Identification of Restriction Factors by Human Genome-Wide RNAInterference Screening of Viral Host Range Mutants Exemplified byDiscovery of SAMD9 and WDR6 as Inhibitors of the Vaccinia VirusK1LC7L Mutant

Gilad Sivana Pinar Ormanoglub Eugen C Buehlerb Scott E Martinb Bernard Mossa

Laboratory of Viral Diseases National Institute of Allergy and Infectious Diseasesa and Division of Preclinical Innovation National Center for Advancing TranslationalSciencesb National Institutes of Health Bethesda Maryland USA

Present address Scott E Martin Department of Discovery Oncology Genentech Inc South San Francisco California USA

ABSTRACT RNA interference (RNAi) screens intended to identify host factors that restrict virus replication may fail if the virusalready counteracts host defense mechanisms To overcome this limitation we are investigating the use of viral host range mu-tants that exhibit impaired replication in nonpermissive cells A vaccinia virus (VACV) mutant with a deletion of both the C7Land K1L genes K1LC7L which abrogates replication in human cells at a step prior to late gene expression was chosen for thisstrategy We carried out a human genome-wide small interfering RNA (siRNA) screen in HeLa cells infected with a VACVK1LC7L mutant that expresses the green fluorescent protein regulated by a late promoter This positive-selection screen hadremarkably low background levels and resulted in the identification of a few cellular genes notably SAMD9 and WDR6 fromapproximately 20000 tested that dramatically enhanced green fluorescent protein expression Replication of the mutant viruswas enabled by multiple siRNAs to SAMD9 or WDR6 Moreover SAMD9 and WDR6 clustered regularly interspaced short palin-dromic repeat (CRISPR)Cas9 knockout HeLa cell lines were permissive for replication of the K1LC7L mutant in agreementwith the siRNA data Expression of exogenous SAMD9 or interferon regulatory factor 1 restricted replication of the K1LC7L

mutant in the SAMD9 cells Independent interactions of SAMD9 with the K1 and C7 proteins were suggested by immunopre-cipitation Knockout of WDR6 did not reduce the levels of SAMD9 and interactions of WDR6 with SAMD9 C7 and K1 proteinswere not detected suggesting that these restriction factors act independently but possibly in the same innate defense pathway

IMPORTANCE The coevolution of microbial pathogens with cells has led to an arms race in which the invader and host continu-ously struggle to gain the advantage For this reason traditional siRNA screens may fail to uncover important immune mecha-nisms if the pathogens have already developed effective responses However host-restricted viral mutants have lost one or moredefense genes needed for their replication in nonpermissive cells By screening human genome libraries of short RNAs that in-hibit the expression of individual host genes in nonpermissive cells we identified SAMD9 and WDR6 as major restriction factorsthat prevented replication of a vaccinia virus mutant and suggest that host range screening can be generally useful for the inves-tigation of host-pathogen interactions

Received 7 July 2015 Accepted 13 July 2015 Published 4 August 2015

Citation Sivan G Ormanoglu P Buehler EC Martin SE Moss B 2015 Identification of restriction factors by human genome-wide RNA interference screening of viral host rangemutants exemplified by discovery of SAMD9 and WDR6 as inhibitors of the vaccinia virus K1LC7L mutant mBio 6(4)e01122-15 doi101128mBio01122-15

Editor Terence S Dermody Vanderbilt University School of Medicine

Copyright copy 2015 Sivan et al This is an open-access article distributed under the terms of the Creative Commons Attribution-Noncommercial-ShareAlike 30 Unported licensewhich permits unrestricted noncommercial use distribution and reproduction in any medium provided the original author and source are credited

Address correspondence to Bernard Moss bmossnihgov

This article is a direct contribution from a Fellow of the American Academy of Microbiology

The coevolution of microbial pathogens with cells has led to anarms race in which the invader and host continuously struggle

to gain the advantage In principle human genome-wide smallinterfering RNA (siRNA) screening of infected cells has the poten-tial to reveal novel immune mechanisms However knockingdown expression of a host defense gene may have little effect if thepathogen has already developed an effective counterresponseTheoretically this limitation could be overcome by using a micro-bial mutant that has lost the ability to effectively respond to aspecific immune mechanism Since cells vary in the extent towhich they express innate defenses such microbial mutants often

exhibit a host range phenotype Consequently one strategy wouldbe to screen siRNA libraries in nonpermissive cells infected withhost range mutants and monitor rescue of infection An attractivefeature of such a screen is that knocking down mRNA expressionwould enable replication of the mutant and therefore elicit a pos-itive response which is likely to minimize nonrelevant indirecteffects The present study demonstrates the power of this ap-proach using a poxvirus host range mutant

Poxviruses are large DNA viruses that reproduce in the cyto-plasm and encode numerous proteins involved in host interac-tions and replicative functions (1) The best known poxvirus spe-

RESEARCH ARTICLE crossmark

JulyAugust 2015 Volume 6 Issue 4 e01122-15 reg mbioasmorg 1

on March 14 2020 by guest

httpmbioasm

orgD

ownloaded from

on M

arch 14 2020 by guesthttpm

bioasmorg

Dow

nloaded from

on March 14 2020 by guest

httpmbioasm

orgD

ownloaded from

cies belong to the orthopoxvirus genus and include variola virusthe vanquished agent of smallpox vaccinia virus (VACV) the livevaccine that eradicated smallpox monkeypox virus the cause of asmallpox-like zoonosis and cowpox virus the agent of a zoonosiscausing mainly localized skin lesions Approximately half of the200 genes of VACV the most intensively studied orthopoxvirusare conserved in all chordopoxviruses (2) and most of these genesare essential for replication The remaining genes are mainly in-volved in virus-cell interactions and some determine host rangeand virulence (3 4) Although host range defects may be associ-ated with loss of a single gene the loss of both C7L and K1L isnecessary to restrict VACV replication in mammalian cell lines(5ndash7) The requirement for both C7L and K1L is intriguing be-cause these two complementary genes are unrelated in sequenceMoreover a third unrelated gene from cowpox virus that is absentfrom VACV is also able to functionally complement the absence ofC7L and K1L genes (6) Without these host range genes the rep-lication block is manifested at the level of viral gene expression(8ndash12)

