[CANCER RESEARCH57. 1030-1034. March 15. 9971

Advances in Brief

Identification of DNA Methylation Markers for Human Breast Carcinomas Usingthe Methylation-sensitive Restriction Fingerprinting Technique1

Tim Hw-Ming Huang,2 Douglas E. Laux, Brian C. Hamlin, Phuong Tran, Hoa Tran, and Dennis B. Lubahn

Department of Pathology and Anatomical Sciences, Ellis Fischel Cancer Center IT. H-M. H., B. C H., P. T., H. T.J, and Departments of Biochemistry and C'hild Health ID. E. L,D. B. LI, School of Medicine, University of Missouri. Columbia, Missouri 65203

igenesis, abnormally hypermethylated or hypomethylated sequencesoccurring in the tumor genome need to be identified.

In this study, we have developed a PCR-based method, calledMSRF,3 to identify abnormally methylated CpG sites in breast carcinomas. Initially, genomic DNA was digested with a 4-base restrictionendonuclease known to cut bulk DNA into small fragments but rarelyto cut in the CG-rich regions. The digests were treated with a secondrestriction endonuclease, which discriminates between methylated andunmethylated CpG sites, and then amplified by PCR with shortarbitrary primers (lO-mers) at low stringency. Amplified products orDNA fingerprints were resolved by high-resolution gel electrophoresis, and aberrantly methylated patterns were detected in the amplified

tumor DNA relative to the amplified normal DNA of the same patient.Here we have successfully employed the technique to identify andclone genomic fragments that frequently undergo methylationchanges in primary breast carcinomas.

Materials and Methods

Tissue Samples. Tumor specimens were obtained from patients with invasive breast carcinomas undergoing mastectomies or biopsies at the Ellis

Fischel Cancer Center (Columbia, MO; this study has been approved by ourinstitutional review board). The adjacent nonneoplastic breast tissue was also

obtained from the same patient to serve as a control (designated as “normal―).High molecular weight DNA was extracted using standard methods.

MSRF. Genomic DNA was digested with MseI alone or digested withBstU I and MseI at 10 units per @tgDNA following the conditions recom

mended by the supplier (New England Biolabs). The PCR reaction wasperformed with the digested DNA (20—100ng) in a 20-s.d volume containinga pair of primers (0.4 jIM), 0.15 units of Taq DNA polymerase (Life Tech

nologies, Inc.), 5% (v/v) DMSO, 200 p.M deoxynucleotide triphosphates, and2 @Ci[a-32P] dCTP (3000 Ci/mmol; Amersham) in buffer III [30 mM Tricine

(pH 8.4), 2 mM MgCl2, 5 mr@if3-mercaptoethanol,0.01% (w/v) gelatin, and0.1% (w/v) thesiti (13). The primers were as follows: Bsl, 5'-AGCGGCCGCG; Bs5, 5'-CTCCCACGCG; Bs7, 5'-GAGGTGCGCG; BslO, 5'-AGGGGACGCG; Bsl 1, 5'-GAGAGGCGCG; Bsl2, 5'-GCCCCCGCGA; Bs13, 5'-CGGGGCGCGA; Bs17, 5'-GQGGACGCGA; and Bsl8, 5'-ACCCCACCCG.Initial denaturation was for 5 mm at 94°C.DNA samples were then subjectedto 30 cycles of amplification consisting of 2 mm of denaturation at 94°C,1mmof annealing at 40°C,and 2 mm of extension at 72°Cin a PTC-l00 thermocycler (M. J. Research, Inc.). The final extension was lengthened to 10 mm.The products (20 pA)of each amplification reaction were mixed with 5 pi ofloading dye. Four pAof each DNA sample were size fractionated on a 4.5%nondenaturing polyacrylamide gel. Samples were loaded onto the gel at —16

V/cm to prevent diffusion from each lane into its neighboring lanes. The gelwas then run for 2 h at 60 W until the bromphenol blue dye front reached 5—10cm from the bottom edge of the gel. After electrophoresis, wet gels were

wrapped with plastic film and subjected to autoradiography at —70°Cfor24—48 h with DuPont Ultra-vision film.

Cloning and Sequencing. Target bands were excised from polyacrylamidegels, and gel fragments were shattered by being centrifuged through a pinholeof a microfuge tube into a second intact microfuge tube. DNA was eluted in

3 The abbreviations used are: MSRF, methylation-sensitive restriction fingerprinting;

HBC, hypermethylation in breast cancer; RLGS, restriction landmark genomic scanning.

