of the 200-kb human ABCA1 gene region anre indicated by solid boxes. The thin black arrows indicate the correene is indicated by a thicker vertical arrow. The broken parts on tequence. The two BACs used for transgenic study are also shown h

FIG. 2. VISTA plot of the human and mouse sequence comparison.percentage identity between human and mouse. The 3 horizontal lines rep

and .75% identity) are highlighted under the curve, with pink indicating a c

(Li et al., 1999; Loots et al., 2000). In this study, wechose higher stringency criteria of 120 bp and 75%identity to define conserved noncoding elements. Our

orresponding mouse region. The 50 exons of the human ABCA1 genending mouse ABCA1 gene exons. The ATG start codon of the ABCA1ines representing human and mouse sequences are the gaps in the.

X-axis represents the human base sequence; the Y-axis represents theent 50%, 75%, and 100% identities. Conserved regions (.120 bp in length

d cspohe l

Theres

onserved noncoding region and lavender indicating a conserved exon.

71COMPARISON OF HUMAN AND MOUSE ABCA1

criteria with a fairly high stringency were chosen toeliminate nonspecific conserved elements. Based onthese criteria, 32 conserved noncoding sequences(CNSs) were identified. Among them, 11 CNSs arelocated at the 59 region, 20 CNSs are in the intronregion, and 1 CNS is located at the 39 end of the ABCA1gene (Table 3). Figure 3 shows the locations of theCNSs. Among the 32 elements identified, CNS1 andCNS2, the two largest highly conserved elements, werechosen for further analysis.

CNS1, demonstrating 88% identity of 498 bp be-tween human and mouse, is located 59 of exon 38. Toexplore the interspecies conservation of this element,the intron 37 region of the ABCA1 gene in rat, dog,rabbit, bovine, and porcine was amplified using theprimers in the flanking exons 37 and 38. The CNS1element was found to be conserved in the samegenomic location (Fig. 4A) in rat, dog, rabbit, bovine,and porcine with 79–88% homology. Evidence suggest-ing that CNS1 is not expressed includes the following:(1) there is no large open reading frame in this 578-bpsequence, with the largest open reading frame being169 bp for human and 111 bp for mouse; (2) geneidentification programs such as GenScan and Grailfailed to identify any obvious splice site at intron 37; (3)a search of both human and mouse EST databases atNCBI failed to detect this element; and (4) PCR usingprimers in ABCA1 exons 36 and 37 to amplify cDNAfrom mouse liver, kidney, and spleen failed to detect asecond PCR product (data not shown).

We used the online program of the transcrip-tion factor database Transfac (http://transfac.gbf.de/TRANSFAC/ (Wingender et al., 2000)) to search for aconsensus binding site for various transcription factorsin the CNS1 element (578 bp) in both mouse and hu-man. This region contains potential binding sites forthe ubiquitously expressed transcription factorsNF-kB and activator proteins (3 AP-1 and 1 AP-4).Both human and mouse sequences have three con-served potential binding motifs for the CCAAT/enhanc-er-binding protein (C/EBP). C/EBP is a liver-enrichedtranscription factor that plays a pivotal role in liverfunctions (Takiguchi, 1998). One pair of GATA sites isidentified in both mouse and human sequences. Bothsequences also have three Sox-5- and two Oct-1-bind-ing sites conserved. Recent studies have provided nu-merous examples of cell type-restricted coregulation ofgene transcription by specific octamer and Sox factorpartner pairs. Other potential binding sites includemotifs for two SRY binding sites and two hepatic nu-clear factor HNF-3b binding sites both of which arearchitectural factors that introduce strong bends in thechromatin. HNF-3b is also a liver-enriched transacti-vating factor. Based on the sequence conservation andpotential transcription binding sites, CNS1 seems to bea good candidate for the study of the regulation ofABCA1. The potential transcription binding sites aremarked in Fig. 4A. To investigate the function of

CNS1, a 700-bp fragment containing CNS1 was cloned

in front of the SV-40 promoter, which drives the ex-pression of the reporter gene. The RAW cells weretransfected with this construct, and both enhancer andrepressor functions were tested in these transfectionexperiments. The cells were also supplemented withcholesterol or cAMP to test whether CNS1 would re-sponse to cholesterol or cAMP. However, the transfec-tion experiments failed to show that CNS1 has anenhancer or a repressor function or it would respond tocholesterol or cAMP stimulations.