One or more homologs of the C7 protein are encoded by mostpoxvirus genera although they are only 20 to 30 identical andshare no recognizable motif (13) Myxoma virus carries genes en-coding three tandem C7 homologs but only MO62 could substi-tute for VACV C7 in overcoming host range restriction (14) Fur-ther studies indicated that the MO62 protein binds to the hostSAMD9 (sterile alpha motif domain-containing 9) protein andthat MO63 a second myxoma C7 homolog facilitates the latterinteraction (15) Importantly knockdown of SAMD9 expressionpartially relieved the host range restriction of the MO62 null mu-tant However the VACV C7 protein was reported not to bindSAMD9 in the context of a myxoma virus infection leaving openthe cellular antagonist of C7 (13 15) The K1 protein which isencoded by some but not all members of the orthopoxvirus genushas no nonpoxvirus homologs and is comprised almost entirely ofankyrin repeats that are important for function (16ndash18) K1 hasbeen reported to inhibit NF-B activation by preventing IBdegradation (19) and to inhibit protein kinase R phosphorylation(20) A common property of C7 and K1 proteins is their ability toantagonize antiviral activities induced by type 1 interferon andinterferon-regulated factor 1 (IRF1) (21) Nevertheless theK1LC7L mutant is unable to replicate in IRF1-negative mouseembryo fibroblasts suggesting that the latter is not the primaryrestriction factor in mouse cells

We considered it likely that VACV C7 and K1 target the samehost defense pathway and decided to conduct a human genome-wide siRNA screen to rescue the replication defect In this com-munication we report our finding that both SAMD9 and WDR6inhibit replication of the VACV K1LC7L mutant specificallyInhibition of the K1LC7L mutant by SAMD9 has also beenreported by Liu and McFadden (22)

RESULTSGenes that restrict the VACV K1LC7L host range mutantidentified by a human genome-wide siRNA screen We em-ployed the VACV mutant vK1LC7LGFP with a deletion ofthe K1L gene and replacement of the C7L gene with an open read-ing frame (ORF) encoding the green fluorescent protein (GFP)regulated by a VACV late promoter (7) GFP fluorescence was asensitive and appropriate readout since late genes are not ex-pressed in nonpermissive cells The ability of vK1LC7LGFP

to replicate in African green monkey BS-C-1 cells but not in hu-man HeLa cells is shown by plaque formation in Fig 1A Toprepare for the siRNA screen we calibrated conditions by parallelinfections of permissive BS-C-1 and restrictive HeLa cell lines in a384-well plate with serial dilution of the mutant virus GFP-positive (GFP) cells were scored using automated fluorescencemicroscopy Even at the highest multiplicity of infection therewere few GFP HeLa cells (Fig 1B) We empirically chose to use amultiplicity of 01 PFU of the mutant virus per cell which resultedin the spread of virus to ~50 of the permissive cells after 18 h butclose to zero in the nonpermissive cells (Fig 1B) These conditionsprovided an extremely robust screen capable of detecting evenminute changes in virus replication

The primary high-throughput screen was performed with theSilencer Select siRNA library from Ambion which consists ofthree different siRNAs targeting each of 21566 human genes inindividual wells A secondary high-throughput siRNA screen wascarried out with the OnTargetPlus genome-wide siRNA libraryfrom Dharmacon which consists of four pooled siRNAs to each of17320 human genes The complete data sets are provided in Ta-bles S11 to S13 and S2 in the supplemental material The redun-dant siRNA analysis tool (RSA) was used to minimize the impactof off-target activities (23) Table 1 shows the 30 RSA top-rankedsiRNA targets By far the strongest siRNA hit was to SAMD9which increased the number of GFP cells to 27 to 46 for each ofthe three siRNAs in the primary screen (Fig 1C and Table 1) andwas also the strongest hit in the secondary screen (Table 1) WDR6and FTSJ1 were ranked number 2 and 3 respectively by RSA andwere the only other hits in which the GFP-positive cells exceeded3 for each of the Ambion siRNAs and the pooled siRNAs (Ta-ble 1) SAMD9 WDR6 FTSJ1 and one lower ranked targetCDC37 were selected for additional specific testing None of theseprioritized targets were significant hits in a previous humangenome-wide screen carried out with wild-type vaccinia virus(24)

Ambion siRNAs targeting the selected genes and controlsiRNA were transfected individually into HeLa cells which weresubsequently infected with 001 PFU of vK1LC7LGFP percell and analyzed for GFP fluorescence by flow cytometry ThesiRNAs to WDR6 although less effective than the siRNA toSAMD9 allowed the host range mutant to spread to about 15 ofthe cells (Fig 2A) While still lower in efficacy the siRNAs to FTJ1and CDC37 increased spread above that of the control siRNA witha P value of 001 for the former (Fig 2A) In the present studywe focused on SAMD9 and to a lesser extent on WDR6 as majorhuman cell restriction factors for the K1LC7L host range mu-tant

