Upload
others
View
4
Download
0
Embed Size (px)
Citation preview
魚 病 研 究 Fish Pathology, 40 (2), 67-71, 2005.6 2005 The Japanese Society of Fish Pathology
I dentification and Pathogenicity of Intracellular
Francisella Bacterium in Three-line Grunt
Parapristipoma trilineatum
Takashi Kamaishi1*, Yutaka Fukuda2, Masaru Nishiyama3,5, Hidemasa Kawakami4,
Tomomasa Matsuyama1, Tomoyoshi Yoshinaga1,6 and Norihisa Oseko1
1National Research Institute of Aquaculture, Fisheries Research Agency, Nansei, Mie 519-0193, Japan
2Fisheries Research Institute, Oita Prefectural Agriculture, Forestry and Fisheries Research Center,
Kamiura, Oita 879-2602, Japan
3Kochi Prefectural Sukumo Fisheries Guidance Station, Sukumo, Kochi 788-0265, Japan
4Ehime Prefectural Fish Disease Control Center, Uwajima, Ehime 798-0087 Japan
5Present address: Kochi Prefectural Government Fisheries Promotion Section,
Marunoushi, Kochi 780-0850, Japan
6Present address: Department of Aquatic Bioscience, Graduate School of Agricultural
and Life Sciences, The University of Tokyo, Bunkyo, Tokyo 113-8657, Japan
(Received February 3, 2005)
ABSTRACT-Bacteriological examination was conducted on the disease of cultured marine fish,
three-line grunt Parapristipoma trilineatum (Japanese common name: isaki). The affected fish
characteristically showed white spots of granulomas containing an intracellular bacterium in the kid
ney and spleen. Total DNA was extracted from the kidney of the diseased fish. The coding
region of small subunit ribosomal RNA (16S rDNA) of eubacteria was amplified from the DNA by
PCR, and nucleotide sequence was determined. The sequenced 16S rDNA revealed high similar
ity (97.3-98.5%) to those of Francisella species. On the basis of phylogenetic analysis, the clos
est relative organism was revealed to be Francisella philomiragia. A bacterium was isolated from
the spleen of one affected fish using cystine heart agar medium with 1% hemoglobin. The 16S
rDNA sequence of the isolated bacterium was consistent with that determined from the kidney tis
sue of the affected fish. An experimental infection with the isolate exhibited the same disease
signs in the injected fish, and the bacterium was reisolated from these fish. These results demon
strate that the intracellular bacterium is pathogenic and is identified to the genus Francisella This
is the first report of pathogenic Francisella from marine fish.
Key words: granuloma, intracellular bacterium, 16S rDNA, Francisella, Parapristipoma trilineatum
Mortality of cultured three-line grunt Parapristipoma
trilineatum (Japanese common name: isaki) has been
occurring sporadically in Kyushu and Shikoku districts,
Japan since autumn in 1999 (Fukuda et al., 2002).
These fish had been imported from China or produced
from the imported brood fish. According to Fukuda et
al. (2002), external signs of diseased fish are hemor
rhage in the body surface, gill and ventral part. Internal
signs are white foci scattered in the kidney, spleen and
sometimes liver. These white foci are composed of
granuloma. An intracellular organism was detected in
the internal organs of affected fish. This organism was
suggested to be a coccoid Gram-negative bacterium
from the results of histological observations on tissue
imprints, but it could not be isolated using general bacte
rial media (Fukuda et al., 2002). The cause of the mor
tality was suggested to be attributed to the infection of
the intracellular bacterium, because isaki intraperito
neally injected with a spleen homogenate of diseased
fish died with granulomas containing the intracellular
bacterium (Fukuda et al., 2002).
In this study, the coding region of small subunit ribo
somal RNA (16S rDNA) sequence of the suspected bac
terium was determined and the phylogenetic relationship
was inferred. The isolation and cultivation of the bacte-
*Corresponding author
E-mail: [email protected]
68 T.Kamaishi,Y.Fukuda,M.Nishiyama,H.Kawakami,T.Matsuyama,T.Yoshinaga and N.Oseko
rium was performed by referring to the cultivation
method for the close relatives,which were inferred from
phylogenetic analysis. Furthermore,the isolated bacte
rium was injected into fish to confirm the etiology of the
disease.
