Upload
others
View
1
Download
0
Embed Size (px)
Citation preview
1
IDENTIFICATION OF Cav 3.2 T-TYPE VOLTAGE GATED CALCIUM CHANNELS AS KEY MEDIATORS OF TARGETED INHIBITION OF HEPATOCELLULAR CARCINOMA BY AMPLITUDE-MODULATED
RADIOFREQUENCY ELECTROMAGNETIC FIELDS
BY
HUGO JIMENEZ
A Dissertation Submitted to the Graduate Faculty of
WAKE FOREST UNIVERSITY GRADUATE SCHOOL OF ARTS AND SCIENCES
In Partial Fulfillment of the Requirements
For the Degree of
DOCTOR OF PHILOSOPHY
Cancer Biology
May, 2018
Winston-Salem, North Carolina
Approved By:
Boris C. Pasche, M.D., Ph.D., Advisor
Glenn Lesser, M.D., Chair
Carl F. Blackman, Ph.D.
Waldemar Debinski, M.D., Ph.D.
Ravi Singh, Ph.D.
2
DEDICATION AND ACKNOWLEDGEMENTS
I dedicate this dissertation to my family and friends who supported me
throughout the process of attaining my doctorate. Their support is constant
reminder of why I chose to complete my doctorate and why I must continue to
strive onward.
I would like to acknowledge Boris C. Pasche, M.D., Ph.D. for his guidance
in my doctoral studies, mentorship in understanding the logistics of academia
and trust in believing that I was capable of deducing the puzzle that is AM RF
EMF. Additionally, I would to like acknowledge Carl F. Blackman, Ph.D. for taking
the time to come to Winston-Salem every week and choosing to spend his
retirement working with our lab to further a field of research that he was
instrumental in founding. Lastly, I would like to acknowledge my predecessor
Jacquelyn W. Zimmerman, M.D., Ph.D. for taking the time to show me the
potential of this project.
I would like to thank the members of my committee Waldemar Debinski,
M.D., Ph.D., Glenn Lesser, M.D. and Ravi Singh, Ph.D. for their understanding,
time and patience.
Finally, I would like to thank all the members of my lab (past and present)
for their help throughout my student career.
3
Contents
LIST OF ILLUSTRATIONS AND TABLES............................................................................................... 7
LIST OF ABBREVIATIONS .................................................................................................................. 9
ABSTRACT ....................................................................................................................................... 11
INTRODUCTION .............................................................................................................................. 12
CHAPTER I: Use of non-ionizing electromagnetic fields for the treatment of cancer ................... 13
Abstract ...................................................................................................................................... 14
Introduction ............................................................................................................................... 14
History of radiofrequency electromagnetic fields (RF EMF) ...................................................... 14
Minimally-invasive RF EMF for therapeutic use in cancer ......................................................... 21
Nano-radio-frequency ablation (Na-RFA) .............................................................................. 21
TheraBionic: tumor-specific AM RF EMF ............................................................................... 24
Novocure ................................................................................................................................ 28
Novocure and TheraBionic: two novel modalities for cancer treatment .................................. 30
Relevant literature for Novocure/Optune ............................................................................. 31
Relevant Literature for TheraBionic ....................................................................................... 31
Conclusion .................................................................................................................................. 33
Acknowledgement ..................................................................................................................... 34
References ................................................................................................................................. 35
Figures, tables and legends ........................................................................................................ 50
CHAPTER II: Cav3.2 T-type VGCCs mediate targeted blockade and myofibroblast differentiation
of hepatocellular carcinoma by tumour-specific AM RF EMF ....................................................... 53
Abstract ...................................................................................................................................... 54
Introduction ............................................................................................................................... 54
Results ........................................................................................................................................ 56
Whole-body and organ-specific dosimetry ............................................................................ 56
Analysis of in vivo effects of amplitude-modulated radiofrequency electromagnetic fields 59
Tumour shrinkage is caused by HCC cell differentiation into quiescent myofibroblasts ...... 61
Calcium influx and Cav3.2 T-type Voltage Gated Calcium Channels mediate AM RF EMF
antiproliferative effects ......................................................................................................... 62
4
HCC-specific AM RF EMF block HCC cancer stem cells .......................................................... 64
Discussion .................................................................................................................................. 65
Online methods: ........................................................................................................................ 70
Acknowledgements: .................................................................................................................. 84
Author contributions: ................................................................................................................ 84
References ................................................................................................................................. 86
Figures and legends ................................................................................................................... 93
Supplemental Figures .............................................................................................................. 101
CONCLUSION ................................................................................................................................ 113
APPENDICES ................................................................................................................................. 115
APPENDIX a: The role of cell death in hepatocellular carcinoma-specific amplitude-modulated
radiofrequency electromagnetic fields .................................................................................... 115
Introduction ......................................................................................................................... 116
Results .................................................................................................................................. 117
Discussion / future direction ................................................................................................ 117
Materials and methods ........................................................................................................ 118
References ........................................................................................................................... 119
Figure, tables and legends ................................................................................................... 120
APPENDIX b: Ambient electromagnetic fields do not affect AM RF EMF antiproliferative
effects ...................................................................................................................................... 122
Introduction ......................................................................................................................... 123
Results .................................................................................................................................. 124
Discussion / future direction ................................................................................................ 124
Materials and methods ........................................................................................................ 125
References ........................................................................................................................... 127
Figures, tables, and legends ................................................................................................. 128
APPENDIX c: MMTV.HER2 / NEU spontaneous mouse model of breast cancer exposed to
breast cancer-specific amplitude modulated radiofrequency electromagnetic fields ............ 129
Introduction ......................................................................................................................... 130
Results .................................................................................................................................. 130
Discussion / future direction ................................................................................................ 131
Materials and methods ........................................................................................................ 132
5
References ........................................................................................................................... 133
Figures, tables and legends .................................................................................................. 134
APPENDIX d: Glioblastoma-specific amplitude modulated radiofrequency electromagnetic
fields ......................................................................................................................................... 135
Introduction ......................................................................................................................... 136
Results .................................................................................................................................. 138
Discussion / future direction ................................................................................................ 141
Materials and methods ........................................................................................................ 143
References ........................................................................................................................... 149
Figures, tables and legends .................................................................................................. 152
APPENDIX e: Testing the specific response of individual cell lines, from multiple cancer
models, to tumor-specific amplitude modulated radiofrequency electromagnetic fields ..... 162
Introduction ......................................................................................................................... 163
Results .................................................................................................................................. 163
Discussion / future direction ................................................................................................ 163
Materials and methods ........................................................................................................ 164
References ........................................................................................................................... 165
Figures, tables and legends .................................................................................................. 166
APPENDIX f: The combined use of anti-mitochondrial metabolism agent, lipoate derivative
CPI-613, and hepatocellular carcinoma-specific amplitude-modulated radiofrequency
electromagnetic fields on Huh-7 cells ...................................................................................... 173
Introduction ......................................................................................................................... 174
Results .................................................................................................................................. 175
Discussion / future direction ................................................................................................ 175
Materials and methods ........................................................................................................ 176
References ........................................................................................................................... 177
Figures, tables and legends .................................................................................................. 179
APPENDIX g: Determination of frequency bandwidths for effective Hepatocellular Carcinoma
specific-amplitude-modulated radiofrequency electromagnetic fields treatment. ................ 181
Introduction ......................................................................................................................... 182
Results .................................................................................................................................. 183
Discussion / future direction ................................................................................................ 183
Materials and methods ........................................................................................................ 184
6
References ........................................................................................................................... 185
Figures, tables and legends .................................................................................................. 187
APPENDIX h: Inducible mouse model of hepatocellular carcinoma and species specificity of
hepatocellular carcinoma-specific amplitude-modulated radiofrequency electromagnetic
fields ......................................................................................................................................... 190
Introduction ......................................................................................................................... 191
Results .................................................................................................................................. 191
Discussion / future direction ................................................................................................ 191
Materials and methods ........................................................................................................ 193
References ........................................................................................................................... 194
Figures, tables and legends .................................................................................................. 195
CURRICULUM VITAE ..................................................................................................................... 196
7
LIST OF ILLUSTRATIONS AND TABLES
CHAPTER I Figure 1. 50 Figure 2. 51 Table 1. 52 CHAPTER II Figure 1. 93 Figure 2. 95-96 Figure 3. 98 Table 1. 99 Table 2. 100 Suppl Figure 1. 101-103 Suppl Figure 2. 104 Suppl Figure 3. 105-107 Suppl Figure 4. 108-109 Suppl Table 1. 110-111 Suppl Table 2. 112 APPENDIX a Figure 1. 120 Figure 2. 121 APPENDIX b Figure 1. 128 APPENDIX c Figure 1. 134 APPENDIX d Figure 1. 152 Figure 2. 153 Figure 3. 154 Figure 4. 155 Figure 5. 156 Figure 6. 157 Figure 7. 158 Figure 8. 159 Figure 9. 160 Table 1. 161 APPENDIX e Figure 1. 166 Figure 2. 167 Figure 3. 168
8
Figure 4. 169 Figure 5. 170 Figure 6. 171 Figure 7. 172 APPENDIX f Figure 1. 179 Figure 2. 180 APPENDIX g Figure 1. 187 Table 1. 188 Table 2. 189 APPENDIX h Figure 1. 195
9
LIST OF ABBREVIATIONS
AM RF EMF: Amplitude-Modulated Radiofrequency Electromagnetic Fields RF EMF: Radiofrequency Electromagnetic Fields HCC: Hepatocellular Carcinoma VGCC: Voltage-Gated Calcium Channel GBM: Glioblastoma Multiforme TTF: Tumor Treating Fields R&D: Research and development V: Volts cm: centimeter nm: nanometer ft: foot m: meter μT: microTesla Hz: Hertz kHz: Kilohertz VHF: Very high frequency EEG: Electroencephalography Na-RFA: Nano-radio frequency ablation SWNT: Single-walled carbon nanotube C-Co-NP: Carbon coated nano particles P: Power R: Resistance I: Electric current J: Joule W: Watt CI: Confidence interval HR: Hazard Ratio RR: Response rate Ca2+: Calcium K+: Potassium Na+: Sodium GABA: Gamma-aminobutyric acid NCI: National Cancer Institute FDA: Food and Drug Administration MHz: Megahertz SAR: Specific Absorption Rate mW: Milliwatt kg: Kilogram wbSAR: Whole Body Specific Absorption Rate psSAR: Peak Spatial Specific Absorption Rate CSC: Cancer Stem Cell GFP: Green Fluorescent protein RFP: Red Fluorescent protein
10
PBS: Phosphate buffered saline XCL2: X-C motif chemokine ligand 2 PLP2: Proteolipid protein 2 IDH1: Isocitrate dehydrogenase 1 IDH2: Isocitrate dehydrogenase 2 GAPDH: Glyceraldehyde 3-phosphate dehydrogenase APC: Adenomatous polyposis coli ASPM: Abnormal spindle-like microcephaly-associated protein CEP 152: Centrosomal Protein 152 PLK 1: Polo-Like Kinase 1 PLK 4: Polo-Like Kinase 4 SHAM: No treatment control group RCF: Random-chosen frequency PFS: Progression-free survival OS: Overall survival mM: milliMolar μM: microMolar NOD SCID: Nonobese diabetic/severe combined immunodeficiency BrdU: Bromodeoxyuridine SEM: Standard error of the Mean CACNA1g: T-type voltage gated calcium channel isoform 3.1 (Cav3.1) CACNA1h: T-type voltage gated calcium channel isoform 3.2 (Cav 3.2) CACNA1i: T-type voltage gated calcium channel isoform 3.3 (Cav 3.3) PDH: Pyruvate dehydrogenase PDK: Pyruvate dehydrogenase kinase LDH: Lactate dehydrogenase TCA: Tricarboxylic acid cycle
11
ABSTRACT
Amplitude-modulated 27.12 MHz radiofrequency electromagnetic fields
(AM RF EMF) delivered via a spoon-shaped antenna placed on the patient’s
tongue results in shrinkage of the primary and metastatic tumors in patients with
advanced hepatocellular carcinoma (HCC). The mechanism by which AM RF
EMF have direct antiproliferative effect cancer cells is largely unknown.
In order to deduce the unknown mechanism of action we have assessed
the Specific Absorption Rate (SAR) level and distribution inside the human body.
Additionally, we performed various in vitro and in vivo experiments that were
exposed to HCC-specific AM RF EMF using systems replicating human exposure
levels and treatment duration. The resulting data provided new insights into the
mechanism of action of a novel systemic therapy.
Therefore, this dissertation will show that HCC-specific AM RF EMF’s
antiproliferative effects are mediated by Ca2+ influx through Cav3.2 T-type
voltage-gated calcium channel (CACNA1H). This finding establishes a key
functional role for Cav3.2 in control of HCC proliferation, and furthermore
establishes this transmembrane protein complex as a main target for HCC-
specific AM RF EMF.
12
INTRODUCTION
In spite of the recent approval of additional treatment modalities the
outcome of patients with advanced hepatocellular carcinoma remains poor and
new therapeutic approaches are sorely needed. There is growing experimental
and clinical evidence that alternating electric fields and amplitude-modulated
electromagnetic fields are capable of blocking tumor growth in a non-ionizing,
non-thermal manner. However, little is known regarding the kHz to THz range of
electromagnetic field interactions with biological systems, which do not result in
changes in temperature within tumor tissues or in tumor cell membrane
electroporation.
Despite the fact that electromagnetic fields (EMF) in medicine have been
used for therapeutic or diagnostic purposes, the use of non-ionizing EMF for
cancer treatment is a new emerging concept in which this dissertation will
summarize the history of EMF, beginning in the 1890’s, to its development in the
early 20th century and end by providing insight on an innovative form of non-
thermal, non-ionizing radiation cancer treatment that may very well provide the
basis for identifying a potential “bio-antenna like” structure in a cell.
13
CHAPTER I: Use of non-ionizing electromagnetic fields for the treatment of
cancer
Hugo Jimenez1,2, Carl Blackman1,2, Glenn Lesser2,3,4, Waldemar Debinski1,2,4, Michael Chan2,5, Sambad Sharma1, Kounosuke Watabe1,2, Hui-Wen Lo1,2, Alexandra Thomas2,3, Dwayne Godwin6, William Blackstock2,5, Albert Mudry7, James Posey8, Rodney O’Connor9, Ivan Brezovich10, Keith Bonin11, Daniel Kim-Shapiro11, Alexandre Barbault12, Boris Pasche1,2,3,12 The following chapter was published online as a review article in the Frontiers in Bioscience (Landmark Ed.) on January 1st, 2018.
PMID: 28930547
14
Abstract
Cancer treatment and treatment options are quite limited in circumstances
such as when the tumor is inoperable, in brain cancers when the drugs cannot
penetrate the blood-brain-barrier, or when there is no tumor-specific target for
generation of effective therapeutic antibodies. Despite the fact that
electromagnetic fields (EMF) in medicine have been used for therapeutic or
diagnostic purposes, the use of non-ionizing EMF for cancer treatment is a new
emerging concept. Here we summarize the history of EMF from the 1890’s to the
novel and new innovative methods that target and treat cancer by non-ionizing
radiation.
Introduction
In this review, we summarize current technologies that utilize non-ionizing
RF EMF for cancer therapy and the existing research that may potentially
elucidate the mechanisms underlying their anti-cancer effects. These include
tissue heating/ablation, altered mitotic spindle formation and channel specific
calcium signaling. We also discuss the development of these technologies and
field of research by reviewing the history of Radiofrequency Electromagnetic
Fields.
History of radiofrequency electromagnetic fields (RF EMF)
The notion that electromagnetic radiation (see Figure 1 for EMF spectrum)
could have a biological impact by releasing heat in tissues emerged in the 1890’s
as electricity began to be produced in a controlled form. Arsène d’Arsonval was
one of the first to identify increases in temperature and metabolism of the
microbial cell in contact with electricity, and then, with Albert Charrin, he reported
15
the attenuation of diphtheria and pyocyanic toxins by radiation at a frequency of 2
x 103 cycles per second (200 kHz) without a significant increase in temperature
(1–3). In 1924, it was shown that when tumorous plants were subjected to ultra-
short wavelengths, tumors would initially grow rapidly but then completely and
selectively necrose (4). Some years later, it was reported that malignant tumors
in mice could be destroyed by currents of very high frequency (VHF) (5). These
reports also opened a large debate over thermal, which predominate, and non-
thermal effects on living tissue (6–8). This scientific research was primarily
conducted in a medical environment, which was interested in therapeutic
applications.
At about the same time the invention of the split-anode magnetron (1920
General Electric research laboratories, New York; Albert W. Hull) and mainly the
klystron (1938 Stanford University; Varian brothers, W.W. Hausen and D.L.
Webster), which generated higher frequencies and power outputs, led to the
development of new microwave energy generators and expanded their potential
uses (9,10). While this was of interest to physicians at the Mayo Clinic in 1937,
the power was far too low for therapeutic use. Over time the power levels began
to increase and in 1938, the magnetron could produce 100 watts of power, then
in 1939 it was found that the klystron could produce several hundred watts of
power. As power began to reach a level high enough for therapeutic use, the
magnetron and klystron became “mysteriously” unavailable (11). It was not until
much later that it was discovered that the development of the magnetron and
klystron were only designated for military application during World War II, in
16
particular for radar, which did not seem harmful to personnel (12). Specifically,
the development of a multicavity, air-cooled magnetron (1940 University of
Birmingham, England; John Randall and Harry Boot) had been very important in
perfecting radar (13). The same year, this multi-cavity magnetron was brought to
the United States, after which the development of tubes that could produce a
power output as high as one million watts was generated (14). The microwaves
these new tubes could create had optical properties that could be reflected,
refracted and diffracted. The cavity magnetron became largely used in radar
technology by the Allies; the klystron being preferred by the Germans. The
impact of war on research was without a doubt important.
In 1946 a microwave generator (cavity magnetron) became available to
the Mayo Clinic for renewed studies on living animals (11). Much more careful
investigation needed to be conducted with microwave energy to understand its
way of functioning and its possible safe place in medical therapy (16). During the
1950’s a considerable push was under way to examine the biological effects of
microwave radiation and possible harmful effects to the human body because
“they have important uses in defense projects, industrial developments, and
basic physical research” (17). A 1957 report described the death of a man
standing in the direct beam of a radar transmitter. It was reported that the man
experienced a sensation of heat, which quickly became intolerable in less than a
minute. Within 30 minutes he developed acute abdominal pain and vomiting,
which prompted surgical opening of the abdomen and draining of approximately
500 cc of serosanguinous fluid with the excision of the appendix that appeared
17
gangrenous. The post-operative course was at first good but abdominal
distention recurred and inflammation of the intestines with evisceration of the
wound led the patient to his death ten days after the incident (18). It reinforced
considerable interest and research in the biological aspects of exposure to radio
frequency electromagnetic field (RF EMF) (19). U.S. government officials and
business companies, such as Chief of R&D of Ordnance Missile Laboratory,
Sylvania Electric Company and Bell telephone labs, began to issue statements
related to the untoward effects of high powered radar for which safety limits
should be determined (1,19). In March 1959, experiments to determine the
effects of close-range exposure of the brain of a monkey to high intensity radio
waves were conducted by the National Institutes of Health and reported before
the House of Representatives Appropriations subcommittee. In examining the
brains of ten monkeys, which died during the experiments, no pathological cause
of death could be found. In a separate set of 10 monkeys whose exposure was
cut short of death, the monkeys had convulsions resembling Parkinson’s disease
in humans (20). Another main aspect of research was to find out non-thermal
non-ionizing biological effect of living tissue (21).
In 1968, James R. Hamer, reported that in 29 human subjects exposed to
sinusoidal electric fields at field magnitudes of four volts per meter in the
frequency range of 2–12 Hertz, reaction time performance was found to be
approximately 1.6 milliseconds faster during “field on” compared to “field off”
conditions. The experiments revealed that the effects were frequency sensitive
and not merely due to the presence of the field (22). This work was a prime
18
example showing that exposure to a low level, low frequency electric field could
impact a biological system in a non-thermal, non-ionizing manner.
In 1969, Gavalas, Walter, Hamer and Adey reported that exposure to low-
level, low frequency sinusoidal electric fields had an effect on the behavior and
pattern of electrical activity (EEG) of monkey brains. Behaviorally, monkeys
displayed a shorter inter response (time between signal and response behavior,
i.e. push a lever in front of each subject) when exposed to 7 cycles per second
but not to 10 cycles per second electric fields. EEG results showed an increase
in percent power at the frequency of the fields for the hippocampus but less
consistently in the amygdala and center median (the brain structures used for
recording EEG and measuring percent power). Percent power is calculated by
averaging spectral intensity and coherences for each brain structure. The
“Coherence,” parameter is calculated by analyzing the coherence between the
imposed field and the activity in each structure, as well as between the brain
structures themselves. The “Spectral intensity,” is a specialized statistical test for
the effect of the imposed field on recorded activity. The increased percent power,
in some brain structures, was observed during two different conditions, one being
7 cycles per second and the other being 10 cycles per second, a previously
reported frequency exposure used by Hamer and identified to have an effect on
human reaction time (23).
In 1973 Bawin, Gavalas-Medici and Adey studied the effects of exposures
to low intensity, very high frequency (VHF-147 MHz) electromagnetic fields,
amplitude-modulated at biologically relevant frequencies (1–25 Hz) on cats with
19
chronically implanted electrodes. To minimize interference with VHF fields due to
behavioral responses and/or gross body movements, cats underwent pattern
conditioning of specific brain locations. This was accomplished by directly
conditioning specific patterns in specific brain locations which would then allow
consideration of the overt behavior as a correlate of the conditioned response
(24). The authors found that low level VHF, amplitude-modulated at specific
frequencies, produced marked effects on conditioned specific brain rhythms
(enhanced regularity of patterns, sharpening of the spectral peaks around the
central frequency of the response, extremely prolonged resistance to extinction).
This work brought attention to the realm of non-thermal biological response to
EMF by showing changes in brain wave patterns. Up until this time, much of the
work had been accomplished by Russian and Eastern European investigators,
although Gavalas et al., 1970, may have been first to report changes in brain
electrical activity (23,24). Building on their previous work, in 1975, Bawin et al.
identified enhanced calcium efflux from chick brain tissue in a test tube following
exposure to amplitude-modulated (AM) radio frequency (RF) waves. This effect
appeared to occur without involvement of heating and appeared to be mediated
by release of calcium. Specifically, the radiofrequency-dependent calcium efflux
from chick brains was only reported when a carrier wave (147 MHZ) was
sinusoidally amplitude-modulated (see Figure 2 for example of amplitude
modulation) at specific frequencies of 6, 9, 11, 16, and 20 Hz. No altered efflux
compared to control was found without modulation nor at 0.5., 3, 25 or 35 Hz
modulations (25). Another, more limited report by the Bawin group show that 450
20
MHz EMF, amplitude modulated at 16 Hz, enhanced calcium release in a narrow
window of intensities (26). Additionally, when chick brains were co-treated with
cyanide (a compound which prevents electron transport in the cytochrome,
shutting down metabolism) calcium efflux still occurred, which indicates that
amplitude modulation-dependent calcium efflux does not depend on metabolic
processes. These findings provided the experimental basis that suggested a
molecular mechanism explaining Bawin et al.’s (1973) work on the inhibition and
excitation of the cerebral cortex of cats, as well as the work of Hamer, Gavalas,
and Subbota (22,25,27,28).
On the heels of Bawin’s work, the focus began to turn to the molecular
mechanism behind EMF exposure effects on biological systems and the
understanding that EMF demodulation could explain such a mechanism.
In 1980 Blackman et al. independently reproduced the work of Bawin et al.
by showing that calcium efflux from chick brains occur in a windowed,
sinusoidally amplitude-modulated, frequency-specific fashion (32). Moreover,
Blackman built on the research performed by Bawin et al. and showed that
calcium efflux depends on specific amplitude-modulations independently of the
carrier wave (50 MHz). Importantly, Blackman et al. validated specific
“modulation frequency windows” at which calcium efflux occurred. They also
demonstrated that such effects only occurred within certain levels of power
exposure and were amplitude-modulation dependent; an effect first identified by
Bawin et al (1975) (25,33,34).
21
In 1984 Dutta et al. (35) published work focusing on calcium ions and their
relationship to microwave radiation (915 MHz) with or without sinusoidal,
amplitude-modulation (80%) at 16 Hz at various specific absorption rates (SAR).
They found that in human neuroblastoma cells (IMR-32) calcium efflux occurred
in a power and amplitude-modulation frequency-specific fashion. Specifically, a
significant efflux of calcium ions was found to occur at two SAR values 0.05 and
1 mW/g of an amplitude-modulated (16Hz AM) microwave (915 MHz-carrier
wave) compared to unexposed samples further validating the work of Bawin,
Adey, Blackman, and Joines. An additional validation of this phenomenon was
provided in 1990 by Schwartz who reported enhanced calcium ion release from
isolated, beating frog hearts only when they were exposed to 240 MHz EMF,
sinusoidally amplitude modulated at 16 Hz, but not when exposed at 0.5 Hz nor
when the EMF was unmodulated (36).
The research and development of EMF in biological systems has now
spanned over 100 years, from d’Arsonval to World War II to calcium efflux, and
now we are beginning to see the rise of therapeutic non-thermal, non-ionizing
EMF exposure. In this review we highlight some of the most innovative and
promising therapeutic research currently being performed in the field of cancer.
Minimally-invasive RF EMF for therapeutic use in cancer
Nano-radio-frequency ablation (Na-RFA)
Non-ionizing radio frequency (RF) radiation is a common thermal therapy
approach used in clinical oncology (37). In particular, radiofrequency ablation’s
(RFA) approach of hyperthermia (temperatures above 47oC) will expose target
tissue to high temperatures to destroy the tissue directly or render cancer cells
22
more susceptible to other treatment modalities (thermal sensitization; 41–45oC)
(37) (Table 1). While this technique does show success, RFA is a localized and
invasive method that requires a needle to penetrate directly into the tumor. Even
though this technique is very effective and widely used, specifically for the
treatment of hepatic (primary or metastatic), kidney, liver and a number of other
neoplasms, this indication is limited by tumor size and tumor location (38, 39).
Close proximity of the tumor to the biliary tree or blood vessels is considered a
contraindication to its use. Moreover, targeting a localized tissue and selecting an
appropriate or efficient method of heat delivery remains an issue. Multiple
sources of energy for heat delivery include microwaves, radiofrequency, laser
and ultrasound (37). Here we briefly summarize a few novel uses of radio
frequency exposure as a method of localized RFA using nano-particles.
Nano-Radio-Frequency Ablation (NaRFA) is an experimental method of
non-invasive RFA with the potential to improve the efficacy of thermal damage to
tumors while minimizing damage to normal healthy tissues. In order to
accomplish this, tumors are loaded with nanoparticles that enhance the
conversion of external energy source (RF) into heat, creating an inside-out
hyperthermia. This is possible because RF fields are able to penetrate deep into
the body without the need for an invasive procedure (37). One such example of
NaRFA is carbon based nanomaterials. Single-walled carbon nanotubes
(SWNTs) can be modified to increase efficacy by improving specificity through
surface engineering of SWNTs to have ligands, which can target receptors
specific to cancer cells (40,41). In a study performed by Gannon et al. RF
23
exposure of SWNT caused cytotoxicity of cancer cells in vitro and in vivo while
being well tolerated by rabbits bearing tumors. A second example can be found
in Carbon coated metallic nanoparticles (C-Co- NPs). C-Co-NPs are 7-nm cubic
crystalline graphitic carbon decorated ferromagnetic cobalt nanoparticles (40).
These nanoparticles have been shown to effectively enter HeLa cells and when
exposed to RF pulses of 350 kHz the nanoparticles generate localized heat, a
process that is dependent on RF power and nanoparticle concentration. The
treated HeLa cells showed DNA fragmentation, nucleus rupturing and membrane
disintegration (40). An additional example is found in the work of Tamarov et al.
and their use of crystalline silicon (Si) based nanomaterials. An aqueous
suspension of Si nanoparticles is able to generate temperatures above 45–50 oC
when exposed to 27 MHz RF EMF (41). Moreover, Si nanoparticles are
biocompatible and biodegradable in biological tissues, decaying into orthosilicic
acid, Si(OH)4,
which will be voided through the urinary tract. In vivo work
displayed inhibition of tumor growth and led to a decrease in tumor volume (42).
Mechanism of action for nano-radio-frequency ablation (NaRFA)
Heat generation in nanoparticles when exposed to low RF fields remains a
contentious subject (37, 43). The dominant mechanism behind RF heating is
joule heating (heat released due to resistivity of nanoparticle; Power (P) is
dissipated in the form of heat, and given I is electric current and R is resistance,
P = I2R). No optimal RF conditions for effective heating have been reported and
power has been reported to range from 40–800 W (37, 40, and 44). A number of
other factors such as electrical conductivity, size, shape, and concentration of the
24
nanoparticles contribute to heating effects as well (37). While systems such as
NaRFA appear to be promising it should be noted that there is a need for more in
vivo, clinical data as well as technological refinement to reduce unwanted tissue
damage and increased specificity of the nanomaterial to the target (37, 40).
