Proc. Nati. Acad. Sci. USAVol. 88, pp. 4309-4312, May 1991Immunology

Human X-box-binding protein 1 is required for the transcription ofa subset of human class II major histocompatibility genes andforms a heterodimer with c-fos

(leucine zipper/antisense RNA/gene regulation)

SANTA JEREMY ONO*, HsIOU-CHI Liout, RUTH DAVIDONt, JACK L. STROMINGER*,AND LAURIE H. GLIMCHERt*Department of Biochemistry and Molecular Biology, Harvard University, 7 Divinity Avenue, Cambridge, MA 02138; and tDepartment of Cancer Biology,Harvard School of Public Health, and Department of Medicine, Harvard Medical School, Boston, MA 02115

Contributed by Jack L. Strominger, January 2, 1991

ABSTRACT A complementary DNA encoding a memberof the leucine-zipper class of proteins (human X-box-bindingprotein, hXBP-1) that binds to the 3' end ofthe conserved X box(X2) of the HLA-DRA major histocompatibility complex genewas recently described. Further gel-retardation analysis hasdemonstrated that hXBP-1 also binds to HLA-DPB X2 but notto other X2 sequences. Transient transfection of a mammalianexpression vector with the hXBP-1 cDNA inserted in theantisense orientation represses the surface expression ofHLA-DR and HLA-DP in Raji cells. Cotransfection of theantisense hXBP-1 vector with a HLA-DRA/chloramphenicolacetyltransferase (but not a HLA-DQB/chloramphenicol ace-tyltransferase) reporter plasmid decreases chloramphenicolacetyltransferase activity in Raji cells and in Y-interferon-treated HeLa cells relative to cells cotransfected with a controlantisense vector. Moreover, hXBP-1 is shown to form a stableheterodimer with the product of the c-fos protooncogene. Thesedata suggest that the hXBP-1 c-fos heterodimer is critical forthe transcription of a subset of the human class II majorhistocompatibility complex genes and that the regulatory mech-anisms for the different class II genes are distinct.

The major histocompatibility complex (MHC) class II mol-ecules determine immune responsiveness to foreign antigenvia thymic T-lymphocyte selection and peripheral presenta-tion of processed antigen (1-5). Seven genes in the HLA-Dregion of the human MHC encode the a- and B-chain poly-peptides that constitute the three class II isotypes in man:HLA-DP, HLA-DQ, and HLA-DR (6). Elucidating the reg-ulation of this closely linked set of genes is of great interest,as their gene products are indispensable for immunologichomeostasis and exhibit tissue-specific and developmentalregulation (6-8). Moreover, dysregulated expression ofthesemolecules in humans results in the bare lymphocyte syn-drome [a subset of severe combined immundeficiency(SCID)], and is hypothesized to trigger or exacerbate certainautoimmune diseases (9, 10).

Transfections into tissue-culture cells and studies usingtransgenic mice have localized important cis-acting se-quences required for B-cell specific and y-interferon-inducedexpression ofclass II genes to the 160-base pair (bp) proximalpromoter (11-15). Three conserved motifs (the W, X, and Yboxes) are found in the proximal promoters of all class IIgenes and are indispensable for their proper transcription(16-20). In addition, sequence-specific DNA-binding activi-ties for these elements have been identified, and some genesencoding these proteins have been cloned (21-24).

Screening of a human B-cell expression library with ahigh-affinity-labeled X-box target oligonucleotide resulted inthe isolation of a clone, hXBP-1, that encodes a member ofthe leucine-zipper class of proteins (21). The human X-box-binding protein 1 (hXBP-1) protein was shown to interactwith the 3' end of the X box (X2) of HLA-DRA (DRA), andencodes a protein with structural similarities to the c-fos andc-jun protooncogene products. Mutation of DRA X2 de-creased DRA promoter activity in transient transfections(21). These data strongly suggested, but did not prove, thatthe hXBP-1 protein was a component of the DRA transcrip-tion complex.

