of January 31, 2018.This information is current as

VertebratesIFNs in Fish Sheds Light on IFN Evolution in Identification of a Second Group of Type I

SecombesJun Zou, Carolina Tafalla, Jonathan Truckle and Chris J.

http://www.jimmunol.org/content/179/6/3859doi: 10.4049/jimmunol.179.6.3859

2007; 179:3859-3871; ;J Immunol 

        average*  

4 weeks from acceptance to publicationSpeedy Publication! •    

Every submission reviewed by practicing scientistsNo Triage! •    

from submission to initial decisionRapid Reviews! 30 days* •    

?The JIWhy

Referenceshttp://www.jimmunol.org/content/179/6/3859.full#ref-list-1

, 11 of which you can access for free at: cites 38 articlesThis article

Subscriptionhttp://jimmunol.org/subscription

is online at: The Journal of ImmunologyInformation about subscribing to

Permissionshttp://www.aai.org/About/Publications/JI/copyright.htmlSubmit copyright permission requests at:

Email Alertshttp://jimmunol.org/alertsReceive free email-alerts when new articles cite this article. Sign up at:

Print ISSN: 0022-1767 Online ISSN: 1550-6606. Immunologists All rights reserved.Copyright © 2007 by The American Association of1451 Rockville Pike, Suite 650, Rockville, MD 20852The American Association of Immunologists, Inc.,

is published twice each month byThe Journal of Immunology

by guest on January 31, 2018http://w

ww

.jimm

unol.org/D

ownloaded from

by guest on January 31, 2018

http://ww

w.jim

munol.org/

Dow

nloaded from

Identification of a Second Group of Type I IFNs in Fish ShedsLight on IFN Evolution in Vertebrates1

Jun Zou,2* Carolina Tafalla,† Jonathan Truckle,* and Chris J. Secombes*

In this report, three type I IFN genes were identified in rainbow trout (rt) Oncorhynchus mykiss and are classified into two groupsbased on their primary protein sequences: group I containing two cysteine residues; and group II containing four cysteinesresidues. The group I rtIFNs were induced in fibroblasts (RTG-2 cells), macrophages (RTS-11 cells), and head kidney leukocyteswhen stimulated with polyinosinic:polycytidylic acid, whereas group II IFN was up-regulated in head kidney leukocytes but notin RTG-2 and RTS-11 cells. Recombinant group I rtIFNs were potent at inducing Mx expression and eliciting antiviral responses,whereas recombinant group II rtIFN was poor in these activities. That two subgroups of type I IFN exist in trout prompted asurvey of the genomes of several fish species, including zebrafish, medaka, threespine stickleback and fugu, the amphibian Xenopustropicalis, the monotreme platypus and the marsupial opossum, to gain further insight into possible IFN evolution. Analysis of thesequences confirmed that the new IFN subgroup found in trout (group II IFN) exists in other fish species but was not universallypresent in fish. The IFN genes in amphibians were shown for the first time to contain introns and to conserve the four cysteinestructure found in all type I IFNs except IFN-�� and fish group I IFN. The data overall support the concept that differentvertebrate groups have independently expanded their IFN types, with deletion of different pairs of cysteines apparent in fish groupI IFN and IFN-�� of mammals. The Journal of Immunology, 2007, 179: 3859–3871.

I n eutherian mammals, type I IFNs comprise seven major ho-mologous subgroups including IFN-�, -�, -�, -�, -�, -�, and-� and are the key cytokines orchestrating host antiviral de-

fense and other physiological processes (1). Not all subgroups ex-ist in all eutherian mammals, as with IFN-� which is found inruminants and IFN-� which has been discovered only in pigs todate (2). With the exception of IFN-�, each of these IFNs areencoded by multiple gene families, at least in some species (2). Forexample, the IFN-� subfamily contains some 13 genes in humansand mice (3), whereas duplicated IFN-� genes are known in cattle(4). It has not been fully established why so many IFNs are needed.Emerging evidence in mammals indicates at least some of the IFNisoforms are involved in physiological processes such as repro-duction and development in addition to immune responses (5).Unique expression patterns are also observed in tissues or cells forindividual IFNs, indicating expression is differentially regulated. Asubpopulation of the dendritic cells, plasmacytoid dendritic cells,is capable of producing �100-fold higher amounts of IFN-� rel-ative to other cell types, although the isoforms have yet to beidentified, and appear to be the main source of circulating IFNs (6).Some of the IFN-� isoforms are synthesized immediately afterinduction or viral infection, whereas others are synthesized at alater stage (7). In ruminants, IFN-�, also designated as tropho-

blast IFN, is temporally synthesized in fetuses during ruminantpregnancy and is involved in the maternal recognition of preg-nancy (5). The IFN-� is not induced by viral infection; however,it possesses antiviral activity, although weaker than other typeI IFN counterparts.

All of these type I IFN genes do not contain introns and areclosely clustered in the same chromosome (8–10). Also, they allshare a common receptor consisting of a heterodimer of IFNR1and IFNR2, although sequence homology between the two chainsis rather limited. It has been suggested by evolutionary analysisthat IFN-� and IFN-� diverged �130 million years ago (2), withsubsequent numerous rounds of gene duplications within mam-mals resulting in the other isoforms such as IFN-�, -�, -�, -�, and-�. These intronless genes are believed to have arisen from anancestor gene shared by structurally related cytokine genes IL-10and IFN-�, which possess 5 exons and 4 introns (11). Strong ev-idence supporting this hypothesis has come from recent studiesconfirming that fish type I IFN genes not only contain introns butalso possess the same genomic gene structure seen in IL-10 andIFN-� genes (12). It is generally believed that a retroposition eventled to the emergence of the intronless IFN genes at some pointbefore the divergence of birds and mammals, because birds alsopossess intronless type I IFN genes (13).

Type I IFN-like genes are now sequenced in several fish speciesincluding zebrafish (Danio rerio; Ref. 14), catfish (Ictalurus punc-tatus; Ref. 15), Atlantic salmon (Salmo salar; Ref. 16), and thepufferfish (Takifugu rubripes; Ref. 17). In general, they are 175–194 aa long with a typical hydrophobic signal peptide except forone of the reported catfish IFN molecules (15). Functional studieshave demonstrated that fish IFNs are capable of inducing expres-sion of the anti-viral protein Mx and exhibit antiviral activities.However, fish type I IFNs share limited sequence homology withtheir counterparts in birds and mammals. For example, zebrafishIFN has 34–39% similarity with avian and mammalian IFN-� andIFN-�. Multiple copies of IFN genes have been suggested bySouthern blot analysis in catfish (15) and, more recently, dupli-cated genes have been shown to be tandemly linked within a

*Scottish Fish Immunology Research Centre, School of Biological Sciences, Univer-sity of Aberdeen, Aberdeen, United Kingdom; and †Centro de Investigacion enSanidad Animal (CISA-INIA), Valdeolmos, Madrid, Spain

Received for publication February 22, 2007. Accepted for publication June 25, 2007.

The costs of publication of this article were defrayed in part by the payment of pagecharges. This article must therefore be hereby marked advertisement in accordancewith 18 U.S.C. Section 1734 solely to indicate this fact.1 This work was supported by an European Community-funded IMAQUANIMproject (Contract 007103).2 Address correspondence and reprint requests to Dr. Jun Zou, Scottish Fish Immu-nology Research Centre, School of Biological Sciences, University of Aberdeen, Ab-erdeen, United Kingdom. E-mail address: j.j.zou@abdn.ac.uk

Copyright © 2007 by The American Association of Immunologists, Inc. 0022-1767/07/$2.00

The Journal of Immunology

www.jimmunol.org

by guest on January 31, 2018http://w

ww

.jimm

unol.org/D

ownloaded from

6.0-kb region in a head-to-tail manner in the fugu genome (17). InAtlantic salmon, two IFN cDNA variants with 95.4% identity havealso been reported, and recent evidence has shown they are en-coded by two distinct genes (16, 18). To date, the genes found infish all appear to be related to a single group of IFNs, which differfrom other known IFN proteins in containing two cysteine residuesrather than the four seen in avian IFNs and mammalian IFN-�, -�,-�, -�, -�, and -� and different to the two cysteines seen in mam-malian IFN-�, making evolutionary relationships difficult tointerpret.

In this study, three cDNA variant transcripts of type I IFN likemolecules have been cloned and sequenced in rainbow trout On-corhynchus mykiss, and their corresponding genomic organizationhas been determined. They belong to two distinct groups that differimportantly in the number of cysteines residues they possess, whileretaining the 5 exon-4 intron gene organization. Expression of thethree trout IFN genes was investigated in fibroblast and macro-phage cell lines and in primary leukocyte cultures after stimulationwith polyinosinic-polycytidylic acid (poly(I:C))3 and in tissuesfrom fish challenged with viral hemorrhagic septicemia virus(VHSV). The effects of the recombinant IFNs on the expression ofthe Mx gene, as well as their antiviral activity, were also assessed.Comparative analysis was performed using the IFN sequences re-trieved by informatics analysis of various vertebrate genomes in-cluding zebrafish, medaka, threespine stickleback, fugu, Xenopus,

platypus, and opossum to gain further insight into the evolution ofthe IFN gene family.