Abstract

We have developed a PCR-based method, called methylation-sensitiverestiiction fingerprinting (MSRF), to screen changes in DNA methylation Inbreast carcInomas. Two hypennethylatios-containing fragments, HBC-1 (for“hypennethylation In breast cancer―) and HBC-2, were identified In theamplified breast tumor DNA relative to the amplified normal breast DNA ofa patient Nucleotide sequence analysis revealed no significant matches between the sequence of HBC-1 and the known sequences In the GenBankdatabase, whereas the sequence ofHBC-2 matched the upstream region of anantisense WTJ (Wilma' tumor suppressor gene) promoter. The methylationstatus In the breast tumor DNA from this patient was confirmed by Southernhybrklization usIng HBC-1 and HBC-2 as probes, respectively. Further analysis showed that HBC-1 was methylated aberrantly In 90% (17 of 19 patients)of the primary breast carcinomas examined. This study demonstrates thatMSRF provides a useful means for screening aberrant changes In DNAmethylation during tumorigenesis. The commonly methylated fragmentsidentified by MSRF could potentially supplement pathological markers currently used for cancers and additionally lead to the discovery of novelmethylated tumor suppressor genes.

Introduction

Abnormal changes in DNA methylation have been observed intumor cells (for a review, see Refs. 1 and 2). These changes usuallyoccur in CpG dinucleotides that are clustered frequently in regions ofabout 1—2kb in length, called CpG islands, in or near the promoterand first exon regions of genes (3). Hypermethylation within CpGislands was found to be associated with inactivation of tumor sup

pressor genes, including the estrogen receptor gene (4) and the MDGI(mammary-derived growth inhibitor) gene (5) in breast carcinoma, theglutathione S-transferase gene in prostate carcinoma (6), the vonHippel-Lindau tumor suppressor gene in renal cell carcinoma (7), the

RB gene in retinoblastoma (8), and the hypermethylation in cancer 1gene (9), the cyclin-dependent kinase N2/p16 gene (10, Il), and the

E-cadherin gene (12) in several types of tumor cells. In addition,aberrant hypermethylation may contribute to tumorigenesis throughthe C-to-T mutation at the methylated CpG dinucleotides (2). Hypomethylation was also observed in nucleotide sequences of severalproto-oncogenes. Potentially, hypomethylation is linked to aberrantincreases in the transcription of these genes. However, a direct correlation between hypomethylation and the up-regulation of protooncogene expression in tumor cells has yet to be established. As afurther step to understanding the role of DNA methylation in tumor

Received I0/I 8/96; accepted 1/27/97.The costs of publication of this article were defrayed in part by the payment of page

charges. This article must therefore be hereby marked advertisement in accordance with18 U.S.C. Section 1734 solely to indicate this fact.

I This work was supported by NIH grant R29-CA-69065 (to T. H-M. H.) and by

United States Army Medical Research Command Grant DAMD17-96-l-6055 (to D. B.L.).

2 To whom requests for reprints should be addressed, at the Department of Pathology

and Anatomical Sciences, Ellis Fischel Cancer Center, University of Missouri, 115Business Loop 1-70 West, Columbia, MO 65203. Phone: 573-882-1283; Fax: 573-884-5206.

1030

Research. on January 23, 2021. © 1997 American Association for Cancercancerres.aacrjournals.org Downloaded from

Methylationconditionsin tumor DNA relativeto normalDNAGellanesThmor

DNAMu I/BstU I Mse I

1 2Normal

DNAMse I/BstUI Mse I

34I.

Nomethylation2.

Normalmethylation(ornoBstUIsites)3.

Hypermethylationa.

Complete—@-b.

Enhanced4.

Hypomethylationa.

Completeb.

Incomplete—

Panel a b

Patient# 27 47TN TN

rn rn

1234

@uI

_‘a

METHYLATION-SENSITIVE RESTRICTION FINGERPRINTING

water and reamplified by 30 cycles of PCR with appropriate primers. Unmodified PCR products were ligated directly into the TA cloning vector, pCR II,

and transformed into Escherichia coli competent cells following the supplier'sprotocol (Invitrogen). Six to eight white colonies were selected, and plasmidDNA was isolated using minipreparation protocols (Qiagen). Double-strandedplasmid DNA was prepared and sequenced with an automated ABI model 373sequencer (Applied Biosystems, Inc.). The resulting nucleotide sequence wascompared to GenBank using the BLAST program (14).