Moreover, there are currently at least two other separate RF technologies in
existence that have no need for nanoparticles and have shown beneficial activity
in cancer patients.
TheraBionic: tumor-specific AM RF EMF
During the 1990’s Pasche et al. demonstrated that intrabuccal
administration of low and safe levels of 27.12 MHz RF EMF, amplitude-
modulated at 42.7 Hz, has a sleep-inducing effect in healthy patients but does
not improve sleep in patients with a diagnosis of insomnia (45,46). However,
when patients with a diagnosis of insomnia were treated with the same carrier
signal amplitude-modulated at four different frequencies (2.7 Hz, 21.9 Hz, 42.7
Hz and 48.9 Hz; i.e. insomnia-specific modulation) they experienced shorter
sleep latency, longer total sleep time, increased sleep efficiency, and increased
numbers of sleep cycles compared to controls (47,48). In early 2000, Pasche and
Barbault hypothesized that tumor-specific modulation frequencies could be used
to treat cancer. In 2009, Barbault et al. published the results of their
investigations to determine if tumors may be sensitive to specific RF EMF
modulated at specific frequencies. Using devices emitting a carrier frequency of
either 433 MHz or 27 MHz the authors exposed 163 patients, who had a
diagnosis of cancer, to RF EMF amplitude-modulated in the range of 0.1Hz to
114 kHz and the results of the study were remarkable (49). The authors reported
25
that patients with cancer, but not healthy patients, had changes in skin electrical
resistance, pulse amplitude and blood pressure (biofeedback responses) when
exposed to a subset of very discrete modulation frequencies. Interestingly,
patients with the same tumor type were found to exhibit biofeedback responses
when exposed to the same discrete modulation frequencies creating a frequency
set specific to tumor type. Moreover, the majority of frequencies found for any
given tumor type were specific to that tumor type only and only 4 frequencies
(1873.5 Hz, 2221.3 Hz, 6350.3 Hz and 10456.4 Hz) were found to overlap in
multiple tumor types specifically, breast cancer, hepatocellular carcinoma,
prostate cancer and pancreatic cancer (49). Post frequency identification, the
authors then proposed to determine if treatment with the recently discovered
tumor-specific frequency sets to corresponding cancer patients would have a
therapeutic effect and hence the authors offered compassionate treatment to
patients with limited therapeutic options. Again, the results were remarkable, of
sixteen patients evaluable for response, one patient with hormone-refractory
breast cancer metastatic to the adrenal gland and bones had a complete
response lasting 11 months. One patient with hormone-refractory breast cancer
metastatic to liver and bones had a partial response lasting 13.5 months, Four
patients had stable disease lasting more than: 7 years (thyroid cancer metastatic
to the lung), 5.1 months (non-small cell lung cancer), 4.1 months (pancreatic
cancer metastatic to liver) and 4.0 months (leiomyosarcoma metastatic to liver)
(15, 49). These results indicate that treatment not only has an impact on the
26
primary tumor but can also treat metastatic tumors implying that this treatment is
systemic.
Building upon their findings from 2009, Costa et al. conducted a single-
group; single-center, open-label, phase I/II study in patients with advanced
hepatocellular carcinoma (HCC). In this study, more than 75% of patients had
radiological evidence of disease progression and half of the patients had poor
liver function with limited treatment options at the time of treatment initiation. All
patients were exposed to electromagnetic fields amplitude modulated at HCC-
specific frequencies. A total of 41 patients with advanced HCC and Child Pugh A
or B disease were accrued and self-administered treatment three times daily for
60 minute (180 min) until disease progression or death and imaging studies were
obtained every eight weeks. The results supported the initial experience with the
same device: four patients had objective tumor response. One patient with prior
progressive disease experienced durable near complete response lasting more
than 5 years, and fourteen patients had stable disease for more than 6 months.
The median progression-free survival (PFS) was 4.4 months (95% CI: 2.1–5.3)
and median overall survival (OS) was 6.7 months (95% CI: 3.0–10.2). Subset
analysis of the patients with similar diagnostic criteria as those applied in phase
III studies such as the SHARP and Asia-Pacific sorafenib studies (Llovet et al.,
2008;Cheng et al., 2009), i.e. biopsy-proven disease and assessment of disease
with CT, shows an objective response rate (RR) by RECIST of 18.2.% (2/11),
and median PFS and OS of 4.9 months (95% CI .6 to 10.8 months) and 10.8
months (95% CI 2.1 to 34.0 months) (50,51). Overall, there were six long-term
27
survivors with an OS greater than 24 months and four long-term survivors greater
than three years. Despite long-term treatment duration and poor liver function in
the majority of patients, treatment was well tolerated and no NCI grade 2, 3, or 4
toxicities were reported (31).
To further evaluate the results found by the work of Barbault et al. (2009)
and Costa et al. (2011), Zimmerman et al. (2012) performed in vitro studies to
begin to elucidate the mechanism of this novel therapy. Using specifically
designed exposure devices to replicate the clinical exposure settings,
Zimmerman et al. investigated whether the proliferation of HCC (HepG2 and
Huh-7), breast cancer (MCF-7) and corresponding non-malignant THLE-2
(represent normal liver cells), MCF-10A (represent normal breast cells) cell lines
would be affected by the tumor-specific modulation RF EMF that were found in
the clinical setting. Using tumor-specific RF EMF vs control exposure, comprised
of randomly chosen modulation frequencies within the same range as cancer-
specific frequencies, authors found that tumor-specific frequencies were able to
inhibit the proliferation of cancer cells when used in a corresponding fashion i.e.
HCC-cell lines exposed to HCC-specific frequencies. Yet, when HCC-specific
frequencies were used on breast cancer cells, or vice versa, no proliferative
inhibition was noted. Furthermore, HCC-specific and breast cancer-specific
frequencies did not inhibit the proliferation of THLE-2 or MCF-10A cells,
respectively. These findings led to the conclusion that exposure to tumor-specific
RF EMF not only had an inhibitory effect on the proliferation of cells but that it did
so in a cancer-specific fashion, apparently not affecting normal healthy cells
28
(15,52). The authors also discovered that mitotic spindle formation was greatly
disrupted in HCC-specific treated HepG2 cell and genes relating to migration
(PLP2) and invasion (XCL2) were found to be significantly downregulated as
shown via RNA-seq and confirmed by qPCR (52). The exact mechanism of
action of this new therapeutic approach is unknown.
Novocure
NovoTTF-100A (brand name Optune®) is a device that delivers low-
magnitude (1–3 V/cm), intermediate frequency (100–300 kHz) tumor treating
electric fields (TTFields) by transducer arrays that are applied directly to the
scalp (53–55). The Novo TTF- 100A system slows tumor growth and inhibits
mitosis. More specifically, TTFields have been shown to disrupt glioblastoma
cells during mitosis, resulting in apoptosis, aneuploidy, asymmetric chromosome
segregation, and defects in centrioles and mitotic spindles. Additionally, TTFields
causes cytoplasmic stress which targets tumor cells for immunological
destruction and clearance TTFields have been demonstrated to inhibit
proliferation in multiple cancer cell lines, e.g., human melanoma, lung, prostate,
pancreas, breast and glioma after 24 hours of continuous exposure while not
having any impact on normal non-dividing cells (53, 54). In addition, mice bearing
tumors (mouse melanoma and rat glioma) also showed growth inhibition and a
decrease in angiogenesis after less than one week of treatment.
Optune® is approved by the U.S. FDA for use as a treatment for adult
patients with histologically-confirmed glioblastoma (55). The activity of TTFields
is intensity and frequency specific and is inversely proportional to tumor cell size.
Hence, the NovoTTF device can be optimized for multiple tumor types such as
29
pancreas adenocarcinoma, ovarian cancer and non-small cell lung cancer (54).
Of importance, the device and treatment is considered to be safe as normally
dividing cells would require a different frequency set to have mitotic interference
making the TTFields specific to dividing cancer cells (54). Due to the effects of
the TTFields being directional (TTF fields function best when applied in the
direction of the separation axis of the dividing cell) two sequential field directions
are applied to patients by wearing two pairs of transducer arrays that generate
fields that switch direction by 90o. Lastly, TTFields do not attenuate over
distance(s) used in treatment and are minimally impacted by biological tissues.
This gives TTFields the capability to cover large body regions that may be
commonly affected by metastases deep within organs, so long as the leads are
placed over the metastatic area. The clinical recommended treatment time is a
minimum of 18 hours continuous treatment per day (54).
In 2014, the Data Safety Monitoring Board recommended that the Phase
III clinical trial of this device in patients with newly diagnosed glioblastoma be
stopped after it was reported that during the interim analysis of 315 patients who
received standard chemoradiation therapy, adding TTFields to maintenance
temozolomide chemotherapy resulted in significant improvements in progression-
free survival (PFS) and overall survival (OS) (56). Specifically, median PFS in the
intent–to–treat population was 7.1 months (95% CI, 5.9–8.2 months) in the
TTFields plus temozolomide group and 4.0 months (95% CI, 3.3–5.2 months) in
the temozolomide alone group; hazard ratio (HR) 0.62; (98.7% CI, 0.43–0.89); P
= 0.001). The median overall survival in the per-protocol population was 20.5
30
months (95% CI, 16.7–25.0 months) in the TTFields plus temozolomide group
(n=196) and 15.6 months (95% CI, 13.3–19.1 months) in the temozolomide alone
group (n=84); HR 0.64 (99.4% CI, 0.42–0.98); P=0.004) (56).
Novocure TTF (tumor treating fields) mechanism of action
The use of intermediate-frequency electric fields (kHz-MHz range)
alternate too fast to cause nerve-muscle stimulation and involve a minimal
amount of heating; until the mid-2000’s fields in this range were generally
accepted as having no biological effect (54, 57). The mechanism of action
involves destabilization of spindle microtubules, consequently leading to mitotic
catastrophe. It is unknown whether this effect occurs by direct interference of the
addition of tubulin subunits to microtubules or by destruction of existing
microtubules structures (57). Hence, cells entering mitosis are those most likely
to respond to treatment and would exclusively impact dividing cells (54, 57).
Additionally, after spindle disruption by TTFields, and the prolonged mitotic arrest
that may occur, subsequent cell death is more likely the outcome than mitotic
arrest and yet it is still not understood what initially triggers the caspase
dependent apoptosis. Data generated by Giladi et al. suggests that the
accumulation of significant aneuploidy, in tandem with mitotic arrest, contributes
to the compromised viability of cancer cells (57).
Novocure and TheraBionic: two novel modalities for cancer treatment
The mechanism(s) of action for RF EMF on biological systems beyond
heating have not been fully established. Hence, we discuss published research
that will have important biological relevance to the likely mechanistic difference
31
that may underlie two distinct therapeutic options offered by Novocure’s TTF-
100A (Optune®) and the Therabionic™ device.
Relevant literature for Novocure/Optune
NovocureTM’s Optune® identified the improper formation of microtubules
as key to the inhibitory action on GBM. In literature relevant to the intracellular
mechanics of centrioles the presence of electromagnetic forces is evident (58).
Microtubules are hollow cylinders composed of 13 longitudinal filaments. The
filaments are strings of alpha/beta tubulin dimers connected end to end with the
alpha/beta tubulin dimers having positive and negative charges at their ends.
During filament movement, by means of their vibration, oscillation of these
charged dimers produces an electromagnetic field (58). Evidence of cellular
electromagnetic field activity occurs during mitosis when centriole pairs are
separated to diametrically opposite sides of the nucleus and extend out
microtubules toward each other to begin the separation the cell in two (58). This
electromagnetically active area certainly appears to continue to be a prime target
for NovocureTM’s treatment and future research.
Relevant Literature for TheraBionic
The work described in the 2009 Barbault et al. paper reports that
discovery of frequencies, used in the treatment of cancer, was based on the
measurement of variations in skin electrical resistance, pulse amplitude and
blood pressure (49). Calcium (Ca2+), Ca2+ signaling and Ca2+ channels are an
important feature of blood pressure regulation and cardiovascular health. Here
we highlight the work performed by Buckner et al. that potentially sheds light on
the work related to calcium ion channels (59, 60). The studies performed by
32
Buckner et al. show that exposure to a specially designed, weak (2–10 μTesla),
frequency-modulated, patterned EMF signal called the Thomas-EMF signal, can
inhibit the growth of malignant cells by promoting Ca2+ uptake through T-type
voltage-gated calcium channels (VGCC) (61). This effect does not appear to be
mediated by L-type voltage-gated calcium channels (61). The Thomas- EMF
pattern is a digital file composed of 849 points programmed to deliver each point
for 3 milliseconds. Exposure to the Thomas-EMF pattern at various time intervals
has been previously associated with an analgesic response, an outcome whose
mechanism was suspected to be due to or include metal binding ions (Ca2+ and
K+) (62). Additionally, the Thomas-EMF pattern was designed to affect
membrane activity associated with epileptic seizures, a disease state known to
be related to alterations in various types of ion channels (Ca2+, K+, Na+, GABA)
(61–63). Buckner et al. exposed cultured cells of mouse and human origin (B16-
BL6, MDA-MB-231, MCF-7, HSG, HBL- 100, HEK293 and HeLa) or mice
(bearing tumors from hind flank injected B16-BL6 cells) to Thomas- EMF signal
(2–10 microT). Proliferative inhibition was found to occur in malignant cells only,
e.g., MDA-MB-231, MCF-7 and HeLa cells and in mice bearing tumors whereas
non-malignant cells, e.g., HBL-100, HEK293 and HSG cells were unaffected. In
attempting to understand the mechanism for proliferative inhibition Buckner et al.
reported that in malignant cells an increase in Ca2+ influx occurred, specifically
through the T-type VGCC while in non-malignant cells no increase in Ca2+ influx
was found. Moreover, blocking Ca2+ influx with T-type VGCC blockers appeared
to block the ability of Thomas- EMF signal to inhibit cell proliferation. Additionally,
33
malignant cells, exposed to Thomas-EMF signal, also showed a slowed entry
into the S-phase of the cell cycle as noted by temporal changes in cyclin
expression but, did not show cell death or DNA fragmentation (61). Hence,
Buckner et al. concluded that specific EMF patterns can affect biological systems
by allowing for increased cytoplasmic Ca2+ which then impacts the cell cycle by
changes in cyclin expression (61, 64, 65). This provides a potential anti-cancer
therapy that acts through the T-type VGCC to allow inappropriate influx of Ca2+
resulting in proliferative inhibition (61).
The research reports published by Buckner et al. appear to have
relevance to Therabionic’s cancer treatment, particularly given the fact that their
initial focus of work was on the treatment of insomnia, a disease state that can be
mediated by Ca2+ and T-type VGCC dysregulation (48, 66, 67). Moreover,
enhanced Ca2+ flux has been shown to be affected by RF exposure in research
that dates as far back as the 1970s and in a modulation specific fashion (68–72).
Hence, hypothetically, amplitude-modulated RF exposure eliciting a calcium
dependent anti-cancer specific response could represent a promising, if not
paradigm changing, direction in the treatment of cancer (30).
Conclusion
In closing, with the number of tumor types currently under investigation
with the NovocureTM technology combined with the tumor types in which
Therabionic™ has already shown some efficacy, treatment, either local or
systemic, of tumors with electromagnetic fields should still be considered in its
infancy. Moreover, as a field of research, we expect that these technologies will
quickly expand over the next ten years to become possibly as common place as
34
chemotherapy with the hope that at the very worst it will allow cancer to become
a chronic condition instead of a life-ending disease.
Acknowledgement
Conflict of Interest: Boris Pasche and Alexandre Barbault hold stocks in
TheraBionic LLC and TheraBionic GmbH.
35
References
1. J J Turner. Ed U.S. Army Ordnance Missile Command. Whippany, New
Jersey (1962)
2. A Arsonval: Influence de I’electricite sur la cellule microbienne. Arch
Physiol Norm Pathol 5, 664–669 (1893)
3. A Arsonval, A Charrin: Action des diverses modalites electriques sur les
toxins bacteriennes. C R Seances Soc Biol Fil 3, 96–99 (1893)
4. A Gosset, A Gutmann, G Lakhovsky, I Magrou: Essai de therapeutique du
cancer experimental des plantes. C R Seances Soc Biol Fil 91, 626–628
(1924)
5. J Schereschewsky: The action of currents of very high frequency upon
tissue cell. Pub Health Rep 43, 927–945 (1928) DOI: 10.2307/4578796
6. W E Curtis, F Dickens, S F Evans: The specific action of ultra-short
wireless waves. Nature 138, 63–65, 591, 110–1101 (1936)
DOI: 10.1038/1381100b0
DOI: 10.1038/138063a0
7. R V Christie: An experimental study of diathermy. VI. Conduction of high
frequency currents through the living cell. J Exp Med 48, 235–246 (1928)
DOI: 10.1084/jem.48.2.235
PMid:19869480 PMCid:PMC2131452
8. W T Szymanowski, R A Hicks: The biological action of ultra-high
frequency currents. J Infect Dis 50, 1–25 (1932)
DOI: 10.1093/infdis/50.1.1
36
9. US patent. USA patent 1.6.28.4.66 (1927)
10. US Patent. USA patent 2.2.50.5.11 (1941)
11. F H Krusen, J F Herrick, K G Wakim: Microkymatotherapy: preliminary
report of experimental studies of the heating effects of microwaves (radar)
in living tissues. Proc Staff Meet Mayo Clin 22, 209–224 (1947)
12. R H J Follis: Studies on the biological effect of high frequency radio waves
(radar) AM J Physiol 147, 281 (1946)
PMid:21000748
13. US patent. USA patent 2.5.42.9.66 (1951)
14. P A Redhead: The invention of the cavity magnetron and its introduction
into Canada and the U.S.A. Phys Can, 321–328 (2001)
15. J W Zimmerman, H Jimenez, M J Pennison, I Brezovich, D Morgan, A
Mudry, F P Costa, A Barbault, B Pasche: Targeted treatment of cancer
with radiofrequency electromagnetic fields amplitude-modulated at tumor-
specific frequencies. Chin J Cancer 32, 573–581 (2013)
DOI: 10.5732/cjc.013.10177
PMid:24206915 PMCid:PMC3845545
16. K G Wakim, J F Herrick, G M Martin, F H Krusen: Therapeutic possibilities
of microwaves. J Am Med Assoc 139, 989–993 (1949)
DOI: 10.1001/jama.1949.02900320019006
PMid:18113906
17. E L Ginzton: Microwaves. Science 127, 841–851 (1958)
DOI: 10.1126/science.127.3303.841
37
PMid:17733817
18. J T McLaughlin: Tissue destruction and death from microwave radiation
(Radar) Calif Med 86, 336–339 (1957)
DOI: 10.1097/00006534-195708000-00021
19. C I Barron, A A Baraff: Medical considerations of exposure to microwaves
(radar) J AM Med Assoc 168, 1194–1199 (1958)
DOI: 10.1001/jama.1958.03000090024006
PMid:13587196
20. P Bailey: High intensity radiation produces convulsions, death in monkey.
Aviation Week May, 29–30 (1959)
21. W Sawicki, K Ostrowski: Non-thermal effect of microwave radiation in vitro
on peritoneal mast cells of the rat. Am J Phys Med 47, 225–234 (1968)
DOI: 10.1097/00002060-196810000-00002
PMid:4175787
22. J R Hamer: Effects of Low Level, Low Frequency Electric Fields on
Human Reaction Time. Commun Behav Biol 2, 217–222 (1968)
23. R J Gavalas, D O Walter, J R Hamer, W R Adey: Effects of low-level, low
frequency electric fields on EEG and behavior in macaca nemestrina.
Brain Res 18, 491–501 (1970)
DOI: 10.1016/0006-8993(70)90132-0
24. S M Bawin, R J Gavalas-Medici, W R Adey: Effects of modulated very
high frequency fields on specific brain rhythms in cats. Brain Res 58,
365–384 (1973)
38
DOI: 10.1016/0006-8993(73)90008-5
25. S M Bawin, L K Kaczmarek, W R Adey: Effects of modulated VHF on the
central nervous system. Ann. N. Y. Acad. Sci. 28, 74–81 (1975)
DOI: 10.1111/j.1749-6632.1975.tb35984.x
26. A R Sheppard, S M Bawin, W R Adey: Models of long-range order in
cerebral macromolecules: Effects of sub-ELF and of modulated VHF and
UHF fields. Radio Sci 6s, 141–145 (1979)
DOI: 10.1029/RS014i06Sp00141
27. R J Gavalas, D O Walter, J Hamer, W R Adey: Effect of low-level, low-
frequency electric fields on EEG and behavior in Macaca nemestrina.
Brain Res. Bull 18, 491–501 (1970)
DOI: 10.1016/0006-8993(70)90132-0
28. A G Subbota: The effect of a pulsed superhigh frequency (SHF)
electromagnetic field on the higher nervous activity of dogs.
Bull Exp Biol Med. 46, 1206–1211 (1957)
DOI: 10.1007/BF00788065
29. teachurselfece. Digital Electronics Basic Electronics, Embedded systems
and VLSI Design (2012)
30. C F Blackman: Treating cancer with amplitude-modulated electromagnetic
fields: a potential paradigm shift, again? Br J Cancer 106, 241–242 (2012)
DOI: 10.1038/bjc.2011.576
PMid:22251967 PMCid:PMC3261673
39
31. F P Costa, A C Oliveira, R Meirelles, M C C Machado, T Zanesco, R
Surjan, M C Chammas, M Souza Rocha, D Morgan, A Cantor, J
Zimmerman, I Brezovich, N Kuster, A Barbault, B Pasche: Treatment
of advanced hepatocellular carcinoma with very low levels of amplitude-
modulated electromagnetic fields. Br J Cancer 105, 640–648 (2011)
DOI: 10.1038/bjc.2011.292
PMid:21829195 PMCid:PMC3188936
32. C F Blackman, S G Benane, J A Elder, D E House, J A Lampe, J M Faulk:
Induction of calcium-ion efflux from brain tissue by radiofrequency
radiation: effect of sample number and modulation frequency on the
power-density window. Bioelectromagnetics 1, 35–43 (1980)
DOI: 10.1002/bem.2250010104
PMid:7284014
33. W T Joines, C F Blackman: Power density, field intensity, and carrier
frequency determinants of RF-energy-induced calcium-ion efflux from
brain tissue. Bioelectromagnetics 1, 271–275 (1980)
DOI: 10.1002/bem.2250010303
PMid:7284025
34. C F Blackman, S G Benane, D E House, W T Joines: Effects of ELF
(1–120Hz) and Modulated (50Hz) RF Fields on the Efflux of Calcium Ion
From Brain Tissue In vitro. Bioelectromagnetics 6, 1–11 (1985)
DOI: 10.1002/bem.2250060102
PMid:3977964
40
35. S K Dutta, A Subramoniam, B Ghosh, R Parshad: Microwave radiation-
induced calcium ion efflux from human neuroblastoma cells in culture.
Bioelectromagnetics 5, 71–78 (1984)
DOI: 10.1002/bem.2250050108
PMid:6712751
36. J L Schwartz, D E House, G A R Mealing: Exposure of Frog Hearts to CW
or Amplitude-Modulated VHF Fields: Selective Efflux of Calcium Ions at
16Hz. Bioelectromagnetics 11, 349–358 (1990)
DOI: 10.1002/bem.2250110409
PMid:2285418
37. J Beik, Z Abed, F S Ghoreishi, S Hosseini-Nami, S Mehrzadi, A Shakeri-
Zadeh, S K Kamrava: Nanotechnology in hyperthermia cancer therapy:
From fundamental principles to advanced applications. J Control Release
235, 205–221 (2016)
DOI: 10.1016/j.jconrel.2016.05.062
PMid:27264551
38. Curley, S. A., Marra, P., Beaty, K., Ellis, L. M., Vauthey, J. N., Abdalla, E.
K., Scaife, C., Raut, C., Wolff, R., Choi, H., Loyer, E. Vallone, P., Fiore, F.,
Scordino, F., De Rosa, V., Orlando, R., Pignata, S., Daniele, B., & Izzo, F.
Early and Late Complications After Radiofrequency Ablation of Malignant
Liver Tumors in 608 Patients. Ann Surg 239, 450–458 (2004)
DOI: 10.1097/01.sla.0000118373.31781.f2
PMid:15024305 PMCid:PMC1356249
41
39. Jindal, G., Friedman, M., Lockin, J. & Wood, B. J. Palliative
Radiofrequency Ablation for Recurrent Prostate Cancer. Cardiovasc
Intervent Radiol 29, 482–485 (2006)
DOI: 10.1007/s00270-004-0200-8
PMid:16010507 PMCid:PMC2386884
40. Rejinold, N. S., Jayakumar, R. & Kim, Y.-C. Radio Frequency responsive
nanobiomaterials for cancer therapy. J Control Release 204, 85–97 (2015)
DOI: 10.1016/j.jconrel.2015.02.036
PMid:25744825
41. Gannon, C. J., Cherukuri, P., Yakobson, B. I., Cognet, L., Kanzius, J. S.,
Kittrell, C., Weisman, R. B., Pasquali, M., Schmidt, H. K., Smalley, R. E., &
Curley, S. A. Carbon Nanotube-enhanced Thermal Destruction of Cancer
Cells in a Noninvasive Radiofrequency Field. Cancer 110 (2007)
DOI: 10.1002/cncr.23155
42. Tamarov, K. P., Osminkina, L. A., Zinovyev, S. V., Maximova, K. A.,
Kargina, J. V., Gongalsky, M. B., Ryabchikov, Y., Alkattan, A., Sviridov, A.
P., Sentis, M., Ivanov, A. V., Nikiforov, V. N., Kabashin, A. V., &
Timoshenko, V. Y. Radio frequency radiation-induced hyperthermia using
Si nanoparticle-based sensitizes for mild cancer therapy. Sci Rep 4 (2014)
43. Collins, C. B., McCoy, R. S., Ackerson, B. J., Collins, G. J. & Ackerson, C.
J. Radiofrequency Heating Pathways for Gold Nanoparticles. nanoscale 6,
8459–8472 (2014)
DOI: 10.1039/C4NR00464G
42
PMid:24962620
PMCid:PMC4624276
44. Moran, C. H., Wainerdi, S. M., Cherukuri, T. K., Kittrell, C. & Wiley, B. J.
Size-Dependent Joule Heating of Gold Nanoparticles Using Capacitively
Coupled Radiofrequency Fields. Nano Res 2, 400–405 (2009)
DOI: 10.1007/s12274-009-9048-1
45. Reite, M., Higgs, L., Lebet, J. P., Barbault, A., Rossel, C., Kuster, N.,
Dafni, U., Amato, D., & Pasche, B. Sleep Inducing Effect of Low Energy
Emission Therapy. Bioelectromagnetics 15, 67–75 (1994)
DOI: 10.1002/bem.2250150110
PMid:8155071
46. Lebet, J. P., Barbault, A., Rossel, C., Tomic, Z., Reite, M., Higgs, L., Dafni,
U., Amato, D., & Pasche, B. Electroencephalographic changes following
low energy emission therapy. Ann Biomed Eng 24, 424–429 (1996)
DOI: 10.1007/BF02660891
PMid:8734063
47. Pasche, B., Erman, M. & Mitler, M. Diagnosis and Management of
Insomnia. N Engl J Med 323, 486–487 (1990)
DOI: 10.1056/NEJM199008163230714
PMid:2374572
48. Pasche, B., Erman, M., Hayduk, R., Mitler, M. M., Reite, M., Higgs, L.,
Kuster, N., Rossel, C., Dafni, U., Amato, D., Barbault, A., & Lebet, J. P.
Effects of Low Energy Emission Therapy in chronic psychophysiological
43
insomnia. Sleep 19, 327–336 (1996)
PMid:8776791
49. Barbault, A., Costa, P. F., Bottger, B., Munden, R. F., Bomholt, F., Kuster,
N., Pasche, B. Amplitude-modulated electromagnetic fields for the
treatment of cancer: discovery of tumor-specific frequencies and
assessment of a novel therapeutic approach. J Exp Clin Cancer Res 28,
51 (2009)
50. Llovet, J. M., Ricci, S., Mazzaferro, V., Hilgard, P., Gane, E., Blanc, J. F.,
Oliveira, A. C., Santoro, A., Raoul, J. L., Forner, A., Schwartz, M., Porta,
C., Zeuzem, S., Bolondi, L., Greten, T. F., Galle, P. R., Seitz, J. F.,
Borbath, I., Haussinger, D., Giannaris, T., Shan, M., Moscovici, M.,
Voliotis, D., & Bruix, J. Sorafenib in Advanced Hepatocellular Carcinoma.
N Engl J Med 359, 378–390 (2008)
DOI: 10.1056/NEJMoa0708857
PMid:18650514
51. Cheng, A. L., Kang, Y. K., Tsao, C. J., Qin, S., Kim, J. S., Luo, R., Feng,
J., Ye, S., Yang, T. S., Xu, J., Sun, Y., Liang, H., Liu, J., Wang, J., Tak, W.