Materials and MethodsPreparation of primary cultures of leukocytes and maintenanceof cell lines

Rainbow trout (O. mykiss; 100–200 g) were purchased from a local Scot-tish fish farm (Almond Bank) and maintained in 1-m-diameter fiberglasstanks supplied with recirculating freshwater at 9–12°C. Fish were fedtwice daily with a commercial pelleted trout diet. Fish were anesthetizedwith 2-phenoxyethanol (0.05%; Sigma-Aldrich) before injection or sacri-fice for tissue collection.

The primary cultures of head kidney leukocytes were prepared as de-scribed previously (19). The head kidney tissue was collected under sterileconditions from freshly killed rainbow trout and gently pushed through a100-m pore size nylon mesh (John Staniar) with ice cold Leibovitz me-dium (L-15; Invitrogen Life Technologies) containing 2% FCS (Sigma-Aldrich) and 10 U/ml heparin (Sigma-Aldrich). After a washing with L-15medium containing 0.1% FCS and 10 U/ml heparin, the cell pellet wasresuspended in L-15 medium containing 0.1% FCS, 100 g/ml penicillin,and 100 U/ml streptomycin (P/S; Invitrogen Life Technologies) and platedinto 25-cm2 flasks at a concentration of 1 � 106 cells/flask.

A rainbow trout macrophage-like cell line (RTS-11) was maintained at20°C in L-15 medium containing 30% FCS and P/S (20). A rainbow troutfibroblast-like cell line (RTG-2) was maintained at 20°C in L-15 mediumcontaining 10% FCS and P/S. Cells were passaged to fresh flasks at 80%confluence and cultured for 2 days before stimulation in the presenceof FCS.

Gene cloning

All PCR products were ligated into pGEM T Easy vector (Progema) at 4°Covernight, and the ligation reaction was transformed into Escherichia coliTAM-competent cells (ActifMotif). Positive clones were screened by stan-dard colony PCR and cultured at 37°C overnight in a shaker for plasmid

3 Abbreviations used in this paper: poly(I:C), polyinosinic-polycytidylic acid; rtIFN,rainbow trout IFN; RTG, rainbow trout gonad; EST, expressed sequence tag; UTR,untranslated region; VHSV, viral hemorrhagic septicemia virus; IPNV, infectiouspancreatic necrosis virus; P/S, 100 g/ml penicillin and 100 U/ml streptomycin; oli-go(dT), oligodeoxythymidylate; oligo(dG), oligodeoxyguanylate; rrtIFN, recombi-nant rtIFN.

Table I. Primer sequences and use

Primer Name Sequence (5�-3�) Used for

Adaptor oligo(dT) GGCCACGCGTCGACTAGTAC(dT)17 3�-RACEAdaptor GGCCACGCGTCGACTAGTAC 3�-RACEOligo(dG) GGGGGGIGGGIIGGGIIG 5�-RACEFISH-F1 TACAGTGCTGAGGCGTGGGAG rtIFN1 3�-RACEIFN-F5 CTACGGAACAACATTTCGGAC rtIFN1 genomic cloningIFN-R1 AGACCGGCAATACAGTTCAGIFN-R3 AACTGGTAAGGGCGTAGCTTC rtIFN1 and rtIFN2 5�-RACEIFN-R6 TCTTTCCCGATGAGCTCCCAIFN2-F1 CGAGTTTGAGGACAAAGTCAG rtIFN2 3�-RACEIFN2-F2 GGAATAGGAATAGGAAGTCAGIFN2-RF1 ATGCAGAGCGTGTGTCATTGC rtIFN2 genomic cloningIFN2-RR1 TCAGTACATCTGTGCCGCAAGIFN3-F4 ACATGGCTGTATTGAAATGG rtIFN3 cDNA and genomic cloningIFN3-R1 GTCAATCGAGCAGCCGAACAGIFN3-R2 CTTTCGCACAATCTCCCATG rtIFN3 5�RACEIFN3-R3 TCCAGAGGATTCCCAAACACGAP-EF2 ATGTCAGACCTCTGTGTTG Expression studyGAP-ER2 TCCTCGATGCCGAAGTTGTCIFN1-EF2 AATTCCTGTGTATCACCTGCCA rtIFN1 expressionIFN1-ER2 GATGATCAGTACATCTGTCTGIFN2-EF2 AGTTCCTGTGTATCACCTGTCG rtIFN2 expressionIFN2-ER2 GATGCTCAGTACATCTGTCCCAIFN3-EF2 CTTAGAGTTATGTGTCGTAGG rtIFN3 expressionIFN3-ER2 ATGTGGTTCTCCTCACGGCTTGMx-EF1 CCTCCTGAAATCAGCGAAGACA Mx expressionMx-ER1 GAGTCTGAAGCATCTCCCTCTGIFN1-RF1 CGGATCCTGTGACTGGATTCGACACCACTA Expression plasmid constructionIFN1-RR1 CAAGCTTATGATCAGTACATCTIFN2-RF2 CGCATGCTGTGACTGGATCCAACACCACTTIFN2-RR2 CAAGCTTATGCTCAGTACATCTGTCCCAIFN3-RF1 TTGCAGGTGGACGCAGTTTAGGGGATCCIFN3-RR1 TAAGCTTTCATCACGGCTTGACTCTG

3860 EVOLUTION OF TYPE I IFNs

by guest on January 31, 2018http://w

ww

.jimm

unol.org/D

ownloaded from

FIGURE 1. Multiple alignment of fishand amphibian IFN protein sequences de-duced from their intron containing IFN genes(A) and comparison of cysteine patterns oftrout IFNs and human type I IFNs andIFN-�s (B). Identical amino acids among allsequences are indicated by an asterisk (�),whereas those with high or low similarity areindicated with a colon (:) and period (.), re-spectively. The predicted signal peptides areunderlined and potential glycosylation sitesare in bold. Conserved cysteines potentiallyforming disulfide bridges are arrowed andnumbered. The cysteines conserved in mostIFN-�s are shadowed. Exons are separatedby spaces and indicated. Note: medaka IFNgenes lack the third intron as indicated in thealignment.

3861The Journal of Immunology

by guest on January 31, 2018http://w

ww

.jimm

unol.org/D

ownloaded from

preparation. Plasmid DNA was extracted using a Qiagen miniprep kit andsequenced by MWG-Biotech.

To prepare cDNA templates for IFN cloning, the RTG-2 cells werestimulated with 50 g/ml poly(I:C) for 4 h at 20°C and harvested forextraction of total RNA using the RNA-STAT60 reagent (AMS Biotech-nology) according to the manufacturer’s instructions. Single-strand cDNAwas synthesized by reverse transcription with oligodeoxythymidylate (oli-go(dT))12–18 (Invitrogen Life Technologies) or adaptor-dT primer (Table I)

using Bioscript reverse transcriptase (Bioline), diluted with 10 mM Tris-EDTA buffer (10 mM Tris, 1 mM EDTA, pH 8.0; TE) and stored at �20°Cbefore use. A primer (Fish-F1) encoding the conserved motif region ([YH]SA[EAG]AWE) of the aligned fish IFN protein sequences and the adaptorprimer (Table I) were used to amplify the 3� end of the trout IFN genes byPCR under the following conditions: 1 cycle of 94°C for 3 min; 35 cyclesof 94°C for 15 s, 55°C for 15 s, 72°C for 30 s; 1 cycle of 72°C for 5 min.The first-round PCR products were then reamplified using the same prim-ers and ligated into the pGEM T Easy vector (Promega), and the cloneswith inserts were sequenced. After a partial sequence was obtained, the 5�end region of the IFN cDNA was amplified by RACE PCR. Briefly, thecDNA was synthesized using oligo(dT)12–18 and tailed with dCTP usingTdT (Promega) according to the manufacturer’s instructions and used forRACE PCR with two pairs of primers R3/oligodeoxyguanylate (oligo(dG))and R6/oligo(dG) under hot start conditions (Table I). The programs forboth rounds of RACE PCR were: 1 cycle of 94°C for 3 min; 32 cycles of94°C for 20 s, 62°C for 20 s, and 72°C for 45 s; and 1 cycle of 72°C for5 min.

Sequencing of the PCR products generated with R6/oligo(dG) revealedtwo different sequences, one overlapping the obtained 3� end region of thetrout IFN cDNA (termed rtIFN1) and the other (termed rtIFN2) havingseveral nucleotide mismatches. To obtain the 3� end region of the rtIFN2cDNA, primers IFN2-F1 and IFN2-F2 specific to the rtIFN2 gene weresynthesized and used for PCR using the PCR protocol described above.