Materials and Methods
Fish employed
For DNA extraction and histological observation,
spontaneously diseased isaki were collected from
aquaculture facilities in Oita Prefecture on 29 October
1999 and Kochi Prefecture on 13 November 2000,
Japan. For isolation of the bacterium,a moribund isaki
(body weight:127g)was collected from a nursery pond on 23 October 2001 at Uwajima,Ehime Prefecture,
Japan. The disease occurred from zero years old fish
of 10g or less to three years old fish of 500g or more,
regardless of age and weight of the fish. These fish
had been imported from China. Healthy isaki used for
an experimental infection were provided from Fisheries
Research Institute,Oita Prefectural Agriculture,Forestry
and Fisheries Research Center,where the fish were arti
ficially bred from native brood stock.
1 6S rDNA sequencing and phylogenetic analysis
Genomic DNA was extracted from the frozen kidney
(50mg)of one diseased fish by a general method using
proteinase K and phenol-chloroform(Sambrook et al.,
1989). 16S rDNA was amplified by using the universal
primers for eubacteria;EubA(AAGGAGGTGATC
CANCCRCA)and EubB(AGAGTTTGATCMTGGC
TCAG)(Giovannoni,1991). The expression of the
primer sequence is based on the IUPAC code. Cycling
conditions for the PCR were 94℃(30 sec),55℃(30
sec)and 72℃(1min)for 30 cycles. The amplified frag
ment was purified,ligated with the plasmid vector pDrive
(QIAGEN),and applied for nucleotide sequencing. The
16S rRNA sequences of eubacterial species were
aligned. Evolutionary distances were calculated by the
method of Kimura's two-parameter model. 16S rDNA
tree was inferred by the neighbor-joining(NJ)method.
The phylogenetic analyses were carried out using
the GENETYX software package(version 10.6,
GENETYX). The determined sequence was aligned
with other 16S rRNA sequences of various eubacteria.
From the alignment,the regions unique to the bacterium
from isaki were deduced to design primers and
probes.
Histological observation and in situ hybridization
Tissue samples of naturally infected isaki were pre
served in Bouin's fixative for 24h. The fixed tissues
were embedded in paraffin,sectioned 6μm thick and
placed on silane coated slides,and then were provided
for hematoxylin-eosin staining,in situ hybridization and
Giemsa staining. Two oligonucleotide probes comple
mentary to 16S rDNA of the bacterium were selected
from the regions in the sequence and synthesized with
5-prime end labeled digoxigenin. These putatively spe
cific bacterial probes were designated as Isaki-DIG-80r
(CTCGTCAGCATCCGAAGACCTGTTA)and lsaki-DIG200r(GGCAGCGCAAAGGCCACCTTTAATCCGCAGA
TAT). The method of in situ hybridization was followed
Stokes and Burreson(2001). The kidney sample of
healthy fish and the reaction without probes were per
formed as negative controls.
Det ection of the bacterium by PCR
For detection of the bacterium using PCR,putatively
specific primers of the bacterium were designed from the
determined 16S rDNA sequences. These were Isaki
60(GTCGAACGGTAACAGGTCTTCGGA)and Isaki
840r(GCCACTAGATCCTTTACACCGAAT). Cycling
conditions for the PCR procedure were 94℃(30 sec),
55℃(30 sec)and 72℃(1min)for 30 cycles.
Isoation and growth of the bacterium
The spleen sample of one fish was spread onto cys
tine heart agar(Difco,USA)with 1% (w/v)hemoglobin
and then cultured at 25℃ for two weeks. After cultiva
tion,four colonies were sequenced for their 16S rDNA
regions. Eugon agar(BBL,USA)with 1% (w/v)hemo
globin or Eugon broth(BBL,USA)with 2mM FeCl3,were
also used for the cultivation. Eugon agar with hemoglo
bin is the modification of Eugon agar supplemented with
blood,which is used for isolation of Francisella tularensis
in Japan(Sato et al,1975;Sato and Ohara,1982). For
the preparation of Eugon broth with FeCI3,Eugon broth
was autoclaved and then mixed with filter-sterilized 1 M
FeCI3 stock solution before use.