Y., Pan, H., Burock, K., Zou, J., Voliotis, D., & Guan, Z. Efficacy and
safety of sorafenib in patients in the Asia-Pacific region with advanced
hepatocellular carcinoma: a phase III randomized, doubleblind, placebo-
controlled trial. Lancet Oncol 10, 25–34 (2009)
DOI: 10.1016/S1470-2045(08)70285-7
44
52. Zimmerman, J. W., Pennison, M. J., Brezovich, I., Yi, N., Yang, C. T.,
Ramaker, R., Absher, D., Myers, R. M., Kuster, N., Costa, F. P., Barbault,
A., & Pasche, B. Cancer cell proliferation is inhibited by specific
modulation frequencies. Br J Cancer 106, 307–313 (2012)
DOI: 10.1038/bjc.2011.523
PMid:22134506
PMCid:PMC3261663
53. Wong, E. T., Lok, E., Swanson, K. D., Gautam, S., Engelhard, H. H.,
Lieberman, F., Taillibert, S., Ram, Z., & Villano, J. L. Response
assessment of NovoTTF-100A versus best physician’s choice
chemotherapy in recurrent glioblastoma. Cancer Med 3, 592–602 (2014)
DOI: 10.1002/cam4.210
PMid:24574359 PMCid:PMC4101750
54. Davies, A. M., Weinberg, U. & Palti, Y. Tumor treating fields: a new
frontier in cancer therapy. Ann N Y Acad Sci 1291, 86–95 (2013)
DOI: 10.1111/nyas.12112
PMid:23659608
55. Novocure. (St. Helier, Jersey, 2014)
56. Stupp, R., Taillibert, S., Kanner, A. A., Kesari, S., Steinberg, D. M., Toms,
S. A., Taylor, L. P., Lieberman, F., Silvani, A., Fink, K. L.,
Barnett, G. H., Zhu, J. J., Henson, J. W., Engelhard, H. H., Chen, T. C.,
Tran, D. D., Sroubek, J., Tran, N. D., Sroubek, J., Tran, N. D., Hottinger,
A. F., Landolfi, J., Desai, R., Caroli, M., Kew, Y., Honnorat, J., Idbaih, A.,
45
Kirson, E. D., Weinberg, U., Palti, Y., Hegi, M. E., & Ram, Z. Maintenance
Therapy with Tumor-Treating Fields Plus Temozolomide vs
Temozolomide Alone for Glioblastoma JAMA 314, 2535–2543 (2015)
57. Giladi, M., Schneiderman, R. S., Voloshin, T., Porat, Y., Munster, M., Blat,
R., Sherbo, S., Bomzon, Z., Urman, N., Itzhaki, A., Cahal, S., Shteingauz,
A., Chaudhry, A., Kirson, E. D., Weinberg, U., & Palti, Y. Mitotic Spindle
Disruption by Alternating Electric Fields Leads to Improper Chromosome
Segregation and Mitotic Catastrophe in Cancer Cells. Sci Rep 5, 16
(2015)
DOI: 10.1038/srep18046
PMid: 26658786
PMCid: PMC4676010
58. Huston, R. L. A review of Electromagnetic Activity in Cellular Mechanics.
Adv Biosci Biotechnol 7, 360–371 (2016)
DOI: 10.4236/abb.2016.79035
59. Kawanabe, Y. & Nauli, S. M. Involvement of extracellular Ca2+ influx
through voltage independent Ca2+ channels in endothelin-1 function. Cell
Signal 17, 911–916 (2005)
DOI: 10.1016/j.cellsig.2005.01.001
PMid: 15894164
60. Mamo, Y. A., Angus, J. A., Ziogas, J., Soeding, P. F. & Wright, C. E. The
role of voltage-operated and non-voltage-operated calcium channels in
46
endothelin-induced vasoconstriction of rat cerebral arteries. Eur J
Pharmacol 742, 65–73 (2014)
DOI: 10.1016/j.ejphar.2014.09.002
PMid:25218985
61. Buckner, C. A., Buckner, A. L., Koren, S. A., Persinger, M. A. & Lafrenie,
R. M. Inhibition of Cancer Cell Growth by Exposure to a Specific Time-
Varying Electromagnetic Field Involves T-Type Calcium Channels. PLoS
ONE 10 (2015)
DOI: 10.1371/journal.pone.0124136
62. Thomas, A. W., Kavaliers, M., Prato, F. S. & Ossenkopp, K. P. Pulsed
Magnetic Fields Induced “Analgesia” in the Land Snail, Cepaea nemoralis,
and the Effects of μ,d, and k Opioid Receptor Agonist/Antagonist.
Peptides 18, 703–709 (1997)
DOI: 10.1016/S0196-9781(97)00004-1
63. Zamponi, G. W., Lory, P. & Perez-Reyes, E. Role of voltage-gated calcium
channels in epilepsy. Pflugers Arch 460, 395–403 (2010)
DOI: 10.1007/s00424-009-0772-x
PMid: 20091047
PMCid: PMC3312315
64. See, V., Rajala, N. K. M., G., S. D. & White, M. R. H. Calcium-dependent
regulation of cell cycle via a novel MAPK-NF-kappB pathway in swiss 3T3
cells. J Cell Biol 166 (2004) 65. Resende, R. R., Adhikari, A., Costa, J.L.,
47
Lorencon, E., Ladeira, M.S., Guatimosim, S., Kihara, A.H., Ladeira, L.O.
influence of spontaneous calcium events on cell-cycle progression in
embryonal carcinoma and adult stem cells. Biochim Biophys Acta 1803,
246–260 (2010)
DOI: 10.1016/j.bbamcr.2009.11.008
PMid: 19958796
66. Amato, D. & Pasche, B. An evaluation of the safety of low energy
emission therapy (published erratum appears in Compr Ther
1994;20(12):681) Compr.Ther. 19, 242–247 (1993)
PMid: 8275672
67. Lee, J., Kim, D. & Shin, H.-S. Lack of delta waves and sleep disturbances
during nonrapid eye movement sleep in mice lacking a1g-subunit of T-
type calcium channels. PNAS 101, 18195–18199 (2004)
DOI: 10.1073/pnas.0408089101
PMid: 15601764
PMCid: PMC539778
68. Bawin, S. M. & Adey, W. R. Sensitivity of Calcium Binding in Cerebral
Tissue to Weak Environmental Oscillating Low Frequency Electric Fields.
Proc Natl Acad Sci USA 73, 1999–2003 (1976)
DOI: 10.1073/pnas.73.6.1999
PMid: 1064869 PMCid:PMC430435
48
69. Adey, W. R., Bawin, S. M. & Lawrence, A. F. Effects of weak
amplitude-modulated microwave fields on calcium efflux from awake cat
cerebral cortex. Bioelectromagnetics 3, 295–307 (1982)
DOI: 10.1002/bem.2250030302
PMid: 6812594
70. Blackman, C. F., Elder, J. A., Weil, C. M., Benane, S. G., Eichinger, D. C.,
& House, D. E. Induction of calcium-ion efflux from brain tissue by
radiofrequency radiation. Bioelectromagnetics 1, 277–283 (1979)
DOI: 10.1002/bem.2250010304
71. Blackman, C. F., Benane, S., Kinney, L. S., Joines, W. T. & House, D. E.
Effects of ELF Fields on Calcium-ion Efflux from Brain Tissue in vitro.
Radiat Res 92, 510–520 (1982)
DOI: 10.2307/3575923
PMid: 7178417
72. Blackman, C. F., Benane, S. G., House, D. E. & Joines, W. T. Effect of
ELF (1–120 Hz) and modulated (50Hz) RF fields on the efflux of calcium
ions from brain tissue in vitro. Bioelectromagnetics 6, 1–11 (1985)
DOI: 10.1002/bem.2250060102
DOI: 10.1002/bem.2250060402
PMid: 3977964
73. Kirson, E. D., Gurvich, Z., Schneiderman, R., Dekel, E., Itzhaki, A.,
Wasserman, Y., Schatzberger, R., & Palti, Y. Disruption of Cancer Cell
Replication by Alternating Electric Fields. Cancer Res 64, 3288–3295
49
(2004)
DOI: 10.1158/0008-5472.CAN-04-0083
PMid: 15126372
74. Kirson, E. D., Giladi, M., Gurvich, Z., Itzhaki, A., Mordechovich, D.,
Schneiderman, R. S., Wasserman, Y., Ryffel, B., Goldesher, D., &
Palti, Y. Alternating electric fields (TTFields) inhibit metastatic spread of
solid tumors to the lungs. Clin Exp Metastasis 26, 633–640 (2009)
DOI: 10.1007/s10585-009-9262-y
PMid: 19387848 PMCid:PMC2776150
50
Figures, tables and legends
Figure 1. The EMF spectrum. As frequency and energy increase the wavelength decreases. Multiple medically related items and common environmental events are displayed in their respective range in the electromagnetic spectrum (15).
51
Figure 2. A & B. Radio frequency carrier signal as a function of time (horizontal axis). A. The physical appearance of an unaltered carrier signal (i.e. a radiofrequency wave) and amplitude-modulated carrier signal. B. An amplitude-modulated carrier signal showing modulation depth and frequency post modulation (29–31).
52
Table 1. Summary of RF treatment modalities used in oncology.
Table 1. Summary of RF treatment modalities used in oncology
Modality Indications/Mode of delivery
Mechanism of Action
RFA37-39 Predominantly used for the treatment of liver metastases. Treatment is administered during surgical procedure.
Tumor necrosis via thermal ablation
Novocure55,73,74 Treatment of glioblastoma following tumor resection and radiation therapy. Treatment is administered for 18 hr daily by means of electrodes glued to the skin.
Mitotic spindle disruption in proliferating cancer cells Exact molecular mechanism is unknown
Therabionic31,49,52 Treatment of advanced HCC with effect on the primary tumor and its metastases Treatment is administered 3 hr daily by means of a spoon-shaped antenna placed in the patient’s mouth that delivers EMF to the entire body
Direct anti-proliferative effect of cancer cells Mitotic spindle disruption Exact molecular mechanism is unknown
53
CHAPTER II: Cav3.2 T-type VGCCs mediate targeted blockade and
myofibroblast differentiation of hepatocellular carcinoma by tumour-
specific AM RF EMF
Jimenez, H.1, Wang, M.1, Zimmerman, J.W.2,3, Pennison, M.J.1, Sharma, S.1, Xu, Z.3, Brezovich, I.4, Absher, D.5, Myers, R.M.5, DeYoung, B.6, Caudell, D.6, Chen, D.7, Lo, H.W.1, Lin, H.K.1, Godwin, D.W.8, Olivier, M.9, Ghanekar, A.10, Chen, K.,11 Miller, L.D.1, Gong, Y.12, Capstick, M.12, Kuster, N.12, D’Agostino Jr, R.B.13, Munden, R.14, Merle, P.15, Barbault, A.16, Blackstock, A.W.17, Bonkovsky, H.L.18, Jin, G.1, Liu, L.1, Zhang, W.1, Watabe, K.1, Blackman, C.1, Pasche, B1.
1Department of Cancer Biology, Wake Forest Baptist Medical Center, Winston-Salem, NC 2Department of Medicine, The Johns Hopkins School of Medicine, Baltimore, MD 3Division of Hematology/Oncology, The University of Alabama at Birmingham, Birmingham, AL 4Department of Radiation Oncology, The University of Alabama at Birmingham, Birmingham, AL 5HudsonAlpha Institute for Biotechnology, Huntsville, AL 6Department of Pathology, Wake Forest Baptist Medical Center, Winston-Salem, NC 7Division of Preventive Medicine, The University of Alabama at Birmingham, Birmingham, AL 8Department of Neurobiology and Anatomy, Wake Forest Baptist Medical Center, Winston-Salem, NC 9Section of Molecular Medicine, Department of Medicine, Wake Forest Baptist Medical Center, Winston-Salem, NC 10Department of Surgery, University Health Network, Toronto, Ontario, Canada 11Toronto General Hospital Research Institute, Toronto, Ontario, Canada 12IT’IS Foundation, Swiss Federal Institute of Technology, Zurich, Switzerland 13Department of Biostatistical Sciences, Wake Forest Baptist Medical Center, Winston-Salem, NC 14Department of Radiology, Wake Forest Baptist Medical Center, Winston-Salem, NC 15Croix-Rousse University Hospital, Hepato-Gastroenterology and Digestive Oncology, Lyon, France 16TheraBionic GmbH, Ettlingen, Germany 17Department of Radiation Oncology, Wake Forest Baptist Medical Center, Winston-Salem, NC 18Section on Gastroenterology, Department of Medicine, Wake Forest Baptist Medical Center, Winston-Salem, NC Correspondence to: Carl Blackman, Ph.D. [email protected] or Boris Pasche, M.D., Ph.D. [email protected]
The following chapter is a manuscript submitted for publication.
54
Abstract
Delivery of amplitude-modulated 27.12 MHz radiofrequency
electromagnetic fields (AM RF EMF) by means of a spoon-shaped applicator
placed on the patient’s tongue yields either tumour shrinkage or disease
stabilization in 49% of patients with advanced hepatocellular carcinoma (HCC),
but the mechanism of action is unknown. We found that intrabuccal
administration results in systemic delivery of low and safe levels of AM RF EMF
in humans. We exposed immunocompromised mice carrying human HCC
xenografts to corresponding AM RF EMF levels. Here we show that HCC-specific
AM RF EMF-mediated tumour shrinkage occurs through differentiation of HCC
cells into quiescent myofibroblasts. We also show that AM RF EMF
antiproliferative effects and down-regulation of cancer stem cells in both hepatitis
B virus positive and negative HCC cells are mediated by Ca2+ influx through
Cav3.2 T-type voltage-gated calcium channel (CACNA1H). This finding
establishes a key functional role for Cav3.2 in control of HCC proliferation, and
furthermore establishes this transmembrane protein complex as the main cellular
target for HCC-specific AM RF EMF.
Introduction
Hepatocellular carcinoma (HCC) death rates in the U.S. are increasing
faster than for any other malignancy, having more than doubled in the past
decade.1,2 Worldwide, HCC is the fourth most common cause of cancer death
and the second most common cause of absolute years of life lost due to cancer.4
Despite the recent approval of additional treatment modalities, the outcome of
patients with advanced HCC remains poor and new therapeutic approaches are
55
sorely needed.5 There is growing experimental and clinical evidence that
alternating electric fields and amplitude-modulated electromagnetic fields are
capable of blocking tumour growth.6 However, little is known regarding the kHz to
THz electromagnetic interactions with biological systems, which do not result in
changes in temperature within tumour tissues or in tumour cell membrane
electroporation.
We previously hypothesized7 and subsequently provided experimental
evidence that delivery of 27.12 MHz radiofrequency electromagnetic fields, which
are amplitude-modulated at tumour-specific frequencies, has anticancer activity
both in vitro3 and in a significant percentage of patients with advanced HCC.8
Using HCC and breast cancer cell lines as well as immortalized hepatocytes and
breast epithelial cells, we demonstrated that amplitude-modulated (AM)
radiofrequency (RF) electromagnetic fields (EMF) control the growth of cancer
cells at tumour-specific modulation frequencies but do not affect the growth of
noncancerous cells.3 While both alternating electric fields9 and amplitude-
modulated electromagnetic fields3 have been shown to disrupt the mitotic spindle
of tumour cells, the mechanism by which amplitude-modulated radiofrequency
electromagnetic fields result in tumour shrinkage and long-term therapeutic
responses in patients with cancer is unknown.6 Furthermore, the human
dosimetry of intrabuccal administration has not been characterized.
Here we show that systemic administration of amplitude-modulated
radiofrequency electromagnetic fields by means of a spoon-shaped antenna
placed on the patient’s tongue results in whole body averaged specific absorption
56
rate (SAR) of 1.35 mW/kg with peak spatial SAR ranging from 146 to 352 mW/kg
averaged over 1g of tissue. Using a mouse exposure system replicating human
exposure conditions,10 we show that AM RF EMF-mediated shrinkage of
hepatocellular carcinoma results from differentiation of cancer cells into
quiescent myofibroblasts. We identify Ca2+ influx, mediated by Cav3.2 T-type
voltage calcium channels (CACNA1H) as necessary mediators of AM RF EMF
antiproliferative effects on HCC cells and down-regulation of cancer stem cells,
which is likely to account for the long-term responses observed in patients with
advanced HCC.
Results
Whole-body and organ-specific dosimetry
Intrabuccal administration of AM RF EMF has yielded objective tumour
shrinkage in the femur7, adrenal gland7, liver8, and lungs8 of several patients
suffering from unresectable or metastatic cancer. This strongly suggests that
intrabuccally-administered 27.12 MHz AM RF EMF have systemic anticancer
effects distant from the point of administration, i.e., the buccal mucosa. However,
the levels of AM RF EMF exposure in humans have not yet been characterized.
Therefore, we tested the hypothesis that intrabuccal administration of AM RF
EMFs are absorbed throughout the body because contact between the spoon-
shaped “antenna” applicator and the anterior part of the patient’s tongue could
result in the patient’s body acting as an extension of the antenna.11
The RF output of the previously described device is adjusted to 100 mW
into a 50 Ω load using a sinusoidal test signal.7,8 We assessed the SAR level and
distribution inside the human body and quantified the variability depending on
57
device positioning and patient posture (Fig. 1a). Homogeneous and
inhomogeneous model simulations show similar SAR distribution patterns (Fig.
1b,c). The whole-body (wbSAR) and the peak spatial SAR (psSAR) over any 10
g (psSAR10g) and 1 g (psSAR1g) of major organs according to IEEE standard12
are listed in Table 1a. As shown in Fig. 1b and 1c, intrabuccal delivery of 27.12
MHz AM RF EMF results in whole-body absorption from head to toe and the
highest peak spatial SAR (psSAR) is at the interface between the tongue and the
spoon-shaped applicator. As shown in Table 1b, there is more radiated power
when the device is far away from the body. Conversely, the wbSAR is slightly
higher when the device touches the body, regardless of position (Table 1c).
Experimental validation measurements based on a tank phantom show that the
SAR distribution inside the tank is similar to that of the homogeneous human
model (Fig. 1c, Suppl. Fig. 1a,1b). The wbSAR is 1.35 mW/kg with psSAR over
1 g from 146 to 352 mW/kg when the applicator spoon is perfectly matched,
which is significantly below the International Commission on Non-Ionizing
Radiation Protection (ICNIRP) standard safety limits of 80 mW/kg wbSAR, or
psSAR of 2,000 mW/kg (Table 2).13
Uncertainty and variation assessments were conducted with the patient
sitting with device placed away from the body (Fig. 1a). The posture variation
based on sitting positions as shown in Fig. 1a introduces 0.06 dB deviation. A
±10 kg variation in body weight introduces 0.39 dB deviation, the biggest
contribution, 2.19 dB comes from the variation of the applicator spoon impedance
with posture and device position and its effect on the power delivered to the
58
patient. Therefore, the total variation of 2.21 dB, as shown in Table 1d, mainly
depends on the delivered power. The SAR distributions along the center line
inside the tank phantom are compared to the simulations of the same
configurations (Suppl. Fig. 1a) to determine the effective power delivered by the
spoon-shaped applicator as a function of the positioning of the device. The
effective power per device location is shown in Suppl. Table 1a. Based on the
delivered power, and the power delivered when matched, the effective return loss
can be calculated and is also shown in Suppl. Table 1a. In the real use scenario,
the delivered power is between 11 and 51% of the perfectly matched case.
Reflection coefficient measurements of the applicator spoon were performed with
a portable vector network analyzer, Suppl. Fig. 1c, Suppl. Table 1b; when
compared to those calculated based on normalized fields, more than one effect
must be present, namely, impedance dependent output power variation as well
as mismatch. Consideration not only of the induced field levels, but also the field
distributions inside the rectangular phantom, shows that the measurements and
simulations are generally in agreement, as shown in Suppl. Fig. 1a for
configurations 1 and 3 in Fig. 1d, which are equivalent to the sitting position with
the device on the thigh and a short distance away from the body, respectively.
The differences are larger in locations with low field strength, e.g., at the far end
of the phantom from the applicator spoon, as the induced field strengths are
close to or below the measurement system noise floor. This is especially evident
in cases where the mismatch is largest and delivered power is low. E-field
measurements normalized to the same delivered power, for lines in the middle
59
and along the bottom of the phantom for the different positions of the device, are
shown in Suppl. Fig. 1b. Away from the immediate vicinity of the applicator
spoon, there is not much difference between the two distributions along the tank,
as might be expected; locations close to the surface are more sensitive to the
device location.
Analysis of in vivo effects of amplitude-modulated radiofrequency
electromagnetic fields
With a well-defined characterization of human exposure dosimetry, we set
out to replicate the human exposure conditions in an in vivo setting, therefore, we
used a custom-designed small animal AM RF EMF exposure system and
exposed tumour-bearing mice with tumours developing in subcutaneous tissue
predominantly surrounded by fat.10 The exposure system RF output was set for
delivery of a SAR level of 67 mW/kg. This SAR was selected so that it is 1) within
the range of previously demonstrated in vitro activity (30 - 400 mW/kg) 3 and 2)
within the range of wbSAR1g and psSAR1g in humans (1 - 352 mW/kg) (Table
2). We used Huh7 and patient-derived tumour cells as subcutaneous cellular
xenograft models of HCC.14-16 Thirty-seven of 40 mice injected with Huh7 cells
developed palpable tumours and were exposed to HCC-specific AM RF EMF
(HCC), randomly chosen AM RF EMF (RCF), or were not exposed to EMF
(SHAM) as controls. Both control subsets (randomly chosen AM RF EMF and no
exposure) were compared to the group exposed to HCC-specific frequencies (N
= 20). The treatment by time interaction was highly significant (p<0.001) showing
that tumour growth curves were different among the three groups. Comparison
between the two control subsets showed no statistical difference over the course
60
of 6 weeks; P = 0.655. The two groups were therefore combined as control
group. Comparison between the pooled control group (N = 17) and the HCC-
specific AM RF EMF (N = 20) group shows beginning separation between groups
at week 4 (p = 0.08), and significant separation at week 5 (p = 0.045), and week
6 (p = 0.019) (Figure 2a).
To characterize, in vivo, the temporal relationship between exposure to
HCC-specific modulation frequencies and HCC growth, we studied five mice,
which had been exposed to randomly chosen AM RF EMF three hours daily for
ten weeks. As shown in Fig. 2b, the growth of Huh7 xenografts stopped within
one week of exposure to HCC-specific AM RF EMF exposure (week 11) and the
tumours shrank by 62% within 3 weeks of exposure. To assess the carry-over
effect of HCC-specific AM RF EMF, we stopped exposure at the end of week 13.
As shown in Fig. 2b, the average volume of Huh7 xenografts increased by 109%
within two weeks. To determine whether repeat exposure to HCC-specific AM RF
EMF could again block tumour growth, mice were re-exposed to HCC-specific
AM RF EMF at week 15. As shown in Fig. 2b tumour growth was, again,
effectively blocked within one week of re-exposure. Lastly, to assess, in vivo, the
effect of HCC-specific AM RF EMF on HCC tissue sampled at the time of
surgery, patient-derived xenograft model (PDX), we exposed 6 PDX mice to
HCC-specific AM RF EMF, with 4 PDX mice observed as controls. As shown in
Fig. 2c, tumour growth was significantly inhibited by HCC-specific AM RF EMF,
test for treatment by time interaction (p = 0.0006).
61
In summary, we observed significant tumour shrinkage ranging from near
complete and partial response to tumour stabilization in two different mouse
models of HCC, which establishes that HCC-specific AM RF EMF exert
sustained control over the growth of HCC tumours in vivo at SAR levels
corresponding to the levels delivered in patients with advanced HCC.
Tumour shrinkage is caused by HCC cell differentiation into quiescent
myofibroblasts
Having observed accumulation of fibroblast-like cells at the site of HCC
xenografts, which had shrunken following exposure to HCC-specific AM RF EMF
(Fig. 2d), we sought to identify the origin of these cells using green-fluorescent
protein (GFP) tagged Huh7 cells.
As shown in Fig. 2e, there was strong GFP staining indicated by the red
staining in the cluster of cells long arrow of the fibroblast-like cells surrounding
and intermeshed with residual Huh7 cells demonstrating the HCC origin of the
fibroblast-like cells. To investigate the nature of this epithelial to mesenchymal
transition (EMT), we performed immunohistochemistry analysis of several EMT
markers. As shown in Fig. 2f, EMT marker analysis identified two separate
subpopulations of fibroblast-like cells in shrunken tumours, a peripheral region
surrounding a distinct central region. The peripheral cells are positive for E-
cadherin, fibronectin, smooth muscle actin (SMA), SNAIL and TWIST while the
centrally located cells are more intensely positive for fibronectin and SMA but did
not stain for E-cadherin, N-cadherin and SNAIL and had decreased staining for
TWIST, indicative of a myofibroblast-like profile (Fig. 2g). These findings suggest
62
that tumour shrinkage during exposure to HCC-specific AM RF EMF results in
the differentiation of HCC cells into a quiescent myofibroblastic phenotype.
To test the hypothesis that HCC-specific AM RF EMF only targets the
proliferation of HCC cells in vivo, we assessed tumour Ki67 as well as intestinal
crypt BrdU staining in mice in which HCC-specific AM RF EMF had yielded at
least 55% tumour shrinkage as well as in control mice. As shown in Fig. 2h, Ki67
and cyclin D1 staining was decreased and p21 increased in the tumours of mice
exposed to HCC-specific AM RF EMF compared to control mice. However, there
was no difference in either intestinal crypt BrdU staining among AM RF EMF-
exposed and control mice (Fig. 2h). Similarly, there were no differences in white
blood cells, red blood cells and platelets between AM RF EMF-exposed and
control mice at the time of sacrifice (Suppl. Table 2a).
Calcium influx and Cav3.2 T-type Voltage Gated Calcium Channels mediate
AM RF EMF antiproliferative effects
To agnostically assess the impact of HCC-specific AM RF EMF on HCC,
we performed a combined review of the previously published RNA-Seq data3 and
new microRNA array assays. Ingenuity pathway analysis identified the IP3/DAG
signaling pathway through differential expression of several genes and
microRNAs (Suppl. Fig 3a). Differential expression of several key genes and
microRNAs modulating this pathway was confirmed in Huh7 cells (Suppl. Fig.
3b). Ca2+ modulates several steps of this pathway,17 and we and others18 have
shown that Ca2+ flux from brain tissue is enhanced upon exposure to RF EMF
when modulated at specific frequencies, irrespective of the carrier frequency
63
used (50, 147, and 450 MHz).19 We therefore postulated that Ca2+ is involved in
HCC-specific AM RF EMF antiproliferative effects on HCC cells.
We first assessed changes in intracellular Ca2+ in HCC cells upon
exposure to HCC-specific AM RF EMF. As shown in Suppl. Fig. 3c, there was
an increase in intracellular Ca2+ following exposure to HCC- specific AM RF
EMF. To further characterize the role of Ca2+ in HCC-specific AM RF EMF, we
added BAPTA, a chelator of extracellular Ca2+, during each HCC-specific AM RF
EMF exposure. As shown in Fig. 3a, chelation of extracellular Ca2+ abrogated
HCC-specific AM RF EMF antiproliferative effects and did not affect the
proliferation of Huh7 cells exposed to randomly chosen AM RF EMF.
Having demonstrated that extracellular Ca2+ influx was necessary for
HCC-specific AM RF EMF inhibition of HCC cell proliferation, we sought to
identify how Ca2+ enters the cells. Ca2+ entry is mainly controlled by voltage-
gated Ca2+ channels (VGCC),20 which are overexpressed in several forms of
cancer and are implicated in limitless replicative potential, invasion, and
metastasis.21,22 We used inhibitors of L-type and T-type VGCCs to determine
whether these VGCCs are involved in HCC-specific AM RF EMF inhibition of cell
proliferation. Neither nifedipine nor amlodipine, both of which block L-type
VGCCs, had any impact on HCC-specific AM RF EMF’s inhibition cell
proliferation (data not shown). In contrast, ethosuximide, which blocks all three
isoforms (Cav 3.1, 3.2, 3.3) of T-type VGCCs,23 abrogated HCC-specific AM RF
EMF’s inhibition of Huh7 cell proliferation (Fig. 3b). Having identified T-type
VGCCs as the necessary mediators of HCC-specific AM RF EMF’s inhibition of
64
HCC cells, we sought to determine which of the three T-type VGCCs isoforms
accounted for this effect. While knockdown of the Cav3.1 and Cav3.3 isoforms did
not affect HCC-specific AM RF EMF-mediated inhibition of HCC cell proliferation,
knockdown of the Cav3.2 isoform did abrogate HCC-specific AM RF EMF’s
antiproliferative effects in Huh7 and Hep3B cell lines (Fig. 3c).
HCC-specific AM RF EMF block HCC cancer stem cells
It has been shown that sorafenib, a tyrosine kinase inhibitor, significantly
improves the survival of patients with advanced HCC.24,25 However, patients
invariably develop resistance to sorafenib and demonstrate objective evidence of
disease progression at 16 months,24-26 and there is growing evidence that HCC
cancer stem cells (CSCs) are responsible for tumour recurrence and resistance
to sorafenib.27-29 We have previously reported several long-term responses in
patients with advanced HCC receiving intrabuccally administered AM RF EMF.