To search for novel IFN genes, the cloned rtIFN1 and rtIFN2 proteinsequences were used to search the TIGR-expressed sequence tag (EST)database (www.tigr.org). This identified a novel partial EST sequence (ac-cession number TC83306) with significant homology with the C-terminalregion of IFN-� from birds and mammals. This EST contig was compiledfrom three EST sequences (GenBank accession numbers CR376285,BX858275, and CR370794) which were generated from trout testis cDNAlibraries. It also contained multiple ATTTA instability motifs within the3�-untranslated region (UTR), a common feature for most IFN genes. Moreimportantly, an amino acid motif (CAWE) conserved in higher vertebratetype I IFNs but not present in the fish IFNs identified to date was also foundat the corresponding region of the EST contig, indicating the EST mayrepresent a new class of type I IFN in fish in addition to the rtIFN1 andrtIFN2 genes. This new trout IFN gene was named rtIFN3. Initial attemptsto clone the full length cDNA of this molecule from the RTG-2 cellsstimulated with poly(I:C) failed to generate any product. Subsequently,leukocytes were freshly isolated from rainbow trout head kidney tissue andstimulated with 100 g/ml poly(I:C) (Sigma-Aldrich) for 6 h at 20°C.Total RNA was extracted and the synthesized cDNA used for RACE PCRusing primers IFN3-R2/oligo(dG) and IFN3-R3/oligo(dG) (Table I). Thisgenerated a 425-bp fragment containing a 32-bp 5�-UTR and 393-bp cod-ing sequence. The full length cDNA sequence was then confirmed by se-quencing the PCR products amplified by primers IFN3-F4 and IFN3-R1(Table I).

To clone the genomic sequences of the three IFN genes, genomic DNAwas extracted from tail fin tissues using a phenol-chloroform extractionmethod. Briefly, trout tail fins were collected and cut into small pieces. Thetissues were lysed in a buffer containing 100 mM Tris-HCl (pH 8.5), 5 mMEDTA, 0.2% SDS, 200 mM NaCl, and 100 g/ml proteinase K at 50°C for3–5 h with inversion every half-hour. The DNA lysate was extracted twicewith an equal volume of phenol/chloroform (24:1, v/v; Sigma-Aldrich),and the aqueous phase was collected. Genomic DNA was then precipitatedwith 2 volumes of cold 100% ethanol and washed once with cold 70%ethanol. The DNA pellet was dried briefly at room temperature and dis-solved in TE buffer. For amplification of the genomic sequence of the troutIFN genes, 0.25 g of genomic DNA were used for hot start PCR under thefollowing conditions: 1 cycle of 94°C for 3 min; 30 cycles of 94°C for 20 s,62°C for 20 s, and 72°C for 2 min; and 1 cycle of 72°C for 5 min using amixture of BIOTAQ DNA polymerase (Bioline) and Pfu DNA polymerase(Promega; 25:1, unit/unit). Primers used for genomic PCR were: IFN1-F5/IFN1-R1 for rtIFN1; IFN2-RF1/RR1 for rtIFN2; and IFN3-F4/IFN3-R1 forrtIFN3. The PCR products were cloned and sequenced as describedpreviously.

Sequence analysis

BLAST was used for identification of homologous sequences in theGenBank databases. A multiple alignment was generated using theCLUSTAL W program (version 1.83; Ref. 21). A phylogenetic tree wasconstructed using the neighbor-joining method within the Mega3 softwareprogram (22). Global comparison of two sequences was performed usingNeedleman-Wunsch global alignment (23). The presence or absence of asignal peptide was predicted using the SignalP program (version 2.0; Ref.

FIGURE 1. (continued)

3862 EVOLUTION OF TYPE I IFNs

by guest on January 31, 2018http://w

ww

.jimm

unol.org/D

ownloaded from

24). The theoretical molecular mass of the proteins was calculated usingthe tools listed on www.expasy.ch/tools.

The IFN contig sequences were retrieved by BLAST analysis from thegenome databases for zebrafish (D. rerio), medaka (Oryzias latipes),threespine stickleback (Gasterosteus aculeatus), fugu (T. rubripes), Afri-can frog (Xenopus tropicalis), platypus (Ornithorhynchus ananitus, andopossum (Monodelphis domestica); see www.ensembl.org. The putativeIFN contig sequences were scanned for IFN sequences usingGenScan (http://genes.mit.edu/GENSCAN.html). The predicted IFN se-quences were deposited in the GenBank/EMBL database as third-partyannotated sequences.

IFN expression in rainbow trout

For in vitro expression studies of the three trout IFN genes, RTG-2 cells orhead kidney leukocytes isolated from rainbow trout were stimulated for 4 hwith 0.1, 1, 10, and 100 g/ml poly(I:C). Total RNA was extracted usingthe RNA-STAT60 reagent (AMS Biotechnology (Europe)) according tothe manufacturer’s instructions. The first-strand cDNA was synthesizedusing oligo(dT)12–18 primer (Invitrogen Life Technologies) and Bio-scriptase (Bioline). The cDNA samples were diluted with TE buffer andused for PCR. Expression of the housekeeping gene, GAPDH, was mea-sured by PCR using primers GAP-EF2 and GAP-ER2 and used as aninternal control, to allow equal amounts of template to be used for detectingIFN expression. The IFN primers used for expression studies are listed inTable I. The PCR program was as follows: 1 cycle of 94°C for 3 min;25–38 cycles of 94°C for 15 s, 62°C for 15 s, and 72°C for 20 s; followedby a cycle of 72°C for 5 min.

To examine where the rtIFN genes are expressed in vivo, tissues in-cluding brain, gill, gut, kidney, liver muscle, skin, spleen, and ovary weretaken from two healthy female fish for RNA extraction. Testis was takenfrom two male fish. RT-PCR was then performed to determine the tissuedistribution of rtIFN gene expression as described previously.

IFN expression in vivo after VHSV infection

VHSV (strain 0771), an enveloped double-stranded RNA virus belongingto the rhabdovirus family, was propagated in an epithelioma papulosumcyprinid cell line (25). Cells were cultured at 18°C in L-15 medium sup-plemented with 10% FCS, containing P/S. Virus was inoculated on epi-thelioma papulosum cyprinid cells in L-15 plus P/S and 2% FCS at 14°C.When the cytopathic effect was extensive, the supernatant was harvestedand centrifuged to eliminate cell debris. Clarified supernatants were usedfor the experiments.

For in vivo challenge, rainbow trout of �8–10 cm (9–12 g, 7 mo old)were obtained from Centro de Acuicultura El Molino (Madrid, Spain),located in a VHSV- and infectious pancreatic necrosis virus-free zone. Fishwere maintained at the Centro de Investigaciones en Sanidad Animal(CISA-INIA) laboratory at 14°C and fed daily with a commercial diet(Trouw). Before the challenge experiments, fish were acclimatized to lab-

oratory conditions for 2 wk, and during this period no clinical signs ofdisease were observed.

For the challenge with VHSV, trout were divided into 2 groups of 20fish. One group was infected by i.p. injection with VHSV (100 l of 1 �107 TCID50/ml per fish). The other group was mock-infected with the samevolume of L-15 medium. At days 1, 2, 3, and 7 postinfection, five fish fromeach group were killed for collection of head kidney, spleen, and livertissue, and RNA was extracted from tissue pools.

Production and purification of recombinant IFNs

The putative mature peptide of the trout IFNs was predicted by the SignalPprogram (24) and confirmed by the multiple alignment generated using theCLUSTAL W program (version 1.83; Ref. 21 and Fig. 1A). The cDNAfragments encoding the putative mature peptide of rtIFN1 and rtIFN3 wereinserted into the pQE30 expression vector (Qiagen) at the restriction en-zyme sites of BamHI and HindIII, respectively, and the cDNA fragmentencoding the putative mature rtIFN2 peptide was cloned into the pQE30vector at the restriction enzyme sites of SphI and HindIII due to the pres-ence of an internal BamHI site in the sequence. The resultant plasmids weretermed pQE30-rtIFN1, pQE30-rtIFN2 and and pQE30-rtIFN3, respec-tively, and were sequenced to verify the reading frame. The N terminus ofall three recombinant proteins contained a 6-histidine tag, and the N-ter-minal sequences were as follows: MRGSHHHHHHGS(6His-tag)-CDWfor rtIFN1; MRGSHHHHHHGSAC(6His-tag)-CDW for rtIFN2; andMRGSHHHHHHGS(6His-tag)-CRW for rtIFN3. To allow expression ofsoluble proteins, the pQE30-IFN plasmids were retransformed into E. coliM15 cells (Qiagen). Induction and purification of the recombinant proteinsunder native conditions were performed as described previously (26). Toeliminate the potential contamination of bacterial endotoxins such as LPSduring protein preparation, the purified recombinant protein was loadedonto a polymyxin B column (Sigma-Aldrich) and the flow-through fractioncollected. The protein samples were stored at �80°C before use. Purity ofthe recombinant proteins was checked on a 4–12% precast SDS-PAGE gel(Invitrogen Life Technologies) stained with Brilliant Blue G (Sigma-Aldrich) and concentration measured by comparing the protein band den-sity with a standard protein (trypsin inhibitor; Sigma-Aldrich) in the sameSDS-PAGE gel using an Ultra Violet Products gel imaging system andUltra Violet Products gelworks ID advanced software.