Experimental infection with isolate
One strain(Ehime-1)was cultivated on the cystine
heart agar with hemoglobin at 25℃ for 72h and sus
pended in PBS. The bacterium was serially ten-fold
diluted with PBS. Twenty-five healthy fish(average
weight:10.9g)were held in 60L circulatory tanks at
25℃ for each experimental inoculum group. The fish
were inoculated with 0.1mL of the bacterial suspension
by intraperitoneal injection. The final doses of infec
tions were from 107 to 104 CFU/fish. A control group
was injected with 0.1mL of PBS. After inoculation,
these fish were kept for 19 days without feeding. Dead
fish were subjected to standard necropsy procedures
including isolation of bacteria from the kidney using cys
tine heart agar with hemoglobin. After cultivation,the
isolates were checked by the PCR using isaki-60 and
isaki-840r primers.
Identification of intracellular bacterium 69
Fig.1. Phylogenetic relationships of 16S rDNA. A sequence detected from diseased isaki was grouped in genus Francisella. The closest relative of the sequence was F.philomiragia. The phylogenetic tree was inferred from 16S rDNA sequences by using the neighbor-joining method. This tree was unrooted. Bootstrap probabilities are shown on the internal branches
(%). Database accession numbers are shown in parentheses following scientific names.
Results
Determination of the 16S rDNA sequence
The sequence of the 16S rDNA(Database acces
sion number:AB194068)was aligned with the other
eubacterial I6S rRNA sequences. A high similarity
97.3-98.5% of the sequence was shown between the
bacterium and Francisella species. Phylogenetic tree
of 16S rDNA inferred by the NJ method is shown in Fig.
1. The analyzed sequence was included in the cluster
of the intracellular bacteria, Francisella species.
Among these species,Francisella philomiragia was the
closest relative to the bacterium. Bootstrap probabili
ties also showed that they were closely related.
Detection of the bacterium by PCR
The PCR products with the expected size(788bp)
were obtained from the isolated bacteria and eight natu
rally diseased fish using the designed primers,lsaki-60
and lsaki-840r.
I solation of the bacterium
Smooth colonies were formed on cystine heart agar
with hemoglobin from an affected fish. These were
gray or green in color. 16S rDNA region of four isolates
were exhibited almost consistent(similarity of 99.7-
100%)with the previously determined sequence of the
bacterium in the tissue of naturally diseased fish. The
bacterium grew optimally at 25℃ but not at 37℃.
Eugon agar with hemoglobin was also able to support
the growth of the bacterium. For the large-scale cultiva
tion,the bacterial growth was considerably improved by
the addition of FeCl3 to Eugon broth.
Experimental infection
All the fish of every infected group died within 19
days in a dose dependent manner(Fig.2). The same
Fig.2. Mortalities of isaki infected with the cultivated bacterium by intraperitoneal injection. One fish of the 106
CFU/fish injection group jumped out from the tank by accident at 15th day. This fish was moribund show
ing same disease signs as other affected fish.
70T. Kamaishi, Y. Fukuda, M. Nishiyama, H. Kawakami, T. Matsuyama, T. Yoshinaga and N. Oseko
disease signs as diseased fish in the farms were observed in these infected fish, e.g. white foci in the spleen and ulcer around the site of injection. Sphere or short rod-shaped bacteria were intracellularly or extra-cellularly observed in the spleen imprint of an affected fish (Fig. 3). The bacteria were reisolated from the kid-ney of the experimentally infected dead fish using cys-tine heart agar with hemoglobin. The PCR confirmed the isolates as the same bacterium in the natural outbreaks. The fish of the control group did not show any disease signs, and no bacterium was isolated from the kidney.
Discussion
In the histological observations, intracellular organ-isms which appeared as bacteria were observed in the kidney of naturally diseased fish. DNA extracted from these kidneys was applied for the sequence of 16S rDNA, and the oligonucleotide probes for in situ hybrid-ization were designed from the sequence. After in situ hybridization using these probes, these organisms in the cells of the kidney showed positive reaction (data not shown). This result indicates that these intracellular organisms include the bacterial 16S rDNA.