SAMD9 knockdown restores the full replication cycle of theK1LC7L mutant Analyzing GFP expression in a virus spreadassay was a convenient quantitative measure of virus replicationNevertheless we wanted to confirm the role of SAMD9 by con-ventional methods HeLa cells were transfected with individualsiRNAs specific for SAMD9 or with a control siRNA and theninfected with 1 PFU of vK1LC7LGFP per cell After 24 h thevirus yields were determined by plaque assay in permissive BS-C-1cells There was a 150-fold increase in virus production afterSAMD9 knockdown compared to the control (Fig 2B) Since rep-lication of the host range mutant is arrested at the stage of viral lateprotein synthesis we also analyzed lysates of infected cells byWestern blotting using antibody to VACV proteins Between 8

Sivan et al

2 reg mbioasmorg JulyAugust 2015 Volume 6 Issue 4 e01122-15

on March 14 2020 by guest

httpmbioasm

orgD

ownloaded from

and 16 h there was a marked increase in synthesis of the majorviral proteins in cells that had been transfected with each SAMD9siRNA (Fig 2C)

Interaction of VACV C7 and K1 with SAMD9 In view of theevidence that SAMD9 is a major restriction factor for replicationof the K1LC7L mutant in HeLa cells we designed an experi-ment to determine whether the two proteins interact directly orindirectly with SAMD9 The parental VACV used to constructvK1LC7LGFP was vTF7-3 (25) which carries the gene en-coding the bacteriophage T7 RNA polymerase regulated by aVACV earlylate promoter and has been used extensively in trans-fection assays for expression of genes preceded by a T7 promoterAccordingly we constructed plasmids with genes encoding V5and FLAG epitope-tagged C7 and K1 proteins respectively withT7 promoters Both proteins were expressed following transfec-tion of permissive and nonpermissive cells that had been infectedwith vK1LC7LGFP (Fig 3A) Furthermore expression ofeither protein alone rescued replication of the host range mutantdemonstrating their biological activity (Fig 3B) Next we carriedout binding experiments in HeLa cells infected with vK1LC7LGFP Antibodies to V5 and FLAG were used to capture C7 and

K1 respectively Western blotting showed that SAMD9 was pulleddown with either viral protein (Fig 3C)

The above data could be explained by direct or indirect bindingof C7 and K1 proteins to SAMD9 To eliminate the possibility ofanother viral protein mediating the association we expressed C7and K1 with different epitope tags using a cytomegalovirus(CMV) promoter in uninfected HeLa cells SAMD9 was capturedin association with hemagglutinin (HA) epitope-tagged C7 pro-tein (C7-HA) and myc epitope-tagged K1 protein (K1-myc) anddetected by Western blotting (Fig 4A) These data eliminated thepossibility that the binding of C7 and K1 to SAMD9 is mediated byanother VACV protein but did not exclude the participation ofanother cellular protein

Assuming that C7 and K1 proteins bind directly to SAMD9they could bind to the same or different sites We carried out anadditional experiment to determine whether binding of SAMD9to C7 and K1 was enhanced or inhibited by the other HeLa cellswere infected with vK1LC7LGFP and transfected with dif-ferent ratios of the plasmids expressing V5 epitope-tagged C7 pro-tein (C7-V5) and FLAG epitope-tagged K1 protein (K1-FLAG)regulated by T7 promoters There was no obvious difference in the

FIG 1 Rescue of vK1LC7LGFP by siRNAs (A) Replication of vK1LC7LGFP in monkey BS-C-1 cells but not in human HeLa cells Cells were infectedwith wild-type VACV expressing GFP (vWT) or vK1LC7LGFP and incubated for 48 h at 37degC with a methylcellulose overlay The images were taken witha fluorescence microscope (B) Effect of virus multiplicity on virus spread HeLa and BS-C-1 cells were seeded into 384-well plates and 48 wells of each cell typewere infected with each serial dilution of vK1LC7LGFP After 18 h the cells were fixed with 2 paraformaldehyde The nuclei were stained with DAPI(4=6-diamidino-2-phenylindole) and imaged by automated fluorescence microscopy GFP-positive cells were scored and plotted against a logarithmic scale ofthe multiplicity of infection (MOI) Values are means standard deviations (error bars) Values that are significantly different (P 00001) as calculated bytwo-way ANOVA and Bonferroni test after ANOVA comparing each dilution in permissive versus nonpermissive cells are indicated by an asterisk Calculationswere made using PRISM by GraphPad (C) SAMD9 siRNAs restore replication of vK1LC7LGFP in HeLa cells Images of the GFP channel (top panels) andDAPI stain (bottom panels) were taken from the genome-wide siRNA screens Three separate SAMD9 siRNAs and a control siRNA (siControl) were tested Thepercentages of GFP-positive cells are indicated

siRNA Screening of Host Range Mutants

JulyAugust 2015 Volume 6 Issue 4 e01122-15 reg mbioasmorg 3

on March 14 2020 by guest

httpmbioasm

orgD

ownloaded from

capture of SAMD9 by C7 in the presence of K1 and vice versa(Fig 4B) In addition there was no evidence for interaction ofC7-V5 with K1-FLAG

Replication of the K1LC7L mutant in SAMD9 knockoutHeLa cells and reversal by expression of exogenous SAMD9 andIRF1 Our evidence for the major role of SAMD9 in restrictingreplication of vK1LC7LGFP was derived using siRNAs Tofurther investigate the host range defect of K1LC7L mutantsclustered regularly interspaced short palindromic repeat(CRISPR)Cas9 technology was used to disrupt the SAMD9 ORFin HeLa cells Only a trace of SAMD9 was detected by Westernblotting in one of the three clonally derived cell lines tested(Fig 5A) Using the latter the replication of vK1LC7LGFP

was evident from the significant virus spread (Fig 5B) Moreovertransfection of a SAMD9-expressing plasmid into the SAMD9knockout cells prevented replication of the host range mutant(Fig 5B)