CNS2 is located 59 immediately upstream of exon 1.It contains 214 bp of GC-rich sequence, and there is81% sequence identity between human and mouse. Weamplified and sequenced a 140-bp fragment (Fig. 4B)from dog, rat, rabbit, cow, and pig using the primersderived from the CNS2 region. Searching for potentialtranscription binding sites with MatInspector V2.2identified a TATA box, AP1, SP1, E box, and SRE site.The SRE site is a sterol regulatory element. A recentstudy has shown that the expression of the ABCA1gene can be regulated by steroids. CNS2 was shown tobe the ABCA1 promoter, which can be transactivatedby the LXR/RXR heterodimers and respond to choles-terol regulation (Costet et al., 2000; Schwartz et al.,

TABLE 3

List of Conserved Noncoding Sequences (CNSs)

Name of CNSsLength

(bp)% identity betweenmouse and human

Location relativeto the gene

CNS19 167 75 59CNS16 180 74 59CNS20 120 77 59CNS21 190 76 59CNS22 143 75 59CNS23 123 76 59CNS24 120 76 59CNS15 162 73 59CNS14 139 76 59CNS11 252 75 59CNS2 214 81 59CNS13 234 75 IntronCNS25 192 76 IntronCNS5 437 76 IntronCNS26 121 77 IntronCNS12 302 77 IntronCNS27 324 78 IntronCNS28 189 75 IntronCNS29 120 75 IntronCNS30 125 75 IntronCNS31 241 76 IntronCNS32 283 75 IntronCNS33 149 79 IntronCNS3 280 79 IntronCNS18 186 75 IntronCNS34 228 75 IntronCNS35 141 79 IntronCNS36 278 86 IntronCNS1 498 88 IntronCNS37 127 75 IntronCNS38 122 77 IntronCNS4 634 79 39

2000).

a

etTA(

72 QIU ET AL.

Expression of ABCA1 in Transgenic Mice

We have obtained four founder lines after introduc-ing human BAC 447M11 into mouse embryos and two

FIG. 3. Locations of the conserved CNSs in the human ABCA1region. The locations of CNSs are indicated by arrows. The two mostconserved CNSs are boxed.

founder lines from human BAC 336M11. BAC 447M11

contains 70 kb upstream of exon 1 and 35 kb down-stream of the ABCA1 gene, while BAC 336M11 startsfrom the intron 1 region and contains 13 kb upstreamof exon 2 and 35 kb downstream of the ABCA1 gene. Toassess the copy number of the human BAC in themouse genome, the genomic DNAs from each founderline were hybridized with the ABCA1 probe. Thegenomic DNA was digested with EcoRI and run on thegel. The probe used for hybridization was from exon 4of the ABCA1 gene. The mouse genomic DNA andhuman BAC would give different size fragments afterhybridization. The human BAC copy number in eachtransgenic line was estimated based on the intensity ofthe hybridization signals. The copy number was esti-mated to be 2, 3, 3, and 4 for the four lines from BAC447M11 and 2 for two lines from BAC 336M11.

The level of expression of the human transgene indifferent tissues was quantitatively assessed in twolines of mice generated from BACs 447M11 and336M11 in RT-PCR analysis (Figs. 5A and 5B). Thetransgenes from BAC 447M11 were expressed in allthe tissues examined (brain, kidney, liver, adrenals,intestine, and heart), and the levels of expression of thetransgenes were similar to the expression pattern ofthe endogenous gene except in intestine, with the tis-sue with the highest level of expression being the liver(Fig. 5A). The transgenes were expressed in intestineat a lower level compared with the endogenous mouseABCA1 gene. It is not clear what causes the lower levelof expression at this stage. This result indicates thatBAC 447M11 contains the regulatory sequences neces-sary for the proper expression of the gene in the tissuesexamined except in intestine. However, the two inde-pendent lines of transgenes derived from BAC 336M11are expressed only in liver among all the tissues exam-ined (Fig. 5B). This suggests the existence of an alter-native promoter in BAC 336M11 that confers tissuespecificity.