Additional gel-retardation analysis presented in this reportindicates that hXBP-1 also binds to the HLA-DPB (DPB) X2box but not to other X2 sequences. Data are also presentedthat indicate that hXBP-1 forms a stable heterodimer with thec-fos protooncogene product. Transient transfection of amammalian expression vector with the hXBP-1 cDNA in-serted in the antisense orientation decreased HLA-DR andHLA-DP cell-surface expression in Raji cells and markedlyinhibited DRA/chloramphenicol acetyltransferase (CAT)(but not DQB/CAT) activity in Raji cells and y-interferon-treated HeLa cells. These data indicate that hXBP-1 isrequired for the transcription of a subset of human class IIMHC genes and show divergence in the transcriptionalregulation of the different class II genes.

MATERIALS AND METHODSPlasmids and Transfections. The antisense hXBP-1 mam-

malian expression vector (pAhXBP-1) was constructed byremoving the hXBP-1 cDNA from pCDM8-hXBP-1 (21) bydigestion with Xba I followed by ligation into the Xba I siteofplasmid pRSV-2 [which contains the 3' Rous sarcoma virus(RSV) long terminal repeat and the simian virus 40 splice andpolyadenylylation sequences]. Plasmid pRSV2.Z was con-structed by first subcloning an 800-bp Dra I-Pst I fragmentfrom the BamHI Z fragment of Epstein-Barr virus intopBluescript II KS(+/-) followed by ligation to pRSV-2cleaved with Xba I and HindIII. Plasmid pHGCAT is apromoterless CAT plasmid. Raji cells were transiently trans-fected using DEAE-dextran and chloroquine as described(25-27), and HeLa cells were transfected using calciumphosphate (28).CAT Assays. CAT activity was determined from cell ex-

tracts from transfected cells by standard techniques and

Abbreviations: CAT, chloramphenicol acetyltransferase; mAb,monoclonal antibody; hXBP-1, human X-box-binding protein;MHC, major histocompatibility complex; X2, 3' end of the conservedX box; RSV, Rous sarcoma virus.

4309

The publication costs of this article were defrayed in part by page chargepayment. This article must therefore be hereby marked "advertisement"in accordance with 18 U.S.C. §1734 solely to indicate this fact.

Dow

nloa

ded

by g

uest

on

Aug

ust 1

0, 2

020

Proc. Natl. Acad. Sci. USA 88 (1991)

A X

0- 14i A-Protein OrI - oZCompetitor:Amt (ng)

XDRw~l~j

£3

.0

c:& i.? rXBP/FrpEnone XAx XDRc XDPIX XDQ{

10 50 10 50 10 50 10 50 1504,* gJi : i.**U

'4:#A 1 4 "'aI

NUCvi'LEAR xEXTRAC AJ

cmpe tI or lone DA X 1i XDPi XDF X DOQ;A'T1l, rign 10 50' 10 50 10 50 10 50 10 50

4k a 0 n a m k % o RM

9.0-

XD PeeXDP4

2 -4i 6x 7i)d0 *

FIG. 1. (A) hXBP-1 encodes a DNA-binding protein with binding specificity for the X box and interspace region of human class II DRA andDPB genes. Gel-retardation and competition assays were performed with radiolabeled DRAX or DPBX oligonucleotides, as described (21).Seven micrograms of protein from Raji nuclear extract, TrpE protein, or hXBP-1/TrpE protein lysates was incubated with 0.1 ng of radiolabeledoligonucleotide probe. Competitor DNAs tested were 10 or 50 ng of DPAX, DPBX, DQAX, DRAX, and AaX oligonucleotide as shown in Fig.2. (B) DPBX-binding activities in native Raji nuclear extract demonstrate similar binding specificity to that of hXBP-1.

ascending TLC followed by autoradiography and liquid scin-tillation counting, as described (29).Flow Cytometric Analysis. After transfection, the cells were

allowed to grow for 48 hr at 370C. Five million cells from eachtransfection were washed three times with phosphate-buffered saline and incubated with saturating primary anti-body [control P3 and the monoclonal antibodies (mAbs):W6/32 (anti-class I framework), LB3.2 (anti-HLA-DR),Genox 3.53 (anti-HLA-DQ), and B7/21 (anti-HLA-DP)].After washing, fluorescein isothiocyanate-conjugated goatanti-mouse immunoglobulin was used to detect binding of theprimary antibody to the transfected cells. Surface expressionof the MHC molecules was analyzed by measuring fluores-cence intensity on individual cells by using an Epics-Cfluorescence-activated cell sorter.