Biological activities of rIFNs

Biological activities of the recombinant rtIFNs (rrtIFN1, 2, and 3) weretested in the trout RTG-2 cells, RTS-11 cells, and head kidney primarycultures where Mx gene expression was analyzed after stimulation. The Mxgene is up-regulated by type I IFNs and was used here as a marker gene toassess the biological activity of the recombinant trout IFNs. The RTG-2cells were passaged into 25-cm2 flasks and cultured at 20°C. When the cellsreached 80% confluence (�2 days), the culture medium was removed, andfresh medium added into the flasks. Before IFN stimulation, cycloheximide

Table II. Features of rainbow trout IFN genes and deduced proteins

Accession No.

cDNA Genomic

Precursor(aa)

MaturePeptide (aa)

MolecularMass(Da) Cysteines

GlycosylationSites

5�-UTR(bp)

Codingregion (bp)

3�-UTR(bp)

ATTTAmotif

Length(bp) Exons Introns

Intronphase

rtIFN1 AJ580911AM489415

427 528 269 4 3,613 5 4 0 175 151 17,998 2 1

rtIFN2 AJ582754AM489416

36 534 340 3 5,610 5 4 0

rtIFN3 AM235738AM489417

32 555 232 7 2,022 5 4 0 177 154 18,532 2 3

184 161 18,572 4 1

Table III. Homology of trout IFNs with other known fish type I IFNs

SalmonIFN1

SalmonIFN2

FuguIFN

TetraodonIFN

CatfishIFN1

CatfishIFN2

GoldfishIFN

ZebrafishIFN1

ZebrafishIFN2

ZebrafishIFN3

rtIFN1 94.3 94.9 56.7 57.4 51.4 50.0 59.4 57.5 45.6 50rtIFN2 90.4 91 56.7 57.6 52.5 52.1 61.7 58.7 45.6 46.7rtIFN3 51.6 50.5 52.7 50.5 40.8 42.8 48.4 52.7 51.1 50

3863The Journal of Immunology

by guest on January 31, 2018http://w

ww

.jimm

unol.org/D

ownloaded from

was added to the cells to achieve a final concentration of 10 g/ml toinhibit synthesis of endogenous IFN. After 0.5 h of incubation, the cellswere stimulated with trout IFNs at doses of 0.1, 1, 10, or 100 ng/ml for 6 hwhen they were then harvested for RNA extraction. Mx expression wasdetermined by RT-PCR with primers Mx-EF1 and Mx-ER1 (Table I) usingthe PCR conditions for detecting IFN expression except for the cyclingnumber, which was kept at 32.

Antiviral activities of the recombinant IFNs were tested in the RTG-2cells. Cells cultured at 18°C in L-15 medium supplemented with 10% FCSand P/S were trypsinized and plated into 96-well plates. After an overnightincubation at 18°C, the culture medium was removed, and cells weretreated with 50 l of L-15 plus 2% FCS and P/S containing 1, 10, 50, or100 ng/ml each rrtIFN. After 4 h of incubation at 18°C, cells were chal-lenged with 50 l of culture medium containing serial VHSV dilutions.Triplicates were always performed for each viral dilution. After 5–7 daysof incubation at 14°C, the plates were observed under an inverted micro-scope for cytopathic effects (27). Viral titers were calculated according tothe method of Reed and Muench (28).

To investigate whether rrtIFN1 and rrtIFN3 bind to the same receptorcomplex, the RTG-2 cells were incubated with 10 g/ml cycloheximide for0.5 h and subsequently stimulated with only rrtIFN3 or costimulated withboth rrtIFN1 and rrtIFN3 for 6 h. For rtIFN3 stimulation, cells were incu-bated with 0.1, 1, 10, and 100 ng/ml rrtIFN3. For costimulation, 2.5 ng/mlrrtIFN1 and various doses of rrtIFN3 (1, 10, 100, and 300 ng/ml) wereused. The cells were then harvested for RNA extraction, and Mx expressionwas determined by RT-PCR with primers Mx-EF1 and Mx-ER1 (Table I)as described previously.

ResultsCloning of trout IFN genes

Three trout IFN genes (rtIFN1, rtIFN2, and rtIFN3) have beenidentified in this study, and features of the nucleotide and deducedamino acid sequences are described in Table II. They share some

common features: 1) they encode peptides with similar length anda predicted signal peptide; 2) the putative mature peptides containglycosylation sites; 3) the genomic gene contains 5 exons and 4introns; and 4) multiple ATTTA instability motifs are present inthe AT-rich 3�-UTR. Compared with the rtIFN2 and rtIFN3 mol-ecules, the rtIFN1 gene has an unexpectedly long 5�-UTR regionwhere 7 start codons (ATG) are present, all of which have a down-stream in-frame stop codon. The rtIFN1 and rtIFN2 share signif-icant homology: 82.0% identity at the nucleotide level for the cod-ing region; and 88.8% similarity at the protein level. However,they have rather limited homology with rtIFN3, 51.1 and 48.9% atthe protein level, respectively, suggesting that they belong to twodifferent subgroups. Furthermore, the rtIFN3 molecule possessesfour cyteines in the mature peptide, potentially forming two disul-fide bridges to stabilize its structure, whereas in the rtIFN1 andrtIFN2 peptides only two cysteines are present as in other fish IFNsknown to date. As a consequence of the presence or absence ofthese cysteines, a conserved CAWE motif at the C-terminal regionof the higher vertebrate type I IFNs is apparent in rtIFN3 but ab-sent in the other two trout IFNs.

Homology analysis of the trout IFN proteins with differentclasses of type I IFNs, IFN-�s and IL-10s is summarized in TablesIII and IV. Within the salmonids, the rtIFN1 has �94% similaritywith the two IFNs cloned previously in Atlantic salmon, and thertIFN2 has a slightly lower similarity of �91%, indicating they areclosely related homologs. Conversely, rtIFN3 shares much lowersimilarity (�51%) with the salmon IFNs and perhaps represents anew class of IFN in trout (designated as group II). Comparison of

Table IV. Homology of trout IFNs with type I IFNs, IFN-�, and IL-10

IFN-� IFN-� IFN-� IFN-� IFN-� Overall Type I IFN-� IL-10

rtIFN1 40.4 � 2.3 42.1 � 2.4 41.6 � 0.1 41.4 � 1.6 41.3 � 1.7 40.9 � 2.0 37.1 � 1.0 41.0 � 2.6rtIFN2 39.4 � 3.5 42.2 � 2.3 41.1 � 0.6 43.4 � 3.1 43.4 � 1.0 43.1 � 2.7 36.3 � 1.2 39.8 � 2.7rtIFN3 46.1 � 4.1 45.7 � 2.7 43.6 � 2.5 48.2 � 2.9 49.7 � 4.9 46.9 � 3.6 36.5 � 3.5 38.9 � 1.5

Table V. Summary of type I IFN genes in nonmammalian species, platypus, and opossum reported in this study

Animal No. of Genes Present Intron Number Genomic Location Accession Number

Danio rerio 3 4 Chro 3a AJ544820BX500440 BN001102

BN001103Oncorhynchus mykiss 3 4 Unknown AJ580911

AJ582754AY788890AM235738AM489415-7

Oryzias latipes 3 3 BAAF03097565.1 BN001095BAAF03125320.1BAAF03063981.1

Gasterosteus aculeatus 3 4 AANH01006384.1 BN001087Takifugu rubripes 2 4 Scaffold 134 AJ583023Xenopus tropicalis 5 4 Scaffold 48 BN001167-171Ornithorhynchus anatinus 6 0 AAPN01027751.1 BN001096-101

AAPN01027751.1AAPN01027751.1AAPN01027751.1AAPN01437888.1AAPN01206298.1

Monodelphis domestica 9 0 Chro 6 BN001104-112AAFR03027363.1AAFR03027364.1AAFR03027366.1AAFR03027456.1

a Chro, Chromosome.

3864 EVOLUTION OF TYPE I IFNs

by guest on January 31, 2018http://w

ww

.jimm

unol.org/D

ownloaded from

the trout group I (rtIFN1 and rtIFN2) and group II (rtIFN3) IFNswith other known fish IFNs containing two cysteines revealed 50–62% and 41–53% similarity, respectively. Similar homology(50%) was seen within the fish group II IFNs (rtIFN3, and ze-brafish IFN2 and 3; see below) which have 4 cysteines in themature peptide region. Homology of the two groups of trout IFNswith mammalian type I IFNs does not vary significantly, rangingfrom 39.4 to 50%, whereas homology to the IFN-related cytokinessuch as IFN-�s and IL-10s was 36.3–41%.