Southern Hybridization Analysis. Five @gof genomic DNA were digested with MseI alone or digested with MseI and BstU I at high concentration

(15 units4tg) to ensure complete digestion of both tumor and normal DNAs.The digestion products were separated on a 1.5% agarose gel and transferred

to nylon membrane (Schleicher & Schuell). Filters were hybridized with a32P-labeled HBC-l probe (230 bp) or a 32P-labeled fragment, HBC-2. 1 (119bp; positions 21—139; see Fig. 2B). Hybridization and washing conditions were

carried out essentially as described (15). Filters were exposed to KOdakBioMax film in the presence of an intensifying screen for 7 days at —70°C.

Results and Discussion

Several fingerprinting techniques based on arbitrarily primed PCR (16,17) have previously been applied to identify genomic alterations (18) and

differentially expressed transcripts (19) in several types oftumor cells. In

the present report, we describe an improved fingerprinting technique,

MSRF, to identify abnormally methylated CpG sites in the breast tumorgenome. Three unique features have been implemented to preferentially

analyze methylation changes within CpG islands: (a) the system used a4-base cutter, MseI, which has previously been shown to restrict genomicDNA into small fragments (once per 140 bp) but preserve the integrity ofthe CpG islands (once per 1,000 bp; Ref. 20); (b) the methylationsensitive endonuclease BstU I was used for differentiating CpG methylation between tumor and normal genomes. This endonuclease waschosen because its recognition sequence (CGCG) occurs frequently

within CpG islands (once per 90 bp) but is rare in bulk DNA (one site per5,000—10,000bp) (20); and (c) methylated CpG islands protected fromthe BstU I digestion were PCR-amplified with short arbitrary primers

(lO-mers) attaching to the flanking homologous sequences in the genomein opposite directions. Except for primer Bs18 (see “Materialsand Meth

ods―),these primers were designed further to contain CGCG at their 3'ends, which would enhance the chance of amplifying regions harboringthe BstU I sites.

At least four conditions related to DNA methylation are distinguished by MSRF (Fig. 1A). In a condition showing no methylation(condition 1), PCR products are identified only in the MseI-digestedtumor and normal DNAs (Fig. 1 A, Lanes 2 and 4) but not in the

MseIJBstU I-digested tumor and normal DNAs (Fig. 1 A, Lanes 1 and3). The absence of products in Lanes 1 and 3 (Fig. 1A) occurs becausethe given genomic sequence, which contains an internal CGCG

site(s), is restricted with BstU I and cannot be amplified by PCR usingappropriate primers. In condition 2, an internal CGCG site(s) for a

given genomic sequence is methylated in both tumor and normal

genomes and thus is protected from the BstU I digestion. Alternatively, the given genomic sequence does not contain an internal BstUI recognition sequence(s). In either situation, amplified products arepresent in all four lanes (Fig. 1A). An aberrant hypermethylation event(condition 3) occurs in tumor when an amplified product is observed(or shows a relative increase in band intensity) in the MseI/BstU

I-digested tumor DNA (Fig. 1A, Lane 1) but not in the doubledigested normal DNA (Fig. lA, Lane 3). Amplified products are seenin the MseI-digested tumor and normal DNAs (Fig. 1A, Lanes 2 and

4). This indicatesthat a BstU I site(s) is specifically methylatedintumor DNA, but not in normal DNA. Hypomethylation (condition 4)

is detected in tumor when a PCR product is observed in the double

B

C

45TN

rn+- +-

++++

1234

+- +.

++++

1234A

.. ——

Fig. 1. MSRF. A, possible outcomes of DNA methylation changes in tumor detected by MSRF. B, genomic DNAs from breast tumor (7)/normal (N) tissue pairs were treated (+)with MseI. The digests were further treated (+) or untreated (—)with BstU I. Patient numbers are shown above lanes. The digests were separately amplified with primer pairs Bs7IBslO(a), Bsl/Bs18 (b), Bs12/Bsl3 (c), Bs13/Bs17 (d), and BsllIBsS (e). The amplified products were size fractionated on 4.5% polyacrylamide gels. Patient numbers are shown above lanes.Molecular weight markers (l00-bp ladder; Life Technologies, Inc.) are shown to the right. Arrowheads, hypermethylation-containing DNA fragments in tumor DNA.