DISCUSSION

In the present study, we reported the sequences ofthe 200-kb human ABCA1 region and 278-kb mouseregion. The human ABCA1 gene spans 148 kb, andthe mouse gene spans 123 kb. Our sequences alsoinclude 34 and 20 kb of 59 and 39 noncoding se-quences for human and 87 and 68 kb, respectively,for the mouse. Previously the mouse ABCA1 genewas identified as having only 49 exons (Remaley et

l., 1999), and an additional exon at the 59 end of thehuman ABCA1 gene has been recently reported(Pullinger et al., 2000), which gives a total of 50xons for the human gene. We have used compara-ive analysis and identified the new mouse exon 1.he genomic organization of the mouse and humanBCA1 gene is similar to that of the ABCR gene

Allikmets et al., 1998), the closest member of theABCA transporter family. Each gene contained 50

exons and 49 introns. The intron sizes for the ABCA1

73COMPARISON OF HUMAN AND MOUSE ABCA1

gene varies from 111 bp to over 16 kb for mouse andfrom 111 bp to over 24 kb for human.

Using comparative sequence analysis of the humanand mouse genes, we have identified 32 conserved non-coding sequences that are potential regulatory ele-ments. The two most conserved elements, CNS1 andCNS2, were further investigated. CNS1 is located inintron 37 and is highly conserved in other mammals.

FIG. 4. (A) Sequence alignment of CNS1 in human, mouse, rat, dare indicated. (B) Sequence alignment of CNS2 in human, mouse, rasites are indicated.

The conservation of CNS1 between mouse and human

is 88% over 498 bp, which is the same as the overallconservation for the ABCA1 coding sequences. Analy-sis of the CNS1 sequence identifies multiple transcrip-tion binding motifs that are also strongly conservedbetween mouse and human. Several lines of evidencesuggest that CNS1 is not coding and given the natureand number of liver-enriched transcription factor bind-ing motifs that it contains, CNS1 would be a good

rabbit, porcine, and bovine. The potential transcription binding sitesog, rabbit, porcine, and bovine. The potential transcription binding

og,t, d

target to study the involvement in the regulation of the

isah

74 QIU ET AL.

ABCA1 gene. There have been several intronic regula-tory elements identified in other genes. These includean enhancer-silencing element in intron 2 of an embry-onic beta-type globin gene (Wandersee et al., 1996), anntronic enhancer essential for tissue-specific expres-ion of the aldolase B gene (Sabourin et al., 1996), andn intronic repressor element in the alpha-myosineavy chain gene (Gupta et al., 1998). Putative intronic

regulatory elements like CNS1 would be hard to iden-tify through classical promoter bashing experiments.The finding of CNS1 illustrates the power of compara-tive sequence analysis to identify noncoding sequenceswith a potential regulatory function. This noncodingsequence that is highly conserved among multiple spe-cies is now a prime candidate for functional analysis.

FIG. 5. Expression of the human transgene and mouse ABCA1genes in transgenic mice from BAC 447M11 (A) and BAC 336M11(B) as measured by TaqMan assay for the quantitation of RT-PCRproducts. Filled bars represent the expression of the human trans-gene relative to the 18S expression, and open bars represent that ofthe mouse gene relative to 18S expression. The values represent twoindependent lines of transgenic mice from both BACs and duplicatemeasurements of the RT-PCR products.

CNS1 failed to show enhancer or repressor function in

the transfection assay in RAW cells. However, a trans-fection assay is not always the best way to study thefunction of a putative regulatory element because reg-ulatory functions may depend on factors expressed incertain cell types and at certain times of development.Perhaps a better way to study CNS1 would be to deletethis element in transgenic mice and then study theexpression and regulation of the ABCA1 gene in differ-ent cell types. Loots et al. (2000) have used this ap-proach to show that the largest conserved noncodingsequence at the interleukin cluster of 5q31 appears toinvolve activation of cytokine genes, specifically in theTh2 cells, a regulatory function operating perhaps bymodulating chromatin structure, a mechanism forwhich there is no standard in vitro assay, suggestingthat this element would have been impossible to iden-tify using conventional transfection experiments.