In silico analysis of vertebrate IFN genes

With the knowledge that two groups of IFN exist in trout, weundertook a comparative study of the IFN family in vertebrates toestablish whether the situation held in other fish species/groups,to confirm the types of IFN gene(s) present in amphibians, and to

examine the appearance of other subgroups in early mammals. Tothis end, the genomes of several fish species, including zebrafish,medaka, threespine stickleback, pufferfish, and of Xenopus, platy-pus, and opossum were analyzed by BLAST using known fish orchicken IFN protein sequences, and the homologous contigs wereretrieved for prediction of IFN transcripts. The transcripts of theretrieved contigs were predicted using the GenScan program(http://genes.mit.edu./GENSCAN) and in some cases were editedmanually. The IFN sequences obtained from genome analysis weredeposited as third-party annotated sequences in the GenBank/EMBL database and are summarized in Table V. In the zebrafishgenome, three copies of IFN genes, including the one reported byAltmann et al. (14), and two new genes (IFN2 and IFN3) havebeen found in chromosome 3 (www.ensembl.org, assembly ver-sion 6). In the EMBL nucleotide database, the zebrafish IFN2 and

FIGURE 2. Phylogenetic tree analysis of type I IFNs in vertebrates. The IFN precursor sequences were used to construct the phylogenetic tree with theneighbor-joining method within the Mega3.1 program. The accession numbers of IFN sequences used for phylogenetic tree analysis (excluding those listedin Table V) are as follows. IFN-�: human, NP_000596; cow, NP_776510; horse, P05003; mouse, NP_034633; sheep, CAA41790; pig, NP_999558; bat,BAF37102; wallaby, AAO37656, AAO37657; echidna, AY194919. IFN-�: human, NM_002176; cow, NM_174350; cat, AB021707; horse, M14546;mouse, NM_010510; rat, NP_062000; pig, M86762; bat, BAF37103; wallaby, AY165862; echidna, AY194920; IFN-�, human, NM_020124; mouse,NM_199157. IFN-�: cow, AY996048; sheep, DQ149979; goat, AAA30907. IFN-�: human, P37290. IFN-�: human, CAH70158; cow, AAG14167; horse,P05001; dog, XP_538690. IFN-�: human, NM_176891; mouse, NM_177348; cow, XP_586616; IFN-�: human, EAW56869, EAW56870, EAW56871;mouse, AAX58714; rat, XP_001078329; cat, NP_001035770; dog, BAE94318. Avian IFN: goose, AAS57787; duck, P51526; turkey, P51527; quail,BAD05037; chicken IFNs were retrieved from chicken chromosome Z in the Ensemble genome database (www.ensemble.org).

3865The Journal of Immunology

by guest on January 31, 2018http://w

ww

.jimm

unol.org/D

ownloaded from

IFN3 are linked in a tail-to-tail arrangement in a �9.1-kb region ina single contig (BX005440). Both medaka and threespine stickle-back possess three almost identical copies of IFN genes within asmall chromosomal region, 12.0 kb in medaka and 8.3 kb inthreespine stickleback (www.ensembl.org). Fish type I IFN genesidentified to date contain 5 exons and 4 phase 0 introns except forthe medaka IFN genes which contain 4 exons and 3 introns due toabsence of the third intron. Analysis of the Ensemble databaseidentified 5 copies of Xenopus IFN genes (scaffold 48), which havethe same genomic organization as their fish counterparts. Align-ment of the IFN sequences containing introns indicates that theexon size is generally comparable and the position of the introns iswell conserved (Fig. 1A). Genomes from two mammalian species,platypus O. ananitus and opossum M. domestica, a monotreme andmarsupial, respectively, were also examined for IFN genes. Asin other mammals, multiple IFN genes lacking introns are present inboth species with 6 copies in platypus and 9 copies in opossum. Inthe EMBL WGS database, four of the six platypus genes (IFN1–4)are located in one contig (accession number AAPN01027751) andthe other two (IFN5 and IFN6) are located in two separate contigsunder the accession numbers AAPN01027751 and AAPN01206298. The opossum IFN genes were found in four contigs,AAFR03027363 (IFN1), AAFR03027366 (IFN2–6), AAFR03027364 (IFN7 and IFN8), and AAFR03027456 (IFN9).

Comparative and phylogenetic analysis

Analysis of all the sequences obtained shows that based on thecysteine numbers and position in the alignment, the fish IFNs canbe classified into two groups as seen in rainbow trout, group I withone pair of cysteines (C1/C3) and group II having an extra pair(C2/C4; Fig. 1), with the presence of C4 contributing to the CAWEmotif as in mammalian IFN-� and -�. Fish group I IFNs werepresent in all teleost species examined. whereas group II IFNswere found in only rainbow trout and zebrafish and perhaps arelimited to particular teleost species. The two cysteines seen in fishgroup I IFNs align well and are conserved among teleosts, but theposition of the cysteines is unique and does not match any of thecysteine arrangements seen in the known subclasses of IFNs inmammals (Fig. 1B). Mammalian IFN-�s and IFN-�s also containone pair of cysteines but they are at different locations and equiv-alent to C2 and C4 of IFN-�. It has been demonstrated by struc-tural analysis that in human IFN-� the four cysteines form twodisulfide bonds, whereas in murine IFN-� a single bond is formedfrom the two cysteines present (29, 30). In both cases, these di-sulfide bridges are important to stabilize the molecular structure. In

contrast, three pairs of cysteines are relatively conserved in mostIFN-�s, two of the cysteines are at the C-terminal region (data notshown). The four cysteines seen in fish group II IFNs match wellwith those seen in Xenopus except for Xenopus IFN1 and avianand mammalian type I IFNs except IFN-��s (Fig. 1). Curiously,despite the presence of C4 in Xenopus IFNs, they lack a CAWEmotif, with various conservative substitutions in the last threepositions.

Phylogenetic tree analysis of the IFN sequences supports fishIFNs being classified into two distinct groups (Fig. 2). Two majorgroups of type I IFNs are also apparent in Xenopus and chicken buttheir relationship with mammalian subtypes is not clear, suggest-ing the IFN proteins diverged into various subtypes after emer-gence of these vertebrate groups. Within the fish group I IFN,three main branches representing salmonids, cyprinids, and ad-vanced fish species that belong to the acanthopterygii (medaka,pufferfish, and threespine stickleback) are obvious. The rtIFN1has a closer relationship with salmon IFN-�1 and IFN-�2 thanwith rtIFN2, indicating that the rtIFN1 is an equivalent ho-molog of the two salmon genes and the rtIFN2 represents adistinct duplicated gene.

The phylogenetic tree (Fig. 2) also shows that in mammals sev-eral major branches exist. The eutherian IFN-� branch containsIFN-�, -�, -�, and -�. Neighboring this branch is the marsupialIFN-� cluster and the IFN-� cluster. The final cluster contains themonotreme IFN-� group, the IFN-� group, and the IFN-� group,with this third branch containing the monotreme, marsupial, andeutherian mammal IFN-� genes. This supports the prediction ofprevious studies that IFN-� and -� diverged earlier in evolutionthan other mammalian subclasses such as IFN-�, -�, -�, and -� (2).Lastly, inclusion of IFN-� in the tree shows that this group of IFN-are evolutionary very distant from the type I IFN identified to date.

IFN expression in trout tissues and cells

With multiple IFN genes present in trout, and particularly with thepresence of a newly identified IFN subgroup (rtIFN3), expressionand functional studies were next performed to gain an insight intohow these genes may differ. Ten fish tissues including brain, gill,gut, kidney, liver, muscle, skin, spleen, ovary, and testis wereexamined for rtIFN gene expression (Fig. 3). The expression ofrtIFN1 was not detected in any of the tissues analyzed, whereasrtIFN2 was constitutively expressed in all. Constitutive expres-sion of rtIFN3 was observed mainly in reproductive organs suchas ovary and testis, although a low level of transcript expressionwas detected in brain, gut, muscle, and skin. The rtIFN3 tran-script level in ovary and testis was much lower than that ofrtIFN2.

FIGURE 3. Tissue distribution of IFN genes in healthy fish. Tissuesstudied included brain, gill, gut, kidney, liver, muscle, skin, spleen, andovary collected from two female fish and testis from two male fish. Theresults from one female and one male individual are shown. GAPDH wasamplified as a positive control.

FIGURE 4. Expression of trout IFN genes in primary cultures of headkidney leukocytes and fibroblasts (RTG-2 cells), after stimulation withpoly(I:C). The cells were stimulated with different doses of poly(I:C) for6 h and total RNA was extracted for RT-PCR analysis of gene expression.GAPDH was amplified as a positive control. Values represent results fromthree independent experiments.

3866 EVOLUTION OF TYPE I IFNs

by guest on January 31, 2018http://w

ww

.jimm

unol.org/D

ownloaded from

To establish expression profiles of the trout IFN genes in vitro,freshly isolated head kidney cells and RTG-2 cells were treatedwith double-stranded poly(I:C) known to be a potent stimulus forIFNs. In primary cultures of head kidney leukocytes, no expressionwas detected for rtIFN1 and rtIFN3 in the control cells or cellsstimulated with low doses (0.1 and 1 g/ml) of poly(I:C), whereasconstitutive expression of the rtIFN2 was observed (Fig. 4). Weakinduction of the rtIFN2 and rtIFN3 was detected after stimulationwith 10 g/ml poly(I:C), whereas stimulation with 100 g/mlpoly(I:C) led to a significant increase of the transcripts for all threegenes, with rtIFN2 being the highest followed by rtIFN3 andrtIFN1. In RTG-2 cells, a fibroblast-like cell line, the expression

pattern of the trout IFN genes was different (Fig. 4). The rtIFN1was not expressed in control cells and cells stimulated with 0.1g/ml poly(I:C) but was induced after incubation with 1, 10, or 100g/ml poly(I:C), although the IFN1 transcriptional level remainedconstant. Similar to that seen in the head kidney cells, rtIFN2 wasconstitutively expressed in control RTG-2 cells, but the cells weremore sensitive to poly(I:C) exposure, with 0.1 g/ml having a largeeffect on rtIFN2 expression. Surprisingly, the rtIFN3 transcripts werenot detected by RT-PCR in both control and stimulated RTG-2 cells.The same expression pattern for the three trout IFN genes was alsoobserved in RTS-11 cells, a macrophage cell line, after stimulationwith poly(I:C) (data not shown).