Specifically, 6 (14.6%) of the 41 patients had an overall survival in excess of 26
months, and one patient was treated continuously for 5 years and 2 months
without any evidence of disease progression prior to expiring of causes unrelated
to her malignancy.8,11 One additional off-study patient with rapidly progressive
disease received continuous treatment with HCC-specific AM RF EMF for 6
years and 2 months prior to expiring with minimal progression of disease (Suppl.
Fig. 4). These unexpectedly long-lasting responses led us to test the hypothesis
that HCC-specific AM RF EMF target cancer stem cells (CSCs) as therapies
affecting CSCs are associated with long-term survival.30
We first assessed the anti-proliferative effects of HCC-specific AM RF
EMF on hepatitis B virus (HBV) positive cell lines as 53% of hepatocellular
65
carcinoma cases worldwide are attributable to HBV infection.31 As shown in Fig.
3d, the proliferation of HBV positive HCC cell lines from patients of Asian
(HCCLM3 and MHCC97L) and African-American (Hep3B) ancestry was
effectively blocked by HCC-specific AM RF EMF. Next, we assessed the impact
of HCC-specific AM RF EMF on HBV negative (Huh7) and HBV positive (Hep3B)
CSCs. As shown on Fig. 3e, exposure to HCC-specific AM RF EMF led to 57%
and 38% decreases in Huh7 and Hep3B CSCs (CD44+CD133+) cells,
respectively. Sphere formation was similarly decreased by 26% and 28% in Huh7
and Hep3B cells, respectively. However, in the presence of ethosuximide, there
were no significant decreases in CSCs or sphere formation in either Huh7 or
Hep3B cells demonstrating that inhibition of CSCs is also mediated by T-type
VGCCs (Suppl. Fig. 2). The experiments were repeated with cells in which
Cav3.2 VGCC had been knocked down. As shown in Fig. 3f, knockdown of
Cav3.2 VGCCs abrogated HCCMF downregulation of CSCs in Huh7 as well as
Hep3B cells.
Discussion
Dosimetry analysis shows that 27.12 MHz AM RF EMF administered by
means of a spoon-shaped applicator results in systemic EMF absorption. The
results also demonstrate that the human body acts as an antenna resulting in
head to toe delivery of AM RF EMF thereby enabling treatment of the primary
tumour and its metastases. These findings provide a biophysical rationale for the
antitumour effects documented in patients with metastases in the femur, liver,
adrenal glands, and lungs.7,8 Tumour-specific AM RF EMF appear to have a
broad therapeutic window as tumour shrinkage was observed in humans,7,8 in
66
human xenografts as presented in this report, and in vitro3 at SARs ranging from
0.02 mW/kg to 400 mW/kg. In all conditions studied, the device complies with the
two standards for human exposure to RF EMF, the ICNIRP13 and the IEEE12.
The animal experiments faithfully reproduce the antitumour effects observed in
patients with advanced HCC8 by demonstrating the antitumour activity of HCC-
specific AM RF EMF with partial responses and significant inhibition of cell
proliferation in Huh7 as well as patient xenografts derived from surgical samples.
These experiments show that the small animal exposure system replicates
human AM RF EMF exposure conditions in mice moving freely in the cage during
treatment.
The lack of antiproliferative activity of randomly chosen AM RF EMF
confirms in vivo the earlier in vitro findings3 and establishes that random AM RF
EMF do not affect HCC proliferation unless they are amplitude-modulated at
HCC-specific frequencies. We have previously shown that HCC-specific AM RF
EMF have a robust in vitro antiproliferative effect occurring after a week of daily
three 1-hour exposures. Similarly, the growth of Huh7 xenografts, which had
grown while exposed to randomly chosen frequencies, was stabilized within one
week of exposure HCC-specific AM RF EMF, which is indicative of in vivo
anticancer effect occurring within the same time interval. The targeted effect of
HCC-specific AM RF EMF compared to randomly chosen AM RF EMF is
illustrated by tumour reduction and changes in tumour Ki67, cyclin D1, and p21
while the proliferation of intestinal cells and complete blood counts are
unaffected. These findings are consistent with the absence of changes in
67
complete blood counts (CBC) in patients receiving HCC-specific AM RF EMF,
even after several years of treatment.8
Our findings establish that tumour reduction mediated by HCC-specific AM
RF EMF results from differentiation of HCC into quiescent myofibroblasts. The
transformation of HCC into quiescent myofibroblasts contrasts with the well
documented association between the EMT phenotype and aggressive HCC32
and unveils a new treatment related phenotype in hepatocellular carcinoma.
The data presented in this report and in our previous publication3 show that
HCC-specific AM RF EMF block the growth of HCC cells derived from African-
American (Hep3B), Asian (Huh7, HCCLM3, MHC97L), and Caucasian (HepG2)
patients with HCC, irrespective of their HBV status, indicating that HBV positive
and negative HCC cells derived from individuals of different ethnic backgrounds
respond to the antiproliferative effects of HCC-specific AM RF EMF. With respect
to CSCs, our results indicate that HCC-specific AM RF EMF have a profound
effect on HBV positive and negative HCC CSCs. This provides a plausible
mechanism for the unusually long therapeutic responses observed in several
patients with advanced HCC. These findings, together with the observation of a
complete response, as identified by the alpha-fetoprotein (AFP) tumour marker,
in a patient receiving a combination of sorafenib and HCC-specific AM RF EMF
provide a strong rationale for clinical studies combining HCC-specific AM RF
EMF with either multi-kinase inhibitors or immune oncology therapies.
From a mechanistic point of view, we show that both Ca2+ and, more precisely,
the Cav3.2 isoform of the T-type VGCCs, are key mediators of the tumour cell
68
response, capable of distinguishing HCC-specific AM RF EMF. We propose that
Cav3.2 VGCCs are selectively sensitive for tumour-specific AM RF EMF
frequencies in epithelial malignancies. That Cav3.2 is responsive to EMF is
strongly supported by prior reports33 and our own findings showing that the same
Cav3.2 VGCCs mediate the antiproliferative effects and repress CSCs in breast
cancer following exposure to breast cancer-specific AM RF EMF (Sharma et al,
co-submitted). We have previously reported that variation in pulse amplitude
constitutes the primary method for identification of tumour-specific modulation
frequencies,7 which have subsequently been shown to target cancer cell
proliferation in a tumour and tissue-specific fashion.3 Cav3.2 T-type VGCCs are
expressed in both endothelial cells and vascular smooth muscle cells of small
arteries, which in turn directly affect pulse amplitude.34 Hence, Cav3.2 T-type
VGCCs are the most probable link between the vascular system, crucial to the
tumour-specific frequency identification process7 and the anticancer effects
observed in vitro, in vivo and in patients with advanced HCC. They are also likely
to be necessary for the myofibroblastic differentiation of HCC during tumour
regression, a phenotype that can only be observed following long term exposure
to HCC-specific AM RF EMF resulting in Cav3.2 T-type VGCC-mediated
inhibition of tumour cell proliferation.
The importance of Cav3.2 VGCCs in cancer proliferation has been
reported in several recent studies across a variety of cancer types,35 including
breast carcinoma, retinoblastoma, neuroblastoma, glioma melanoma, and
HCC.35,36 The most likely functional role of these channels is in mediation of Ca2+
69
influx that may contribute to Ca2+ oscillations within carcinoma stem cells – these
have been observed to occur in the G(1) to S cell cycle transition.37-40
Pharmacological block of T-type channels is thought to slow the G(1) to S
transition, but may not necessarily kill proliferating cells.
In the current study, Cav 3.2 T-type VGCCs were found to be necessary
and sufficient to mediate the antiproliferative effects of tumour-specific AM RF
EMF. Surprisingly, blocking of the T-type channel did not affect HCC cell
proliferation and appears to protect against the antiproliferative effects of AM RF
EMF though a mechanism that is yet unknown. The blockade is counterintuitive
given the preliminary success of some T-type channel blockers in reducing
proliferation and enhancing survival in several cancer types.41 This suggests that
the nature of T-type channel is complex, potentially extending to orchestration of
intracellular events either in tandem with, or independently from voltage-
dependent calcium influx.36,42 The effect of AM RF EMF acting in concert with
these channels may be to perturb Ca2+ oscillations, disrupt intracellular Ca2+
levels, the G(1) to S transition, and promote transformation to a quiescent
myofibroblast. These findings also indicate that the use of T-type VGCCs
blockers such as ethosuximide at therapeutic doses does not affect the growth of
HCC. However, until this mechanism is better understood, our results suggest
that the use of T-type VGCCs blockers such as ethosuximide should be avoided
in patients receiving treatment with tumour-specific-AM RF EMF, as they are
likely to oppose the anticancer effects of the treatment.
70
What remains to be established is the site(s) where the HCC-specific AM
RF EMF signal is demodulated so as to influence the changes in pulse pressure
identified in patients with specific cancers7 and the mechanism(s) by which the
HCC-specific AM RF EMF signal influences the Cav 3.2 T-type VGCCs on
tumour cells. Knowledge of the mechanism(s) should also lead to a better
understanding of the precision and effectiveness of the HCC-specific
frequencies.
In summary, we have identified Cav3.2 T-type VGCCs as the necessary
and sufficient mediators of antiproliferative and CSCs downregulating effects of
non-ionizing, non-thermal RF EMF, which are amplitude-modulated at HCC-
specific frequencies. These findings may have broad implications for the
diagnosis and treatment of various forms of cancer.
Online methods:
Dosimetry simulation
The primary purpose of the dosimetry assessment is to determine the
safety of the device and provide insight into organ-specific absorption of AM RF
EMF. The predicted absorption of intrabuccally-administered 27.12 MHz AM RF
EMF and the observed clinical results showing shrinkage of the primary and/or
metastatic tumours in several parts of the body of several patients prompted us
to systematically characterize the overall and organ-specific levels of AM RF
EMF delivered during treatment with the previously described TheraBionic
device.7,8 As previously described, the AM RF EMF generator is a battery driven
device connected to a 1.5 m long 50 Ω coaxial cable, which ends with a
stainless-steel spoon-shaped mouthpiece connected via an impedance
71
transformer.7,8 The device operates at a carrier frequency of 27.12 MHz. The
carrier frequency is amplitude-modulated at tumour-specific frequencies with
85% modulation depth, sequentially switched every 3 seconds from the lowest to
the highest frequency in the range of 0.01 Hz to 150 kHz. Dosimetry simulation,
performed with SEMCAD X, was based on the adult male anatomical model
Duke (weight 73 kg) of the ‘Virtual Population’.43 For simplicity, the TheraBionic
device is represented by a metal box of dimensions 80 mm × 60 mm × 160 mm,
covered with a plastic layer. The wire, modeled as 1 m in length, is connected to
a metal block of size 5 mm × 30 mm × 50 mm to mimic the spoon-shaped
mouthpiece, which is placed on the anterior part of the human model’s tongue.
The simulation is set with 2 mm resolution for humans at a frequency of 27.12
MHz. The total power delivered, SAR distribution, and the organ specific SAR are
assessed, and compared with the experimental results based on a similar but
simplified scenario.
The scenarios of the different treatments are selected based on the three
most common postures used with the device, which are shown in Fig. 1a: 1)
sitting with the device on the leg; 2) sitting with the device on the abdomen; 3)
sitting with the device placed away from the body. 4) is a theoretical position to
test the hypothesis that the body can act as one half of a short dipole antenna –
with the cable and device forming the other half – that occurs when the device is
placed away from the head and aligned with the body and the patient lying down.
These human postures are first simulated on homogeneous models with
dielectric parameters of muscle (εr = 95.9 and σ = 0.65 S/m), which provides a
72
general view of the power dissipation and SAR distribution in the human models.
Furthermore, inhomogeneous human models – with all tissues segmented and
allocated appropriate electrical properties – are simulated for two of the four
cases, 1) and 3), which are the two most common adopted by patients receiving
treatment, to verify the power dissipation and SAR distribution compared with the
homogeneous model and to analyze the organ-specific SAR.
Dosimetry experimental validation
The validation measurements are based on a tank phantom due to its
simple construction and higher SAR levels for given input power. The size of the
chosen tank is 100 mm × 150 mm × 890 mm, with a tissue simulating liquid
composed of saline with εr = 78.9 and σ = 0.435 S/m. Similar configurations in
geometry are used as for human body simulation, thus allowing the same degree
of comparison, and are shown in Fig. 1d. In each configuration, two lines in the
tank have been measured with SPEAG’s Dosimetric Assessment System
(DASY) with EX3DV3 probe S/N 3515 (SPEAG, Switzerland); one line is 5 mm
above the spoon position, and the other is 5 mm above the bottom of tank. These
measured results are compared to the corresponding tank simulation to verify the
simulation reliability.
AM RF EMF exposure in vitro: Cell lines were exposed to 27.12 MHz
radiofrequency electromagnetic fields using exposure systems designed to
replicate clinical exposure levels. Experiments were conducted at an SAR of 30
and 400 mW/kg. Cells were exposed for three hours daily, seven days in a row.
Cells were exposed to tumour-specific modulation frequencies that were
73
previously identified by changes in pulse pressure7 in patients with a diagnosis of
HCC8 or modulation frequencies never identified in patients with a diagnosis of
cancer. Specifically, the randomly chosen frequencies have been selected at
random in the range of 500 Hz to 22 kHz, i.e., within the same range as the
hepatocellular carcinoma-specific and breast cancer-specific frequencies. The
only selection criterion within this range was for frequencies to be at least 5 Hz
higher or lower than any hepatocellular carcinoma or breast cancer-specific
frequency identified in patients with the corresponding diagnoses.3,7,8 We have
previously reported that the primary method for identification of tumour-specific
frequencies is an increase in the amplitude of the pulse for one or more beats
during scanning of frequencies.7 Using the same method, we monitored
variations in the amplitude of the radial pulse in thirty patients with a diagnosis of
cancer and did not observe any change in pulse amplitude during exposure to
the randomly chosen frequencies.
Cell lines: HCC cell lines of various ethnic background, HepG2
(Caucasian), Hep3B (African American, hepatitis B positive) and Huh7 (Asian),
HCCLM3 (Asian, hepatitis B positive), and MHCC97-L (Asian, hepatitis B
positive) were used as models of representation for HCC. THLE2 cells are an
immortalized non-malignant hepatocyte cell line. HepG2, Hep3B and THLE2
cells were purchased from ATCC (Manassas, VA) and Huh7 cells were
purchased from Creative Bioarray (Shirley, NY). HCCLM3 and MHCC97-L were
a gift from the Liver Cancer Institute, Fudan University, China. The Huh7/GFP
cells were established by infection with lentiviruses expressing Lv-EF1α-puro-
74
GFP (SignaGen, Rockville, MD) followed by selection with 1 µg/ml puromycin for
2 weeks. Pools of puromycin-resistant stable clones were collected. Expression
of GFP was determined by western blot and fluorescent microscopy.
Gene expression analysis: RNA extraction from cells was performed by
using RNeasy Mini Kit or miRNeasy Mini Kit (QIAGEN). qRT-PCR was
performed using a Roche LightCycler II and 1-Step Brilliant II SYBR Green qRT-
PCR master mix kit (Agilent Technologies). Data for qRT-PCR were expressed
as mean ± SEM and statistical differences between groups were calculated by a
2-tailed Student t-test.
shRNA knockdown of T-type voltage gated calcium channels: The
specific knockdown of all 3 T-type VGCC isoforms Huh-7 and Hep3B cells were
accomplished by using the following kits. CACNA1g Human shRNA Plasmid Kit
[Locus ID 8913] (Cat# TL305680 ORIGENE); CACNA1h Human shRNA Plasmid
KIT [Locus ID 8912] (Cat# TL314243 ORIGENE); CACNA1i Human shRNA
Plasmid Kit [Locus ID 8911] (Cat# TL314242 ORIGENE).
Quantitative real time PCR target primers and machine protocol:
CACNA1g (Cav 3.1)-Forward primer: 5’ CTT ACC AAC GCC CTA GAA ATC A 3’;
CACNA1g (Cav 3.1)-Reverse primer: 5’ GAT GTA GCC AAA GGG ACC ATA C
3’; CACNA1h (Cav 3.2)-Forward primer: 5’ CAA GGA TGG ATG GGT GAA CA 3’
; CACNA1h (Cav 3.2)-Reverse primer: 5’ GAT GAG CAG GAA GGA GAT GAA G
3’; CACNA1i (Cav 3.3)-Forward primer: 5’ GCC CTA CTA TGC CAC CTA TTG
3’; CACNA1i (Cav 3.3)-Reverse primer: 5’ AGG CAG ATG ATG AAG GTG ATG
3’; GAPDH-Forward primer: 5’ TGC ACC ACC AAC TGC TTA GC 3’; GAPDH-
75
Reverse primer: 5’ GGC ATG GAC TGT GGT CAT GAG 3’; MIR-1246-Forward
primer: 5’ CCG TGT ATC CTT GAA TGG ATT T 3’; MIR-1246-Reverse primer: 5’
CAT TGC TAG CCT ATG GAT TGA TTT 3’; HSA-LET-7G-Forward primer: 5’
GCT GAG GTA GTA GTT TGT ACA GTT 3’; HSA-LET-7G-Reverse primer: 5’
GCA GTG GCC TGT ACA GTT AT 3’; RPLPO-Forward primer: 5’ TTC ATA CCC
AGC TAG CCA ATC 3’; RPLPO-Reverse primer: 5’ TTT CCA TCC CAC TCC
CTT TC 3’; All primers were purchased from IDT. Roche LightCycler 489
Instrument II Protocol: 1 cycle for 30 min at 50oC, 1 cycle for 10 min at 95oC, 40 x
(30 sec at 95oC / 1 minute at 60oC), Rest at 4oC.
Extracellular Ca2+ chelation: Huh-7 cells – seeded in 35 mm dishes, 6
dishes per group – were cultured in the presence or absence of the extracellular
Ca2+ chelator 1,2-bis(2-aminophenoxy) ethane-N,N,Nʹ,Nʹ-tetraacetic acid
(BAPTA; Sigma-Aldrich). BAPTA was dissolved in dimethyl sulfoxide (DMSO;
Fisher), as per Sigma-Aldrich recommendations, to create a working solution.
The AM RF EMF treatment groups were as follows: HCC-specific, randomly
chosen, HCC-specific + BAPTA, randomly chosen + BAPTA. Cells were left to
adhere overnight then were cultured in Dulbecco’s Modified Eagle’s Medium
(DMEM; Cellgro) supplemented with heat inactivated fetal bovine serum (FBS,
final concentration 10%; Atlanta Biologicals). Cells were exposed to either HCC-
specific or randomly chosen frequencies daily for 3 hours in a row, either in the
presence or absence of BAPTA (final concentration 100 µM). The BAPTA
working solution was added to the culture medium within 5 min before exposure
to HCC-specific or randomly chosen frequencies. Within 5 min after completion
76
of the 3-hour exposure time, the BAPTA-containing media was discarded and
replaced with fresh media without BAPTA. On the day 7, cell proliferation was
assessed with the tritiated thymidine incorporation assay. Experiments were
repeated twice. Statistics: We fit a 2-way ANOVA model to examine the effect of
experiment (first/second) and group (four-levels: HCC, randomly chosen, HCC +
BAPTA, and randomly chosen + BAPTA).
L--type and T-type voltage gated calcium channel blockade:
L-type VGCC blockade: Huh-7 cells were seeded in 6-well plates and cultured
in the presence or absence of a L-type voltage gated calcium channel (VGCC)
blocker, nifedipine, (Sigma-Aldrich). Nifedipine was dissolved in dimethyl
sulfoxide (DMSO; Fisher), as per Sigma-Aldrich recommendations, to create
working solution. The treatment groups were as follows: HCC, randomly chosen
frequencies, HCC + nifedipine, and randomly chosen frequencies + nifedipine.
Cells were left to adhere overnight and then were cultured in Dulbecco’s Modified
Eagle’s Medium (DMEM; Cellgro) supplemented with heat inactivated FBS (final
concentration 10%). Cells were exposed to either HCC-specific or randomly
chosen frequencies daily for 3 hours in a row, either in the presence or in the
absence of nifedipine (final concentration 100 µM or 10 µM). Nifedipine working
solution was added to the culture medium within 5 min before exposure to HCC-
specific or randomly chosen frequencies. Within 5 min after completion of the 3-
hour exposure time, media was removed from all dishes and replaced with fresh
media, not containing nifedipine. On day 7, cell proliferation was assessed with
the tritiated thymidine incorporation assay. The experiment was repeated twice.
77
T-type VGCC blockade: Huh-7 cells were seeded in 6 well plates at 20,000 cells
per dish and cultured in the presence or absence of a pan T-type VGCC 2-ethyl-
2-methlysuccinimide (ethosuximide, ETHOS group) (1 mM) (Sigma-Aldrich).
Ethosuximide was dissolved in 100% ethanol as the vehicle control (VC) (Fisher)
as per Sigma-Aldrich recommendation to create working solution. The treatment
groups were as follows: SHAM (VC), RCF (VC), HCC (VC), SHAM (ETHOS),
RCF (ETHOS) and HCC (ETHOS). Cells were left to adhere overnight and were
then cultured in Dulbecco’s Modified Eagle’s Medium (DMEM; Cellgro)
supplemented with heat inactivated FBS (final concentration 10%). Cells were
exposed to either HCC-specific or randomly chosen AM RF EMF daily for 3
hours in a row or received no treatment, either in the presence or in the absence
of ethosuximide (final concentration 1mM). Ethosuximide working solution was
added to the culture medium within 10 min before exposure to HCC, RCF, or
SHAM groups. Within 5 min after completion of the 3-hour exposure time, media
was removed from all dishes and replaced with fresh media without
ethosuximide. On day 7, cell proliferation was assessed with the tritiated
thymidine incorporation assay, flow cytometry markers were stained, or cells
were cultured in tumour sphere media for sphere formation assays. Experiments
were repeated at least twice. Statistics: One-way ANOVA was used to
statistically compare the effect of experimental (HCC-specific AM RF EMF) and
control groups (SHAM and randomly chosen frequencies). Post hoc testing was
by the Tukey test. Data are expressed as mean ± SEM. Graphpad Prism was the
software used for statistical analysis.
78
Flow Cytometric Analysis: Cells cultured, divided and treated into HCC,
RCF or SHAM groups. After 7 days of treatment cells were labeled for CD44-
APC (mouse anti-human 1:20,000(Huh-7) and 1:10(Hep3B), Cat#103011
Biolegend) and CD133-PE (mouse anti-human 1:10 (Huh-7) and 1:20(Hep3B),
Cat# 130-098-826 Miltenyi Biotec) markers of cancer stem cell, fixed and
analyzed via flow cytometry. Data collection was performed on a C6 Accrui flow
cytometer while analysis was performed on CFlow Plus software (Becton
Dickinson).
Sphere formation assay: Cells were cultured, divided and treated in
HCC, RCF or SHAM groups. Cells were plated (200 cells/well) in 96-well ultra-
low attachment plates (Corning) with DMEM/F12 supplemented with 2% B27
(Invitrogen), 20 ng/ml EGF (Sigma Aldrich), and 4 μg/ml insulin (Sigma-Aldrich).
Cells seeded at a density of 100-500 viable cells per 100uL. 5-7 days post-
treatment cells were counted for the number of spheres present in each well and
data were represented as the means ± SEM.
In vivo effects of amplitude-modulated radiofrequency
electromagnetic fields: To replicate the dosimetric conditions resulting from
intrabuccal administration of AM RF EMF in vivo, we designed and developed a
small animal exposure system for AM RF EMF.10 This exposure system allows
for control of SAR levels in the same range as those generated by intrabuccal
administration.10 Mice were exposed to RF EMF amplitude-modulated at the
previously published HCC-specific3 or randomly chosen3 frequencies 3 hours
daily. Another group of control mice was not exposed to any RF EMF. All
79
procedures were approved by the Wake Forest Institutional Animal Care and Use
Committee (IACUC). A total of 40 non-obese diabetic severe combined
immunodeficient (NOD SCID; Jackson labs) mice (male and female) were used.
Mice were housed in plastic cages with up to 5 mice/cage at room temperature
and fed a standard mouse diet with water ad libitum (food and water were
autoclaved). Mice were injected subcutaneously in the right hind flank with 7.0 x
106 Huh-7 cells, re-suspended in 200 µL of DPBS, at 5-7 weeks of age and then
randomly assigned to HCC-specific RF EMF, randomly chosen frequencies, or
no exposure (SHAM) conditions. Thirty seven of the 40 (92.5%) mice developed
palpable Huh7 tumours. Upon establishment of a palpable tumour, measuring at
a minimum of 0.5 cm in one dimension (Length or Width), mice were exposure
with HCC-specific RF EMF or randomly chosen frequencies was initiated and
give 3 hours daily. An additional group of mice were not exposed to any RF EMF
(SHAM treatment group). Mice set to receive AM RF EMF exposure were placed
in a custom-designed exposure system,10 consisting of two transverse
electromagnetic (TEM) cells configured as half-wave resonators (sXv-27, IT’IS,
Zurich, Switzerland). Mice were exposed to 27.12 MHz EMF, modulated at HCC-
specific amplitude 8 or randomly chosen3 frequencies with a SAR of 400 mW/kg,
which results in an organ-specific SAR of 67 mW/kg for subcutaneous tumours,
i.e., tumours located in the subcutaneous fat.10 Tumours were measured with
calipers three times per week. Mice were euthanized when tumour burden was
excessive; 2 hours before euthanasia, a total of 12 mice (6 exposed to HCC-
specific AM RF EMF, 3 exposed to randomly chosen AM RF EMF, 3 not exposed
80
to EMF) were injected intraperitoneally with 200 µL bromodeoxyuridine labeling
reagent (BrdU; Life Technologies). Mouse tissue and xenograft tumour were
collected/fixed for paraffin embedding and evaluated by immunohistochemistry.
Patient derived Xenograft mice: 10 NSG female mice, with PDX implanted
tumours, were provided by Anand Ghanekar M.D. from University Health
Network (UHN) (Toronto, Ontario, Canada). Briefly, the patient derived tumour
was from a 63 year-old male HCC patient with negative viral serologies, no
metastases to lymph nodes, positive for microscopic and large vessel vascular
invasions, multiple satellites/intrahepatic metastatic smaller nodules, TNM stage:
pT3bN0 and no significant fibrosis or other active parenchymal or biliary injury.
The tumour was implanted into immunocompromised (NSG) mice as previously
described.44 After one month of quarantine, 6 mice were exposed to HCC-
specific AM RF EMF, and 4 mice were observed as controls. In total, mice
received HCC-specific AM RF EMF for 8 weeks. Statistics: In vivo tumour
volume comparisons were accomplished by repeated measures mixed models
analysis. In these models group and time were fixed effects and the individual
animals were treated as random effects. A time by group interaction was
examined to determine if tumour growth rates were different between groups. If
the time by group interaction was found to be significant, the mixed models were
fit again stratified by time to allow for groups to be compared at individual time
points to determine when the observed effects became statistically significant.
Immunohistochemistry: Xenografts were fixed in 10% neutral buffered
formalin (NBF), sectioned at 4 μm and stained for the following: Cyclin D1 [92G2]
81
(Rabbit anti-human 1:100, #2978s Cell Signaling Technology); Ki-67 [D2H10]
(Rabbit anti-human 1:800, #9027s Cell Signaling Technology); p21 Waf1/Cip1
[DCS60] (Mouse anti-human 1:100, #2946s Cell Signaling Technology); S100B
[9A11B9] (Mouse anti-human 1:100, sc-81709 Santa Cruz Biotechnology); BrdU
[Bu20a] (Mouse anti-human 1:400, #5292s Cell Signaling Technology); PCNA
[PC10] (Mouse anti-human 1:8000, #2586s Cell Signaling Technology); Green
Fluorescent Protein (GFP) (Rabbit 1:400, #2555s Cell Signaling Technology);
SLUG [A-7] (Mouse anti-human (no results), sc-166476 Santa Cruz
Biotechnology); E-Cadherin [HECD-1] (Mouse anti-human 1:100, ab1416
ABCAM); N-Cadherin [D4R1H] XP (Rabbit anti-human 1:125, #13116 Cell
Signaling Technology); SNAI1 [OTI5E12] (Mouse anti-human 1:25), TA500316
ORIGENE); Alpha Smooth Muscle Actin (Rabbit anti-human 1:200, ab5694
ABCAM); Vimentin [V9] (Mouse anti-human 1:1200, ab8069 ABCAM);
Fibronectin [F1] (Rabbit anti-human 1:300, ab32419 ABCAM); Twist [10E4E6]
(Mouse anti-human 1:100, ab175430 ABCAM); The small bowels of mice were
fixed in 10% Neutral buffered formalin and stained for BrdU (1:400). Average
number of positive staining cells was counted in a blinded fashion for both control
and treated groups. Tumour samples were from mice with established tumour
after subcutaneous xenograft injection of the Huh-7 cells, having received HCC-
specific, randomly chosen frequencies or SHAM treatment for ten weeks. EMT
and GFP tagged IHC slides were prepared and digitally scanned by the Wake
Forest Baptist Comprehensive Cancer Center Tumour Tissue and Pathology
Shared Resource. All images were prepared with Nano Zoomer Digital pathology
82
software (Hamamatsu Photonics K.K.) from digital slide scans (1x and 20x
magnification). IHC staining was performed by Dr. David Caudell. Visualization
and quantification were performed by Dr. Barry DeYoung, average number of
positive staining cells was counted for both control and treated groups. Tumour
samples were from mice with established tumour after subcutaneous xenograft
injection of the Huh-7 cells, having received HCC-specific, randomly chosen
frequencies or SHAM treatment for ten weeks. Statistics: One-way Analysis of
Variance (ANOVA) was used to statistically compare the effect of experimental
(HCC-specific AM RF EMF) and control groups (SHAM & Randomly chosen
frequencies). Post-Hoc testing was compared by a Tukey Test. Data for
Immunohistochemistry were expressed as mean ± SEM. Graphpad Prism was
the software used for statistical analysis.