The 16S rDNA sequence of the bacterium revealed a 98.5% similarity to F. philomiragia and a 97.3% similar-ity to F. tularensis. From the phylogenetic analysis, the bacterium in the kidney of diseased isaki was inferred to belong to a same cluster among genus Francisella. The phylogenetic tree showed that F. philomiragia was the closest relative of the bacterium. F. philomiragia has been known as the bacterium isolated from dead muskrat Ondatra zibethica and river water. It is also occasionally associated with diseases in humans
(Jensen et al., 1969; Hollis et al., 1989; Forsman et al., 1994).
Characteristics of the members of genus Francisella
are intracellular, pathogenic, rod-shaped, Gram-nega-
tive, nonmotile and aerobic (Anonymous, 1994). F.
tularensis is the causative agent of tularemia in humans
and animals (Eigelsbach and McGann, 1984; Wong and
Shapiro, 1999). Although F. tularensis causes zoono-
sis, the bacterium isolated from isaki may be innocuous
for mammals because they cannot grow at 37•Ž.
However, further study is necessary on the virulence of
the bacterium to mammalian hosts.
The bacterium could not be isolated on standard
media like brain heart infusion agar, Trypto-Soya agar,
nutrient agar, 1% Ogawa medium, 3% Ogawa medium,
thiosulfate citrate bile saccharose agar and Salmonella-
Shigella agar (Fukuda et al., 2002). The present study
showed that some specific media for genus Francisella
supported the growth of the bacterium isolated from
naturally and experimentally infected fish.
The isolate was able to infect healthy isaki experi-
mentally, and the disease signs were reproduced in the
infected fish. The isolates from the dead fish by experi-
mental infection showed positive by PCR using specific
primers of the bacterium. Based on all these informa-
tion, it is suggested that the bacterium is a species
belonging to genus Francisella. This is the first report
on isolation of Francisella species from marine fish.
A few intracelluar bacteria have been reported in
several species of fish (Fryer and Maurel, 1997; Mauel
and Miller, 2002) The present isaki bacterium is appar-
ently different from Piscirickettsia salmonis reported by
Fryer et al. (1992) (Fukuda et al. 2002). In Taiwan and
Hawai, the diseases of tilapia with similar disease signs
such as multiple white granulomas have been reported,
which were caused by Piscirickettsia-like organisms
(HTPLOs) (Chern and Chao, 1994; Chen et al., 1994;
Mauel et al., 2003). One Taiwanese bacterium was
isolated and cultivated in several fish cell lines with cyto-
pathic effect (Chern and Chao, 1994), and another
Taiwanese bacterium grew in CHSE-214 cells with no
cytopathic effect (Chen et al., 1994). In contrast, the
isaki bacterium was not able to be isolated using some
fish cell lines (CHSE-214, BF-2, FHM and EPC) (data
not shown). Phylogenetic relationship between the
isaki bacterium and HTPLOs remains to be investigated.
It is further necessary to clarify the physicochemical
and biochemical properties for the identification of the
present bacterium, and it is also important to examine
the susceptibility of other fish species to the bacterium.
Acknowledgements
The authors thank Mses. J. Hiraga, K. Hayashi
and N. Isetani for their technical support and Dr. N.
Tsutsumi for the scientific advice.
Fig. 3. A spleen imprint of experimentally challenged isaki with
the isolated bacterium. Intracellular bacteria are
observed (arrows). The bar is 10 ƒÊm.
Identification of intracellular bacterium 71
References
Anonymous(1994): Genus Francisella. In"Bergey's manual of determinative bacteriology,9th ed."(ed.by Holt,J.G.,N.
R. Krieg, P.H.A. Sneath, J.T. Staley and S.T. Williams).Willams and Wilkins, Baltimore, pp.83.
Chern, R.S. and C.B. Chao(1994):Outbreaks of a disease caused by rickettsia-like organism in cultured tilapias in
Taiwan. Fish Pathol., 29,61-71.Chen, S.C., M.C. Tung, S.P. Chern, J.F. Tsai, P.C. Wang,R.