IRF1 induces a large number of interferon-stimulated genes(26) and was shown to inhibit replication of the VACVK1LC7L mutant in permissive human Huh7 cells (21) It wastherefore of interest to see whether expression of IRF1 would in-hibit replication of K1LC7L mutant in SAMD9 knockout cellsThe latter cells were transfected with an IRF1 expression plasmidand infected with vK1LC7LGFP or a control virus (iFire)expressing K1 and C7 proteins as well as GFP and luciferase (notrelevant to this study) GFP expression was drastically reduced in

the transfected cells that were infected with the K1LC7L virusbut only modestly reduced in the control virus (Fig 5C)

Replication of vK1LC7LGFP in permissive human Huh-751 cells Meng and coworkers (21) had reported that the repli-cation of the VACV K1LC7L mutant was restricted by type 1interferons in permissive Huh-7 cells Therefore we wanted todetermine whether these cells normally expressed SAMD9 andwhether SAMD9 was induced by beta interferon (IFN-) In con-trast to HeLa cells SAMD9 was not detected in Huh751 cells byWestern blotting (Fig 6A and B) However IFN- but not IRF1increased SAMD9 expression in Huh-751 cells (Fig 6A and B)SAMD9 siRNA partially reduced SAMD9 expression induced byinterferon (Fig 6A and B) and enhanced vK1LC7LGFP

spread in interferon-treated Huh-751 cells (Fig 6C) Taken to-gether these data suggest that insufficient SAMD9 could explainthe permissiveness of Huh-751 cells in the absence of interferon

Further analysis of the effect of WDR6 on vK1LC7L replica-tion WDR6 was the second strongest hit in the genome-widescreen In order to confirm the siRNA data we used CRISPRCas9technology to inactivate the WDR6 gene in HeLa cells There wasa partial reduction of WDR6 expression in cell line 1 and a morecomplete inactivation in cell line 2 suggesting knockout of oneand two alleles respectively (Fig 7A) In neither cell line howeverwas a reduction in SAMD9 noted (Fig 7A) Moreover SAMD9retained the ability to interact with C7 and K1 proteins in theabsence of WDR6 Replication of vK1LC7L corresponded in-

TABLE 1 Priority hits of primary and secondary human genome-wide siRNA screensa

Gene symbol GeneID

GFP-positive cellsNo of siRNAs with3 GFP cells

RSA logPscoreAmbion_1 Ambion_2 Ambion_3 Dharmacon

SAMD9 54809 4649 3410 2698 1610 4 127WDR6 11180 1044 531 443 440 4 76FTSJ1 24140 531 377 341 618 4 67MAPK14 1432 368 354 322 029 3 65CDC37 11140 787 503 297 167 2 63GNPDA2 132789 568 515 297 036 2 63DPAGT1 1798 753 571 061 000 2 56CRHBP 1393 1015 336 238 038 2 53IARS 3376 766 368 219 006 2 52ALPK2 115701 472 333 211 048 2 52SORCS3 22986 1266 487 208 NA 2 51PPP1R11 6992 595 368 204 028 2 51DPAGT1 1798 753 571 061 000 2 47CKAP5 9793 480 480 000 000 2 46CDS1 1040 993 453 076 012 2 45PAQR5 54852 948 433 123 028 2 45PDCL 5082 419 418 164 089 2 45ARPC1A 10552 479 334 161 000 2 44UTP11L 51118 566 409 068 056 2 43PPP3CB 5532 897 387 019 039 2 43PDE4B 5142 647 384 094 010 2 41AMACR 23600 397 363 053 035 2 41AURKB 9212 693 357 020 000 2 40PROCA1 147011 407 345 065 016 2 39PTPN11 5781 348 326 103 008 2 39POLD2 5425 341 324 048 003 2 39KLK7 5650 655 312 060 000 2 38MSTN 2660 1283 302 012 013 2 37ABHD4 63874 670 301 033 005 2 25KIF11 3832 503 163 062 628 2 25a The primary screen was performed with three individual siRNAs targeting each gene from the Ambion Silencer Select siRNA library The secondary screen was performed withfour pooled siRNAs targeting each gene from the Dharmacon OnTargetPlus siRNA library The genes are ordered according to their RSA logP scores

Sivan et al

4 reg mbioasmorg JulyAugust 2015 Volume 6 Issue 4 e01122-15

on March 14 2020 by guest

httpmbioasm

orgD

ownloaded from

versely to the WDR6 level WDR62 WDR61 HeLa cells(Fig 7B)

DISCUSSION

The present study demonstrates the power of a genome-widesiRNA screen to unambiguously identify cellular restriction fac-tors for a virus host range mutant Of the more than 20000 humangenes probed only siRNAs to SAMD9 fully rescued the VACVK1LC7L host range mutant as determined by the facile GFPspread assay Moreover SAMD9 was the strongest hit for each of