RNA-Seq data analysis: We have generated two RNA-Seq data sets
using two cell lines, Huh-7 and HepG2. The RNA-Seq data of Huh-7 include 6
controls and 6 treated samples. HepG2 data set contains 2 controls and 2
treated samples. The alignment and quality control of RNA-Seq data followed the
pipeline developed by The NCI's Genomic Data Commons (GDC,
https://gdc.cancer.gov/). The alignment was performed using a two-pass method
with STAR2.45 The quality assessment was carried out by FASTQC
(https://www.bioinformatics.babraham.ac.uk/projects/fastqc/) on the pre-
alignment, and RNA-SeQC46 and Picard tools
(http://broadinstitute.github.io/picard/) on the post-alignment. Read Counts were
performed by SummarizedExperiment of DESeq2.47 The count data were
83
normalized by betweenLaneNormalization function of EDASeq48 to normalize the
data using upper-quartile (UQ) normalization and then estimate the factors of
unwanted variation using empirical control genes, e.g.,, least significantly
differentially expressed (DEGs) genes based on a first-pass DEG analysis
performed prior to RUVg normalization.49 Lastly, DEG analysis is implemented by
DESeq2 by adding the factors of unwanted variation into design of DESeq2 in
order to remove unwanted variation. MicroRNA arrays: the initial microRNA array
analysis did not reach any significance. Eighty percent of miRs are not expressed
and should not be penalized. After adjustment for the lack of expression of 80%
of the miRs, miR-1246 was the most significant miR showing differential
expression in both HepG2 and Huh7. There are additional miRs that are
invariably significant in addition to miR-1246: miR-4306, 378b, 1973, 3175, which
are similarly more expressed upon exposure to HCC-specific AM RF EMF.
Long-term antitumour effect in a patient with advanced
hepatocellular carcinoma: A 79-year-old man, diagnosed with hepatocellular
carcinoma in January 2011, underwent left hepatectomy in February 2011.
Histologic review revealed a 10-cm lesion consistent with poorly differentiated
hepatocellular carcinoma with negative margins, pT3NxMx. Recurrent disease
was identified by radiologic imaging in May 2011 revealing four new lesions
within the right lobe of the liver. The patient underwent chemoembolization of the
liver lesions with lipiodol and doxorubicin in June 2011. Follow-up magnetic
resonance imaging (MRI) obtained in July 2011 showed intrahepatic progression
of disease. The patient started sorafenib on August 15, 2011 and compassionate
84
use treatment with the TheraBionic device on September 15, 2011. As shown on
Suppl. Fig. 4 the patient had a complete response by marker and a partial
response as assessed by imaging studies, which lasted more than 6 years.
Acknowledgements:
Research reported in this publication was supported by the National
Cancer Institute’s Cancer Center Support Grant award number P30CA012197
issued to the Wake Forest Baptist Comprehensive Cancer Center (BP) and by
funds from the Charles L. Spurr Professorship Fund (BP). DWG is supported by
R01 AA016852. The content is solely the responsibility of the authors and does
not necessarily represent the official views of the National Cancer Institute. The
authors wish to acknowledge the support of the Wake Forest Baptist
Comprehensive Cancer Center Cancer Genomics, Proteomics, Biostatistics, and
Bioinformatics Shared Resource, supported by the National Cancer Institute’s
Cancer Center Support Grant award number P30CA012197. The content is
solely the responsibility of the authors and does not necessarily represent the
official views of the National Cancer Institute.”
Author contributions:
Jimenez, H., Wang, M., Zimmerman, J.W., Sharma, S., Xu, Z., and
Pennison, M., contributed directly to data generation and performance of in vitro
and in vivo experiments.
Brezovich, I., designed initial cell culture model of EMF exposure device
and provided physics related tutoring and initial EMF SAR calculations.
Lin, H.K., Blackstock, A.W., Bonkovsky, H.L. reviewed the manuscript and
provided critical comments.
85
Capstick, M., Gong, Y., and Kuster, N. designed and performed dosimetry
models, data analysis and write up of final results.
Ghanekar, A. and Chen, K. provided the implanted PDX tumour mouse
model.
Watabe, K., Lo, H.W., and Godwin, D.W., provided specialized training in
CSC-related cell culture, mouse handling, and Ca2+ related tools and signaling to
Jimenez, H.
Merle, P., and Munden, R. provided clinical HCC patient information and
data review.
Absher, D., Myers, R.M., Miller, L.D., Olivier, M., Jin, G., Liu, L., and
Zhang, W. were involved in microRNA and RNA-Seq data generation, analysis
and interpretation.
DeYoung, B. and Caudell, D. performed IHC staining, interpretation and
overall pathology review.
Jimenez, H. and D’Agostino Jr., R.B. performed all statistics
Jimenez, H., Blackman, C., Barbault, A., and Pasche, B. designed all
experiments, reviewed all data, and were responsible for data write up.
COMPETING FINANCIAL INTERESTS
Boris Pasche and Alexandre Barbault hold stocks in TheraBionic LLC and
TheraBionic GmbH.
86
References
1 Siegel, R. L., Miller, K. D. & Jemal, A. Cancer statistics, 2017. CA. Cancer
J. Clin. 67, 7-30, doi:10.3322/caac.21387 (2017).
2 Islami, F. et al. Disparities in liver cancer occurrence in the United States
by race/ethnicity and state. CA. Cancer J. Clin. 67, 273-289,
doi:10.3322/caac.21402 (2017).
3 Zimmerman, J. W. et al. Cancer cell proliferation is inhibited by specific
modulation frequencies. British journal of cancer 106, 307-313 (2012).
4 Global Burden of Disease Cancer, C. Global, regional, and national
cancer incidence, mortality, years of life lost, years lived with disability,
and disability-adjusted life-years for 32 cancer groups, 1990 to 2015: A
systematic analysis for the global burden of disease study. JAMA
Oncology 3, 524-548, doi:10.1001/jamaoncol.2016.5688 (2017).
5 Kudo, M. et al. Lenvatinib versus sorafenib in first-line treatment of
patients with unresectable hepatocellular carcinoma: a randomised phase
3 non-inferiority trial. Lancet, doi:10.1016/S0140-6736(18)30207-1 (2018).
6 Jimenez, H. et al. Use of non-ionizing electromagnetic fields for the
treatment of cancer. Front Biosci (Landmark Ed) 23, 284-297 (2018).
7 Barbault, A. et al. Amplitude-modulated electromagnetic fields for the
treatment of cancer: discovery of tumor-specific frequencies and
assessment of a novel therapeutic approach. J. Exp. Clin. Cancer Res.
28, 51, doi:10.1186/1756-9966-28-51 (2009).
87
8 Costa, F. P. et al. Treatment of advanced hepatocellular carcinoma with
very low levels of amplitude-modulated electromagnetic fields. British
journal of cancer 105, 640-648 (2011).
9 Kirson, E. D. et al. Disruption of Cancer Cell Replication by Alternating
Electric Fields. Cancer Res. 64, 3288-3295 (2004).
10 Capstick, M., Gong, Y., Pasche, B. & Kuster, N. An HF exposure system
for mice with improved efficiency. Bioelectromagnetics 37, 223-233,
doi:10.1002/bem.21969 (2016).
11 Zimmerman, J. W. et al. Targeted treatment of cancer with radiofrequency
electromagnetic fields amplitude-modulated at tumor-specific frequencies.
Chin J Cancer 32, 573-581, doi:10.5732/cjc.013.10177 (2013).
12 IEEE. IEEE Standards for Safety Levels with Respect to Human Exposure
to Radio Frequency Electromagnetic Fields, 3 kHz to 300 GHz, IEEE
C95.1-2005. (Institute of Electrical and Electronics Engineers, New York,
2006).
13 ICNIRP. Guidelines for limiting exposure to time-varying electric, magnetic
and electromagnetic fields (up to 300 GHz). Health Phys. 74, 494-522
(1998).
14 Schnater, J. M. et al. Subcutaneous and intrahepatic growth of human
hepatoblastoma in immunodeficient mice. J. Hepatol. 45, 377-386,
doi:10.1016/j.jhep.2006.03.018.
88
15 Sharma, D. et al. Adiponectin antagonizes the oncogenic actions of leptin
in hepatocellular carcinogenesis. Hepatology 52, 1713-1722,
doi:10.1002/hep.23892 (2010).
16 Ahmed, S. U. et al. Generation of subcutaneous and intrahepatic human
hepatocellular carcinoma xenografts in immunodeficient mice. J Vis Exp,
e50544, doi:10.3791/50544 (2013).
17 Albarran, L., Lopez, J. J., Salido, G. M. & Rosado, J. A. in Calcium Entry
Pathways in Non-excitable Cells (ed Juan A. Rosado) 3-24 (Springer
International Publishing, 2016).
18 Blackman, C. F. et al. Induction of calcium-ion efflux from brain tissue by
radiofrequency radiation. Bioelectromagnetics 1, 277-283 (1980).
19 Bawin, S. M., Kaczmarek, L. K. & Adey, W. R. Effects of modulated VHF
fields on the central nervous system. Ann.N Y.Acad.Sci. 247, 74-81
(1975).
20 Catterall, W. A. Voltage-Gated Calcium Channels. Cold Spring Harbor
Perspectives in Biology 3, doi:10.1101/cshperspect.a003947 (2011).
21 Prevarskaya, N., Skryma, R. & Shuba, Y. Ion channels and the hallmarks
of cancer. Trends in molecular medicine 16, 107-121,
doi:http://doi.org/10.1016/j.molmed.2010.01.005 (2010).
22 Prevarskaya, N., Skryma, R. & Shuba, Y. Calcium in tumour metastasis:
new roles for known actors. Nature Reviews Cancer 11, 609-618 (2011).
23 Gomora, J. C., Daud, A. N., Weiergräber, M. & Perez-Reyes, E. Block of
Cloned Human T-Type Calcium Channels by Succinimide Antiepileptic
89
Drugs. Mol. Pharmacol. 60, 1121-1132, doi:10.1124/mol.60.5.1121
(2001).
24 Llovet, J. M. et al. Sorafenib in Advanced Hepatocellular Carcinoma. The
New England Journal of Medicine 359, 378-390 (2008).
25 Cheng, A. L. et al. Efficacy and safety of sorafenib in patients in the Asia-
Pacific region with advanced hepatocellular carcinoma: a phase III
randomised, double-blind, placebo-controlled trial. The lancet oncology
10, 25-34, doi:10.1016/S1470-2045(08)70285-7 (2009).
26 Abou-Alfa, G. K. et al. Phase II study of sorafenib in patients with
advanced hepatocellular carcinoma. J. Clin. Oncol. 24, 4293-4300 (2006).
27 Wang, A., Qu, L. & Wang, L. At the crossroads of cancer stem cells and
targeted therapy resistance. Cancer Lett. 385, 87-96,
doi:http://doi.org/10.1016/j.canlet.2016.10.039 (2017).
28 Tovar, V. et al. Tumour initiating cells and IGF/FGF signalling contribute to
sorafenib resistance in hepatocellular carcinoma. Gut 66, 530-540,
doi:10.1136/gutjnl-2015-309501 (2017).
29 Xu, Y. et al. MicroRNA-122 confers sorafenib resistance to hepatocellular
carcinoma cells by targeting IGF-1R to regulate RAS/RAF/ERK signaling
pathways. Cancer Lett. 371, 171-181,
doi:http://doi.org/10.1016/j.canlet.2015.11.034 (2016).
30 Jones, R. J. & Matsui, W. Cancer Stem Cells: From Bench to Bedside.
Biology of blood and marrow transplantation : journal of the American
90
Society for Blood and Marrow Transplantation 13, 47-52,
doi:10.1016/j.bbmt.2006.10.010 (2007).
31 Perz, J. F., Armstrong, G. L., Farrington, L. A., Hutin, Y. J. & Bell, B. P.
The contributions of hepatitis B virus and hepatitis C virus infections to
cirrhosis and primary liver cancer worldwide. J. Hepatol. 45, 529-538,
doi:10.1016/j.jhep.2006.05.013 (2006).
32 Critelli, R. et al. Microenvironment inflammatory infiltrate drives growth
speed and outcome of hepatocellular carcinoma: a prospective clinical
study. Cell Death Dis 8, e3017, doi:10.1038/cddis.2017.395 (2017).
33 Cui, Y., Liu, X., Yang, T., Mei, Y.-A. & Hu, C. Exposure to extremely low-
frequency electromagnetic fields inhibits T-type calcium channels via
AA/LTE4 signaling pathway. Cell Calcium 55, 48-58,
doi:https://doi.org/10.1016/j.ceca.2013.11.002 (2014).
34 Mikkelsen, M. F., Bjorling, K. & Jensen, L. J. Age-dependent impact of Cav
3.2 T-type calcium channel deletion on myogenic tone and flow-mediated
vasodilatation in small arteries. The Journal of physiology 594, 5881-5898,
doi:10.1113/JP271470 (2016).
35 Dziegielewska, B., Gray, L. S. & Dziegielewski, J. T-type calcium channels
blockers as new tools in cancer therapies. Pflügers Archiv - European
Journal of Physiology 466, 801-810, doi:10.1007/s00424-014-1444-z
(2014).
36 Li, Y. et al. A role of functional T-type Ca2+ channel in hepatocellular
carcinoma cell proliferation. Oncol. Rep. 22, 1229-1235 (2009).
91
37 Resende, R. R. et al. Influence of spontaneous calcium events on cell-
cycle progression in embryonal carcinoma and adult stem cells.
Biochimica et Biophysica Acta (BBA) - Molecular Cell Research 1803,
246-260, doi:https://doi.org/10.1016/j.bbamcr.2009.11.008 (2010).
38 Keir, S. T., Friedman, H. S., Reardon, D. A., Bigner, D. D. & Gray, L. A.
Mibefradil, a novel therapy for glioblastoma multiforme: cell cycle
synchronization and interlaced therapy in a murine model. J. Neurooncol.
111, 97-102, doi:10.1007/s11060-012-0995-0 (2013).
39 Gray, L. S., Schiff, D. & Macdonald, T. L. A model for the regulation of T-
type Ca2+ channels in proliferation: roles in stem cells and cancer. Expert
Review of Anticancer Therapy 13, 589-595,
doi:http://dx.doi.org/10.1586/era.13.34 (2013).
40 Lory, P., Bidaud, I. & Chemin, J. T-type calcium channels in differentiation
and proliferation. Cell Calcium 40, 135-146,
doi:https://doi.org/10.1016/j.ceca.2006.04.017 (2006).
41 Krouse, A. J., Gray, L., Macdonald, T. & McCray, J. Repurposing and
Rescuing of Mibefradil, an Antihypertensive, for Cancer: A Case Study.
Assay and drug development technologies 13, 650-653,
doi:10.1089/adt.2015.29014.ajkdrrr (2015).
42 Tonelli, F. M. P. et al. Stem Cells and Calcium Signaling. Adv. Exp. Med.
Biol. 740, 891-916, doi:10.1007/978-94-007-2888-2_40 (2012).
43 Gosselin, M. C. et al. Development of a new generation of high-resolution
anatomical models for medical device evaluation: the Virtual Population
92
3.0. Phys. Med. Biol. 59, 5287-5303, doi:10.1088/0031-9155/59/18/5287
(2014).
44 Chen, K., Ahmed, S., Adeyi, O., Dick, J. E. & Ghanekar, A. Human solid
tumor xenografts in immunodeficient mice are vulnerable to
lymphomagenesis associated with Epstein-Barr virus. PloS one 7,
e39294, doi:10.1371/journal.pone.0039294 (2012).
45 Dobin, A. et al. STAR: ultrafast universal RNA-seq aligner. Bioinformatics
29, 15-21, doi:10.1093/bioinformatics/bts635 (2013).
46 DeLuca, D. S. et al. RNA-SeQC: RNA-seq metrics for quality control and
process optimization. Bioinformatics 28, 1530-1532,
doi:10.1093/bioinformatics/bts196 (2012).
47 Love, M. I., Huber, W. & Anders, S. Moderated estimation of fold change
and dispersion for RNA-seq data with DESeq2. Genome Biol 15, 550,
doi:10.1186/s13059-014-0550-8 (2014).
48 Risso, D., Schwartz, K., Sherlock, G. & Dudoit, S. GC-content
normalization for RNA-Seq data. BMC Bioinformatics 12, 480,
doi:10.1186/1471-2105-12-480 (2011).
49 Risso, D., Ngai, J., Speed, T. P. & Dudoit, S. Normalization of RNA-seq
data using factor analysis of control genes or samples. Nat Biotechnol 32,
896-902, doi:10.1038/nbt.2931 (2014).
93
Figures and legends
Figure 1.| Intrabuccal delivery results in systemic absorption of AM RF EMF. a,1) Patient sitting with device on thigh, 2) Patient sitting with device on the abdomen, 3) Patient sitting with device placed away from the body, 4) Patient in supine position to test the hypothesis that the body can act as one half of a short dipole antenna while the cable and device form the other half, or for treatment lying down while the device is behind the head. The device and coaxial cable are shown in blue. The electric dipole is shown in green. b, SAR slice views in the homogeneous human model: the images are normalized to 5 W/kg/W, with 3 dB/contour. 1) Patient sitting with device on thigh, 2) Patient sitting with device on the abdomen, 3) Patients sitting with device placed away from the body, 4) Patient in supine position. c, SAR slice views in the inhomogeneous model: the images are normalized to 5 W/kg/W, with 3 dB/contour. Left panels: patient sitting with device on thigh. Right panels: patient sitting with device located away from the body. d, Experimental validation measurements setups and results.1) The device is located at one extremity underneath the tank, 2) The device is in the middle underneath the tank, 3) The device is beside the tank, 4) The device is as far away from the tank as possible.
94
Figure 2 | Antiproliferative effects of HCC-specific AM RF EMF in vivo. a, Mice were exposed to either HCC-specific AM RF EMF exposure with a xenograft-specific SAR of 67 mW/kg or are assigned to the control treatment group 3 hours per day. Control group is comprised of mice receiving either randomly chosen frequency AM RF EMF with a xenograft-specific SAR of 67 mW/kg and those receiving no exposure to EMF. Tumour volume is measured 3 times per week and volume is calculated as (Length x Width2) / 2. After of 6 weeks of exposure, statistical significance between treated and control groups has been achieved; Week 5 (p = 0.045), Week 6 (p = 0.019). P-value was calculated via student’s t-test. Test for treatment by time interaction (p < 0.001). b, Sequential exposure to randomly chosen and HCC-specific AM RF EMF. Five mice carrying Huh7 xenografts were exposed to randomly chosen AM RF EMF (grey line) 3 hours per day for ten weeks during which the average tumour volume increased by 48%. Exposure was switched to HCC-specific AM RF EMF (blue line) after ten weeks. Exposure to EMF was discontinued for one week after four weeks exposure, then resumed. Mice were sacrificed at the end of week 16. c, Patient-derived HCC xenografts (PDX) exposed to HCC-specific AM RF EMF or not exposed to EMF. Patient derived xenografts from a 63-year-old male with hepatocellular carcinoma. Mice received either HCC-specific AM RF EMF exposure (HCC; N = 6) or received no treatment (SHAM; N =4). Tumour volume measured 3 times per week and volume is calculated as (Length x Width2) / 2. After 8 weeks of exposure, statistical significance had been achieved; Week 4 (p = 0.0176), Week 5 (p = 0.0211). At week 6, all mice in the Sham group expired and tumour volume was imputed, Week 6 (p = 0.0553). Test for treatment by time interaction (p = 0.0006). d, Origin of fibroblast-like cells intermeshed with tumour cells following HCC specific AM RF EMF mediated tumour shrinkage. Transition between epithelial neoplasm with strong GFP signal on the right contrasted with decreased but persistent GFP signal in cells with more spindle morphology on the left demonstrating the same cell of origin for the two populations (20x Lens). e, Epithelial to myofibroblast transition of Huh7 cells after exposure to HCC-specific AM RF EMF. IHC staining pattern. f, IHC summary of EMT staining pattern of responding tumours after HCC-specific AM RF EMF treatment. g, Fibroblast-like cells surrounding residual HCC cells following exposure to HCC-specific AM RF EMF. NOD SCID mice carrying palpable xenografts were exposed to HCC-specific AM RF EMF three hours daily at a SAR of 67 mW/kg. The Huh7 xenograft shrank by approximately 70% at the same time point. Histological analysis (20X) shows residual HCC cells () surrounded by layers of fibroblast-like cells (#) and occasional lipocytes. h. Tumor and intestinal crypt cell proliferation in mice exposed to HCC-specific AM RF EMF, randomly chosen AM RF EMF, and mice not exposed to EMF. IHC of Huh-7 Xenograft tumors, Representative figures and graphs represent mean +/- SEM (SHAM: N = 3; RCF: N = 3; HCC: N = 6). (1st row): Ki-67 staining of SHAM, RCF and HCC treated tumors. Anova: F = (2, 33) 67.55, P = <0.0001. Post-Hoc Tukey Test: Sham vs RCF p = 0.2067, SHAM vs HCC p <0.0001, RCF vs HCC p < 0.0001. (2nd row): Cyclin D1 staining of SHAM, RCF and HCC treated tumors. Anova: F = (2, 33) 23.29, p < 0.0001. Post-Hoc Tukey test: Sham vs RCF p =
95
0.1379, SHAM vs HCC p <0.0001, RCF vs HCC p = 0.0005. (Third row): p21 staining of SHAM, RCF and HCC treated tumors Anova: F = (2, 33) 6.907, p = 0.0031. Post-Hoc Tukey test: Sham vs RCF p = 0.7373, Sham vs HCC p = 0.0411, RCF vs HCC p = 0.0049. (Fourth row): BRDU staining of SHAM, RCF and HCC treated tumors. Positive staining in all crypts; no statistics performed.
96
97
Fig. 3 | HCC-specific AM RF EMF antiproliferative effects and downregulation of CSCs are mediated by Cav 3.2 T-type voltage gated calcium channels. a, Ca2+ chelation abrogates AM RF EMF-mediated inhibition of Huh7 cell proliferation. Huh7 cells were exposed to either randomly chosen (RCF) or hepatocellular carcinoma-specific (HCCMF) AM RF EMF three hours daily for seven days prior to cell proliferation assays with tritiated thymidine incorporation. ANOVA followed by tukey post hoc-test showed that only the proliferation of cells exposed to HCC-specific AM RF EMF was significantly lower than cells exposed to the extracellular Ca2+ chelator (BAPTA) or randomly chosen AM RF EMF (p = 0.0023). b, T-type voltage gated calcium channel blockade with ethosuximide abrogates HCC-specific AM RF EMF inhibition of Huh7 cell proliferation. Huh7 cells were exposed to HCC-specific AM RF EMF(HCCMF) three hours daily for seven days prior to cell proliferation assays. Huh7 cells not exposed to AM RF EMF (SHAM) were used as controls. Experiments were performed in the presence or absence of ethosuximide (Ethos). ANOVA followed by Tukey post-hoc indicates that only HCC-specific AM RF EMF block Huh7 cell proliferation (p < 0.0001). c, Inhibition of cell proliferation by HCC-specific AM RF EMF in Huh7 and Hep3B cells with selective knockdown of Cav 3.1, 3.2 and 3.3 T-type voltage gated calcium channels. The three T-type voltage-gated calcium channels Cav 3.1, Cav 3.2, and Cav 3.3 were selectively knocked down using siRNA targeting the CACNA1G (sh3.1), CACNA1H (sh3.2), and CACNA1I (sh3.3) genes, respectively. CACNA1I (sh3.3) expression in Hep3B cells was not detectable by qPCR, as noted in Cav isoform relative expression graph, hence knockdown was not attempted. Cell proliferation was assessed after exposure to HCC-specific AM RF EMF (HCCMF) three hours daily for seven days. Control cells were not exposed to AM RF EMF (SHAM). Huh7 data (LEFT): shScramble (N=5 for both groups) T-test p value: 0.0092; sh3.1 (N=6 for both groups) t test p value: <0.0001; sh3.2 (N=6 for both groups) t test p value: 0.4948; Sh3.3 (N=6 for both groups) t test p value: 0.0071. Hep3B data (RIGHT): shScramble (N=5 for SHAM and N=6 for HCCMF) T-test p value: 0.0493; sh3.1 (N=6 for SHAM and N=5 for HCCMF) t test p value: 0.0443; sh3.2 (N=6 for both groups) t test p value: 0.1691. (Lower): Basal expression levels of the three T-types voltage-gated calcium channels isoforms Cav 3.1, Cav 3.2, and Cav 3.3 in multiple cell lines (RED circles signify targets with no detectable expression via qRT-PCR). d, Antiproliferative effects of HCC-specific AM RF EMF on HBV positive HCC cells. Cell proliferation was assessed in HCC cells exposed to HCC-specific AM RF EMF using a [3H]thymidine incorporation assay as described before.3 e, Effect of HCC-specific AM RF EMF on HCC Cancer stem cells. The cancer stem cell population of Huh7 (upper panel) and Hep3B (lower panel) cells was assessed after one week of exposure to HCC-specific AM RF EMF. Control cells were not exposed to HCCMF. The population of cancer stem cells was significantly lower following exposure to HCC-specific AM RF EMF. (UPPER PAIR) Huh7 %CSC Data: SHAM (N = 4) and HCCMF (N = 4); T-test p value = 0.0091. Huh7 Sphere formation: SHAM (N = 5) and HCCMF (N = 5); T-test p-value = 0.0011. (LOWER PAIR) Hep3B %CSC Data: SHAM (N = 4) and HCCMF (N = 3); T-test p value = 0.0091. Hep3B Sphere formation: SHAM
98
(N = 7) and HCCMF (N = 6); T-test p-value = 0.0011. f, Effect of HCC-specific AM RF EMF on Cav 3.2 knockdown HCC Cancer stem cells. The cancer stem cell population of Huh7 Cav3.2 knockdown (upper panel) and Hep3B Cav 3.2 knockdown (lower panel) cells was assessed after one week of exposure to HCC-specific AM RF EMF. Control cells were not exposed to EMF. The population of cancer stem cells was equal to or greater than the control group following exposure to HCC-specific AM RF EMF. (UPPER) Huh7 Cav 3.2 knockdown sphere formation: SHAM (N = 5) and HCCMF (N = 5); T-test p-value = 0.2364. (LOWER) Hep3B Cav 3.2 knockdown sphere formation: SHAM (N = 6) and HCCMF (N = 7); T-test p-value = 0.0034.
99
Table 1. Dosimetry assessment
100
Table 2. Organ-specific SAR
101
Supplemental Figures
Suppl. fig. 1a: Measurement and simulation comparison for case 1 and 3. After correct normalization of the delivered power, the measurement and simulation data can be compared: they are generally in agreement for cases 1 and 3. The larger deviations between simulation and measurement at the far end of tank as for case 3 are due in part to the lower delivered power, resulting in a decrease in the fields too close to the noise floor of the measurement system.
102
Suppl. fig. 1b: Measurement data along a line in the middle of and close to the bottom surface of the tank phantom for the four cases The measured electric (E-) fields for the different positions of the treatment device, normalized to remove the effect of the mismatch, are shown below. The two graphs show the measurement results of the middle and bottom (close to the surface) measurement tracks. It can be observed that there is not much difference between the middle track and the bottom track in the tank when away from the immediate vicinity of the spoon. The measurement along a line at the bottom close to the surface is more sensitive to the device position. The position of the device influences the distribution of power deposition. There is a slight difference caused by the cable of the device and its proximity to the phantom. From the simulation, the influence of the cable has been evaluated with the cable attached to the phantom surface, which increases the coupling; an increase of 0.6 dB in average SAR is observed.
Middle of the tank phantom
Bottom close to the surface of the tank phantom
103
Suppl. fig 1c: Vector network analyzer (VNA) connected to the end of the coaxial cable. Matching of the device plays an important role with respect to power delivery. We have therefore measured the applicator spoon feed impedance and reflection coefficient using a vector network analyzer (VNA) connected wirelessly to the computer. We measured an applicator containing the standard matching network at the device end of the coaxial cable.