S. Chen,S.C. Lin and A.Adams(1994):Systematic granulomas caused by a rickettsia-like organism in Nile tilapia,Oreochromis niloticus (L.), from southern Taiwan. J. Fish
Dis., 17,591-599.
Eigelsbach, H.T. and V.G. McGann(1984):Genus Francisella Dorofe'ev 1947,176AL. In"Bergey's manual of systematic
bacteriology 1st ed." (ed. by N.R. Kreig and J.G. Holt).The Williams and Wilkins, Baltimore, vol. 1, pp. 394-399.
Forsman, M., G. Sandstrom and A. Sjostedt(1994):Analysis of 16S ribosomal DNA sequences of Francisella strains and
utilization for determination of the phylogeny of the genus and for identification of strains by PCR. Int. J. Syst.
Bacteriol., 44,38-46.Fryer, J.L. and M.J. Mauel(1997):The rickettsia:an emerging
group of pathogens in fish. Emerg.Inf. Dis., 3,137-144.Fryer, J.L., C.N. Lannan, S.J. Giovannoni, N.D. Wood(1992):
Piscirickettsia salmonis gen.nov.,sp.nov.,the causative
agent of an epizootic disease in salmonid fishes. Int. J.Syst. Bacterilo., 42,120-126.
Fukuda, Y.,A. Okamura, M. Nishiyama, H. Kawakami,T.Kamaishi and T. Yoshinaga(2002):Granulomatosis of cultured three-line grunt Parapristipoma trilineatum caused by
an intracellular bacterium. Fish Pathol., 37,119-124.
Giovannoni, S. (1991): The polymerase chain reaction. In"Nucleic acid techniques in bacterial systematics" (ed.by E
. Stackebrandt and M. Goodfellow). John Wiley and Sons,New York, pp.177-201.
Hollis, D.G.,R.E. Weaver, A.G. Steigerwalt, J.D. Wenger, C.
W. Moss and D.J. Brenner(1989):Francisella philomiragia
comb. nov.(formerly Yersinia philomiragia) and Francisella tularensis biogroup novicida(formerly Francisella novicida)
associated with human disease. J. Clin. Microbiol.,27,1601-1608.
Jensen, W.L.,C.R. Owen and W.L. Jellison(1969):Yersiniaphilomiragia sp.n.,a new member of the Pasteurella group
of bacteria, naturally pathogenic for the muskrat(Ondatrazibethica). J.Bacteriol., 100,1237-1241.
Mauel, M.J. and Miller, D.L. (2002):Piscirickettsiosis and
piscirickettsiosis-like infections in fish:a review. Vet.Microbiol., 87,279-289.
Mauel, M.J.,D.L. Miller, K.Frazier, A.D. Liggett, L. Styer,D. Montgomery-Brock and J. Brock (2003):Characterization
of a piscirickettsiosis-like disease in Hawaiian tilapia. Dis.
Aquat. Org., 53,249-255.Sato, T.,Y. Watanabe and A. Fukuoka(1975):Utilization of
commercially available agar medium for cultivation ofFrancisella tularensis. Jpn. Assoc. Med. Tech.,24,29-32(in Japanese).
Sato, T.and S. Ohara(1982):On isolation and cultivation ofFrancisella tularensis. Annu. Rep. Ohara Hosp.,25,1-5
(in Japanese with English summary).Sambrook, J.,E.F. Fritsch and T. Maniatis(1989):Commonly
used techniques in molecular cloning. In"Molecular cloning, 2nd ed.".Cold Spring Harbor Laboratory Press, NewYork,pp.E.3-E.4.
Stokes, N.A. and E.M. Burreson(2001):Differential diagnosisof mixed Haplosporidium costale and Haplosporidium
nelsoni infections in the eastern oyster, Crassostreavirginica, using DNA probes. J. Shellfish Res., 20,207-
213.Wong, J.D. and D.S. Shapiro(1999):Francisella. In"Manual
of clinical microbiology, 7th ed."(ed.by P.R. Murray,E.J.Baron, M.A. Pfaller, F.C. Tenover and R.H. Yolken).American Society for Microbiology, Washington, D.C., pp.647-651.