FIG 2 Validation of SAMD9 as a major host restriction factor forvK1LC7LGFP (A) Comparison of positive-hit siRNAs The indicatedsiRNAs were individually transfected into HeLa cells in a 24-well format After48 h the cells were infected with 001 PFU of vK1LC7LGFP per cell andincubated for 18 h GFP-positive cells were scored by flow cytometry Datafrom three experiments each carried out in triplicate were combined Valuesare means plus standard deviation (error bars) Values that are significantlydifferent from the siControl value calculated by Bonferroni test after the one-way ANOVA test using PRISM GraphPad software are indicated by asterisks asfollows P 0001 P 005 (B) Replication of vK1LC7LGFP inHeLa cells transfected with SAMD9 siRNA Three different SAMD9 siRNAsand control siRNA were transfected into HeLa cells in a 24-well format After48 h the cells were infected with 001 PFU of vK1LC7LGFP and incu-bated for 24 h Cells were lysed by freezing and thawing and infectious virustiters were determined by plaque assay on permissive BS-C-1 cells Data fromtwo experiments each carried out in triplicate were combined Values aremeans plus standard deviation (error bars) Values that are significantly dif-ferent (P 0005) from the siControl value calculated by Bonferroni test afterthe one-way ANOVA test using PRISM GraphPad software are indicated ()(C) Synthesis of viral proteins in HeLa cells transfected with SAMD9 siRNAand infected with vK1LC7LGFP HeLa cells were transfected with control(siCtr) or three different SAMD9-specific siRNAs for 48 h and then infectedwith 3 PFU of vK1LC7LGFP per cell for the indicated hours postinfection(HPI) The cells were lysed and the proteins were resolved by SDS-PAGE andWestern blotting with broadly reactive antibodies to VACV proteins The elec-trophoretic positions of molecular mass markers (in kilodaltons) are indicatedto the left of the gel

FIG 3 C7L and K1L proteins physically interact with SAMD9 (A) Expressionof C7L-V5 and K1L-FLAG following transfection with bacteriophage T7 pro-moter plasmids HeLa cells were infected with vK1LC7LGFP which ex-presses the T7 RNA polymerase and transfected 1 h later with plasmids T7-C7L-V5 and T7-K1L-FLAG encoding C7L-V5 (two clones) or K1L-FLAGregulated by T7 promoters respectively After 14 h the cells were lysed andtheir proteins were resolved by SDS-PAGE and Western blotting with antibod-ies to the V5 and FLAG epitope tags The positions of molecular mass markers(M) (in kilodaltons) are indicated to the left of the gel (B) Rescue ofvK1LC7LGFP by expression of C7 or K1 protein HeLa cells were infectedwith vK1LC7LGFP and mock transfected (upper panel) or transfectedwith T7-C7L-V5 or T7-K1L-FLAG for 16 h Cells were imaged by GFP fluo-rescence microscopy and bright-field microscopy (C) Association of C7 andK1 proteins with SAMD9 HeLa cells were infected with vK1LC7LGFP

and mock transfected () or transfected () with T7-C7L-V5 or T7-K1L-FLAG for 16 h The cells were lysed and incubated with antibodies to the V5 orFLAG epitope tag and captured with magnetic beads conjugated to protein GInput and eluted proteins were resolved by SDS-PAGE following Westernblotting with antibodies to endogenous SAMD9 and to V5 and FLAG tags Theposition of the heavy chain of the antibody is indicated by an asterisk to theright of the gel The experiment was repeated three times with similar resultsAbbreviations IP immunopurification V5 antibody to V5 epitope FLAGantibody to FLAG epitope

siRNA Screening of Host Range Mutants

JulyAugust 2015 Volume 6 Issue 4 e01122-15 reg mbioasmorg 5

on March 14 2020 by guest

httpmbioasm

orgD

ownloaded from

three individual siRNAs in the primary screen as well as for a poolof four siRNAs in the secondary screen Only two additional genetargets namely WDR6 and FTSJ1 scored highly positive for allthree individual siRNAs in the primary screen as well as the pooledsiRNAs in the secondary screen Further analyses confirmed thatthe siRNAs targeting SAMD9 WDR6 and FTSJ1 significantly en-hanced spread of the mutant in the order SAMD9 WDR6 FTSJ1 On the basis of these results we focused primarily onSAMD9 and to a lesser extent on WDR6 The roles of SAMD9 andWDR6 in preventing replication of vK1LC7L were confirmedby demonstrating that both SAMD9 and WDR6 CRISPRCas9

knockout human cell lines were permissive for replication of themutant virus

Although SAMD9 had been shown to be an antagonist of themyxoma virus C7 homolog MO62 prior to this study (15) we didnot anticipate that it would also be a major restriction factor forthe VACV K1LC7L mutant for the following reason Althoughproteomic studies had identified SAMD9 as a binding partner ofMO62 (15) the C7 protein was reported not to interact withSAMD9 when expressed by transfection in cells infected withmyxoma virus leading to the suggestion that C7 might act at an-other step possibly in the SAMD9 antiviral pathway (13 15) Fur-thermore replication of the C7LK1L mutant is restricted inmouse cells (14) which do not carry genes that encode SAMD9(27) Nevertheless we found that C7 and K1 independently inter-acted with SAMD9 both in VACV-infected and uninfected cellsDifferences in the experimental protocols likely contributed to thedifferent conclusions Interestingly SAMD9 was not diminishedin WDR6 knockout cells and thus far we have not detected aninteraction between WDR6 and SAMD9 C7 or K1 After ourscreen was completed Liu and McFadden (22) also reported thatknocking down SAMD9 rescued a VACV K1LC7L mutant inhuman cells