104
Suppl. fig. 2: Ethosuximide blocks HCC-specific AM RF EMF inhibition of CSC. a. Huh7 %Cancer Stem Cell population (CD44+CD133+) of SHAM and HCCMF groups cultured in the presence or absence of Ethosuximide (Ethos) (1mM) (N ≥ 3). Anova: F (3,10) = 11.16; p = 0.0016. Post-Hoc Tukey Test: SHAM vs HCCMF p = 0.0015 and SHAM+Ethos vs HCCMF+Ethos p = 0.5537. b. Number of Huh7 tumor spheres (counted 6 days post treatment) of SHAM and HCCMF groups cultured in the presence or absence of Ethosuximide (1mM) (N ≥ 5). Anova: F (3,18) = 39.69; p < 0.0001. Post-Hoc Tukey Test: SHAM vs HCCMF p = 0.0060 and SHAM+Ethos vs HCCMF+Ethos p = 0.0037. c. Hep3B %Cancer Stem Cell (CD44+CD133+) of SHAM and HCCMF groups cultured in the presence or absence of Ethosuximide (N = 4). Anova: F (3,12) = 5.416; p = 0.0137. Post-Hoc Tukey Test: SHAM vs HCCMF p = 0.0212 and SHAM+Ethos vs HCCMF+ Ethos p = 0.5426. d. Number of Hep3B tumor spheres (counted 6 days post treatment) of SHAM and HCCMF cultured in the presence or absence of Ethosuximide (N = 6). Anova: F (3,20) = 9.092; p = 0.0005. Post-Hoc Tukey Test: Sham vs HCCMF p = 0.0007 and SHAM+Ethos vs HCCMF+Ethos p = 0.2005.
105
Suppl. fig. 3a HCC-specific AM RF EMF modulation of the IP3/DAG signaling pathway. Pathway analysis using HepG2 RNA-seq and microRNA arrays identified the IP3/DAG signaling pathway. The brown background highlights the differentially expressed genes and microRNAs. The role of Ca2+ in this pathway is highlighted with yellow square frames.
106
Suppl. fig. 3b Validation of differently expressed IP3/DAG signaling pathway gene and miRNA in HepG2 and Huh7 cells exposed to HCC-specific AM RF EMF. (1st Row) S100b target validation in HepG2 [(Left; N = 8 both group) T-test p-value = 0.0265] and Huh7 [(Right; N = 10 Control / N = 9 HCC group) T-test p-value < 0.0001]. (2nd Row) miRNA-1246 target validation in HepG2 [(Left; N = 14 both groups) T-test p-value = 0.0214] and Huh7 [(Right; N = 15 both groups) T-test p-value = 0.0069]. (3rd Row) hsa-let-7g target validation in HepG2 [(Left; N = 14 Control / N = 15 HCC group) T-test p-value = 0.0462] and Huh7 [(Right; N = 18 both groups) T-test p-value = 0.0059].
107
Suppl. fig. 3c Distribution of calcium in HepG2 cells exposed to HCC specific AM RF EMF. Calcium was more diffusely distributed in the cytoplasm of HepG2 cells exposed to HCC specific AM RF EMF for 3 hours than in control HepG2 cells not exposed to AM RF EMF. (A) Oregon Green 488 BAPTA-AM was used to identify Ca2+ localization with the green fluorescent protein (GFP) channel of the microscope; (B) Overlayed bright field and GFP images to view Ca2+ localization in combination with the entire cell structure. Qualitiative experiment performed once.
108
Suppl. fig. 4a Long-term response in a patient with metastatic hepatocellular carcinoma receiving treatment with HCC specific AM RF EMF. A 79-year-old man was diagnosed with hepatocellular carcinoma in January 2011. He underwent left hepatectomy in February 2011, which revealed the presence of a poorly differentiated hepatocellular carcinoma. The tumors largest diameter was 10 cm and was staged as pT3NxMx. In May 2011, the patient had evidence of disease progression with four new lesions identified within the right lobe of the liver and new mediastinal adenopathy. Treatment with sorafenib was initiated in August 2011 and discontinued in February 2013 because of intolerable side effects. Simultaneous compassionate treatment with the TheraBionic device was administered 3 hours a day from September 2011 until April 2017 when the patient became unable to receive treatment on a regular basis because of hip fracture secondary to a fall, generalized weakness, and worsening renal failure. He passed away in October 2017. The patient had complete response by marker as the level of alpha fetal protein (AFP) decreased from 92,620 international units/ml (IU/ml) on August 12, 2011 prior to treatment initiation to 4.18 IU/ml on January 16, 2011. Following discontinuation of Nexavar in February 2013 the patient’s AFP level remained below 20 IU/ml until May 2014 when it started to rise slowly and was 553 IU/ml in June 2017 prior to admission to the hospital for left femur fracture repair. The AFP level began to rise more rapidly from the time the patient became unable to receive TheraBionic treatment until October 9, 2017, when it reached 2038 IU/ml.
109
Suppl. fig. 4b Key imaging studies of the same patient. Imaging studies obtained prior (upper panel: July 2011) and during (lower panel: December 2011) treatment show partial response as assessed by RECIST criteria.
110
Suppl. Table 1a: Effective treatment powers with the TheraBionic Device.
111
Suppl. Table 1b: Measured return loss for spoon shaped antenna.
112
Suppl. Table 2. Peripheral blood counts of tumour-bearing NOD-SCID mice exposed to HCC-specific AM RF EMF as well as mice not exposed to EMF.
113
CONCLUSION
This dissertation builds on prior scientific discoveries that identified
changes in vascular tone in patients exposed to radiofrequency electromagnetic
fields when modulated at specific frequencies. Exposure of patients with
advanced hepatocellular carcinoma to the same modulation frequencies has
yielded tumor shrinkage and tumor stabilization. Exposure of hepatocellular
carcinoma cells to the same modulation frequencies resulted in in vitro
proliferative inhibition, mitotic spindle disruption, and subtle changes in gene
expression.
First, using mouse models I discovered that hepatocellular carcinoma cells
differentiate into quiescent myofibroblasts during AM RF EMF-mediated tumor
shrinkage. Second, I found that AM RF EMF antiproliferative effects and down-
regulation of cancer stem cells are mediated by Ca2+ influx through Cav3.2 T-
type voltage-gated calcium channel (CACNA1H). Third, I demonstrated that this
mechanism of action is relevant to both hepatitis B virus positive and negative
HCC cells. The findings reported here represent a major milestone in
understanding the therapeutic action of tumor-specific AM RF EMF. The
discovery that Cav3.2 (CACNA1H) VGCC is a key mediator of the anticancer
effect of tumor-specific AM RF EMF exposure may broaden our understanding of
how electromagnetic fields in the kHz to the THz range interact with biological
systems, a known ‘black box’ in the research field of Bioelectromagnetics.
While some research has previously suggested ion channels being
affected by EMF exposure, this is the first report of a specific isoform of a
channel necessary and sufficient for the antiproliferative and stem-cell repressive
114
effects AM RF EMF. This may be a crucial step towards identification of a
potential broad reaching “bio-antenna” for an EMF.
It is my hope that these findings will lead to the establishment of a model
that can be used in identifying the point(s) of demodulation thereby advancing
the field of Bioelectromagnetics in diagnostics and therapeutics and lead to the
discovery of the cascade of events fundamental to the anticancer effect of tumor-
specific AM RF EMF.
115
APPENDICES
APPENDIX a: The role of cell death in hepatocellular carcinoma-specific
amplitude-modulated radiofrequency electromagnetic fields
Experimental design was conceived and analyzed by Boris C. Pasche, Carl F. Blackman, and Hugo Jimenez. Data Generation / Collection was performed by
Hugo Jimenez and Minghui Wang
116
Introduction
Hepatocellular carcinoma (HCC) death rates in the U.S. are increasing
faster than for any other malignancy, having more than doubled in the past
decade.1,2 In the last decade, HCC drug development has seen 4 global phase 3
trials fail (sunitinib, brivanib, linifanib, and erlotinib plus sorafenib), i.e., none of
these agents showed non-inferiority or superiority to sorafenib in terms of overall
survival (OS) as first-line treatment of HCC.3 While sorafenib remains the sole
first-line treatment available for HCC in the U.S. as of March 2018. A recent
study of lenvatinib (LenvimaR), an inhibitor of VEGF receptors 1-3, FGF receptors
1-4, PDGF receptor alpha, RET, and KTT, has shown that this drug is not inferior
to sorafenib. An application was submitted to the FDA in September 2017 and is
currently being reviewed to approve lenvatinib as another first-line therapy for
advanced hepatocellular carcinoma. Additionally, lenvatinib has displayed
significant and meaningful improvement in progression-free survival, time to
progression and objective response rate over sorafenib.3 Yet, despite lenvatinib’s
promising future or the recent approval of additional second-line treatment
modalities (regorafenib and nivolumab), the outcome of patients with advanced
hepatocellular carcinoma remains poor and new therapeutic approaches are
sorely needed.3
While the use of cancer-specific AM RF EMF has shown clinical, in vitro
and in vivo (unpublished) activity, the mechanism of action with regards to
proliferative inhibition is essentially unknown. Therefore, in order to understand
what is occurring, we sought to identify if any cell death mechanisms, such as
117
apoptosis and autophagy, were responsible. The following are the preliminary
results of our investigation into apoptosis.
Results
Results of the Tunel assay, seen in Fig 1, a and b, found no difference
between Huh-7 cells exposed to SHAM, RCF or HCC groups [F (2, 57) = 1.036,
p = 0.3613]. Additionally, the Tunel assay results, seen in Fig 2, a and b, also
found no difference between Hep3B cells exposed to SHAM, RCF or HCC
groups [F (2, 57) = 0.2478, p = 0.7813].
Discussion / future direction
The results of the Tunel assay, in both Huh-7 and Hep3B, show that
apoptosis is not the mechanism responsible for the anti-cancer effect of AM RF
EMF4-6. To confirm these results, we will further investigate at least 2 apoptosis
targets via western blot analysis. Additionally, to compliment and further
understand these findings, we will investigate the potential role of autophagy in
the action of AM RF EMF.
Tumor shrinkage and stable disease has been previously identified in
patients responding to AM RF EMF5,6. Hence, there must be some mechanism
of removal of cancer cells and we must therefore continue to investigate this
novel action as understanding its capabilities can lead to exploiting its potential.
118
Materials and methods
DeadEnd Tunel assay: 20,000 Huh-7 or 30,000 Hep3B cells were
seeded onto 35 mm IBIDI dishes (IBIDI, Cat #: 81156). Cells were placed into
three treatment groups SHAM, RCF or HCC; 4 dishes/group. Cells were treated
for 3 hours daily for seven days in the IT’IS in vitro exposure device. Media was
changed every two days and at the end of seven days the PROMEGA DeadEnd7
Colorimetric Tunel system assay kit (Cat #: G7130) was used for analysis.
Images were taken using the EVOS FL Auto microscope (Life Technologies).
Statistics and graphs were generated with Graphpad Prism. Experiments have
been repeated at least three times.
AM RF EMF exposure in vitro: Treatment of patients with intrabuccally-
administered AM RF (27.12 MHz) EMF results in whole body mean SAR ranging
from 0.2 to 1 mW/kg, with peak spatial SAR over 1g ranging from 150 to 350
mW/kg. Cell lines were exposed to 27.12 MHz radiofrequency electromagnetic
fields, identically amplitude modulated, using exposure systems designed to
replicate in vivo exposure levels. Experiments were conducted at an SAR of 0.03
and 0.4 W/kg. Cells were exposed for three hours daily, seven days in a row.
Cells were exposed to tumor-specific modulation frequencies that were
previously identified in patients with a diagnosis HCC or modulation frequencies
never identified in patients with a diagnosis of cancer (RCF) or no treatment
(SHAM). Experiments were repeated at least twice.
119
References
1 Siegel, R. L., Miller, K. D. & Jemal, A. Cancer statistics, 2017. CA. Cancer
J. Clin. 67, 7-30, doi:10.3322/caac.21387 (2017).
2 Islami, F. et al. Disparities in liver cancer occurrence in the United States
by race/ethnicity and state. CA. Cancer J. Clin. 67, 273-289,
doi:10.3322/caac.21402 (2017).
3 Kudo, M. et al. Lenvatinib versus sorafenib in first-line treatment of
patients with unresectable hepatocellular carcinoma: a randomised phase
3 non-inferiority trial. Lancet, doi:10.1016/S0140-6736(18)30207-1 (2018).
4 Zimmerman, J. W. et al. Cancer cell proliferation is inhibited by specific
modulation frequencies. Br J Cancer 106, 307-313,
doi:https://dx.doi.org/10.5732%2Fcjc.013.10177 (2012).
5 Costa, F. P. et al. Treatment of advanced hepatocellular carcinoma with
very low levels of amplitude-modulated electromagnetic fields. Br J
Cancer 105, 640-648 (2011).
6 Barbault, A. et al. Amplitude-modulated electromagnetic fields for the
treatment of cancer: discovery of tumor-specific frequencies and
assessment of a novel therapeutic approach. Journal of experimental &
clinical cancer research : CR 28, 51, doi:10.1186/1756-9966-28-51 (2009).
7 Jackson, S., Ghali, L., Harwood, C. & Storey, A. Reduced apoptotic levels
in squamous but not basal cell carcinomas correlates with detection of
cutaneous human papillomavirus. Br J Cancer 87, 319-323,
doi:10.1038/sj.bjc.6600431 (2002).
120
Figure, tables and legends
Figure 1. TUNEL ASSAY OF THE Huh-7 cell line. a. Positive staining cells of Tunel assay (N = 4/group). b. Representative images of Huh-7 cells exposed to SHAM, RCF or HCC-specific frequencies for three hours daily for seven days. No statistical difference was found. a.
b.
121
Figure 2. TUNEL ASSAY OF THE Hep3B cell line. a. Positive staining cells of Tunel assay (N = 4/group). b. Representative images of Hep3B cells exposed to SHAM, RCF or HCC-specific frequencies for three hours daily for seven days. No statistical difference was found. a.
b.
122
APPENDIX b: Ambient electromagnetic fields do not affect AM RF EMF
antiproliferative effects
Experimental design was conceived and analyzed by Hugo Jimenez and Carl F.
Blackman. Data Generation / Collection was performed by Hugo Jimenez
123
Introduction
The impact of ambient electromagnetic fields in the research environment
has been of interest and concern as a potential confounder for researchers in the
field of bioelectromagnetics. For example, low-frequency, time-varying electric
and magnetic fields were reported by Wilson et al. to depress secretion of
melatonin into the blood stream.1 Additionally, it has been shown and
independently confirmed, that melatonin treatment of MCF-7 cells can result in
growth inhibition in a 0.2uT field but lead to enhanced cell growth in a 1.2uT
field.2 In 1997, Harland and Liburdy reported the first experimental evidence that
environmental-level magnetic fields can modify drug interaction with human
breast cancer cells, i.e., 1.2uT; 60Hz magnetic field exposure blocked the growth
inhibitory effect of Tamoxifen in MCF-7 cells.3 Moreover, in 2005 Trillo et al.
reported that the peak “no growth” response function of neurite outgrowth of PC-
12 cells was altered when the cells were grown in the magnetic fields (MF) of a
standard cell-culture incubator (Forma #3158) as compared to peak “no growth’
response in the absence of MF, which was achieved by Mu metal shielding.4
Hence, the authors determined that the magnetic fields present in some
manufacturer’s incubators during normal operation can alter cell responses to
intentionally imposed magnetic fields and that a Mu-metal chamber can be
satisfactorily placed inside an incubator to shield the unwanted, incubator-
generated ambient EMFs.
To determine the potential impact of these “incubator ambient”
electromagnetic fields on HCC-specific AM RF EMF’s anti-cancer effect, we
minimized the exposure using a similar experimental design.3-5 We used a MU
124
METAL box, ventilated to minimize EMF leakage to the inside. The box was
housed inside a standard cell-culture incubator, to virtually remove all ambient
fields5. The sole item inserted into the box was the antenna emitting HCC-
specific AM RF EMF to expose the cells. The results would determine if
incubator-generated ambient electromagnetic fields, plays any role in the anti-
cancer effects of HCC-specific AM RF EMF exposure.
Results
Results of the tritiated thymidine incorporation assay demonstrated that
the antiproliferative effects of cancer-specific AM RF EMF were not altered by the
MU METAL chamber, i.e., a virtual absence of ambient EMF. Specficially, HCC-
specific AM RF EMF inhibited proliferation of Huh-7 when the cells were in the
Mu Metal box; SHAM vs HCC p = 0.0032 and Random Chosen Frequencies
(RCF) vs HCC p = 0.0272 as identified by Post-Hoc Tukey Test (Figure 1).
Proliferation of the RCF treated group did not show any difference when
compared to SHAM; Sham vs RCF p = 0.6854 as identified by Post-Hoc Tukey
Test. Anova: F(2, 29) = 7.286; p = 0.0027 (Figure 1).
Discussion / future direction
This data shows that ambient EMFs do not influence the anti-proliferative
effect observed when cells are exposed to cancer-specific AM RF EMF.
Moreover, the HCC-specific AM RF EMF treated group was the only group to
experience proliferative inhibition which is the expected trend as previously
identified.6 These data taken together indicate that the anti-proliferative effect is
due to cancer-specific AM RF EMF treatment only and not related to the ambient
125
fields of the environment. Moreover, these data are vitally important for future
researchers who will attempt to replicate our results.
Materials and methods
[3H ] thymidine incorporation assay: Growth inhibition (GI) was
assessed in Huh-7 cells exposed to HCC-specific modulation frequencies as
previously described6. Briefly, cells were treated with the frequencies for 7 days,
3 hours every day. At day 7, cells were washed, [3H] thymidine (Amersham) was
added, and cells were incubated for 4 hrs. After 4 hrs incubation, cells were
washed with ice-cold PBS for 5 minutes then lysed with 800uL of 0.2 N NaOH.
[3H] thymidine incorporation was measured using a Beckman Coulter scintillation
counter. Statistics and graphs were generated with Graphpad Prism.
Experiments have been repeated twice. The Mu Metal box was provided by Carl
F. Blackman, PhD.
AM RF EMF exposure in vitro: Cell lines were exposed to 27.12 MHz
radiofrequency electromagnetic fields at an SAR of 0.03 W/kg. Cells were
exposed for three hours daily, seven days in a row. Cells were exposed to tumor-
specific amplitude modulation frequencies that were previously identified in
patients with a diagnosis HCC or modulation frequencies never identified in
patients with a diagnosis of cancer. Experiments were repeated twice.
Mu Metal Box: Magnetic shield box with door, 16’H x 16”W x 16”D, made
from 0.050 Co-Netic AA alloy, using Full Butt seam weld, top and bottom each
have 4 holes with cylinders (1” dia x 1”long) welded to outside, and annealed
after fabrication. See image below for design schematics; built for Carl F.
Blackman, Ph.D. by Magnetic Shield Corporation, Bensenville, IL.
126
127
References
1 Wilson, B. W., Anderson, L. E., Hilton, D. I. & Phillips, R. D. Chronic
exposure to 60‐Hz electric fields: Effects on pineal function in the rat.
Bioelectromagnetics 2, 371-380, doi:10.1002/bem.2250020408 (1981).
2 Liburdy, R. P., Blackman, C. F. & Luben, R. A. in Electricity and
Magnetism in Biology and Medicine (ed Ferdinando Bersani) 59-62 (Springer
US, 1999).
3 Harland, J. D. & Liburdy, R. P. Environmental magnetic fields inhibit the
antiproliferative action of tamoxifen and melatonin in a human breast cancer cell
line. Bioelectromagnetics 18, 555-562 (1997).
4 Trillo, M. A., Ubeda, A., Benane, S. G., House, D. E. & Blackman, C. F. in
Bioelectromagnetics Society and the European BioElectromagnetic Association.
(National Health and Enviromental Effects Research Laboratory2005).
5 Ishido, M., Nitta, H. & Kabuto, M. Magnetic fields (MF) of 50 Hz at 1.2
microT as well as 100 microT cause uncoupling of inhibitory pathways of
adenylyl cyclase mediated by melatonin 1a receptor in MF-sensitive MCF-7 cells.
Carcinogenesis 22, 1043-1048 (2001).
6 Zimmerman, J. W. et al. Cancer cell proliferation is inhibited by specific
modulation frequencies. Br J Cancer 106, 307-313,
doi:https://dx.doi.org/10.5732%2Fcjc.013.10177 (2012).
128
Figures, tables, and legends
Figure 1. Representative figure of tritiated thymidine Incorporation assay of the Huh-7 cell line. CPM count of SHAM (N=10), RCF (N=10) and HCC (N=12). Anova: F (2, 29) = 7.286; p = 0.0027. SHAM vs RCF p = 0.6854, SHAM vs HCC p = 0.0032, RCF vs HCC p = 0.0272
129
APPENDIX c: MMTV.HER2 / NEU spontaneous mouse model of breast
cancer exposed to breast cancer-specific amplitude modulated
radiofrequency electromagnetic fields
Experimental design was conceived and analyzed by Boris C. Pasche, Carl F.
Blackman, Hugo Jimenez and Minghui Wang. Data Generation / Collection was performed by Hugo Jimenez and Minghui Wang
130
Introduction
In 2012, Zimmerman et al. showed that AM RF EMF exposure blocked the
proliferation of the MCF-7 [ER+, PR+, and ERBB2-] breast cancer cell line.1 To
build off these results we sought to identify a mouse model that could be
representative of the in vitro and clinical response to breast cancer-specific AM
RF EMF exposure.2 In our preliminary unpublished data we found that MMTV-
PYMT mice (Jackson labs) bearing spontaneous tumors did not respond to
breast cancer-specific AM RF EMF. More specifically, we did not observe any
significant difference in percent tumor mass, treatment time to euthanasia, or rate
of weight increase (data not shown) between mice exposed to breast cancer-
specific AM RF EMF and control mice, which were not exposed to AM RF EMF.
In continuing to identify a mouse model, we chose to use the MMTV.Her2/Neu
mouse model from Jackson labs.
In this current pilot study we found that two of seven MMTV.Her2/Neu mice
(Jackson Labs), exposed to breast cancer-specific AM RF EMF, had an objective
response of either partial response (PR) or stable disease (SD) as identified by
revised RECIST criteria3.
Results
16 mice female mice were allocated for the experiment. One mouse was
used as a no treatment control, 7 mice did not develop any tumor, 1 mouse was
found dead and 8 mice had palpable tumor(s) available for measurement. Seven
of the 8 mice with palpable tumor were exposed to Breast cancer-specific AM RF
EMF for 3 to 8 weeks (Figure 1). M07 was found to have approximately 70%
tumor shrinkage over the course of 5 weeks of AM RF EMF before being
131
sacrificed. M06 experienced stable disease for six weeks before experiencing
progressive disease (PD) (Figure 1). The control mouse, receiving no exposure,
and 5 of the mice in the treatment group displayed PD of either a near doubling
of tumor volume or greater in just 2 weeks (Figure 1).3
Discussion / future direction
The positive results of this pilot study show that it is feasible to use the
spontaneous MMTV.HER2/NEU mouse as a model for experiments to study
breast cancer. Even with only two of seven mice showing an objective response
to breast cancer-specific AM RF EMF the preliminary data has shown success.
Next, we will continue by characterizing the response of this mouse model, i.e.,
the frequency of response to breast cancer-specific AM RF EMF, difference in
tumor mass, time to progression during treatment, etc. Additionally, the
MMTV.Her2/Neu model has a competent immune system that can provide us
with an understanding of how or if the immune system is modulated by breast
cancer-specific AM RF EMF. Lastly, we will be able to combine breast cancer-
specific AM RF EMF with current standard-of-care (SOC) treatment to identify if
an improved outcome vs SOC alone may be possible.
132
Materials and methods
Animal experiments: tumor measurements were taken three times a
week using calipers to find length and width. FVB/N-Tg(MMTVneu)202Mul/J
mice were obtained from Jackson Labs, Cat No: 002376.
AM RF EMF exposure: All mice were exposed to 27.12 MHz amplitude-
modulated radiofrequency electromagnetic fields using exposure systems
designed to replicate the clinical exposure setting. Experiments were conducted
at an SAR of 0.4 W/kg. Mice were exposed for three hours daily for the duration
of the experiment once palpable tumors were present.
Revised RECIST Response Criteria (v1.1): Complete Response (CR):
Disappearance of all target lesions. Any pathological lymph nodes (whether
target or non-target) must have reduction in short axis to <10 mm. Partial
Response (PR): At least a 30% decrease in the sum of diameters of target
lesions, taking as reference the baseline sum diameters. Progressive Disease
(PD): At least a 20% increase in the sum of diameters of target lesions, taking as
reference the smallest sum on study (this includes the baseline sum if that is the
smallest on study). In addition to the relative increase of 20%, the sum must also
demonstrate an absolute increase of at least 5 mm. (Note: the appearance of
one or more new lesions is also considered progression). Stable Disease (SD):
Neither sufficient shrinkage to qualify for PR nor sufficient increase to qualify for
PD, taking as reference the smallest sum diameters while on study.3
133
References
1 Zimmerman, J. W. et al. Cancer cell proliferation is inhibited by specific
modulation frequencies. Br J Cancer 106, 307-313,
doi:https://dx.doi.org/10.5732%2Fcjc.013.10177 (2012).
2 Barbault, A. et al. Amplitude-modulated electromagnetic fields for the
treatment of cancer: discovery of tumor-specific frequencies and assessment of a
novel therapeutic approach. Journal of experimental & clinical cancer research :
CR 28, 51, doi:10.1186/1756-9966-28-51 (2009).
3 Eisenhauer, E. A. et al. New response evaluation criteria in solid tumours:
revised RECIST guideline (version 1.1). European Journal of Cancer 45, 228-247
(2009).
134
Figures, tables and legends
Figure 1. MMTV-HER2 spontaneous mouse model of breast cancer tumor growth curve.
135
APPENDIX d: Glioblastoma-specific amplitude modulated radiofrequency
electromagnetic fields
Experimental design was conceived and analyzed by Boris C. Pasche, Carl F. Blackman, and Hugo Jimenez. Data Generation / Collection performed by Hugo Jimenez, Sambad Sharma, and Denise Gibo. RNA-seq analysis was performed by Liang Liu & Kyle Matsuo. Imaging studies were interpreted by Annette Johnson M.D.
136
Introduction
Glioblastoma (GBM) remains one of the most difficult cancers to manage
and is the most common primary tumor of the brain. It is estimated that more
than 16,000 individuals died of brain tumors in the US in 2016.1 Only two new
treatment approaches have led to improved survival in the past decades: 1)
addition of temozolomide to radiotherapy for newly diagnosed GBM has
increased the median survival by 2.5 month2, 2) addition of alternating electric
fields (Tumor Treating Fields) delivered by the Optune® device has further
extended survival by 4.9 months, results in a five year survival rate of 13%
compared to 5% for the control arm3 and did not have any negative impact on
health-related quality of life.4
Barbault and Pasche have developed a novel treatment approach for
cancer based on delivery of low and safe levels of 27.12 MHz radiofrequency
(RF) electromagnetic fields (EMF), which are amplitude-modulated (AM) at
tumor-specific frequencies.5-7 Treatment is administered at home daily with a
portable device for three hours based on published dose response experiments.6
The TheraBionic® device is connected to a spoon-shaped antenna, which is
placed on the anterior part of the patient’s tongue and results in AM RF EMF
delivery to the whole body, from the head to the extremities as the body becomes
an extension of the antenna. While there are some similarities between the
TheraBionic® and the Optune® devices, e.g. both result in disruption of the mitotic
spindle,6,8 there are also notable differences: 1) TheraBionic® is a systemic
treatment as the whole body becomes an extension of the antenna; Optune® is a
localized treatment restricted to the body areas on which electrodes are placed,
137
2) TheraBionic® delivers 27.12 MHz radiofrequency electromagnetic fields, which
are amplitude-modulated at multiple tumor-specific frequencies ranging from 1
Hz to 100 kHz and results in electric fields of less than 35 V/m applied three
hours per day;6 Optune® delivers electric fields of 100-200 V/m modulated at a
single frequency ranging from 100-300 kHz applied 18 hours per day.6
Treatment with tumor-specific AM RF EMF as a monotherapy has been
shown to yield both complete and partial responses in patients with advanced
hepatocellular carcinoma treated with hepatocellular carcinoma-specific
modulation frequencies and in patient with stage IV breast cancer treated with
breast-cancer specific modulation frequencies. Objective tumor shrinkage has
been documented in the liver, bone, and adrenal gland thus demonstrating
systemic antitumor effects.5,9 No side effects other than grade 1 fatigue and
grade 1 mucositis have been reported in two clinical trials that included 69
patients, even after more than seven years of continuous daily treatment.5,9,10
This work aims to study the mechanism(s) underlying anti-tumor action in
vitro and, in vivo, with a GBM mouse model using systems that faithfully replicate
the levels of exposure delivered by the TheraBionic® device in patients.6,11
Treatment with AM RF EMF is emerging as a low risk novel approach for the
treatment of cancer. These results suggest the existence of a molecular
mechanism capable of mediating the antitumor effects of tumor-specific
frequencies, a major new concept in cancer medicine. These findings provide
support for the pioneering idea that systemic administration of AM RF EMF by
138
means of buccal delivery is a precision medicine approach based on tumor-
specific frequencies.