FIGURE 5. Expression of trout IFN genes in tissuesafter viral challenge. Two groups of rainbow trout(9–12 g) were injected i.p. with 100 l of 1 � 107

TCID50/ml per fish or L-15 medium. At days 1, 2, 3, and7 postinjection, five fish from each group were killed forcollection of head kidney, spleen, and liver. Tissueswere pooled for extraction of total RNA and RT-PCRanalysis. GAPDH was amplified as a positive control.

FIGURE 6. Characterization of biological activities of the recombinant trout IFNs produced in E. coli. A, SDS-PAGE analysis of rrtIFN proteins underreducing conditions. The rrtIFN proteins were purified from E. coli M15 cells under native conditions. Lanes 1–3, 0.5 g of rrtIFN1, rrtIFN2, and rrtIFN3respectively. B, Mx expression in RTG-2 cells stimulated with rrtIFNs. The RTG-2 cells were preincubated with 10 g/ml cycloheximide for 0.5 h and thenstimulated with different doses of rrtIFNs for 6 h. Elution buffer used to elute IFN proteins during purification was used as a negative control, with GAPDHamplified as a positive control. Values are representative of the results from three independent experiments. C, antiviral activities of rrtIFNs. The RTG-2cells were incubated with varying doses of the rrtIFNs for 4 h and then challenged with VHSV. After 5–7 days, the cells were observed under an invertedmicroscope for cytopathic effects and viral titers were calculated according to the method of Reed and Muench (27).

3867The Journal of Immunology

by guest on January 31, 2018http://w

ww

.jimm

unol.org/D

ownloaded from

In vivo IFN expression in response to viral challenge

VHSV is a widespread infectious pathogen in rainbow trout. Toinvestigate the IFN expression profiles during VHSV infection,fish were exposed to VHSV by i.p injection with the virus andtissues, including head kidney, spleen, and liver, were sampled forRT-PCR analysis. As observed in the in vitro studies, rtIFN2 wasconstitutively expressed in these tissues (Fig. 5), and infection re-sulted in increased expression most notable at day 3 in the kidneyand spleen. For rtIFN1, no constitutive expression was seen butexpression was apparent at day 2/3 in spleen or 3 in the kidneypostinfection. With rtIFN3, a similar result was seen at day 2 inspleen and days 2 or 3 in kidney. Weak expression of rtIFN3 wasalso seen in the liver at days 1 and 7.

Biological activities of bacterially expressed recombinant trouttype I IFNs

To test the biological activities of the identified IFN molecules,rrtIFN proteins were produced in E. coli and purified under nativeconditions (Fig. 6A). The three recombinant trout IFNs with a6-histidine tag at the N terminus migrate at the size of �18–20kDa, consistent with the theoretical molecular mass calculated byPeptideMass program (www.expasy.ch): 19.4 kDa for rrtIFN1;20.1 kDa for rrtIFN2; and 20.0 kDa for rrtIFN3. The Mx protein,known to be up-regulated by type I IFNs (14–16), was studiedinitially to determine the activities of the recombinant proteins. Toexclude the interference of endogenous IFN proteins constitutivelyproduced in the RTG-2 cells, the cells were incubated with me-dium containing 10 g/ml cycloheximide for 0.5 h before stimu-lation with the rrtIFNs. Then, in the presence of cycloheximide, thecells were cultured with the rrtIFNs for 6 h at doses of 0.1, 1, 10,and 100 ng/ml, respectively. Fig. 6B shows there was a clear dose-dependent effect on Mx gene expression after stimulation with therrtIFN1 and rrtIFN2. However, rrtIFN3 purified under native con-ditions was ineffective at up-regulating Mx gene expression atdoses of 0.1, 1, and 10 ng/ml, although at 100 ng/ml the proteinelicited a weak induction. Similar results were found with bothRTS-11 cells and primary cultures of head kidney leukocytes (datanot shown).

The IFN biological activity was studied further in antiviral ex-periments conducted in RTG-2 cells and showed that both rrtIFN1and rrtIFN2 were potent in inducing a cellular antiviral state butthat rrtIFN3 had no impact (Fig. 6C). Thus, both rrtIFN1 andrrtIFN2 resulted in a decrease in the VHSV titer in a dose-depen-dent manner, whereas rrtIFN3 was not capable of significantlyinhibiting viral replication at the doses used.

A further experiment was performed to investigate whetherrrtIFN1 and rrtIFN3 bind to the same receptor complex. RTG-2

cells were incubated simultaneously with 2.5 ng/ml rrtIFN1 andvarious doses of rrtIFN3 for 6 h (Fig. 7). This experiment showedthat rrtIFN1-induced Mx expression was not decreased by incuba-tion with rrtIFN3, suggesting that rrtIFN3 failed to bind to thereceptor complex used by rrtIFN1.

DiscussionIn this report, three type I IFN homologues, belonging to two dis-tinct groups, have been characterized in rainbow trout Oncorhyn-chus mykiss. All of the genes have a predicted signal peptide, sug-gesting they are secreted, have a similarly sized mature peptide(151–161 aa) and a common gene structure of 5 exons and 4 in-trons. However, the presence/absence of key cysteine residues andoverall homology allow the categorization into the two subgroups,which expression studies confirm are different in terms of the cellsand tissues the produce them. The trout group I IFNs (rtIFN1 andrtIFN2) are equivalent to other fish type I IFN molecules se-quenced to date and structurally and functionally resemble type IIFN family members in higher vertebrates. They are induced bypoly(I:C) and virus, and themselves can induce an antiviral stateand up-regulation of antiviral proteins (e.g., Mx). Although bothproteins had similar potency, rtIFN2 was the dominant transcriptand was constitutively expressed in a wide range of tissues fromhealthy fish (Fig. 3) and cell lines. In contrast, trout group II IFN(rtIFN3) appears to have a more restricted expression pattern withexpression detected in reproduction organs such as testis and ovaryfrom healthy fish (Fig. 3), and upon appropriate stimulation isdetectable in mixed leukocyte cell suspensions but not cell lines.The antiviral activity of rrtIFN3 also appears minimal, although itcannot be excluded at this time that incorrect folding of the puri-fied rrtIFN3 hampered binding of rrtIFN3 to its receptor or thecells used for these functional studies (cell lines and head kidneyleukocytes) could lack an appropriate receptor to respond tortIFN3.

It is not unusual for particular type I IFNs to have differentialexpression patterns. In mammals, IFN-�, is mainly produced byviral infected leukocytes while IFN-� is synthesized by most celltypes but especially in fibroblasts (31, 32). Recently it has beenshown in humans and mice that the main IFN-� producer is asubtype of dendritic cell which accounts for �1% of blood leu-kocytes (6). These dendritic cells, that play a crucial role in pre-senting viral Ags to Th cells and CTLs, are capable of synthesizing�100-fold higher amounts of IFN-� than any other cell types uponviral infection. Recent evidence suggests that dendritic cells maybe present in fish (33), so whether the same situation exists in fishand whether particular cell types express only some of the IFNisoforms now known will be particularly interesting to determinein future studies.

Although previous studies have investigated the functional ac-tivity of fish type I IFNs, they have used culture medium derivedfrom cells transfected with expression plasmids containing thecloned fish IFN genes (14–16). Thus, this is the first study to usepurified recombinant fish IFNs for biological studies. The abovestudies used eukaryotic cells for transfection, and so this is alsothe first report that E. coli derived fish rIFN is active, and thatglycosylation may not be essential for biological activity althoughputative N-linked glycosylation sites are present in the mature pep-tides of the trout molecules. However, one explanation for the pooractivity of rrtIFN3 could be that it does require glycosylation to beactive. There is no clear reason why this might be the case, and theprotein does not have more potential glycosylation sites than seenin the other trout isoforms. Indeed, rtIFN2 has the largest numberof potential sites (3) relative to the other two isoforms (which have1 each). As stated above, perhaps it is more likely that folding is

FIGURE 7. RT-PCR analysis of Mx expression in RTG-2 cells aftercostimulation with rrtIFN1 and rrtIFN3 purified under native conditions.The RTG-2 cells were incubated with 10 g/ml cycloheximide for 0.5 hand subsequently stimulated with only rrtIFN3 or costimulated withrrtIFN1 and rrtIFN3 for 6 h. For costimulation, 2.5 ng/ml rrtIFN1 andvarious doses of rrtIFN3 (1, 10, 100, and 300 ng/ml) were used. As acontrol, cells were stimulated with only rrtIFN3 at doses of 0.1, 1, 10, and100 ng/ml. The cells were harvested for RNA extraction, and Mx expres-sion was determined by RT-PCR. GAPDH was amplified as a positivecontrol. EB, Elution buffer.