1031

d e47 25

TN TNrn rn+-+- +-+-

++++ ++++

5234 1234

.. @ølS bp

—@ 1,500

, -00

. @200

Research. on January 23, 2021. © 1997 American Association for Cancercancerres.aacrjournals.org Downloaded from

+

+

METHYLATION-SENSITIVE RESTRICI1ON FINGERPRINTING

A BEBC-2

1 lCGGGGC@O@M‘rc'rGATcAAAGAACACA.AGCCTCAGCGACCAGTAACT1'GT@,wI

51CCCAACGCCCc'rSGAOTACA1.AMACTAATTPCM@?AACT@C-2.I.

AG'rGGAGGcA ACCCTTGGGT CTGC'N'GCGG TTCCTCCACA GGACAGTGAT

151 CCCAGATTCT CCCGAAGAAA ACCGCGG@1'T CGATT'I'CTCC AAGGC!I@@tJJI

101

BatUl+-+-BstUIMieX

++++MaeI

+

1 2 3 4

@1,530

@@J:@

bp

Fig. 2. A and B, upperpanels, nucleotide sequences of HBC-l and HBC-2. Both strands of the inserts were sequenced with Ti and SP6 promoter primers. Primers used in MSRFare shown in the boxed regions. The restriction endonuclease sites for BstU I are underlined. An internal fragment, HBC-2.l(underlined), was used as a probe in Southern hybridization;lowerpanels, methylation analysis of breast tumor-normal DNA pairs by Southern hybridization. Genomic DNA (5 @g)was treated (+) or untreated (—)with restriction endonucleasesas indicated and subjected to Southern hybridization analysis using HBC-l and HBC-2.l, respectively, as probes. T, breast tumor, N, normal breast tissue. Molecular weight markers(100 bp ladder; Life Technologies, Inc.) are shown to the right.

digested normal DNA (Fig. 1A, Lane 3), but not (or in a reducedquantity) in the double-digested tumor DNA (Fig. 1A, Lane 1).

Representative results of MSRF screening using a panel of primerpairs are shown in Fig. lB. The majority of amplified products showed

either condition 1 (no methylation) or condition 2 (normal methylation orno internal BstU I sites). Two candidate fragments containing abnormallyhypermethylated BstU I sites (condition 3) in the tumor DNA wereobserved in Fig. lB. b and c at —230and —200bp, respectively (Fig. lB.arrowheads); these DNA bands were detected in the MseI/BstU 1-digested tumor DNA, but not in the double-digested normal DNA. Moth

ylation differences between amplified tumor and normal DNAS were notnoted in Fig. lB. a, d@or e. PCR products were not observed in the controlreactions (no DNA template) amplified with these primer pairs at the

concentration specified in the protocol.The two hypermethylation-containing fragments (-@-23Oand —‘200

bp), now designated as HBC-l and HBC-2, respectively, were clonedfor sequencing. The fragments were found to have the expectedprimers at the 5' and 3' ends (Fig. 2, A and B, top). A BLAST searchrevealed no significant matches between the known sequences in thedatabase and the sequence of HBC-l . Subsequent observation hasshown that HBC-1 contains a novel expressed sequence based on aNorthern hybridization analysis.4

Studies are currently underway to clone the full-length cDNArelated to HBC-1. HBC-2 matched the upstream region of the antisense WT1 (Wilma' tumor suppressor gene) promoter located in thefirst intron on the chromosome 1lpl3 region; the 3' end of HBC-2 atposition 157—206matched the published sequence of the antisenseWT1 promoter at position 1—50(GenBank accession no. S79781; Ref.21), while the rest matched the unpublished sequence.5