Although the K1LC7L VACV mutant is defective in mosthuman cells hepatoma Huh-7 cells are an exception (7) TheVACV K1LC7L mutant was able to grow in Huh-751 cellsderived from Huh-7 cells (28) but was inhibited by pretreatmentof the cells with beta interferon SAMD9 was detected by Westernblotting in Huh-751 cells only after interferon treatment Knock-down of SAMD9 with siRNA in interferon-treated Huh-751 cellspartially restored replication of the mutant virus suggesting thatthe innate level of SAMD9 in untreated Huh-751 cells may be toolow to inhibit the VACV K1LC7L mutant

The K1LC7L VACV mutant and the corresponding myx-oma virus mutant exhibit impaired viral protein synthesis (8ndash1015) However relatively little is known about SAMD9 function(27) In some cells SAMD9 expression is upregulated by tumornecrosis factor type I and II interferons and IRF1 (26 28ndash30)and mutations have been associated with the severe rare diseasenormophosphatemic familial tumoral calcinosis (31) Liu andMcFadden (22) showed that SAMD9 associates with stress gran-ules induced by sodium arsenate and cytoplasmic granulesformed after infection with myxoma virus MO62 and VACVK1LC7L and VACV E3L host range mutants Still less isknown about WDR6 than SAMD9 WDR6 belongs to the WDrepeat protein family found in all eukaryotes with roles in a vari-ety of functions including signal transduction transcription andcellular proliferation (32ndash34) However we are unaware of anyknown relationship between SAMD9 and WDR6 Poxvirus hostrange mutants may provide a handle to determine the cellularfunctions of SAMD9 and WDR6 In addition the successful use ofa poxvirus host range mutant for screening against a humangenome-wide library suggests that this approach should be appli-cable to other virus families

MATERIALS AND METHODSCells and viruses BS-C-1 (ATCC CCL-26) and HeLa (ATCC CCL-2)cells were grown in minimum essential medium with Earlersquos salt andDulbecco minimum essential medium respectively supplemented with10 fetal bovine serum 100 U of penicillin and 100 g of streptomycinper ml (Quality Biologicals Gaithersburg MD) Huh-751 cell were

FIG 4 C7L and K1L interact with SAMD9 independently and in the absenceof other viral proteins (A) HeLa cells were infected with vK1LC7LGFP

and transfected with 3 g of T7-C7L-V5 and increasing amounts of T7-K1L-FLAG or with 3 g of T7-K1L-FLAG and increasing amounts of T7-C7L-V5The amounts of T7-C7L-V5 and T7-K1L-FLAG (in micrograms) are givenabove the gels ( none) After 16 h the cells were lysed and incubated withantibodies for the V5 or FLAG epitope tag Input and proteins captured bymagnetic beads conjugated to protein G were resolved by SDS-PAGE andWestern blotting with antibodies to endogenous SAMD9 and V5 or FLAGepitope tag The positions of mass markers (in kilodaltons) are shown to theleft of the gels The positions of tagged proteins are shown to the right of thegels The position of the antibody heavy chain is indicated by an asteriskAbbreviations IP immunopurification V5 antibody to V5 epitope FLAGantibody to FLAG epitope (B) Uninfected HeLa cells were transfected withplasmids that express C7L-HA K1L-myc or enhanced GFP (eGFP) regulatedby CMV promoters After 24 h the cells were lysed and incubated with anti-bodies to the HA or myc epitope tag Input and eluted proteins were analyzedby SDS-PAGE and Western blotting to detect C7L-HA K1L-myc and endog-enous SAMD9

Sivan et al

6 reg mbioasmorg JulyAugust 2015 Volume 6 Issue 4 e01122-15

on March 14 2020 by guest

httpmbioasm

orgD

ownloaded from

grown in Dulbecco minimum essential medium supplemented with 10fetal bovine serum 10 mM HEPES and 1 nonessential amino acidsVACV with deletions of the C7L and K1L ORFs and expressing GFP andbacteriophage T7 RNA polymerase (7) was a generous gift of Yan Xiang

Plasmids The following primers were used for PCR to construct plas-mids in which K1L C7L and SAMD9 were regulated by bacteriophage T7promoters C7L forward TAATACGACTCACTATAGGGAATTGTGAGCGCTCGCCACATGGGTATACAGCACGAATTCGAC C7L reverseTACGTAGAATCGAGACCGAGGAGAGGGTTAGGGATAGGCTTACCATCCATGGACTCATAATCTCTATACGG K1L forward TAATACGACTCACTATAGGGAATTGTGAGCGCTCGCCACATGGATCTGTCACGAATTAATACTTGG K1L reverse CTACTTGTCGTCATCGTCTTTGTAGTCTACGTTTTTCTTTACACAATTGACGTACATG SAMD9 for-ward TAATACGACTCACTATAGGGAATTGTGAGCGCTCGCCACATGGCAAAGCAACTTAACCTTCCAG and SAMD9 reverse (TTAAGCGTAATCTGGAACATCGTATGGGTAAACAATTTCAATGTCATAAGCAAGTGG

PCR products were cloned into the Zero Blunt PCR cloning vector(Life Sciences Technologies) and sequenced CMV-C7L-HA and CMV-K1L were codon optimized and synthetized by GeneArt Life SciencesTechnologies

Antibodies and other reagents Antibodies specific for humanSAMD9 and epitope tags for V5 myc HA and FLAG were purchased fromSigma IFN- was purchased from Antigenix America Inc Silencer Selectpredesigned siRNAs were purchased from Ambion (Life Sciences Tech-nologies)