3868 EVOLUTION OF TYPE I IFNs

by guest on January 31, 2018http://w

ww

.jimm

unol.org/D

ownloaded from

an issue, and that the majority of the recombinant rrtIFN3 mole-cules are not folded correctly, leading to failure of binding to itsreceptor. The rtIFN3 molecule possesses four cysteines, two morethan that in rtIFN1 and rtIFN2, and pairing of such cysteines couldbe crucial to maintain the correct structure. Finally, it cannot beexcluded that rrtIFN3 may bind to a different receptor from thatused by rtIFN1 and rtIFN2, thus leading to a distinct cellularresponse.

The discovery of a second group of type I IFN in trout encour-aged the search for equivalent molecules in other fish species, andspecies for which a genome is available for in silico analysis werestudied. This analysis showed that while fish group I IFNs appearto be present universally in teleosts, fish group II IFNs were foundonly in more primitive species such as rainbow trout and zebrafish.In addition, this bioinformatics analysis of other vertebrate ge-nomes (for Xenopus, chicken and mammals) confirmed the ab-sence of homologues equivalent to fish group I IFNs. The analysisof the Xenopus genome identified for the first time type I IFNgenes in amphibians, and confirmed that they are of the four cys-teine type although they could also be divided into two main sub-groups, and are intron containing genes, with the now typical 5exon-4 intron organization. In mammals, particular attention wasgiven to the platypus and opossum genomes, where 6 and 9 copiesof intronless type I IFN genes were found respectively. Their link-age was not entirely clear, but multiple genes within contigs wereapparent. That relatively few IFN genes were found in platypussupports the argument put forward in recent papers thatmonotremes have fewer IFN genes compared with marsupial andeutherian mammals (2, 34), with expansion of IFN subclasses dur-ing evolution in higher mammals perhaps associated with the tran-sition from egg-laying into fetus based reproduction (5).

All of these new genes were added to other known mammalian,chicken and fish type I IFN genes for phylogenetic tree analysis. It

is evident from this analysis that fish, amphibians and birds do nothave the equivalent subclasses of type I IFNs seen in mammals,such as IFN-�, �, �, �, �, � and �, although two distinct groupsappear to be present within such vertebrate species. Thus bothamphibian and avian type I IFNs could be divided into two sub-groups, although in all cases they were 4 cysteine containing mol-ecules. The previously classified chicken IFN-� and IFN-� appearto be homologous isoforms because they are within the same cladeconsisting of chicken IFN1–4, and so are not true orthologs ofmammalian IFN-� and IFN-� as stated previously (35). However,chicken IFN5 represents a quite disparate chicken IFN subgroup.Similarly in monotreme mammals such as platypus and echidna,only two major isoforms of type I IFN exist, suggesting expansionof the mammalian subclasses is a recent evolutionary event. Thesetwo groups of monotreme IFNs are probably the prototypes of the� and � subgroups, despite their clustering with IFN-��s, based onthe fact that one group, including platypus IFN1–4 and echidnaIFN-�, contain four cysteines as seen in IFN-� whereas the secondgroup, containing platypus IFN5 and IFN6 and echidna IFN-�,have only two cysteines that share the same cysteine pattern (i.e.,C2 and C4) as in IFN-��s (Fig. 1B). The phylogenetic tree analysisof the opossum IFN genes also showed that IFN-� possibly ap-peared in marsupials after divergence of IFN-�, by duplication ofan IFN progenitor with four cysteines, because one of the opossumgenes clusters well with the IFN-�s. Although this is the first find-ing of an IFN-� in marsupials, it had been predicted in previousstudies that IFN-� diverged early from other type I IFNs in mam-mals (2). The phylogenetic tree has also demonstrated that theIFN-�s, also containing the same cysteine pairing pattern (C2C4)with IFN-�, are likely to have been duplicated from IFN-� pos-sibly at a later stage in evolution because to date no IFN-� s havebeen identified in noneutheria vertebrate species (3).

FIGURE 8. Schematic model proposed for the evolution of type I IFN family members in vertebrates.

3869The Journal of Immunology

by guest on January 31, 2018http://w

ww

.jimm

unol.org/D

ownloaded from

It is still not known what selection advantage multiple copies oftype I IFNs give. It may be that during evolution vertebrates hadto produce a repertoire of IFNs to combat increasing numbers ofpathogens or in response to other immune/physiological changes.In contrast, lack of introns restrained variation of the IFN isoformsbecause splicing of intron sequences at the RNA level at least canprovide the possibility to generate different proteins. Indeed, IFNvariants derived from alternative RNA splicing have been reportedin catfish (15), rainbow trout (GenBank accession numberAJ580911), Atlantic salmon (18), and more recently zebrafish(36).

The type I IFN genes are clustered in the genomes of all ver-tebrate groups in which they have been discovered (i.e., fish, am-phibians, birds, mammals), providing a map to analyze gene/ge-nome duplications or other events in evolution. A single IFN locuswith multiple tandemly linked IFN genes exists in most verte-brates, although the IFN-� genes are located at a chromosomallocus distant from the main IFN locus (3, 37). That amphibian aswell as fish type I IFN genes contain 5 exons and 4 introns sup-ports the concept that a retroposition event occurred between theemergence of amphibians and birds/mammals, which led to re-placement of the single type I IFN gene locus by an IFN transcript.No evidence for an intron containing an intron lacking IFN genescoexisting in any vertebrate species has been found, and it is un-likely that an IFN transcript was introduced into a different locuswhile the whole IFN locus was simultaneously deleted. Futuresequencing of the IFN genes in reptiles should help determine thetime of this retroposition event and whether it was a random eventor potentially coincident with the appearance of major physiolog-ical changes (e.g., perhaps the emergence of warm bloodedness).

The presence of introns in primordial IFN genes gives clues toeven earlier origins of this cytokine family, with clear relatednessto other four � helix cytokines such as IL-10 family members andIFN-� molecules, suggesting that they arose from a common an-cestor (11). This is supported by the fact that they have similarpredicted protein structure, although divergent in the primary pro-tein sequences, and exactly the same gene organization with 4introns at phase 0. In addition, one of the two chains forming thereceptor complex that is shared by IL-10 and IFN-� (IL-10R2), iswithin the chromosomal locus where type I IFN receptors are lo-cated, providing an example of coevolution of ligands and recep-tors after gene/genome duplication. Gene synteny of the IFN re-ceptor locus is known to be conserved in chickens (38). It couldbe argued that fish type I IFN are perhaps more closely related tothe intron containing IFN-�; recent work to characterize candidateIFNR chains in zebrafish suggest just this, as the receptor identifiedis similar to the IFN-� receptor based on some elegant knockdownstudies (36). However, these studies did not use recombinant orpurified IFN and were not aware of the multiple isotypes of type IIFN in fish; thus, the jury must remain out for the time being. Onthe basis of homology alone, fish type I IFNs appear closer to theknown type I IFNs (e.g., average 41–47%, trout IFNs vs type IIFNs) than to IFN-�s (e.g., average �37%, trout IFNs vs IFN-�s)and homology analysis (e.g., BLAST) of the primary nucleotideand protein sequences indicates that fish IFNs are closer to mam-malian type I IFNs than IFN-�s (14–17). Moreover, fish IFNspossess distinct cysteine patterns (two or four cysteines) compa-rable with known type I IFNs and different from IFN-�s, whichcontains six cysteines. Finally, and most notably, fish group IIIFNs contain a CAWE motif conserved among mammalianIFN-�s.

In summary (Fig. 8), this study has demonstrated that there existmultiple copies of type I IFN genes from fish to mammals, whichcan be classified into three different groups based on cysteine pat-

terns. In fish, amphibians, and birds, type I IFN genes are confinedin a single chromosomal locus. Evolution of the type I IFN genescan be divided into two major phases possibly separated by a ge-nome retroposition event that occurred between the emergence ofamphibians and birds/mammals, resulting in loss of the unique IFNlocus containing intronic IFN genes and introduction of intron-lacking genes. Expansion within species due to gene or genomeduplication is apparent. The four-cysteine-containing IFNs exist inevery order of vertebrates, and we postulate that they are the an-cestors of the type I IFN family. The two-cysteine-containingIFN-�s and IFN-�s evolved from a four-cysteine-containing pro-genitor by deletion of two cysteines (C1 and C3) and are presentin mammals. An isoform of IFN that also contains two cysteines ispresent uniquely in fish and retained C1 and C3 in contrast toIFN-� and IFN-�. This isoform may have superceded the four-cysteine-containing isoform in advanced teleosts. The results fromthis study on IFN molecules in a lower vertebrate species (rainbowtrout) suggests that as in mammals, different groups of IFNs mayhave arisen with distinct physiological and/or immune functions innonmammalian species.

DisclosuresThe authors have no financial conflict of interest.

References1. Samuel, C. E. 2001. Antiviral actions of interferons. Clin. Microbiol. Rev. 14:

778–809.2. Harrison, G. A., L. J. Young, C. M. Watson, K. B. Miska, R. D. Miller, and

E. M. Deane. 2003. A survey of type I interferons from a marsupial andmonotreme: implications for the evolution of the type I interferon gene family inmammals. Cytokine 21: 105–119.