4 T. H-M. Huang, unpublished data.

5 K. T. A. Malik, personal communication.

We further confirmed the findings of aberrant hypermethylation inbreast tumors by Southern hybridization analysis. The HBC-l probedetected an —-800-bpband (Fig. 2A, Lanes 2 and 4) in the MseIdigested tumor and normal DNAs from patient 47. HBC-l alsodetected an —800-bp fragment in the MseI/BstU I-digested breasttumor DNA from patient 47 (Fig. 14, Lane 1) but hybridized to a bandof a smaller size (—190bp) in the digested normal DNA of the samepatient (Fig. 2A, Lane 3). This result indicates that the BstU I siteslocated within the —800bp MseI-digested fragment were protected(i.e., methylated) from restriction in the tumor DNA. The —-190-bpband detected corresponds to the BstU I-restricted fragment within theHBC-l sequence, indicating that the two BstU I sites were unmethylated in the normal DNA. (A minor band at —-190bp was observed atthe MseIJBstU I-digested tumor DNA, which can be attributed to thepresence of contaminating normal tissue in the tumor sample.) Asimilar Southern hybridization result was obtained when HBC-2.l (aninternal fragment of HBC-2 from the antisense WT1 promoter) wasused as a probe (Fig. 2B, bottom). The BstU I sites located within the—1000bp MseI-digested fragment were found to be methylated in thedigested tumor DNA (Fig. 2B, Lane 1). HBC-2 detected two fragments (—200and —500bp) in the digested normal DNA (Lane 3); the—200-bp fragment corresponds to the BstU I-digested fragmentwithin HBC-2, indicating that the two BstU I sites were unmethylatedin the normal DNA, whereas the —500-bp fragment can be attributedto the presence of partially methylated BstU I sites in some normalcells.

We extended the methylation analysis of HBC-l to an additional 18breast tumor-normal DNA pairs. Fig. 3A shows representativeresults offour patients using MSRF. The HBC-l fragment was detected in theamplified double-digested tumor DNA ofpatients 19, 25, and 65, but notin that of patient 31. HBC-l was not noted in the double-digested normal

1032

HBC-1

1 IAac:cIGc:cGc@IGGAGGG!rrGA CTTTGCCACG CCATTCGTTG TGGGCTTCTA@.rJJI

51 TGCAGT'rGTc TATAAAG'rcT GGTCAGTGATGGATGGGATTTTGGAAGATG

101 TAGTGGGTAC CAAACACAGA CCCAAGATCC ATMACAACT GAAT'PrATI'C

151 TACAGAGCCATGGAAGGATGTGGAGGATGCGGAGGATACCCTGAC@C@@rJJI

2 01 @GACAGTAACGGC'l'GGGGTA @GGGTGGGG @1 201 @GGGGt2

T N T NI II I I ii

Research. on January 23, 2021. © 1997 American Association for Cancercancerres.aacrjournals.org Downloaded from

METHYLATION-5ENSITIvE RESTRICTION FINGERPRINTING

A

B

Patlent#19253165TNTNTNTNrnrnrnrn@u

I+-+-+-+-+-+-+-+-A@I++++

1234++++ 1234.@++++

1234

t,++++1234

0

II..a

— 1— @ucHBC-1

+ + + + + bp

Fig. 3. Representative results of methylationsensitive restriction fingerprinting (MSRF) andSouthern hybridization. A, Genomic DNA frombreast tumor (7)/normal (N) tissue pairs of patientswas treated (-) or untreated (+) with restrictionendonucleases as indicated. The digests were amplifiedwith a primerpair (Bsl and Bs18).Theamplified products were size-fractionated on 4.5%polyacrylamide gels. Patient numbers are shown atthe top oflanes. Molecular weight markers (lOO-bpladder, Life Technologies, Inc.) are shown to thetight.Arrowheads,the locationof a hypermethylation-containing fragment HBC-l (see explanationin Fig. lA). B, Genomic DNA (5 gig) was treated(+) or untreated (-) with restriction endonucleasesas indicated and subjected to Southern hybridization analysis using HBC-l as a probe. T, breasttumor, N, normal breast tissue. Patient numbers areshown at the top of lanes. Molecular weight markers (100 bp ladder; Life Technologies, Inc.) areshown to the tight.