The second most highly conserved element wasCNS2. CNS2 is also highly conserved in other mam-mals. Just after its identification through comparativesequence analysis in this study, it was reported that a1135-bp fragment that contains CNS2 acts as a pro-moter and is responsive to sterol regulation (Santama-rina-Fojo et al., 2000). Along this 1135-bp sequence,only the CNS2 region is highly conserved betweenmouse and human, and CNS2 has a consensus bindingsite for SREBP. These findings suggest that the 214-bpCNS2 element may be the component of the experi-mentally identified 1135-bp fragment possessing generegulatory activities. A recent study identified a bind-ing site (Costet et al., 2000; Schwartz et al., 2000) thatfalls in the CNS2 region for nuclear hormone receptorsof the LXR/RXR, which are known to be activated byoxysterols and to mediate a positive response by bind-ing specific DNA elements. Mutation of the LXR/RXRbinding site (TGACCGATAGTAACCT) in the CNS2region was shown to abolish the sterol-mediated acti-vation of the promoter (Costet et al., 2000; Schwartz etal., 2000). The regulation of the ABCA1 gene is com-plex since the gene has been reported to have functionsrelated to processes other than cholesterol efflux. Theconservation in the 214-bp CNS2 region other than theLXR/RXR binding element suggests that this regionmight be involved in other regulatory functions as well.The identification of CSN2 serves as a proof of principleof the comparative sequencing to identify functionalregulatory elements. The 32 noncoding elements withmore than 120 bp and 75% identity identified in ourstudy also serve as candidates for regulatory elements.

The transgenic study from the BAC containing 70and 35 kb of the 59 and 39 flanking regions of theABCA1 gene has shown that the human ABCA1 trans-gene is expressed in mouse in the same tissues as theendogenous gene despite different copy numbers. Thehuman transgene used in these studies expresses in amanner that is independent of the site of integration.This suggests that the sequences used in these studieslikely contain the regulatory elements necessary for

the proper expression of the gene. Overexpression of

icPFihsloA

B

B

B

B

B

C

E

E

F

G

G

L

L

L

L

L

L

L

L

M

M

75COMPARISON OF HUMAN AND MOUSE ABCA1

the ABCA1 gene has been shown to increase ApoA1-mediated cholesterol efflux in cultured cells. An in-creased level of cholesterol efflux observed in macro-phages of these transgenic mice (Cavelier et al., inpreparation) further supports the notion that we havean animal model in hand with which to study the invivo effect of overexpression of ABCA1. The heterozy-gous ABCA1/null mice show a proportional decrease inHDL values (McNeish et al., 2000). It has not yet beenproven whether overexpression of ABCA1 in vivowould increase the rate of HDL formation and wouldprotect against atherogenesis. These transgenic lineswill be of great value in evaluating the therapeuticvalue of increasing HDL to prevent atherogenesis.

The transgenic study from the BAC containing ashorter 59 region without the sterol responsive pro-moter and exon 1 has shown that there is likely asecond promoter in the intron 1 region that results inthe liver-specific expression of the human ABCA1transgene. Previous studies have failed to identify thispromoter because the cDNAs used for 59 RACE todentify transcription start sites were made from pla-ental RNA or the THP1 cell line (Costet et al., 2000;ullinger et al., 2000; Santamarina-Fojo et al., 2000).urther study to identify the sequence of this promoter

s under way. The function of ABCA1 in macrophagesas been well studied; however, it is not well under-tood what role ABCA1 plays in liver. These transgenicines that overexpress the human ABCA1 transgenenly in liver may give insight into the regulation of theBCA1 gene in liver.