Gel Mobility-Shift Assays. Protein-DNA complexes wereresolved from free 32P-radiolabeled double-stranded oligonu-cleotides by electrophoresis through polyacrylamide gelsfollowed by autoradiography. DNA-binding reactions andsalt conditions are as described (21).In Vitro Transcription and Translation. An hXBP-1 sub-

fragment was generated by PCR so that the resulting fragmentcontains an RSV Kozak sequence and amino acid residues38-263 ofhXBP-1. This hXBP-1 subfragment was cloned intothe Xba I site of pBluescript KS for in vitro expressionstudies. In vitro transcription and translation were carried outusing both the mCAP mRNA capping kit (Stratagene) andrabbit reticulocyte lysate (Promega) as recommended by themanufacturers. T7fos and T7jun constructs were described(37).

Immunoprecipitation. hXBP-1, c-fos and c-jun proteinswere either cotranslated or translated individually and coin-cubated at 370C for 30 min before immunoprecipitation. Themixed translated proteins were then added to 150 ,ul ofice-cold RIPA buffer (10 mM Tris, pH 7.5/150 mM NaCI/1%Nonidet P-40/0.1% SDS/1 mM EDTA/10 mM KCI) and 15,ul of protein G affinity-purified anti-hXBP-1 antibody andincubated at 40C for 60 min with shaking. After addition of 100,uL of 50% protein A-Sepharose and incubation for 60 min at40C, the Sepharose beads were washed three times withRIPA buffer, resuspended in protein-loading buffer, andresolved on a 12.5% SDS/PAGE gel.

RESULTS AND DISCUSSIONGel-retardation assays using X2 sequences from the varioushuman class II genes demonstrated that the hXBP-1 fusionprotein bound to DPB X2 as well as to DRA X2 (while notbinding to the DRB, DQA, DQB, and DPA X2 probes) (Fig.1, and data not shown). Inspection of the X2 sequencesreveals variable degrees of sequence homology; DRA and'DPB X2 sequences show the greatest similarity (Fig. 2).A RSV-derived mammalian expression vector was con-

structed to express high levels of antisense hXBP-1 RNA.The entire hXBP-1 cDNA was removed from pCDM8-hXBP-1 by digestion withXba I and was inserted into the XbaI site ofpRSV-2 (between the 3' RSV long terminal repeat andthe simian virus 40 splice and polyadenylylation sequences).A plasmid with the hXBP-1 cDNA in the antisense orienta-tion (pAhXBP-1) was identified by dideoxynucleotide chain-termination sequencing with an oligonucleotide primer fromthe RSV long terminal repeat (Fig. 3A).pAhXBP-1 and a control antisense vector pRSV2.Z

(pRSV-2 containing the 5' end of the Epstein-Barr virusBZLF1 gene in the antisense orientation, constructed by D.Williams, Harvard University) was introduced into theB-lymphoblastoid cell line Raji by transfection using DEAE-dextran and chloroquine (25-27). The levels of expression ofthe three major isotypes ofhuman class II antigens, DR, DQ,and DP, were measured by fluorescein-activated cell sortingusing mAbs specific for each isotype (Fig. 3B). Reproducibly10-15% of Raji cells transiently transfected with pAhXBP-1expressed decreased levels of HLA-DR and HLA-DP anti-gen. This degree of efficiency compares with that seen in

X Box IntersaaceDRAXDRBXDPAXDPBXDOAXDQBX

CCTAGCAACAGATGCGTCATCTCAAAAACCAGCAACTGATGATGCTATTGAACTCCCAGCAACAGAGAATGTCAGCTCTATCCTAGTGAGCAATGACTGATACAAAGCGCTAGTAACTGAGATGTCACCATGGGGCCCAGAGACAGATGAGGTCCTTCAGCT

FIG. 2. Comparison of the X box and interspace regions amongsix human class II MHC promoters. Probes used in the gel-retardation assays of Fig. 1 are as indicated.