-@

19

T N+ ++ +

25T N+ +

31

T N+ +

65T N+ +

Patlent#

N@uI -

h@I +

—1,530

h • —600

@“ —200ii'

DNA of these patients (Residual intensifies of bands seen in the doubledigested normal DNA could be due to incomplete restriction ofBstU I orlow-level methylation). A parallel Southern hybridization analysis (Fig.3B) was also conducted, showing a consistent finding of hypermethylation detected in the tumor DNA of patients 19, 25, and 65. The digestedtumor DNA of patient 31 showed at least two smaller fragments (Fig. 3B, arrowheads), —200and --‘400bp, that can be attributed to partiallymethylated or unmethylated BstU I sites within the MseI-restiicted fragmont. This condition may reflect the heterogeneous nature ofthis primarytumor or contamination of normal cells in the tumor specimen analyzed.The methylation data based on Southern hybridization as well as patients'clinical information are summarized in Table 1. Taken together, HBC-lwas methylated aberrantly in 90% (17 of 19 patients) of the primarybreast tumors examined. Currently, we are studying more tumor samples

to determine whether hypermethylation of HBC-1 is correlated withspecific cinicopathological parameters of the patients with breast cancer.

Hypermethylation of HBC-2 within the antisense promoter in theintron 1 of WT1 also appeared to be common in primary breastcarcinomas.4 We are currently extending the methylation study to thepromoter and first exon regions of WT1 . The results will be reportedin a separate paper.

Several conditions may interfere with identification of true abnormal methylation sites from breast tumors. As discussed by others,artifacts occur in the PCR-based methodologies such as representstional difference analysis (22) or differential display (23). As shownin Fig. 3A, this potential problem can be minimized by studyingindependent tumors and by scoring the same aberrant PCR productsonly consistently revealed in a group of patients. Secondly, because

1033

0

.@

.@

Research. on January 23, 2021. © 1997 American Association for Cancercancerres.aacrjournals.org Downloaded from

Patientno.Age

atdiagnosis (yr)Histological @aClinical staging'@Methylation

statusof HBC-l intumorc364MD,IDC11Th+964MD,IDClib+1964MD,IDCIV+2542MD,IDClila+2750MD,IDCifib+2977WD,

IDCND+3160PD,IDCFIb-3340Lobularlila+4335PD,

IDCHib—4544MD,IDCifia+4738PD,IDClila+6542PD,

IDClila+6740MD,IDC11Th+7133MD,IDCIla+7356MD,IDCHa+7948MD,IDCHa+8345MD,

IDCLila+8776MD,IDCIla+8983PD,LDCIV+

poorly differentiated;

METHYLATION-SENSI11VERESTRICTION FINGERPRINTING

Table 1 Clinical information and methylation studies offemale patients with breasttumors

a WD, well-differentiated; MD, moderately differentiated; PD,

LDC,infiltrating ductal carcinoma.b Clinical staging was according to the criteria of the American Joint Committee on

Cancer (27). ND, not determined.C ÷, hypermethylation in tumor; —, lack of methylation in tumor (see additional

description in the text).

primary tumor specimens rather than homogeneous cell lines wereused in our MSRF screening, residual normal tissue is likely to bepresent in the cancer biopsies, or vice versa. Nevertheless, the residualtissue contamination problem does not apply to detecting the gain ofPCR fragments containing hypermethylated CpG sequences in tumorspecimens that have some normal cells present.

MSRF also can be applied to detect hypermethylated DNA inspecimens with multicenter or multifocal lesions, in which it is notpossible to obtain pure tumor cells. However, the detection of hypomethylation-containing fragments by MSRF can be impaired if containinating normal cells are present in the tumor tissue to be tested.Because a small amount of genomic DNA (20—100ng) is applied inMSRF, one future improvement would be the use of microdissectiontechniques (24), which allows the isolation of pure cell populations.

To our knowledge, only one other technique, RLGS, has previouslybeen developed for screening changes of CpG methylation betweendifferent cell types (25, 26). RLGS employed digestion of genomicDNA with a series of restriction endonucleases, one being methylationsensitive NotI. The digests are then subjected to two rounds of gelelectrophoresis, generating complicated two-dimensional DNA patterns. Identification of methylation differences is based on comparisonof more than 2500 Not! spots between two autoradiographs representing two different cell types. The procedure had the advantage ofsurveying thousands of CpG islands in a single experiment. Thelimitation of RLGS is that a substantial amount of genomic DNA isrequired to start with, to enable the subsequent cloning of differentialspots. For example, 500 @gof genomic DNA was used by Kawai eta!. (25) in RLGS to clone methylation-specific DNA spots for different stages of brain development in the mouse.