ACKNOWLEDGMENTS

This work was supported by NIH grants HL63897-01 andHL66728-01, the Swedish Medical Research Council and the Knutand Alice Wallenberg Stiftelse for LBC postdoctoral fellowships.Research was conducted at the E.O. Lawrence Berkeley NationalLaboratory and performed under Department of Energy ContractDE-AC0376SF00098, University of California.

REFERENCES

Allikmets, R., Wasserman, W. W., Hutchinson, A., Smallwood, P.,Nathans, J., Rogan, P. K., Schneider, T. D., and Dean, M. (1998).Organization of the ABCR gene: Analysis of promoter and splicejunction sequences. Gene 215: 111–122.

Batzoglou, S., Pachter, L., Mesirov, J., Berger, B., and Lander, E. S.(2000). Comparative Analysis of Mouse and Human DNA andApplications to Exon Prediction. Genome Res. 10: 950–958.

odzioch, M., Orso, E., Klucken, J., Langmann, T., Bottcher, A.,Diederich, W., Drobnik, W., Barlage, S., Buchler, C., Porsch-Ozcu-rumez, M., Kaminski, W. E., Hahmann, H. W., Oette, K., Rothe,G., Aslanidis, C., Lackner, K. J., and Schmitz, G. (1999). The geneencoding ATP-binding cassette transporter 1 is mutated in Tang-ier disease. Nat. Genet. 22: 347–351.roccardo, C., Luciani, M., and Chimini, G. (1999). The ABCA sub-class of mammalian transporters. Biochim. Biophys. Acta. 1461:395–404.rooks-Wilson, A., Marcil, M., Clee, S. M., Zhang, L. H., Roomp, K.,van Dam, M., Yu, L., Brewer, C., Collins, J. A., Molhuizen, H. O.,

Loubser, O., Ouelette, B. F., Fichter, K., Ashbourne-Excoffon,

K. J., Sensen, C. W., Scherer, S., Mott, S., Denis, M., Martindale,D., Frohlich, J., Morgan, K., Koop, B., Pimstone, S., Kastelein,J. J., and Hayden, M. R. (1999). Mutations in ABC1 in Tangierdisease and familial high-density lipoprotein deficiency. Nat.Genet. 22: 336–345.rown, M. S., and Goldstein, J. L. (1997). The SREBP pathway:Regulation of cholesterol metabolism by proteolysis of a mem-brane-bound transcription factor. Cell 89: 331–340.urge, C., and Karlin, S. (1997). Prediction of complete gene struc-tures in human genomic DNA. J. Mol. Biol. 268: 78–94.

ostet, P., Luo, Y., Wang, N., and Tall, A. R. (2000). Sterol-depen-dent transactivation of the ABC1 promoter by the liver X receptor/retinoid X receptor. J. Biol. Chem. 275: 28240–28245.wing, B., and Green, P. (1998). Base-calling of automated se-quencer traces using phred. II. Error probabilities. Genome Res. 8:186–194.wing, B., Hillier, L., Wendl, M. C., and Green, P. (1998). Base-calling of automated sequencer traces using phred. I. Accuracyassessment. Genome Res. 8: 175–185.

ielding, C. J., and Fielding, P. E. (1995). Molecular physiology ofreverse cholesterol transport. J. Lipid Res. 36: 211–228.ordon, D., Abajian, C., and Green, P. (1998). Consed: A graphicaltool for sequence finishing. Genome Res. 8: 195–202.upta, M., Zak, R., Libermann, T. A., adnGupta, M. P. (1998).Tissue-restricted expression of the cardiac alpha-myosin heavychain gene is controlled by a downstream repressor element con-taining a palindrome of two ets-binding sites. Mol. Cell. Biol. 18,7243–7258.

angmann, T., Klucken, J., Reil, M., Liebisch, G., Luciani, M. F.,Chimini, G., Kaminski, W. E., and Schmitz, G. (1999). Molecularcloning of the human ATP-binding cassette transporter 1 (hABC1):Evidence for sterol-dependent regulation in macrophages. Bio-chem. Biophys. Res. Commun. 257: 29–33.