High-throughput screen Screening was conducted as previously de-scribed (24) using the Ambion Silencer Select Human Genome siRNALibrary version 4 which targets ~21500 genes with the vast majorityconsisting of three nonoverlapping and nonpooled siRNAs and the Dhar-macon On-Target Plus SMARTpool siRNA consisting of four uniquesiRNA duplexes per gene in a single well Image acquisition with a Molec-ular Devices ImageXpress Micro high-content platform integrated into anAgilent BioCel robotic system and image processing were previously de-scribed (24) A number of parameters were calculated using associatedMetaXpress software These included the percentage of cells positive forvirus and total nuclei Data were ranked by the percentage of cells positivefor virus The redundant siRNA analysis tool (RSA) was used to minimizethe impact of off-target activities (23)

Western blot analysis Proteins of whole-cell lysates were separated in4 to 12 Novex NuPAGE acrylamide gels with 2-(N-morpholino)ethanesulfonic acid buffer or 3 to 8 Tris-acetate gels and transferred tonitrocellulose membranes using the iBlot system (Invitrogen) The mem-brane was blocked with 5 nonfat milk in Tris-buffered saline and thenincubated for 2 h at room temperature or overnight at 4degC in the samesolution with 005 Tween 20 and primary antibodies at appropriatedilutions Excess antibodies were removed by washing with Tris-bufferedsaline containing Tween 20 followed by phosphate-buffered saline with-out detergent IRDye 800- or 700-conjugated secondary antibodiesagainst mouse and rabbit antibodies were added and the mixture wasincubated for 1 h at room temperature washed and developed using anOdyssey infrared imager (LI-COR Biosciences Lincoln NE) The imageswere acquired with Image Studio software (LI-COR Biosciences LincolnNE) and prepared with Adobe Photoshop

Immunoprecipitation Cells from six-well plates were washed withcold phosphate-buffered saline scraped off and lysed in 1 NP-40

FIG 5 Rescue of vK1LC7LGFP by inactivation of SAMD9 and inhibi-tion of replication by IRF1 (A) Generation of SAMD9-deficient cells byCRISPRCAS9 technology HeLa cells were transfected with the CRISPRCas9components as described in Materials and Methods Colonies were lysed andtheir proteins were resolved by SDS-PAGE and analyzed by Western blottingto detect endogenous SAMD9 and -actin as a loading control Colony 3 waschosen for further experiments and labeled as SAMD9 HeLa cells (B)Functional validation of SAMD9 HeLa cells Normal HeLa cells andSAMD9 HeLa cells were infected with 001 PFU of vK1LC7LGFPOne set of infected SAMD9 cells were transfected with T7-SAMD9-HAAfter 18 h GFP-positive cells were scored by flow cytometry (Inset) Westernblot demonstrating expression of SAMD9 by T7-SAMD9-HA Data from twoseparate experiments each performed in triplicate were combined Values aremeans plus standard deviations (error bars) The value that was significantlydifferent (P 0001) from the value for the untransfected control calculatedby Bonferroni test after one-way ANOVA using PRISM GraphPad software isindicated () (C) Overexpression of IRF1 prevents spread of vK1LC7LGFP in SAMD9 HeLa cells SAMD9 cells were mock transfected ortransfected with plasmid expressing IRF1 regulated by the CMV promoter At30 h after transfection the cells were infected with 001 PFU of vK1LC7L

(Continued)

Figure Legend Continued

GFP After an additional 18-h incubation GFP-positive cells were scored byflow cytometry (Inset) Western blot showing IRF1 expression Data fromthree separate experiments performed in triplicate were combined Values aremeans plus standard deviations (error bars) The values that were significantlydifferent calculated by Bonferroni test after one-way ANOVA using PRISMGraphPad software are indicated by asterisks as follows P 0001 relativeto the value for C7LK1LGFP P 005 relative to the value for iFire

siRNA Screening of Host Range Mutants

JulyAugust 2015 Volume 6 Issue 4 e01122-15 reg mbioasmorg 7

on March 14 2020 by guest

httpmbioasm

orgD

ownloaded from

150 mM NaCl 50 mM Tris-HCl (pH 7) and Complete protease inhibi-tors (Roche) for 15 min on ice Lysates were cleared by high-speed cen-trifugation for 5 min and portions (10) of the supernatants were kept asinput controls The lysates were incubated with 2 g IgG for 2 h followedby 1-h incubation with protein G conjugated to Dynabeads magnetic

beads (Life Sciences Technologies) The beads were washed with lysisbuffer and the proteins were eluted by boiling in reducing sample buffer

Generation of knockout cells using CRISPRCas9 HeLa cells with aninactivated SAMD9 gene were generated by using the Edit-R CRISPR-Cas9 Gene Engineering kit (Dharmacon) according to the manufacturerrsquosinstructions Transfections were carried out with Dharmafect Duo trans-fection reagent (Dharmacon) Targeting sequences were designed usingthe web tool CRISPR Design at httpcrisprmitedu After transfectioncells were treated with puromycin (1 gml) for 48 h The surviving cellswere plated in the absence of puromycin in 96-well plates with ~1 to 5cellswell Colonies were selected according to their ability to supportreplication of vC7LK1LGFP

Statistical analysis Figures with graphs with error bars show themeans of two or three independent experiments performed in triplicateand P values were calculated using one-way analysis of variance (ANOVA)and multiple test correction using the Bonferroni method The calcula-tions were performed in GraphPad PRISM 6

SUPPLEMENTAL MATERIALSupplemental material for this article may be found at httpmbioasmorglookupsuppldoi101128mBio01122-15-DCSupplemental