4310 Immunology: Ono et al.

Dow

nloa

ded

by g

uest

on

Aug

ust 1

0, 2

020

Proc. Natl. Acad. Sci. USA 88 (1991) 4311

A Xbal DRA300CATXbal

RSV LTR hXBP1lc AcDNA3' 5' SV40 Splice

+poly A

B

Control Class HLA-DR HLA-DQ HLA-DPAntisenseFi 77 77C7Di7,,

Antisensehxbp 1

Fluorescence Intensity

FIG. 3. Down-regulation of cell-surface HLA-DR and HLA-DPexpression on Raji cells transiently transfected with pAhXBP-1. (A)Map of plasmid pAhXBP-1. LTR, long terminal repeat; SV40, simianvirus 40. (B) Flow cytometric analysis of Raji cells transfected witha control antisense vector and pAhXBP-1. Raji cells were transfectedwith plasmid DNA as described (25-27). Arrows, decreased levels ofHLA-DR and HLA-DP antigens.

several other systems using antisense vectors (S.J.O. andJ.L.S., unpublished data). In contrast, expression ofHLA-DQ and class I antigen was unaffected by pAhXBP-1transfection. Transfection with the control vector pRSV2.Zdid not affect the expression of any of the MHC molecules.A cotransfection assay was also used to examine the role

of hXBP-1 in class II gene transcription. Fifteen microgramsof either pAhXBP-1 or pRSV2.Z was cotransfected with 3 ,4gof either pDRA300CAT or pDQB160CAT into Raji cells(number in plasmit designates the number of nucleotidesupstream of the transcription initiation sites for the DRA andDQB genes cloned in front of the CAT gene (28, 29).Cotransfection ofpAhXBP-1 reduced pDRA300CAT activityin Raji cells to 43% of that in cells transfected with pRSV2.Zbut did not affect pDQB160CAT activity (Fig. 4). Cotrans-fection of pAhXBP-1 also decreased y-interferon-inducedpDRA300CAT activity to 38% of that obtained from cotrans-fection with pRSV2.Z (Fig. 5).As some members of the leucine zipper class of proteins

form heterodimers, immunoprecipitation experiments with invitro-translated hXBP-1, c-fos and c-jun proteins were per-formed to investigate potential complex formation betweenthese proteins. Antiserum immunoreactive with hXBP-1, butnot c-fos or c-jun, immunoprecipitated both hXBP-1 andc-fos from a mixture ofthese proteins, indicating that hXBP-1forms a stable heterodimer with c-fos in vitro (Fig. 6). hXBP-1was unable to form a complex with c-jun (data not shown).Two different assay systems (flow cytometric analysis of

surface-antigen expression and cotransfection with reporterplasmids) have demonstrated that hXBP-1 is critical for both

DRA300CAT DQB1 60CAT

A0T

+a.s.hxbpl;4ck +ylFN

I I

+a.s.BZLFI/+yI FN

11

*e * ..*FIG. 5. Inhibition of y-interferon-induced DRA promoter activity

in HeLa cells. HeLa cells were transiently cotransfected with thereporter plasmid pDRA300CAT and the indicated effector plasmid.HeLa cells were transfected as described (28). At 36 hr aftertransfection, y-interferon was added to a final concentration of 400units per ml. CAT activity was measured 48 hr after addition ofy-interferon. a.s.hxbpl, antisense hXBP-1; a.s.BZLFI, controlantisense vector pRSV2.Z.

constitutive and inducible expression of a subset of class IIgenes. Gel-retardation analysis shows that the hXBP-1 fusionprotein can bind to the DRA and DPB X2 boxes in vitro butcannot bind to the X2 boxes in the other human class II genes.These data are in agreement with previous gel-retardationassays that suggested that multiple X-box-binding proteinsdiscriminate between the different class II promoters (19,30-33). The demonstration in vivo that hXBP-1 regulates onlya subset of the class II genes is direct evidence that thedifferent class II genes use different transcription factors.The demonstration that hXBP-1 forms a stable heterodimerwith c-fos in vitro raises the question whether this complexforms in vivo and whether it constitutes an additional acti-vating complex. The demonstration that transient expressionof antisense c-fos RNA inhibits the transcription of the sameclass II MHC genes regulated by hXBP-1 (38) stronglysupports this concept.