Results
The GBM cell line U-251, as well as two low passage GBM explant cells
(BTCOE-4536 and BTCOE-4795), which were developed by the Wake Forest
Brain Tumor Center of Excellence (BTCOE), were exposed to 27.12 MHz RF
EMF amplitude-modulated at GBM-specific frequencies using exposure systems
designed to replicate treatment at human exposure levels, i.e. at a Specific
Absorption Rate of 0.03 and 0.40 W/kg. Cells were exposed daily for 3 hours for
a total of 7 days for all experiments. As shown in Fig. 1, the proliferation of U-
251, BTCOE 4795 and BTCOE 4536 cell lines was decreased by 19% (N = 10; p
= 0.0018), 14.5% (N = 10; p = 0.0431) and 23% (N = 4; p = 0.0348) following
exposure to GBM-specific AM RF EMF.
To further investigate the decrease in proliferative inhibition, we assessed
the impact on stem-like cells and found that the tumor sphere-forming ability of
the U-251 and BTCOE-4795 cell lines was inhibited by 48.0% (N = 6; p = 0.0040)
and 31.7% (N = 6; p = 0.0002) following exposure to GBM-specific AM RF EMF
(Fig. 2). These results are indicative that the glioma stem-like cells may be even
more sensitive to AM RF EMF than more differentiated ones
To begin to comprehensively investigate the mechanism of action of GBM
specific AM RF EMF in GBM cells we performed RNA-seq of GBM U-251 cells.
RNA-seq data analysis identified the Mitotic Roles of Polo-Like Kinase pathway
as the prime target of GBM-specific AM RF EMF (Fig. 3). Polo-Like
139
kinases (PLKs) are regulatory serine/threonine kinases of the cell cycle involved
in mitotic entry, mitotic exit, spindle formation, cytokinesis, and meiosis.13
Five of the differentially-expressed genes of this canonical pathway were
validated by qRT-PCR: Abnormal Spindle Microtubule Assemble (ASPM), Polo-
Like Kinase 1 & 4 (PLK1 & PLK4), Centrosomal Protein 152 (CEP 152) and
Cyclin B1 (CCNB1) which had an increase in fold change of 1.69, 1.89, 1.61,
1.18 and 1.72 respectively, as identified by RNA-seq (Table 1). qRT-PCR
validation of the target genes confirmed highly significant RNA-seq differential
expression: ASPM, 429% increased expression (N = 18; p = 4.809x10-04), PLK1,
965% increased expression (N = 18; p = 2.932x10-06), PLK4, 997% increased
expression (N = 15; p = 2.343x10-17), CEP152, 276% increased expression (N =
18; p = 1.790x10-5) and Cyclin B1, 1916% increased expression (N = 18; p =
1.004x10-08) (Fig 4).
Given the previously observed disruption of the mitotic spindle in
hepatocellular carcinoma cells upon exposure to HCC specific AM RF EMF6 and
the impact of ASPM, PLK1 and PLK4 on mitotic spindle formation, we
hypothesized that GBM-specific AM RF EMF might disrupt the mitotic spindle of
GBM cells. Mitotic spindles were identified as either proceeding normally,
questionably or abnormally in U-251 cells and were assessed blindly by two
investigators. As shown in Fig. 5, GBM-specific AM RF EMF exposure resulted in
disruption of the mitotic spindle of U-251 cells. Thus, we demonstrate for the first
time the effect of AM RF EMF on the mitotic processes in GBM cells.
140
Preliminary in vivo data shows there was a statistically significant
decrease in intensity for the EMF treated group (p = 0.04) at day 4. There was
no change in the SHAM group (p = 0.16). Both SHAM (N = 17) and EMF (N =
17) groups had identical levels of intensity at baseline (p = 0.84) but the EMF
group was significantly lower at day 4 (p = 0.03). (Fig 6.)
The family of a female patient residing in Italy with recurrent GBM
requested compassionate use of the TheraBionic® device. Briefly, the patient
was a 38-year-old woman who was diagnosed with gliosarcoma with
components of glioblastoma in April 2014. She underwent resection of the tumor
and received treatment with radiation therapy and temozolomide. She was
subsequently treated with nivolumab, then bevacizumab and fotemustine. She
was also on a ketogenic diet. As seen in Fig. 7, the patient had progression of
disease prior to initiation of treatment with GBM-specific AM RF EMF.
Treatment with the TheraBionic device programmed to administer GBM-specific
frequencies was initiated on July 4, 2016. At the follow up visit on August 5 the
patient’s spouse reported improvement in word recognition. He also reported that
the patient was able to dance at a party, a significant functional improvement.
However, she complained of persistent left upper and lower extremity weakness.
As shown on Fig. 8, the scan taken on the 8th of August, 2016 demonstrated a
decreased intensity and amount of enhancement as compared with the initial
scan taken the 20th of June, 2016.
The left temporal enhancing mass demonstrates a much less solid
enhancement pattern over a somewhat larger area and is difficult to measure.
141
The left parietal enhancing mass has increased in size but shows much more
heterogeneous pattern of more ill-defined enhancement. The findings are
suggestive of treatment effect rather than tumor progression. Treatment was
stopped after three months because of intracranial bleeding felt to be unrelated
to the AM RF EMF treatment. The patient expired the 22nd of November, 2016.
Discussion / future direction
We have shown that AM RF EMF significantly suppress the growth of
three different GBM cell lines. We also found that AM RF EMF disrupts the
mitotic spindle of U-251 GBM cells and blocks the growth of GSCs. The net
result is a decrease in cell proliferation and potentially suppression of self-
renewal of GSC. Our preliminary data also shows that that treatment with GBM-
specific AM RF EMF may yield clinical response in patients with recurrent GBM.
Despite the promising data the exact mechanism underlying this growth
suppression is not fully understood. We currently postulate that AM RF EMF
block the growth of GBM cells by modulation of the Polo-Like kinase pathway as
several key genes of the pathway are differentially expressed following exposure
to GBM-specific AM RF EMF, specifically, CEP-152 and PLK-4. Moreover, the
modulation of the Polo-Like Kinase pathway is directly linked to disruption of the
mitotic spindle of GBM cells following AM RF EMF exposure.
To further examine this hypothesis, we examined the structural biology of
centrioles and their biogenesis. CEP-152 and PLK-4 are vitally important to the
genesis of centrioles where CEP-152 recruitment, leads to PLK-4 scaffold
switching and the repositioning of PLK-4, leading to the completion of the
daughter centriole in the G1 phase of mitosis. Based off our RNA-seq data
142
(Table 1) and the noted increase in mitotic spindle disruption (Fig 5.), the
overexpression of CEP152 and PLK-4, or potentially the suppression of the
degradation of PLK-4, can lead to an increase in the number of centrioles and
hence each mother centriole will be able to nucleate more than one daughter
centriole at a time leading to disruption of the mitotic mechanism (Figure 9).14,15
Moreover, published data has shown that modulation to PLK-4 expression can
cause distress in mitotic fidelity.16-19 While our data has shown that mitotic
spindle disruption is indeed occurring in the U-251 cell line, we have yet to show
this trend in the two BTCOE cell lines and that this is also the causative agent for
inhibition of GSC.
Our future directions include, mitotic spindle microscopy of BTCOE cell
lines, completion of the U251 mouse model, expanding our understanding of the
genomic signatures by examining the two BTCOE cell lines via RNA-seq and
other possible genomic strategies (microRNA-seq, copy number variation, etc…)
and identifying the potential role of Ca2+ in GBM-specific AM RF EMF as we have
previously identified the T-type voltage gated calcium channel as a necessary
mediator of HCC-specific AM RF EMF (unpublished data). Successful completion
of these future directions may provide novel actionable pathways and targets in
GBM.
143
Materials and methods
[3H ] thymidine incorporation assay: Growth inhibition (GI) was
assessed in Huh-7 cells exposed to HCC-specific modulation frequencies as
previously described6. Briefly, cells were treated with the frequencies for 7 days,
3 hours every day. At day 7, cells were washed, [3H]thymidine (Amersham) was
added, and cells were incubated for 4 hrs. After 4 hrs incubation, cells were
washed with ice-cold PBS for 5 minutes then lysed with 800uL of 0.2 N NaOH.
[3H ] thymidine incorporation was measured using a Beckman Coulter
scintillation counter. Statistics and graphs were generated with Graphpad Prism.
AM RF EMF exposure in vitro: Treatment of patients with intrabuccally-
administered AM RF EMF results in whole body mean SAR ranging from 0.2 to 1
mW/kg, with peak spatial SAR over 1g ranging from 150 to 350 mW/kg. Cell lines
were exposed to 27.12 MHz radiofrequency electromagnetic fields using
exposure systems designed to replicate in vivo exposure levels. Experiments
were conducted at an SAR of 0.03 and 0.4 W/kg. Cells were exposed for three
hours daily, seven days in a row. Cells were exposed to tumor-specific
modulation frequencies that were previously identified in patients with a
diagnosis GBM or no treatment (SHAM).
Sphere-forming assay: Cells were plated (200 cells/well) in 96-well ultra-
low attachment plates (Corning) with DMEM/F12 supplemented with 2% B27
(Invitrogen), 20 ng/ml EGF (Sigma Aldrich), and 4 μg/ml insulin (Sigma-Aldrich).
The number of spheres was counted at day 7, and data were represented as the
means ± SEM.
144
Cell lines: U-251, BTCOE 4536, and BTCOE-4795 cell lines were
provided by the Debinski Laboratory and the Brain Tumor Center of Excellence.
Firefly Luciferase transfection: Bioluminescence Reporter (EF1a-
Luciferase (firefly)-2A-RFP (bsd)) luciferase tagging kit was from GenTarget Inc.
catalog number (LVP439). Blasticidin (25ug/mL-U251 cells) used as the antibiotic
selecting agent.
In Vivo: All mouse procedures were approved by Wake Forest
Institutional Animal Care and Use Committee. Intracranial injections: animals
were anesthetized with an i.p. injection of a mixture of ketamine (50-75 mg/kg
body weight), and xylazine (5-7.5 mg/kg). Hair on the mouse will be remove
using clippers followed by shaving with a razor. Mice were positioned into a Kopf
stereotactic frame. With the mouse secured in the frame we swabbed the
forehead (between eyes back to ears) with betadine via sterilized cotton swab,
and then used a scalpel to make a 5-6 mm caudal-rostral incision slightly to the
right of midline while stretching skin with thumb and forefinger while avoiding the
prefrontal sinus. We then used the wood end of cotton swab to scrape away
fascial tissues covering the skull, and dry the skull well with the cotton end to
help locate midline and coronal sutures. With the mouse secured and
anesthetized we drilled a 0.45mm Burr hole placed 1.5-2 mm to the right of the
midline suture and 1mm anterior to the coronal suture, and 5uL of cell
suspension was injected 2.5mm deep in the right cerebral hemisphere at a rate
of 1 uL/min. A sterile 25 gauge needle was attached to the syringe. One minute
after injection was completed and needle removed we applied a small amount of
145
bone wax to occlude the hole. After occlusion of the burr hole the tissue was
sutured together. Mice that failed to recover or that died within the first 24hrs
were deemed surgical/anesthesia failures and were necropsied to determine
whether inoculum placement was correctly performed. Animals that became
moribund were euthanized and necropsied.
Bioluminescence imaging: Caliper IVIS1100 Imaging system was used
for bioluminescent imaging (BLI) and tracking of intracranial tumors and cell
lines. This instrument is part of the Cell and Viral Vector Laboratory (CVVL)
shared resource at Wake Forest Baptist Medical Center.
Confocal laser scanning microscopy of mitotic spindles: Cells
undergoing mitosis were imaged using an Olympus FV1200 SPECTRAL Laser
scanning confocal microscope with an Olympus IX83 inverted platform (Olympus,
Tokyo, Japan). For imaging experiments, U251 cells were grown in sterile 35mm
optical glass bottom cell culture dishes (ibidi μ-Dish, Cat#81156, ibidi USA, Inc.,
Fitchburg, WI). U251 cells were initially plated at a concentration of 5,000 cells
per mL in 3mL of media. Once the cells were given 8-18 hours to attach to the
cover glass, they were exposed to RF EMF exposure 3 hours a day for 7
consecutive days. Following RF EMF exposure, indirect immunofluorescent
microscopy was used to compare the cells receiving GBM-specific modulation
frequencies with cells not receiving any exposure (Aurora A/AIK (1G4) Rabbit
mAb #4718, Cell Signaling Technology Inc., Danvers, MA; Goat anti-Rabbit IgG
(H+L) Cross-Adsorbed Secondary Antibody, Alexa Fluor 594, A-11012,
146
ThermoFisher Scientific, Waltham, MA; SlowFade® Diamond Antifade Mountant
with DAPI, Catalog# S36964, ThermoFisher Scientific, Waltham, MA).
Gene expression analysis: RNA extraction from cells was performed
using RNeasy Mini Kit (QIAGEN). qRT-PCR was performed using a Roche
LightCycler II and 1-Step Brilliant II SYBR Green qRT-PCR master mix kit
(Agilent Technologies). Data for qRT-PCR were expressed as mean ± SEM, and
statistical differences between groups were calculated by a 2-tailed Student t-
test.
The Cancer Genomics Shared Resource: RNA-sequencing: Was
performed by the Cancer Genomics Shared Resource Core. RNA was purified
from cells using the miRNA mini kit from Qiagen. RNA integrity (RIN) was
determined by electrophoretic tracing using an Agilent Bioanalyzer. RNA-seq
libraries were constructed for samples (RIN >8.0) using the Illumina TruSeq
Stranded Total RNA kit with Ribo-Zero rRNA depletion. Indexed libraries were
sequenced using an Illumina NextSeq 500 DNA sequencer programmed for
150x150 nt paired end reads, generating >50 million reads per sample with
>75% of sequences achieving >Q30 Phred quality score. This sequencing depth
and quality are optimal for analysis of differentially expressed genes (DEGs) and
allele-specific gene expression, and read lengths are sufficient to detect splice
variations, gene fusions, and long noncoding RNAs (lncRNAs). RNA-seq Data
Analysis: Read alignment was performed using the STAR sequence aligner, and
gene counts determined using featureCounts software. Differential gene
expression will be analyzed using DESeq2 software. Six replicates per
147
experimental condition were performed, and all experimental conditions prepared
in the same experiment, to have sufficient power to detect DEGs at each time
point using DESeq2.25 Significant DEGs will be conservatively defined as p<0.05
after adjustment for false discovery. DEGs will be analyzed for significant
enrichment of biological pathways and signaling networks using Ingenuity
Pathway Analysis (IPA), Causal Network Analysis and Upstream Regulator
Tools, and DAVID software. The Cancer Genomics Shared Resource services
are supported by the Comprehensive Cancer Center of Wake Forest Baptist
Medical Center, NCI CCSG P30CA012197 grant.
PCR Primers and Machine protocol:
ASPM-Forward primer: 5’ GAG AGA GAG AAA GCT GCA AGA A 3’
ASPM-Reverse primer: 5’ GAA TGA CGA GTG CTG CAT TAA C 3’
CEP 152-Forward primer: 5’ CAG CAG CTC TTT GAG GCT TAT 3’
CEP 152-Reverse primer: 5’ CAC AGC AGT CAC CTC CTT ATT C 3’
CYCLIN B1-Forward primer: 5’ GAT GCA GAA GAT GGA GCT GAT 3’
CYCLIN B1-Reverse primer: 5’ TCC CGA CCC AGT AGG TAT TT 3’
PLK 1-Forward primer: 5’ CAG CAA GTG GGT GGA CTA TT 3’
PLK 1-Reverse primer: 5’ GTA GAG GAT GAG GCG TGT TG 3’
PLK 4-Forward primer: 5’ TCA AGC ACT CTC CAA TCA TCT T 3’
PLK 4-Reverse primer: 5’ CAA ACC ACT GTT GTA CGG TTT C 3’
GAPDH-Forward primer: 5’ TGC ACC ACC AAC TGC TTA GC 3’
GAPDH-Reverse primer: 5’ GGC ATG GAC TGT GGT CAT GAG 3’
148
Protocol: 1 cycle for 30 min at 50C, 1 cycle for 10 min at 95C, 40 x (30 sec
at 95C / 1 minute at 60C), Rest at 4C
GBM Patient information: 38 year-old woman with IDH1 and IDH2 wt,
EGFRvIII negative recurrent GBM s/p temozolomide, radiation therapy, ketogenic
diet, nivolumab, bevacizumab, and fotemustine. The patient had progression of
disease prior to initiation of treatment with GBM-specific AM RF EMF. Baseline
imaging occurred March 2016 and progression of disease was noted June 2016.
Patient began compassionate treatment July 4th, 2016.
149
References
1 Siegel, R. L., Miller, K. D. & Jemal, A. Cancer statistics, 2016. CA. Cancer
J. Clin. 66, 7-30, doi:10.3322/caac.21332 (2016).
2 Stupp, R. et al. Radiotherapy plus Concomitant and Adjuvant
Temozolomide for Glioblastoma. The New England Journal of Medicine 352,
987-996 (2005).
3 Stupp, R., Taillibert, S., Kanner, A. A. & et al. Maintenance therapy with
tumor-treating fields plus temozolomide vs temozolomide alone for glioblastoma:
A randomized clinical trial. JAMA 314, 2535-2543, doi:10.1001/jama.2015.16669
(2015).
4 Gourd, E. Tumour-treating fields complement glioblastoma treatment. The
Lancet Oncology, doi:10.1016/S1470-2045(18)30088-3.
5 Barbault, A. et al. Amplitude-modulated electromagnetic fields for the
treatment of cancer: discovery of tumor-specific frequencies and assessment of a
novel therapeutic approach. Journal of experimental & clinical cancer research :
CR 28, 51, doi:10.1186/1756-9966-28-51 (2009).
6 Zimmerman, J. W. et al. Cancer cell proliferation is inhibited by specific
modulation frequencies. Br J Cancer 106, 307-313,
doi:https://dx.doi.org/10.5732%2Fcjc.013.10177 (2012).
7 Pasche, B. et al. in Bioelectromagnetic and Subtle Energy Medicine (ed
P.J. Rosch) Ch. 27, 299-305 (CRC Press, 2015).
8 Kirson, E. D. et al. Disruption of Cancer Cell Replication by Alternating
Electric Fields. Cancer Research 64, 3288-3295 (2004).
150
9 Costa, F. P. et al. Treatment of advanced hepatocellular carcinoma with
very low levels of amplitude-modulated electromagnetic fields. Br J Cancer 105,
640-648 (2011).
10 Zimmerman, J. W. et al. Targeted treatment of cancer with radiofrequency
electromagnetic fields amplitude-modulated at tumor-specific frequencies.
Chinese journal of cancer 32, 573-581,
doi:https://dx.doi.org/10.5732%2Fcjc.013.10177 (2013).
11 Capstick, M., Gong, Y., Pasche, B. & Kuster, N. An HF exposure system
for mice with improved efficiency. Bioelectromagnetics 37, 223-233,
doi:10.1002/bem.21969 (2016).
12 IEEE. IEEE Standards for Safety Levels with Respect to Human Exposure
to Radio Frequency Electromagnetic Fields, 3 kHz to 300 GHz, IEEE C95.1-
2005. (Institute of Electrical and Electronics Engineers, New York, 2006).
13 Barr, F. A., Sillje, H. H. W. & Nigg, E. A. Polo-like kinases and the
orchestration of cell division. Nat Rev Mol Cell Biol 5, 429-441 (2004).
14 Park, S.-Y. et al. Molecular basis for unidirectional scaffold switching of
human Plk4 in centriole biogenesis. Nature Structural &Amp; Molecular Biology
21, 696, doi:10.1038/nsmb.2846
https://www.nature.com/articles/nsmb.2846#supplementary-information (2014).
15 Bettencourt-Dias, M., Hildebrandt, F., Pellman, D., Woods, G. & Godinho,
S. A. Centrosomes and cilia in human disease. Trends in Genetics 27, 307-315,
doi:https://doi.org/10.1016/j.tig.2011.05.004 (2011).
151
16 Swallow, C. J., Ko, M. A., Siddiqui, N. U., Hudson, J. W. & Dennis, J. W.
Sak/Plk4 and mitotic fidelity. Oncogene 24, 306, doi:10.1038/sj.onc.1208275
(2005).
17 Kleylein-Sohn, J. et al. Plk4-Induced Centriole Biogenesis in Human Cells.
Developmental cell 13, 190-202, doi:https://doi.org/10.1016/j.devcel.2007.07.002
(2007).
18 Habedanck, R., Stierhof, Y.-D., Wilkinson, C. J. & Nigg, E. A. The Polo
kinase Plk4 functions in centriole duplication. Nature Cell Biology 7, 1140,
doi:10.1038/ncb1320 https://www.nature.com/articles/ncb1320#supplementary-
information (2005).
19 Ko, M. A. et al. PLK4 haploinsufficiency causes mitotic infidelity and
carcinogensis. Nature Genetics 37 883-888, doi:10.1038/ng1605 (2005).
152
Figures, tables and legends
Figure 1 a-c. Tritiated Thymidine incorporation proliferation assay in three GBM cell lines and explants exposed to GBM-specific AM RF EMF for three hours daily for seven days.
153
Figure 2a & b. Neurosphere formation assay in a GBM cell line and a GBM explant exposed to GBM-specific AM RF EMF for three hours daily for seven days.
154
Figure 3. The Mitotic Roles of Polo-Like Kinase Pathway. The Polo-Like Kinases are essential cell-cycle regulators as they are heavily involved in centriole biogenesis and therefore important in multiple phases of cell division.
155
Figure 4. qRT-PCR validation of five differentially-expressed genes from the canonical pathway Mitotic Roles of Polo-Like Kinase. Abnormal Spindle Microtubule Assemble (ASPM), Polo-Like Kinase 1 & 4 (PLK1 & PLK4), Centrosomal Protein 152 (CEP 152) and Cyclin B1 (CCNB1) which had an increase in fold change of 1.69, 1.89, 1.61, 1.18 and 1.72 respectively. qRT-PCR validation of the target genes confirmed highly significant RNA-seq differential expression: ASPM, 429% increased expression (N = 18; T-test p = 4.809x10-04), PLK1, 965% increased expression (N = 18; T-test p = 2.932x10-06), PLK4, 997% increased expression (N = 15; T-test p = 2.343x10-17), CEP152, 276% increased expression (N = 18; T-test p = 1.790x10-5) and Cyclin B1, 1916% increased expression (N = 18; T-test p = 1.004x10-08).
156
Figure 5 a - c. AM RF EMF disrupt the mitotic spindle of GBM cells. U-251 cells were exposed to 27.12 MHz RF EMF amplitude-modulated at GBM specific frequencies three hours daily for seven days. a. Mitotic spindle visualization and quantification by two blinded, independent investigators revealed that AM RF EMF treated cells exhibit higher number of mitotic spindle disruption events than control cells. b. There were significantly more Questionable+Abnormal events among AM RF EMF treated cells (71.43%) than among untreated cells (12.82%), T-test p = 0.0013. c. Analysis restricted to Abnormal versus Normal events showed that AM RF EMF treated cells exhibit a higher frequency of Abnormal events (19.05%) than untreated cells (2.56%), T-test p = 0.0478.
157
Figure 6. GBM-specific AM RF EMF inhibit U-251 GBM cells in vivo. U-251-LUC GBM cells were intracranially implanted in NOD SCID mice and imaged for luciferase intensity seven days post-implantation. Treatment with GBM-specific AM RF EMF or SHAM was initiated the following day. Tumor growth was monitored by bioluminescence imaging (N = 17 / group). Panel shows representative bioluminescence intensity for both groups. There was a statistically significant decrease in intensity for the EMF treated group (T-test p = 0.04) at day 4. There was no change in the SHAM group (T-test p = 0.16). Both SHAM and EMF groups had identical levels of intensity at baseline (T-test p = 0.84) but the EMF group was significantly lower at day 4 (T-test p = 0.03).
158
Figure 7. 38 year-old woman with IDH1 and IDH2 wt, EGFRvIII negative recurrent GBM s/p temozolomide, radiation therapy, ketogenic diet, nivolumab, bevacizumab, and fotemustine. The patient had progression of disease prior to initiation of treatment with GBM-specific AM RF EMF. Baseline imaging occurred March 2016 and progression of disease was noted June 2016. Patient began compassionate treatment July 4th, 2016.
159
Figure 8. 38 year-old woman with IDH1 and IDH2 wt, EGFRvIII negative recurrent GBM: The patient received compassionate treatment with TheraBionic device and had follow up imaging August, 18th 2016. The patient showed a decreased intensity and amount of enhancement. The left temporal enhancing mass demonstrates a much less solid enhancement pattern over a somewhat larger area and is difficult to measure. The left parietal enhancing mass has increased in size but shows much more heterogeneous pattern of more ill-defined enhancement. The findings are suggestive of treatment effect rather than tumor progression. Treatment was stopped after three months because of intracranial bleeding felt to be unrelated to the AM RF EMF treatment. The patient expired on 11/22/16.
160
Figure 9. Schematic diagrams illustrating Centriole Biogenesis14,15. a. PLK-4 triggers centriole biogenesis when it is recruited to the centrosome by CEP152. b. Mechanism by which CEP152 recruits PLK-4 from Cep192-PLK4 complex and repositions PLK-4 at the outer boundary of a newly forming CEP152 ring structure.
161
Table 1. Differentially expressed genes identified by RNA-seq analysis of U-251 cells exposed to GBM-specific AM RF EMF for three hours daily for seven days. Abnormal Spindle Microtubule Assemble (ASPM), Polo-Like Kinase 1 & 4 (PLK1 & PLK4), Centrosomal Protein 152 (CEP 152) and Cyclin B1 (CCNB1) had increases in fold-change of 1.69, 1.89, 1.61, 1.18 and 1.72, respectively.
162
APPENDIX e: Testing the specific response of individual cell lines, from
multiple cancer models, to tumor-specific amplitude modulated
radiofrequency electromagnetic fields
Experimental design was conceived and analyzed by Boris C. Pasche and Hugo
Jimenez. Data Generation / Collection was performed by Hugo Jimenez and Minghui Wang
163
Introduction
We have previously demonstrated proliferative inhibition in malignant
cancer cell lines, from two different cancer models (HCC and Breast cancer)
treated with their respective cancer-specific AM RF EMF sets1. In order to
expand our understanding of the cancer-specific AM RF EMF phenomena we
sought to determine what cell lines, obtained from various cancer models, would
be optimal for experimental testing. We examined a number of cell lines from
various cancer types exposed to their respective cancer-specific AM RF EMF.
Results
Cell lines from the Hepatocellular carcinoma model, SNU-387, SNU-423
and SNU-475 failed to demonstrate proliferative inhibition to HCC-specific AM RF
EMF (T-test; p > 0.05) (figures 1, 2 and 3). Pancreatic cancer cell line BXPC3
failed to demonstrate proliferative inhibition (T-test; p > 0.05) BxPC3 (figure 4) to
Pancreatic-specific AM RF EMF while the PANC-1 cell line did show 11.3%
growth inhibition (T-test; p = 0.01) (figure 5). Prostate cancer cell lines LNCAP
and PC-3 both failed to demonstrate proliferative inhibition to Prostate-specific
AM RF EMF (T-test; p > 0.05) (figure 6 and 7).
Discussion / future direction
This study is ongoing as a number of cell lines still require repeat testing
to confirm results, and new cells lines are added to the list of potential
candidates.
164
Materials and methods
[3H ] thymidine incorporation assay: Growth inhibition (GI) was
assessed in Huh-7 cells exposed to HCC-specific modulation frequencies as
previously described1. Briefly, cells were treated with the frequencies for 7 days,
3 hours every day. At day 7, cells were washed, [3H] thymidine (Amersham) was
added, and cells were incubated for 4 hrs. After 4 hrs incubation, cells were
washed with ice-cold PBS for 5 minutes then lysed with 800uL of 0.2 N NaOH.
[3H] thymidine incorporation was measured using a Beckman Coulter scintillation
counter. Statistics and graphs were generated with Graphpad Prism or Microsoft
Excel.
Cell lines: HCC cell lines SNU-387 (CRL-2237), SNU-423 (CRL-2238)
and SNU-475 (CRL-2236) were purchased from ATCC. Pancreatic cell lines and
PANC-1 were gifts provided by the Buchsbaum lab from the University of
Alabama-Birmingham. Prostate cell lines PC-3 and LNCAP were gifts provided
by the Yang lab from the University of Alabama-Birmingham.