awn, R. M., Wade, D. P., Garvin, M. R., Wang, X., Schwartz, K.,Porter, J. G., Seilhamer, J. J., Vaughan, A. M., and Oram, J. F.(1999). The Tangier disease gene product ABC1 controls the cel-lular apolipoprotein-mediated lipid removal pathway. J. Clin. In-vest. 104: R25–R31.

ehmann, J. M., Kliewer, S. A., Moore, L. B., Smith-Oliver, T. A.,Oliver, B. B., Su, J. L., Sundseth, S. S., Winegar, D. A., Blanchard,D. E., Spencer, T. A., and Willson, T. M. (1997). Activation of thenuclear receptor LXR by oxysterols defines a new hormone re-sponse pathway. J. Biol. Chem. 272: 3137–3140.

i, Q., Harju, S., and Peterson, K. R. (1999). Locus control regions:Coming of age at a decade plus. Trend Genet. 15: 403–408.

oots, G. G., Locksley, R. M., Blankespoor, C. M., Wang, Z. E., Miller,W., Rubin, E. M., and Frazer, K. A. (2000). Identification of acoordinate regulator of interleukins 4, 13, and 5 by cross-speciessequence comparisons. Science 288: 136–140.

opez, D., and McLean, M. P. (1999). Sterol regulatory element-binding protein-1a binds to cis elements in the promoter of the rathigh density lipoprotein receptor SR-BI gene. Endocrinology 140:5669–5681.

uciani, M. F., and Chimini, G. (1996). The ATP binding cassettetransporter ABC1 is required for the engulfment of corpses gen-erated by apoptotic cell death. EMBO J. 15: 226–235.

uciani, M. F., Denizot, F., Savary, S., Mattei, M. G., and Chimini, G.(1994). Cloning of two novel ABC transporters mapping on humanchromosome 9. Genomics 21: 150–159.ayor, C., Brudno, M., Schwartz, J. R., Rubin, E. M., Frazer, K. A.,Pachter, L. S., and Dubchak, I. (2000). VISTA: VISualization toolfor alignments. Submitted for publication.cNeish, J., Aiello, R. J., Guyot, D., Turi, T., Gabel, C., Aldinger, C.,Hoppe, K. L., Roach, M. L., Royer, L. J., de Wet, J., Broccardo, C.,Chimini, G., and Francone, O. L. (2000). High density lipoprotein

deficiency and foam cell accumulation in mice with targeted dis-

P

P

P

R

R

R

S

S

S

S

T

T

U

V

W

W

W

76 QIU ET AL.

ruption of ATP-binding cassette transporter-1. Proc. Natl. Acad.Sci. USA 97: 4245–4250.

Orso, E., Broccardo, C., Kaminski, W. E., Bottcher, A., Liebisch, G.,Drobnik, W., Gotz, A., Chambenoit, O., Diederich, W., Langmann,T., Spruss, T., Luciani, M. F., Rothe, G., Lackner, K. J., Chimini,G., and Schmitz, G. (2000). Transport of lipids from Golgi toplasma membrane is defective in Tangier disease patients andAbc1-deficient mice. Nat. Genet. 24: 192–196.

achter, L. (1999). “Domino Tiling, Gene Recognition and Mice,”Ph.D. Thesis, MIT.

eet, D. J., Turley, S. D., Ma, W., Janowski, B. A., Lobaccaro,J.-M. A., Hammer, R. E., and Mangelsdorf, D. J. (1998). Choles-terol and bile acid metabolism are impaired in mice lacking thenuclear oxysterol receptor LXRa. Cell 93: 693–704.