Transloted andLoaded directly oxhXBP-l Ab &hXBP-1 Ab

--l -- CO-'--'C'1~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~\ .&

7.t--wF'~:a...~~~~~~~~(.C

Al

4- 9: '9:

% zS C-C':

* * * *

FIG. 4. Specific inhibition of constitutive or y-interferon-inducedexpression of the DRA promoter by antisense hXBP-1 RNA, mea-

sured by CAT activity. Raji cells were transiently cotransfected witha reporter plasmid (either pDRA300CAT or pDQB160CAT) and withan effector plasmid, as indicated. CAT activity was measured as

described (29).

1 2 3 4 S 6 7 8

FIG. 6. hXBP-1 forms a heterodimer with c-fos in vitro. In vitrotranscription and translation was performed as before (37). Lanes:1-3, fos, hXBP-1, and jun translated and loaded directly; 4-6, sameas lanes 1-3 but after immunoprecipitation with ahXBP-1 rabbitantiserum; 7, hXBP-1 and fos cotranslated and then immunoprecip-itated with ahXBP-1 antibody; 8, hXBP-1 (unlabeled) and fos (la-beled) translated and then mixed and immunoprecipitated withanti-hXBP-1 antibody.

Immunology: Ono et A

Dow

nloa

ded

by g

uest

on

Aug

ust 1

0, 2

020

Proc. Natl. Acad. Sci. USA 88 (1991)

Three conclusions stem from these demonstrations. (i)Additional factors that regulate the other members of theclass II multigene family still need to be identified and theirgenes cloned. (ii) The issue of differential expression of theclass II isotypes in vivo warrants a closer analysis in relationto possible divergence in the biological function of theisotypes (34-36). (iii) Antisense constructs ofcDNAs encod-ing putative gene-specific transcription factors, coupled withsuitable assays, provide a useful method of assessing incultured cells the functional importance of these clonedDNA-binding proteins in the transcription of a specific gene.

We thank the members of the Glimcher, Melton, Maniatis, andStrominger laboratories for helpful suggestions and encouragement.We thank Jenny Ting for the plasmid pDRA300CAT and DimitrisThanos of the Maniatis laboratory for stimulating discussions. Thiswork was supported by National Institutes of Health Grant GM36864and a Leukemia Scholar Award (L.H.G.), by National Institutes ofHealth Grants DK-30241 and CA-47554 (J.L.S.), and by the HelenHay Whitney Foundation (S.J.O.).

1. Benacerraf, B. (1981) Science 212, 1229-1238.2. Kappes, D. J. & Strominger, J. L. (1988) Annu. Rev. Biochem.

57, 991-1028.3. Bjorkman, P. J., Saper, M. A., Samraoui, B., Bennett, W. S.,

Strominger, J. L. & Wiley, D. C. (1987) Nature (London) 329,506-512.

4. Pullen, A. M., Marrack, P. & Kappler, J. W. (1988) Nature(London) 335, 7%-801.

5. Finkel, T. H., Cambier, J. C., Kubo, R. T., Born, W. K.,Marrack, P. & Kappler, J. W. (1989) Cell 58, 1047-1054.

6. Kaufman, J. F., Auffray, C., Korman, A. J., Shakelford, D. A.& Strominger, J. L. (1984) Cell 36, 1-13.

7. Bottazzo, G. F., Todd, I., Mirakian, R., Belfiore, A. & Pujol-Borrell, R. (1986) Immunol. Rev. 94, 137-169.

8. Matis, L. A., Glimcher, L. H., Paul, W. E. & Schwarz, R. H.(1983) Proc. Natl. Acad. Sci. USA 80, 6019-6023.

9. de Preval, C., Lisowska-Grospierre, B., Loche, M., Griscelli,C. & Mach, B. (1985) Nature (London) 318, 291-293.

10. Pujol-Borrell, R., Todd, I., Doshi, M., Bottazzo, G. F., Sutton,R., Gray, D., Adolf, G. R. & Feldmann, M. (1987) Nature(London) 326, 304-309.

11. Gillies, S. D., Folsom, V. & Tonegawa, S. (1984) Nature(London) 310, 594-598.

12. Finn, P. W., Kara, C. J., Douhan, J., III, Van, T. T., Folsom,V. & Glimcher, L. H. (1990) Proc. Natl. Acad. Sci. USA 87,914-918.