MSRF, described here, provides an additional approach to study CpGmethylation throughout the genome. The procedure is PCR based, onlyneeds a small amount of genomic DNA, and, thus, is suitable for analyzing clinical specimens. DNA of interest is isolated directly from gelsand reamplified by PCR for cloning. Additionally, it should be possibleto speed up methylation screening with more short primers by a highthroughput protocol using a 96—wellplate format thermocycler. Therefore, it is expected that MSRF should have a wide-ranging application inthe study of changes in DNA methylation in cancer as well as in aging,cell differentiation, and development.

Acknowledgments

The authors thank Dr. Wade V. Welshons and Christina M. Khojasteh forcritical reading of the manuscript.

References

1. Baylin, S. B., Makos, M., Wu, J. J., Yen, R. W. C., de Bustros, A., Vertino, P., andNelkin, B. D. Abnormal patterns of DNA methylation in human neoplasia: potentialconsequences for tumor progression. Cancer Cells (Cold Spring Harbor), 3: 383—390,1991.

2. Jones, P. A. DNA methylation errors and cancer. Cancer Res., 56: 2463—2467, 1996.3. Adam, R. L. P., and Burdon, R. H. Molecular biology of DNA methylation. New

York: Springer-Verlag New York, Inc., 1985.4. Ottaviano, Y. L., Issa, J-P., Parl, F. F., Smith, H. S., and Baylin, S. B. Methylation of

the estrogen receptor gene CpG island marks loss of estrogen receptor expression inhuman breast cancer cells. Cancer Res., 54: 2552—2555,1994.

5. Huynh, L., Alpert, L, and Pollak, M. Silencing of the mammary-derived growthinhibitor (MDGL) gene in breast neoplasms is associated with epigenetic changes.Cancer Res., 56: 4865—4870, 1996.

6. Lee, W-H., Morton, R. A., Epstein, J. I., Brook, J. D., Campbell, P. A., Bova, 0. 5.,Hsieh, W. S., Isaacs, W. B., and Nelson, W. G. Cytidine methylation of regulatorysequences near the ir-class glutathione S-transferase gene accompanies human prostatic carcinogenesis. Proc. NaIl. Acad. Sci. USA, 91: 11733—11737, 1994.

7. Herman, S. G., Latif, F., Weng, Y., Lerman, M. I., Thar, B., Liu, S., Samid, D., Duan,D-S. R., Gnarra, R. J., Linehan, W. M., and Baylin, S. B. Silencing of the VHLtumor-suppressor gene by DNA methylation in renal carcinoma. Proc. Nail. Acad.Sci. USA, 91: 9700—9704, 1994.

8. Sakai, T., Toguchida, J., Ohtani, N., Yandell, D. W., Rapaport, J. M., and Dryja, 1. P.Allele-specific hypermethylation of the retinoblastoma tumor-suppressor gene.Am. J. Hum. Genet., 48: 880—888,1991.

9. Wales, M. M., Bid, M. A., El Deiry, W., Nelkin, B. D., Issa, J-P., Cavenee W. K.,Kuerbitz, S. J., and Baylin, S. B. p53 activates expression of HIC-l, a new candidatetumor suppressor gene on llpl3.3. Nat. Med., 1: 570—577,1995.

10. Herman, J. G., Merlo, A., Mao, L., Lapidus, R. G., Issa, i-P. J., Davidson, N. E.,Sidransky, D., and Baylin, S. B. Inactivation of the CDKN2/p16/MTSJ gene isfrequently associated with aberrant DNA methylation in all common human cancers.Cancer Res., 55: 4525—4530,1995.

11. Gonzalez-Zulueta, M., Bender, C. M., Yang, A. S., Nguyen, T., Bean, R. W., VanTomout, J. M., and Jones P. A. Methylation of the 5' CpG island of the p16/CDKN2tumor suppressor gene in normal and transformed human tissues correlates with genesilencing. Cancer Res., 55: 453 1—4535,1995.

12. Yoshiura, K., Kanai, Y., Ochiai, A., Shimoyama, Y., Sugimura, T., and Hirohashi, S.Silencing of the E-cadherin invasion-suppressor gene by CpG methylation in humancarcinomas. Proc. Nati. Acad. Sci. USA, 92: 7416—7419,1995.

13. Ponce, M. R., and Micol, J. L. PCR amplification of long DNA fragments. NucleicAcids Res., 20: 623, 1992.

14. Altschul, S. F., Gish, W., Miller, W., Myers, E. W.. and Lipman. D. J. Basic localalignment search tool. J. Mol. Biol., 215: 403—410,1990.