3. Hardy, M. P., C. M. Owczarek, L. S. Jermiin, M. Ejdeback, and P. J. Hertzog.2004. Characterization of the type I interferon locus and identification of novelgenes. Genomics 84: 331–345.

4. Roberts, R. M., L. Liu, Q. Guo, D. Leaman, and J. Bixby. 1998. The evolutionof the type I interferons. J. Interferon Cytokine Res. 18: 805–816.

5. Demmers, K. J., K. Derecka, and A. Flint. 2001. Trophoblast interferon andpregnancy. Reproduction 121: 41–49.

6. Siegal, F. P., N. Kadowaki, M. Shodell, P. A. Fitzgerald-Bocarsly, K. Shah,S. Ho, S. Antonenko, and Y. J. Liu. 1999. The nature of the principal type 1interferon-producing cells in human blood. Science 284: 1835–1837.

7. van Pesch, V., H. Lanaya, J. C. Renauld, and T. Michiels. 2004. Characterizationof the murine � interferon gene family. J. Virol. 78: 8219–8228.

8. Coulombel, C., G. Vodjdani, and J. Doly. 1991. Isolation and characterization ofa novel interferon-�-encoding gene, IFN-� 11, within a murine IFN cluster. Gene104: 187–195.

9. Kotenko, S. V., G. Gallagher, V. V. Baurin, A. Lewis-Antes, M. Shen,N. K. Shah, J. A. Langer, F. Sheikh, H. Dickensheets, and R. P. Donnelly. 2003.IFN-�s mediate antiviral protection through a distinct class II cytokine receptorcomplex. Nat. Immunol. 4: 69–77.

10. Sheppard, P., W. Kindsvogel, W. Xu, K. Henderson, S. Schlutsmeyer,T. E. Whitmore, R. Kuestner, U. Garrigues, C. Birks, J. Roraback, et al. 2003.IL-28, IL-29 and their class II cytokine receptor IL-28R. Nat. Immunol. 4: 63–68.

11. Lutfalla, G., C. H. Roest, N. Stange-Thomann, O. Jaillon, K. Mogensen, andD. Monneron. 2003. Comparative genomic analysis reveals independent expan-sion of a lineage-specific gene family in vertebrates: the class II cytokine recep-tors and their ligands in mammals and fish. BMC Genomics 4: 29.

12. Robertsen, B. 2006. The interferon system of teleost fish. Fish Shellfish Immunol.20: 172–191.

13. Schultz, U., B. Kaspers, and P. Staeheli. 2004. The interferon system of non-mammalian vertebrates. Dev. Comp. Immunol. 28: 499–508.

14. Altmann, S. M., M. T. Mellon, D. L. Distel, and C. H. Kim. 2003. Molecular andfunctional analysis of an interferon gene from the zebrafish, Danio rerio. J. Virol.77: 1992–2002.

15. Long, S., M. Wilson, E. Bengten, L. Bryan, L. W. Clem, N. W. Miller, andV. G. Chinchar. 2003. Identification of a cDNA encoding channel catfish inter-feron. Dev. Comp. Immunol. 28: 97–111.

16. Robertsen, B., V. Bergan, T. Rokenes, R. Larsen, and A. Albuquerque. 2003.Atlantic salmon interferon genes: cloning, sequence analysis, expression, andbiological activity. J. Interferon Cytokine Res. 23: 601–612.

17. Zou, J., S. Bird, and C. Secombes. 2005. Fish cytokine gene discovery and link-age using genomic approaches. Marine Biotech. 6: S533–S539.

18. Berga, V., S. Steinsvik, H. Xu, O. Kileng, and B. Robertsen. 2006. Promoters oftype I interferon genes from Atlantic salmon contain two main regulatory regions.FEBS J. 273: 3893–3390.

19. Sharp, G. J. E., A. W. Pike, and C. J. Secombes. 1991. Leukocyte migration inrainbow trout (Oncorhynchus mykiss Walbaum): optimization of migration con-ditions and responses to host and pathogen (Diphyllobothrium dendriticumNitzsch) derived chemoattractants. Dev. Comp. Immunol. 15: 295–305.

3870 EVOLUTION OF TYPE I IFNs

by guest on January 31, 2018http://w

ww

.jimm

unol.org/D

ownloaded from

20. Ganassin, R. C. 1998. Development of a monocyte/macrophage-like cell line,RTS11, from rainbow trout spleen. Fish Shellfish Immunol. 8: 457–476.

21. Thompson, J. D., D. G. Higgins, and T. J. Gibson. 1994. CLUSTAL W: improv-ing the sensitivity of progressive multiple sequence alignment through sequenceweighting, position-specific gap penalties and weight matrix choice. Nucleic Ac-ids Res. 22: 4673–4680.

22. Kumar, S., K. Tamura, and M. Nei. 1994. Mega-molecular evolutionary geneticsanalysis software for microcomputers. Comput. Appl. Biosci. 10: 189–191.

23. Needleman, S. B., and C. D. Wunsch. 1970. A general method applicable to thesearch for similarities in the amino acid sequence of two proteins. J. Mol. Biol.48: 443–453.

24. Nielsen, H., J. Engelbrecht, S. Brunak, and G. von Heijne. 1997. A neural net-work method for identification of prokaryotic and eukaryotic signal peptides andprediction of their cleavage sites. Int. J. Neural Syst. 8: 581–599.

25. Fijan, N., D. Sulimanovic, M. Bearzotti, D. Mizinic, L. O. Zwillenberg,S. Chilmonczyk, J. F. Vautherot, and P. de Kinkelin. 1983. Some properties of theepithelioma papulosum cyprini (EPC) cell line from carp Cyprinus carpio. Ann.Virol. 134: 207–220.

26. Hong, S., J. Zou, M. Crampe, S. Peddie, G. Scapigliati, N. Bols, C. Cunningham,and C. J. Secombes. 2001. The production and bioactivity of rainbow trout (On-corhynchus mykiss) recombinant IL-1�. Vet. Immunol. Immunopathol. 81: 1–14.

27. Beales, L. P., D. J. Wood, P. D. Minor, and J. A. Saldanha. 1996. A novelcytopathic microtitre plate assay for hepatitis A virus and anti-hepatitis A neu-tralizing antibodies. J. Virol. Methods 59: 147–154.

28. Reed, L., and H. Muench. 1938. A simple method of estimating fifty percent endpoints. Am. J. Hyg. 27: 493–497.

29. Karpusas, M., M. Nolte, C. B. Benton, W. Meier, W. N. Lipscomb, and S. Goelz.1997. The crystal structure of human interferon � at 2.2-A resolution. Proc. Natl.Acad. Sci. USA 94: 11813–11818.

30. Klaus, W., B. Gsell, A. M. Labhardt, B. Wipf, and H. Senn. 1997. The three-dimensional high resolution structure of human interferon �-2a determined byheteronuclear NMR spectroscopy in solution. J. Mol. Biol. 274: 661–675.

31. Derynck, R., J. Content, E. DeClercq, G. Volckaert, J. Tavernier, R. Devos, andW. Fiers. 1980. Isolation and structure of a human fibroblast interferon gene.Nature 285: 542–547.

32. Goeddel, D. V., D. W. Leung, T. J. Dull, M. Gross, R. M. Lawn, R. McCandliss,P. H. Seeburg, A. Ullrich, E. Yelverton, and P. W. Gray. 1981. The structure ofeight distinct cloned human leukocyte interferon cDNAs. Nature 290: 20–26.

33. Ohta, Y., E. Landis, T. Boulay, R. B. Phillips, B. Collet, C. J. Secombes,M. F. Flajnik, and J. D. Hansen. 2004. Homologs of CD83 from elasmobranchand teleost fish. J. Immunol. 173: 4553–4560.

34. Harrison, G. A., K. A. McNicol, and E. M. Deane. 2004. Type I interferon genesfrom the egg-laying mammal. Tachyglossus aculeatus (short-beaked echidna).Immunol. Cell Biol. 82: 112–118.

35. Sick, C., U. Schultz, and P. Staeheli. 1996. A family of genes coding for twoserologically distinct chicken interferons. J. Biol. Chem. 271: 7635–7639.

36. Levraud, J., P. Doudinot, I. B. A. Colin, N. Peyrieras, P. Herbomel, andG. Lutfalla. 2007. Identification of the zebrafish IFN receptor: implications forthe origin of the vertebrate IFN system. J. Immunol. 178: 4385–4394.

37. LaFleur, D. W., B. Nardelli, T. Tsareva, D. Mather, P. Feng, M. Semenuk,K. Taylor, M. Buergin, D. Chinchilla, V. Roshke, et al. 2001. Interferon-�, anovel type I interferon expressed in human keratinocytes. J. Biol. Chem. 276:39765–39771.

38. Reboul, J., K. Gardiner, D. Monneron, G. Uze, and G. Lutfalla. 1999. Compar-ative genomic analysis of the interferon/interleukin-10 receptor gene cluster. Ge-nome Res. 9: 242–250.

3871The Journal of Immunology

by guest on January 31, 2018http://w

ww

.jimm

unol.org/D

ownloaded from