13. Miwa, K. & Strominger, J. L. (1987) Nucleic Acids Res. 15,8057-8067.

14. Sakurai, M. & Strominger, J. L. (1988) Proc. Natl. Acad. Sci.USA 85, 6909-6913.

15. Tseng, S. Y., Nakanishi, M. & Peterlin, B. M. (1988) Proc.Natl. Acad. Sci. USA 85, 8598-9602.

16. Miwa, K., Doyle, C. & Strominger, J. L. (1987) Proc. Natl.Acad. Sci. USA 84, 4939-4943.

17. Sherman, P. A., Basta, P. V. & Ting, J. P.-Y. (1987) Proc.Natl. Acad. Sci. USA 84, 4254-4258.

18. Boss, J. M. & Strominger, J. L. (1986) Proc. Natl. Acad. Sci.USA 83, 9139-9143.

19. Boothby, M., Liou, H. C. & Glimcher, L. H. (1989) J. Immu-nol. 142, 1005-1014.

20. Dorn, A., Fehling, H. J., Koch, W., LeMeur, M., Gerlinger,P., Benoist, C. & Mathis, D. (1988) Mol. Cell. Biol. 8, 3975-3987.

21. Liou, H. C., Boothby, M. R., Finn, P. W., Davidon, R., Na-bavi, N., Zeleznik-Le, N. J., Ting, J. P.-Y. & Glimcher, L. H.(1990) Science 247, 1581-1584.

22. Didier, D. K., Schiffenbauer, J., Woulfe, S. L., Zacheis, M. &Schwartz, B. D. (1988) Proc. Natl. Acad. Sci. USA 85, 7322-7326.

23. Liou, H. C., Boothby, M. R. & Glimcher, L. H. (1988) Science242, 69-71.

24. Reith, W., Barras, E., Satola, S., Kobr, M., Reinhart, D.,Herrero Sanchez, C. H. & Mach, B. (1989) Proc. NatI. Acad.Sci. USA 86, 4200-4204.

25. McCutchan, J. H. & Pagano, J. S. (1969) J. Natl. Cancer Inst.41, 351-357.

26. Luthman, H. & Magnusson, G. (1983) Nucleic Acids Res. 11,1295-1308.

27. Farrell, P. J., Rowe, D. T., Rooney, C. M. & Kouzarides, T.(1989) EMBO J. 8, 127-132.

28. Basta, P. V., Sherman, P. A. & Ting, J. P.-Y. (1988) Proc.NatI. Acad. Sci. USA 85, 8618-8622.

29. Sakurai, M. & Strominger, J. L. (1989) Tissue Antigens 34,64-77.

30. Celada, A. & Maki, R. A. (1989) Mol. Cell. Biol. 9, 3097-3100.31. Kobr, M., Reith, W., Herrero Sanchez, C. & Mach, B. (1990)

Mol. Cell. Biol. 10, 965-971.32. Reith, W., Satola, S., Kobr, D., Reinhart, C., Herrero Sanchez,

C. & Mach, B. (1988) Cell 53, 897-906.33. Liou, H. C., Ivashkiv, L. B., Kara, C. J. & Glimcher, L. H.,

in Transgenic Mice and Mutants in MHC Research (Springer,New York), in press.

34. Nishimoto, H., Kikutani, H., Yamamura, K. & Kishimoto, T.(1988) Nature (London) 328, 432-434.

35. Sasazuki, T. (1989) Cold Spring Harbor Symp. Quant. Biol. 54,69.

36. Ono, S. J., Bazil, V., Sugawara, M., Strominger, J. L. (1991)J. Exp. Med. 173, 629-638.

37. Ivashkiv, L. B., Liou, H. C., Kara, C. J., Lamph, W. W.,Verma, I. M. & Glimcher, L. H. (1990) Mol. Cell. Biol. 10,1609-1621.

38. Ono, S. J., Basil, V., Levi, B.-Z., Ozato, K. & Strominger,J. L. (1991) Proc. Natl. Acad. Sci. USA 88, 4304-4308.

4312 Immunology: Ono et al.

Dow

nloa

ded

by g

uest

on

Aug

ust 1

0, 2

020