15. Huang, T. H-M., Hejtmancik. J. F., Edwards, A., Pettigrew, A. L, Herrera, C. A.,Harnmand, H. A., Caskey, C. T., Zoghbi, H. Y., and Ledbeuer, D. H. Linkage ofthe genefor an X-linked mental retardation disorder to a hypervariable (AGAT)n repeat motifwithin the human HPRT locus (Xq26). Am. I. Hum. Genet., 49: 1312-1319, 1991.

16. Williams, J. G. K., Kubelik, A. R., Livak, K. I., Rafalski, J. A., and Tingey, S. V.DNA polymorphisms amplified by arbitrary primers are useful as genetic markers.Nucleic Acids Res., 18: 6531—6535,1990.

17. Welsh, J., and McClelland, M. Fingerprinting genomes using PCR with arbitraryprimers. Nucleic Acids Res., 18: 7213—7218,1990.

18. Peinado, M. A., Malkhosyan, S., Velasquez, A., and Perucho, M. Isolation andcharacterization of ailelic losses and gains in colorectal tumors by arbitrarily primedpolymerase chain reaction. Proc. Natl. Acad. Sci. USA, 89: 10065—10069,1992.

19. Liang, P., and Pardee,A. B. Differentialdisplayofeukaryotic messengerRNA by meansof the polymerase chain reaction. Science (Washington DC), 257: 967-971, 1992.

20. Cross, S. H., Charlton, J. A., Nan, X., and Bird, A. P. Purification of CpG islandsusing a methylated DNA binding column. Nat. Genet., 6: 236—244,1994.

21. Malik, K. T. A., Wallace, J. I., Ivins, S. M., and Brown, K. W. Identification of anantisense WT1 promoter in intron 1: implication for Wil gene regulation. Oncogene,II: 1589—1595,1995.

22. Lisitsyn, N., Lisitsyn, N., and Wigler, M. Cloning the differences between twocomplex genomes. Science (Washington DC), 259: 946—951, 1993.

23. Watson, M. A., and Fleming, 1. P. Isolation of differentially expressed sequence tagsfrom human breast cancer. Cancer Res., 54: 4598—4602,1994.

24. Zheng, Z., Merino, M. J., Chuaqui, R., Lioua, L. A., and Emmett-Buck, M. R.Identical allelic loss on chromosome 11q13 in micmdissected in situ and invasivehuman breast cancer. Cancer Res., 55: 467—471, 1995.

25. Kawai, J., Hirotsune, S., Hirose, K., Fushiki, S., Watanabe, S., and Hayashizaki, Y.Methylation profiles of genomic DNA of mouse developmental brain detected byrestriction landmark genomic scanning (RLGS) method. Nucleic Acids Res., 21:5604—5608,1993.

26. Hatada, I., Sugama, S., and Mukai, T. A new imprinted gene cloned by a methylationsensitive genome scanning method. Nucleic Acids Res., 21: 5577—5582,1993.

27. American Joint Committee on Cancer. Manual for Staging of Cancer, pp. 93—99.Philadelphia: J. B. Lippincots Co., 1989.

1034

Research. on January 23, 2021. © 1997 American Association for Cancercancerres.aacrjournals.org Downloaded from

1997;57:1030-1034. Cancer Res   Tim Hui-Ming Huang, Douglas E. Laux, Brian C. Hamlin, et al.   Fingerprinting TechniqueCarcinomas Using the Methylation-sensitive Restriction Identification of DNA Methylation Markers for Human Breast

  Updated version

  http://cancerres.aacrjournals.org/content/57/6/1030

Access the most recent version of this article at:

   

   

   

  E-mail alerts related to this article or journal.Sign up to receive free email-alerts

  Subscriptions

Reprints and

  .pubs@aacr.orgDepartment at

To order reprints of this article or to subscribe to the journal, contact the AACR Publications

  Permissions

  Rightslink site. Click on "Request Permissions" which will take you to the Copyright Clearance Center's (CCC)

.http://cancerres.aacrjournals.org/content/57/6/1030To request permission to re-use all or part of this article, use this link

Research. on January 23, 2021. © 1997 American Association for Cancercancerres.aacrjournals.org Downloaded from