AM RF EMF exposure in vitro: Cell lines were exposed to 27.12 MHz
radiofrequency electromagnetic fields at an SAR of 30 and 400 mW/kg. Cells
were exposed for three hours daily, seven days in a row. Cells were exposed to
tumor-specific modulation frequencies that were previously identified in patients
with a diagnosis of HCC, a diagnosis of pancreatic cancer, a diagnosis of
prostate cancer, and to modulation frequencies never identified in patients with a
diagnosis of cancer (RCF) or no treatment (SHAM).
165
References
1 Zimmerman, J. W. et al. Cancer cell proliferation is inhibited by specific
modulation frequencies. Br J Cancer 106, 307-313,
doi:https://dx.doi.org/10.5732%2Fcjc.013.10177 (2012).
166
Figures, tables and legends
Figure 1. HCC Cell line SNU-387. N=6 per group. Experiment performed only once. T-test p = 0.3882
167
Figure 2. HCC Cell line SNU-423. N=6 per group. Experiment performed only once. T-test p = 0.5182
168
Figure 3. HCC Cell line SNU-475. N = 6 per group. Experiment performed only once. T-test p = 0.2475
169
Figure 4. Pancreatic Cell line BxPC3. N=12 per group. Experiment performed only once. [F(2,33) = 20.02, p < 0.0001]; SHAM vs. RCF p = 0.0016, SHAM vs. PANC p < 0.0001, RCF vs. PANC p = 0.0470
170
Figure 5. Pancreatic cell line PANC-1 seeded at 5000 cells/well (N = 12). 11.30% inhibition; T-test p value 0.01. Control group is RCF.
171
Figure 6. Prostate cell line LNCAP. N = 6/group; 5000 cells/well. [F (2,15) = 0.2829, p = 0.9722]; SHAM vs. RCF p = 0.9972, SHAM vs. PROSTATE p = 0.9858, RCF vs. PROSTATE p = 0.9708, Experiment was repeated twice.
172
Figure 7. Prostate cell line PC-3. N = 12, 5000 cells/well. [F (2, 330 = 2.125, p = 0.1355]; SHAM vs. RCF p = 0.2927, SHAM vs. PROSTATE p = 0.8994, RCF vs. PROSTATE p = 0.1372. Experiment was repeated three times.
173
APPENDIX f: The combined use of anti-mitochondrial metabolism agent,
lipoate derivative CPI-613, and hepatocellular carcinoma-specific
amplitude-modulated radiofrequency electromagnetic fields on Huh-7 cells
Experimental design was conceived and analyzed by Boris C. Pasche, Tim Pardee and Hugo Jimenez. Data Generation / Collection was performed by
Hugo Jimenez and Minghui Wang
174
Introduction
PDH is a key mitochondrial enzyme acting as the entry point for pyruvate
into the tricarboxylic acid (TCA) cycle, generating cellular energy and
biosynthetic precursors. PDH and its regulatory kinase, PDK, have significantly
altered activity in cancer cells.1 In cancer cells energy is generated by shunting
pyruvate away from PDH and the TCA cycle and driving it to LDH and anaerobic
glycolysis (the Warburg effect). Yet, cancer cells still require TCA intermediaries
(PDH) for biosynthesis of lipids, nucleic acids, etc. Hence, the activity of
mitochondrial PDH is a necessary mediator of malignant cell function and since
lipoate is a necessary catalytic cofactor for PDH, and other mitochondrial
enzymes, CPI-613 is a prime candidate to disrupt malignant cell activity.1,2
The anti-mitochondrial metabolism agent, CPI-613, activates lipoate-
sensitive pyruvate dehydrogenase (PDH) kinase (PDK) which phosphorylates
three specific phosphoserines on lactate dehydrogenase (LDH).1 In turn, the
phosphorylation inhibits LDH, suppressing mitochondrial ATP production and
leading to cell death.1,3
CPI-613 exhibits anti-cancer activity across multiple cancer types since
mitochondrial function is necessary for multiple tumor types.1 Moreover, our
unpublished data indicate that HCC-specific AM RF EMF’s anti-cancer activity
occurs by modulating Ca2+ influx via the T-type VGCC (Cav 3.2 isoform)
channels. Hence, we hypothesize that the sustained (3 hours) EMF treatment
with HCC-specific AM RF EMF could affect the metabolic rate of cancer cells and
in turn have an additive or synergic interaction with CPI-613.
175
Results
We determined the optimal concentration of CPI-613 by performing an
IC50 experiment at two different time points (48 and 72hours) (Figure 1a).
Results show 100uM dosage of CPI-613, for 48 hours, would be the optimal
concentration to combine with HCC-specific AM RF EMF as that concentration
caused minimal inhibitive of proliferation, and would therefore provide time for
HCC-specific AM RF EMF to complete its 7-day treatment cycle (Figure 1b & c).
The resulting data (Figure 2a & b) did not show any indication that the addition
of CPI-613 to HCC-specific AM RF EMF, in this treatment design, had any
significant additional antiproliferative effect when combined with HCC-specific
AM RF EMF.
Discussion / future direction
Hepatocellular carcinoma (HCC) death rates in the U.S. are increasing
faster than for any other malignancy, having more than doubled in the past
decade.4,5 Despite the recent approval of additional second-line treatment
modalities (regorafenib and nivolumab) the outcome of patients with advanced
hepatocellular carcinoma remains poor and new therapeutic approaches are
sorely needed.6 Hence, it would be of significant value to continue to investigate
other treatment combinations such as CPI-613 + HCC-specific AM RF EMF in
tandem for the entirety of the 7-day treatment session. This experiment is still
ongoing. However, clinical evidence suggests that CPI-613 is most efficacious
when combined with chemotherapy agents that bind albumin.7,8 CPI 613 single
agent activity is modest and current evidence suggests that AM RF EMF have
little in common with chemotherapy with respect to mechanism of action.
176
Materials and methods
[3H ] thymidine incorporation assay: Growth inhibition (GI) was
assessed in Huh-7 cells exposed to HCC-specific modulation frequencies as
previously described.9 Briefly, cells were treated with the frequencies for 7 days,
3 hours every day. At day 7, cells were washed, [3H]thymidine (Amersham) was
added, and cells were incubated for 4 hrs. After 4 hrs incubation, cells were
washed with ice-cold PBS for 5 minutes then lysed with 800uL of 0.2 N NaOH.
[3H ] thymidine incorporation was measured using the Beckman Coulter
scintillation counter. Statistics and graphs were generated with Graphpad Prism.
AM RF EMF exposure in vitro: Cell lines were exposed to 27.12 MHz
radiofrequency electromagnetic fields using exposure systems designed to
replicate clinical exposure levels. Experiments were conducted at an SAR of 30
and 400 mW/kg. Cells were exposed for three hours daily, seven days in a row.
Cells were exposed to tumor-specific modulation frequencies that were
previously identified in patients with a diagnosis HCC or no treatment (SHAM).
Experiments are ongoing.
CPI-613: This agent is a lipoate analog, first-in-class agent that targets
mitochondrial metabolism. We cultured Huh-7 cells with CPI-613 (100uM) for 48
consecutive hours (i.e. first 48 hours of the 7-day treatment cycle had CPI-613
and EMF exposure occurring in tandem). The remaining 5 days, without the CPI-
613 incubation, would continue with HCC-specific AM RF EMF treatment only.
Huh-7 cells were treated at 20,000/well.
177
References
1 Lycan, T. W. et al. A Phase II Clinical Trial of CPI-613 in Patients with
Relapsed or Refractory Small Cell Lung Carcinoma. PloS one 11, e0164244,
doi:10.1371/journal.pone.0164244 (2016).
2 DeBerardinis, R. J., Lum, J. J., Hatzivassiliou, G. & Thompson, C. B. The
biology of cancer: metabolic reprogramming fuels cell growth and proliferation.
Cell metabolism 7, 11-20, doi:10.1016/j.cmet.2007.10.002 (2008).
3 Zachar, Z. et al. Non-redox-active lipoate derivates disrupt cancer cell
mitochondrial metabolism and are potent anticancer agents in vivo. J Mol Med
(Berl) 89, 1137-1148, doi:10.1007/s00109-011-0785-8 (2011).
4 Siegel, R. L., Miller, K. D. & Jemal, A. Cancer statistics, 2017. CA. Cancer
J. Clin. 67, 7-30, doi:10.3322/caac.21387 (2017).
5 Islami, F. et al. Disparities in liver cancer occurrence in the United States
by race/ethnicity and state. CA. Cancer J. Clin. 67, 273-289,
doi:10.3322/caac.21402 (2017).
6 Kudo, M. et al. Lenvatinib versus sorafenib in first-line treatment of
patients with unresectable hepatocellular carcinoma: a randomised phase 3 non-
inferiority trial. Lancet, doi:10.1016/S0140-6736(18)30207-1 (2018).
7 Alistar, A. et al. Safety and tolerability of the first-in-class agent CPI-613 in
combination with modified FOLFIRINOX in patients with metastatic pancreatic
cancer: a single-centre, open-label, dose-escalation, phase 1 trial. The lancet
oncology, doi:10.1016/S1470-2045(17)30314-5.
8 Pardee, T. S. et al. A Phase I Study of the First-in-Class Antimitochondrial
Metabolism Agent, CPI-613, in Patients with Advanced Hematologic
178
Malignancies. Clin. Cancer Res. 20, 5255-5264, doi:10.1158/1078-0432.ccr-14-
1019 (2014).
9 Zimmerman, J. W. et al. Cancer cell proliferation is inhibited by specific
modulation frequencies. British journal of cancer 106, 307-313 (2012).
179
Figures, tables and legends
Figure 1. IC50 experiments with Huh-7 cells. a. Proliferative inhibition of Huh-7 cells treated for 48 or 72 hours at multiple concentrations of CPI-613. b. 48 hour comparison of no treatment (N = 4) vs CPI-613 (100uM) (N = 6); T-test p-value < 0.0001. c. 72 hour comparison of no treatment (N = 6) vs CPI-613 (100uM) (N = 4); T-test p-value = 0.1336. a.
0 1 0 0 2 0 0 3 0 0 4 0 0 5 0 0 6 0 0
0
5 0 0 0 0
1 0 0 0 0 0
1 5 0 0 0 0
2 0 0 0 0 0
C P I-6 1 3 (u M )
3H
Th
ym
idin
e I
nc
orp
ora
tio
n (
CP
M)
4 8 h rs
7 2 h rs
b. c.
0100
0
2 0 0 0 0
4 0 0 0 0
6 0 0 0 0
8 0 0 0 0
1 0 0 0 0 0
C P I-6 1 3 (u M )
3H
Th
ym
idin
e I
nc
orp
ora
tio
n (
CP
M)
*
0100
0
5 0 0 0 0
1 0 0 0 0 0
1 5 0 0 0 0
2 0 0 0 0 0
C P I-6 1 3 (u M )
3H
Th
ym
idin
e I
nc
orp
ora
tio
n (
CP
M)
N S
180
Figure 2. 48 hours CPI-613 + HCC-specific AM RF EMF experiment Huh-7 cells. a. CPI-613+EMF compared to vehicle control; [F (3, 18) = 20.17, p < 0.0001. b. Repeat experiment of CPI-613+EMF compared to vehicle control; [F (3, 17) = 2.791, p < 0.0720. a.
SH
AM
+D
MS
O
EM
F+D
MS
O
SH
AM
+C
PI-
613
EM
F+ C
PI-
613
0
5 0 0 0 0 0
1 0 0 0 0 0 03
H T
hy
mid
ine
In
co
rp
ora
tio
n (
CP
M)
b.
SH
AM
+D
MS
O
EM
F+D
MS
O
SH
AM
+C
PI-
613
EM
F+ C
PI-
613
0
5 0 0 0 0 0
1 0 0 0 0 0 0
3H
Th
ym
idin
e I
nc
orp
ora
tio
n (
CP
M)
181
APPENDIX g: Determination of frequency bandwidths for effective
Hepatocellular Carcinoma specific-amplitude-modulated radiofrequency
electromagnetic fields treatment.
Experimental design was conceived and analyzed by Boris C. Pasche, Carl F Blackman and Hugo Jimenez. Data Generation / Collection was performed by
Hugo Jimenez and Minghui Wang
182
Introduction
The concept of an interaction of a weak EMF with a living organism has
existed in the Bioelectromagnetics field for decades. One of the earliest
examples by Hamer in 1968 showed that low level, low frequency electric fields
could affect human reaction time1. Additionally, Bawin et al. in 1978 studying
radiofrequency (RF) effects on chick brains and later expanded upon by
Blackman et al., discovered that calcium transport is profoundly affected only
when RF is amplitude-modulated (AM) at specific extremely low frequencies
(ELF).2-8 Liboff proposed a detailed Cyclotron Resonance model that could
explain the results reported by Blackman9. Briefly, the Cyclotron Resonance
model proposed that certain ionic species and even some enzymes will follow a
circular or well-defined helical pathway under the influence of a “Resonant
Frequency” determined by a static magnetic field(s) (Figure 1).9
Cancer-specific AM frequencies were identified in patients that had a
diagnosis of cancer and exhibited biofeedback upon exposure to specific AM
frequency.10,11 The biofeedback responses were identified at very discrete AM
frequencies with some of those frequencies showing resolution down to the
1/1000th of a hertz.11 With the discovery that such narrow-band AM frequencies
can produce the biofeedback response in human subjects, we performed tests to
determine the bandwidth of the effective frequencies in laboratory tests using two
human cancer cell lines.
183
Results
Using the Huh-7 and Hep3B cell lines we exposed cells to HCC-specific
frequencies that were altered by adding 1.0, 0.1, 0.01, or 0.001 Hz to each
frequency in the base AM frequency set. As seen in Table 1 and 2, the data is
not yet complete and no discernable trend can be interpreted as of March 2018.
Discussion / future direction
With the discovery of extremely precise cancer-specific AM RF EMF
reactions in patients, it is probably that the EMF is resonating very precise
“structure(s)” in the cell that elicit the cancer-related response(s). Such
“structure(s)” may very well be “antenna-like” receptors capable of
demodulating/interpreting the cancer-specific AM RF EMFs. To further explore
this concept, we will use frequency sets that are slightly offset from the effective
target frequencies to establish the frequency precision necessary to cause the
cancer cell response limits, i.e., the “efficacy windows”. This information can
have significant bearing on developing further clinical understanding of the
underlying bases for effective results.
We have yet to complete experiments needed to identify AM frequency
bandwidths; experiments are still ongoing. After completion of the initial,
“additive frequencies,” to the base frequency set, we plan to “reduce frequencies”
from the base set by the same amounts, for a series of increments (1.0Hz, 0.1
Hz, 0.01 Hz, 0.001Hz) in order to identify the “shape” and “robustness” of the
frequency set on both sides of the discrete frequency set, which was initially
determined from the responses of patients with particular cancers.
184
Materials and methods
[3H ] thymidine incorporation assay: Growth inhibition (GI) was
assessed in Huh-7 cells exposed to HCC-specific modulation frequencies as
previously described12. Briefly, cells were treated with the frequencies for 7 days,
3 hours every day. At day 7, cells were washed, [3H] thymidine (Amersham) was
added, and cells were incubated for 4 hrs. After 4 hrs incubation, cells were
washed with ice-cold PBS for 5 minutes then lysed with 800uL of 0.2 N NaOH.
[3H] thymidine incorporation was measured using a Beckman Coulter scintillation
counter. Statistics and graphs were generated with Graphpad Prism and
Microsoft Excel.
HCC-specific AM RF EMF frequency set: Cell lines were exposed to
27.12 MHz radiofrequency electromagnetic fields at an SAR of 0.03 W/kg. We
then created 4 frequency shift sets by adding 1Hz, 0.1Hz, 0.01Hz, and 0.001Hz
to the base HCC-specific modulation frequency set.
AM RF EMF exposure in vitro: Cell lines were exposed to AM-
modulated 27.12 MHz radiofrequency electromagnetic fields at an SAR of 0.03
W/kg. Cells were exposed for three hours daily, seven days in a row.
Experiments are ongoing.
185
References
1 Hamer, J. R. Effects of Low Level, Low Frequency Electric Fields on
Human Reaction Time. Communications in Behavioral Biology 2, 217-222
(1968).
2 Bawin, S. M., Adey, W. R. & Sabbot, I. M. Ionic factors in release of
45Ca2+ from chicken cerebral tissue by electromagnetic fields. Proceedings of
the National Academy of Sciences of the United States of America 75, 6314-
6318 (1978).
3 Blackman, C. F. et al. Induction of calcium-ion efflux from brain tissue by
radiofrequency radiation: effect of sample number and modulation frequency on
the power-density window. Bioelectromagnetics 1, 35-43 (1980).
4 Joines, W. T. & Blackman, C. F. Power density, field intensity, and carrier
frequency determinants of RF-energy-induced calcium-ion efflux from brain
tissue. Bioelectromagnetics 1, 271-275 (1980).
5 Joines, W. T., Blackman, C. F. & Hollis, M. A. Broadening of the RF
power-density window for calcium-ion efflux from brain tissue. IEEE transactions
on bio-medical engineering 28, 568-573, doi:10.1109/tbme.1981.324829 (1981).
6 Blackman, C. F., Benane, S. G., Kinney, L. S., Joines, W. T. & House, D.
E. Effects of ELF fields on calcium-ion efflux from brain tissue in vitro. Radiat Res
92, 510-520 (1982).
7 Blackman, C. F., Benane, S. G., House, D. E. & Joines, W. T. Effects of
ELF (1-120 Hz) and modulated (50 Hz) RF fields on the efflux of calcium ions
from brain tissue in vitro. Bioelectromagnetics 6, 1-11 (1985).
186
8 Blackman, C. F., Benane, S. G., Rabinowitz, J. R., House, D. E. & Joines,
W. T. A role for the magnetic field in the radiation-induced efflux of calcium ions
from brain tissue in vitro. Bioelectromagnetics 6, 327-337 (1985).
9 Liboff, A. R. Geomagnetic cyclotron resonance in living cells. Journal of
Biological Physics 13, 99-102, doi:10.1007/bf01878387 (1985).
10 Costa, F. P. et al. Treatment of advanced hepatocellular carcinoma with
very low levels of amplitude-modulated electromagnetic fields. Br J Cancer 105,
640-648 (2011).
11 Barbault, A. et al. Amplitude-modulated electromagnetic fields for the
treatment of cancer: discovery of tumor-specific frequencies and assessment of a
novel therapeutic approach. Journal of experimental & clinical cancer research :
CR 28, 51, doi:10.1186/1756-9966-28-51 (2009).
12 Zimmerman, J. W. et al. Cancer cell proliferation is inhibited by specific
modulation frequencies. Br J Cancer 106, 307-313,
doi:https://dx.doi.org/10.5732%2Fcjc.013.10177 (2012).
187
Figures, tables and legends
Figure 1. Liboff cyclotron resonance diagram9
188
Table 1. Huh-7 +Hz shift
Huh-7 Internal Control 1Hz 0.1Hz 0.01Hz
1/1/2017 GOOD ↓ NS
2/8/2017 GOOD
↑
3/2/2017 GOOD
↓ ↓
3/24/2017 GOOD
↓ ↓
10/25/2017 GOOD
NS NS
11/24/2017 GOOD
NS NS
189
Table 2. Hep3B +Hz shift
Hep3B Internal Control 0.1Hz 0.01Hz
11/1/2017 GOOD NS ↓
11/14/2017 GOOD NS NS
190
APPENDIX h: Inducible mouse model of hepatocellular carcinoma and
species specificity of hepatocellular carcinoma-specific amplitude-
modulated radiofrequency electromagnetic fields
Experimental design was conceived and analyzed by Boris C. Pasche, Carl F Blackman and Hugo Jimenez. Data Generation / Collection was performed by
Hugo Jimenez and Minghui Wang. Mouse model was provided by our collaborator Anja Runge PhD
191
Introduction
Anja Runge, PhD of the German Cancer Research Center recognized the
need for tumor models that faithfully mimic the progression of human
Hepatocellular carcinoma tumors and their response to therapy1. To address the
issue of limited HCC mouse models, Runge et al. developed and validated an
inducible model of hepatocarcinogenesis in adult mice.1 This model replicated
the clinical vascular growth of HCC and responded well to first line treatment,
Sorafenib, thus it was a viable model to test our HCC-specific AM RF EMF
treatment. Hence, we contacted Dr. Runge and obtained the mouse model for a
pilot study.
Results
Using the iAST inducible mouse model, we established tumors following
the published inducible procedure1 and treated with mice with HCC-specific AM
RF EMF and found no therapeutic response after 5 weeks of continuous
treatment (Figure 1).
Discussion / future direction
The negative results of the mouse model has raised questions about the
ability of the human derived HCC-specific AM RF EMF to target tumors of mouse
origin2. Hence, it may be possible that tumors that are entirely of mouse origin
may not be able to “respond” to human HCC-specific AM RF EMF. To prevent a
misuse of time and materials, we will no longer investigate cell cancer models of
mouse origin. The cancer-specific frequencies were identified through
examination of patients with a diagnosis of cancer. Based on these results and
other unpublished results using a mouse model of breast cancer, it appears that
192
our current objectives would be better utilized focusing on cell models that would
more accurately represent the human condition, rather than pursuing the issue of
cross-species reactivity2-4. We also hypothesize that tumor-specific frequencies
may well be species specific.
193
Materials and methods
Magnetic Resonance Imaging (7T MRI): Mouse imaging was
accomplished at Wake Forest Baptist Medical Center’s Translational Imaging
Program. Briefly, mice were induced and maintained in a twilight state via
Isoflurane inhalation (1-3%), at which point mice were imaged.
Inducible model of Hepatocellular Carcinoma: Transgenic mice
expressing the hepatocyte-specific albumin promoter, a loxP-flanked stop
cassette, and the SV40 large T-antigen (iAST)1 were used in this study. Initially,
iAST mice were tail vein injected with a 100uL bolus containing 1x109 PFU of
iCre adenovirus (Vector Biolabs). Nine weeks after induction mice had fully
formed Hepatocellular Carcinoma1. Post 9-weeks we performed Magnetic
Resonance (MR) imaging to verify presence of tumors. Once tumors were
verified we began treatment with human-derived, tumor-specific frequencies and
followed up with MR imaging two weeks later. iAST mice were a gift from our
collaborators (Anja Runge) at the German Cancer Research Center.
PCR Primers and protocol:
iAST Forward primer: GGACAAACCACAACTAGAATGCAGTG
iAST REVERSE primer: CAGAGCAGAATTGTGGAGTGGAAA
Machine protocol: 1x 95°C for 5 min, 35 x (95°C for 40 seconds / 60°C for
30 seconds / 72°C for 1 min), 1 x 72°C for 10 minutes followed by 4°C. The PCR
product is 475bp.
194
References
1 Runge, A. et al. An Inducible Hepatocellular Carcinoma Model for
Preclinical Evaluation of Antiangiogenic Therapy in Adult Mice. Cancer Research
74, 4157-4169, doi:10.1158/0008-5472.can-13-2311 (2014).
2 Barbault, A. et al. Amplitude-modulated electromagnetic fields for the
treatment of cancer: discovery of tumor-specific frequencies and assessment of a
novel therapeutic approach. Journal of experimental & clinical cancer research :
CR 28, 51, doi:10.1186/1756-9966-28-51 (2009).
3 Costa, F. P. et al. Treatment of advanced hepatocellular carcinoma with
very low levels of amplitude-modulated electromagnetic fields. Br J Cancer 105,
640-648 (2011).
4 Zimmerman, J. W. et al. Cancer cell proliferation is inhibited by specific
modulation frequencies. Br J Cancer 106, 307-313,
doi:https://dx.doi.org/10.5732%2Fcjc.013.10177 (2012).
195
Figures, tables and legends
Figure 1. Representative MRI scans of iAST mice treated as a function of time (or three hours daily) with HCC-specific AM RF EMF (N = 4). a. Mouse I.D. 011. Negative control. No tumor growth identified after MR imaging. b. Mouse I.D. 007. Multiple nodule present in liver. Mouse started tumor-specific AM RF EMF after imaging. c. Mouse I.D. 007. Two weeks after initial MRI scans the images show progression of tumors. d. Mouse I.D. 007. Five weeks after initial MRI scans, the image shows continued tumor progression.
196
CURRICULUM VITAE
HUGO JIMENEZ PhD Candidate
Department of Cancer Biology Wake Forest School of Medicine
(708) 870-7659 [email protected]
Campus Address: Department of Cancer Biology Suite: NRC 441 Wake Forest University School of Medicine Winston-Salem, NC. 27157 Education: 2014-Present PhD, Cancer Biology Wake Forest University School of Medicine Winston-Salem, NC. 27157 Mentor: Boris C. Pasche, M.D., PhD 2011-2014 PhD, Cancer Biology University of Alabama-Birmingham Birmingham, AL. 35205 Mentor: Boris C. Pasche, M.D., PhD 2008-2010 Master’s in Clinical Laboratory Sciences Rush University Medical Center Chicago, IL. 60612 2003-2008 Bachelor’s degree in Biology Benedictine University Lisle, IL. 60532 Research Experience: 2011-2018 PhD Student Mentor: Boris C. Pasche, M.D., PhD 2009-2010 Masters Graduate Student Mentor: Kent Christopherson, PhD Positions and Honors Honors: 2013 Travel Award to BioEM conference, Thessaloniki, Greece
197
2010 Associate Member of Rush University Cancer Center, Rush University, Chicago, Illinois 2010 Outstanding Teaching Assistant, Rush University, Chicago, Illinois 2010 Chairman’s Award, Rush University, Chicago, Illinois Positions and Employment 2012-2013 Student member of admissions committee, UAB, Birmingham, Alabama 2010 Research Assistant II, Tumor Immunology laboratory, Rush Medical Center, Chicago, Illinois 2010 Teaching Assistant, Rush University, Chicago, Illinois 2009-2010 Laboratory Assistant, Rush Pathology Laboratory, Chicago, Illinois 2008-2010 Student member of ASCLS 2007-2008 Physics Grader, Benedictine University, Lisle, Illinois 2006-2008 Teacher Laboratory Assistant, Benedictine University, Lisle, Illinois Other Experience and Professional Memberships 2014-2015 Technology Commercialization Internship, Wake Forest Innovations, Wake Forest University, Winston-Salem, North Carolina 2013- The Bioelectromagnetic Society, BEMS 2012- American Association for Cancer Research, AACR 2011- Member of Academy for Future Science Faculty, Northwestern University, Chicago, IL 2009-2010 Clinical Rotations, University of Chicago, Chicago, Illinois 2009-2010 Clinical Rotations, Rush University, Chicago, Illinois Bibliography: Book Chapters 1. Pasche B, Jimenez H, Zimmerman J, Pennison M, Wang M, Posey J, Forero-Torres A, Carpenter JT, Brezovich I, Blackstock AW, Costa FP and Barbault A. (2015) Systemic Treatment of Cancer with Low and Safe Levels of Radiofrequency Electromagnetic Fields Amplitude-Modulated at Tumor-Specific Frequencies. In P. J. Rosch, (Ed.) Bioelectromagnetic and Subtle Energy Medicine (pp. 299-303). 2nd ed. London, England: CRC Press
198
Review Articles 1. Jimenez H, Blackman C, Lesser G, Debinski W, Chan M, Sharma S, Watabe K, Lo H, Thomas A, Godwin D, Blackstock W, Mudry A, Posey J, O’Connor R, Brezovich I, Bonin K, Kim-Shapiro D, Barbault A and Pasche B. (2018) Use of Non-Ionizing Electromagnetic Fields for the Treatment of Cancer. 2018 Jan; 23: 284-297. 2. Pasche B, Pennison MJ, Jimenez H, Wang M. (2014). TGFBR1 and cancer susceptibility. Transactions of the American Clinical and Climatological Association. 2014, 125: 300-312. 3. Pasche B, Wang M, Pennison M, Jimenez H. (2014). Prevention and Treatment of Cancer with Aspirin: Where do we stand? Seminars in Oncology. 2014 Jun; 41(3): 397-401. 4. Zimmerman JW, Jimenez H, Pennison MJ, Brezovich I, Morgan D, Mudry A, Costa FP, Barabult A & Pasche B. (2013) Targeted treatment of cancer with radiofrequency electromagnetic fields amplitude-modulated at tumor-specific frequencies. Chinese Journal of Cancer. 2013 Nov; 32(11): 573-81. PMID: 24206915 Research Articles 1. Ahmad I, Jimenez H, Yaacob NS, & Yusuf N. (2012) Tualang Honey Protects Keratinocytes from Ultraviolet Radiation-Induced Inflammation and DNA Damage. Photochemistry and Photobiology. 2012 Sep-Oct; 88(5): 1198-204. PMID: PMC3375347 Conferences Attended 2018 -GI ASCO, San Francisco, California 2016 -BioEM, Ghent,Belgium -Society for NeuroOncology, Scottsdale, Arizona 2015 -ASCO, Chicago, Illinois -BioEM, Pacific Grove, California 2014 -Alliance for Clinical Trials in Radiation Oncology, Chicago, Illinois 2013 -BioEM Thessaloniki, Greece -ASCI/AAP, Chicago, Illinois