ullinger, C. R., Hakamata, H., Duchateau, P. N., Eng, C., Aouiz-erat, B. E., Cho, M. H., Fielding, C. J., and Kane, J. P. (2000).Analysis of hABC1 gene 59 end: Additional peptide sequence, pro-moter region, and four polymorphisms. Biochem. Biophys. Res.Commun. 71: 451–455.emaley, A. T., Rust, S., Rosier, M., Knapper, C., Naudin, L., Broc-cardo, C., Peterson, K. M., Koch, C., Arnould, I., Prades, C., Du-verger, N., Funke, H., Assman, G., Dinger, M., Dean, M., Chimini,G., Santamarina-Fojo, S., Fredrickson, D. S., Denefle, P., andBrewer, H. B., Jr. (1999). Human ATP-binding cassette trans-porter 1 (ABC1): Genomic organization and identification of thegenetic defect in the original Tangier disease kindred. Proc. Natl.Acad. Sci. USA 96: 12685–12690.epa, J. J., Turley, S. D., Lobaccaro, J. M. A., Medina, J., Li, L.,Lustig, K., Shan, B., Heyman, R. A., Dietschy, J. M., and Mangels-dorf, D. J. (2000). Regulation of absorption and ABC1-mediatedefflux of cholesterol by RXR heterodimers. Science 289: 1524–1529.ust, S., Rosier, M., Funke, H., Real, J., Amoura, Z., Piette, J. C.,Deleuze, J. F., Brewer, H. B., Duverger, N., Denefle, P., and Ass-mann, G. (1999). Tangier disease is caused by mutations in thegene encoding ATP-binding cassette transporter 1. Nat. Genet. 22:352–355.

abourin, J. C., Kern, A. S., Gregori, C., Porteu, A., Cywiner, C.,

Chatelet, F. P., Kahn, A., and Pichard, A. L. (1996). An intronic

enhancer essential for tissue-specific expression of the aldolase Btransgenes. J. Biol. Chem. 271: 3469–3473.

antamarina-Fojo, S., Peterson, K., Knapper, C., Qiu, Y., Freeman,L., Cheng, J. F., Osorio, J., Remaley, A., Yang, X. P., Prades, C.,Chimini, G., Blackmon, E., Francois, T., Duverger, N., Rubin,E. M., Rosier, M., Denefle, P., Fredrickson, D. S., and Brewer, H. B.(2000). Complete genomic sequence of the human ABCA1 gene:Analysis of the human and mouse ATP-binding cassette A pro-moter. Proc. Natl. Acad. Sci. USA 97: 7987–7992.

chwartz, K., Lawn, R. M., and Wade, D. P. (2000). ABC1 geneexpression and ApoA-I-mediated cholesterol efflux are regulatedby LXR. Biochem. Biophys. Res. Commun. 274: 794–802.

eroussi, E., Pan, H. Q., Kedra, D., Roe, B., and Dumanski, J. P.(1998). Characterization of the human NIPSNAP1 gene from22q12: A member of a novel gene family. Gene 212: 13–20.

akiguchi, M. (1998). The C/EBP family of transcription factors inthe liver and other organs. Int. J. Exp. Pathol. 79: 369–391.

sui, M. M., and Banfield, D. K. (2000). Yeast Golgi SNARE inter-actions are promiscuous. J. Cell Sci. 113: 145–152.eda, Y., Royer, L., Gong, E., Zhang, J., Cooper, P. N., Francone, O.,and Rubin, E. M. (1999). Lower plasma levels and acceleratedclearance of high density lipoprotein (HDL) and non-HDL choles-terol in scavenger receptor class B type I transgenic mice. J. Biol.Chem. 274: 7165–7171.enkateswaran, A., Repa, J. J., Lobaccaro, J. M., Bronson, A., Man-gelsdorf, D. J., and Edwards, P. A. (2000). Human white/murineABC8 mRNA levels are highly induced in lipid-loaded macro-phages. A transcriptional role for specific oxysterols. J. Biol. Chem.275: 14700–14707.andersee, N. J., Ferris, R. C., and Ginder, G. D. (1996). Intronicand flanking sequences are required to silence enhancement of anembryonic beta-type globin gene. Mol. Cell. Biol. 16: 236–246.ingender, E., Chen, X., Hehl, R., Karas, H., Liebich, I., Matys, V.,Meinhardt, T., Pruss, M., Reuter, I., and Schacherer, F. (2000).TRANSFAC: An integrated system for gene expression regulation.Nucleic Acids Res. 28: 316–319.u, Y. C., and Horvitz, H. R. (1998). The C. elegans cell corpseengulfment gene ced-7 encodes a protein similar to ABC transport-

ers. Cell 93: 951–960.