FIG 6 Interferon induces SAMD9 expression in Huh-751 cells and inhibitsreplication of vK1LC7LGFP (A) Induction of SAMD9 in Huh-751cells Huh-751 and HeLa cells were transfected with control siRNA orSAMD9 siRNA and 24 h later the cells were treated with 200 Uml of IFN- orleft untreated After an additional 24 h the cells were lysed and analyzed byWestern blotting with antibodies to SAMD9 and -actin as a loading control(B) Quantification of SAMD9 The bands in panel A were quantified usingImage Studio software from LI-COR The intensities of SAMD9 bands werenormalized to the intensities of the -actin bands (C) Inhibition ofvK1LC7LGFP replication in Huh-751 cells treated with IFN- and par-tial reversal with SAMD9 siRNA Huh-751 cells were transfected with controlsiRNA or siRNA to SAMD9 for 24 h and then were left untreated or treatedwith 200 Uml of IFN- for 24 h After infection with 001 PFU ofvK1LC7LGFP per cell for 18 h GFP was measured by flow cytometryData from two experiments each performed in triplicate were combined Val-ues are means plus standard deviation (error bars) Values that are significantlydifferent (P 0001) calculated as Bonferroni test after one-way ANOVAusing PRISM GraphPad software are indicated ()

FIG 7 WDR6 is a restriction factor for vK1LC7LGFP (A) Generation ofWDR6-depleted cells by CRISPRCas9 technology HeLa cells were transfectedwith the CRISPRCas9 components as described in Materials and MethodsCells from individual colonies 1 and 2 were lysed and their proteins wereresolved by SDS-PAGE and analyzed by Western blotting to detect endoge-nous WDR6 SAMD9 and actin (B) HeLa cells and two WDR6 depletedcolonies were infected with vK1LC7LGFP (001 PFU per cell) and incu-bated for 18 h GFP-positive cells were quantified using flow cytometry Datafrom three experiments each performed in triplicate were combined Valuesare means plus standard deviations (error bars) The values that are signifi-cantly different (P 0001) relative to the value for HeLa cells calculated byBonferroni test after one-way ANOVA using PRISM GraphPad software areindicated () (C) HeLa cells and cells of two WDR6 depleted colonies wereinfected with vK1LC7LGFP at 3 PFU per cell and mock transfected ortransfected with C7L-V5 or K1L-FLAG regulated by the T7 promoter Eigh-teen hours later the cells were lysed and incubated with antibodies for the V5or FLAG epitope tag Input and proteins captured by magnetic beads conju-gated to protein G were resolved by SDS-PAGE and Western blotting forendogenous SAMD9 and V5 or FLAG epitope tag

Sivan et al

8 reg mbioasmorg JulyAugust 2015 Volume 6 Issue 4 e01122-15

on March 14 2020 by guest

httpmbioasm

orgD

ownloaded from

Table S11 XLSX file 2 MBTable S12 XLSX file 2 MBTable S13 XLSX file 19 MBTable S2 XLSX file 12 MB

ACKNOWLEDGMENTS

We thank Yan Xiang for the K1LC7L deletion virusThe research was supported by funds from the Division of Intramural

Research National Institute of Allergy and Infectious Diseases NationalInstitutes of Health

REFERENCES1 Moss B 2013 Poxviridae p 2129 ndash2159 In Knipe DM Howley PM (ed)

Fields virology 6th ed vol 2 Lippincott Williams amp Wilkins PhiladelphiaPA

2 Upton C Slack S Hunter AL Ehlers A Roper RL 2003 Poxvirusorthologous clusters toward defining the minimum essential poxvirusgenome J Virol 777590 ndash7600 httpdxdoiorg101128JVI77137590-76002003

3 Bratke KA McLysaght A Rothenburg S 2013 A survey of host rangegenes in poxvirus genomes Infect Genet Evol 14406 ndash 425 httpdxdoiorg101016jmeegid201212002

4 Haller SL Peng C McFadden G Rothenburg S 2014 Poxviruses and theevolution of host range and virulence Infect Genet Evol 2115ndash 40 httpdxdoiorg101016jmeegid201310014

5 Gillard S Spehner D Drillien R Kirn A 1986 Localization and se-quence of a vaccinia virus gene required for multiplication in human cellsProc Natl Acad Sci U S A 835573ndash5577 httpdxdoiorg101073pnas83155573

6 Perkus ME Goebel SJ Davis SW Johnson GP Limbach K Norton EKPaoletti E 1990 Vaccinia virus host range genes Virology 179276 ndash286httpdxdoiorg1010160042-6822(90)90296-4

7 Meng X Jiang C Arsenio J Dick K Cao J Xiang Y 2009 Vaccinia virusK1L and C7L inhibit antiviral activities induced by type I interferons JVirol 8310627ndash10636 httpdxdoiorg101128JVI01260-09

8 Drillien R Koehren F Kirn A 1981 Host range deletion mutant ofvaccinia virus defective in human cells Virology 111488 ndash 499 httpdxdoiorg1010160042-6822(81)90351-2

9 Sutter G Ramsey-Ewing A Rosales R Moss B 1994 Stable expressionof the vaccinia virus K1L gene in rabbit cells complements the host rangedefect of a vaccinia virus mutant J Virol 684109 ndash 4116

10 Ramsey-Ewing AL Moss B 1996 Complementation of a vaccinia virushost range K1L gene deletion by the non-homologous CP77 gene Virol-ogy 22275ndash 86 httpdxdoiorg101006viro19960399

11 Hsiao JC Chung CS Drillien R Chang W 2004 The cowpox virus hostrange gene CP77 affects phosphorylation of eIF2 alpha and vaccinia viraltranslation in apoptotic HeLa cells Virology 329199 ndash212 httpdxdoiorg101016jvirol200407032

12 Backes S Sperling KM Zwilling J Gasteiger G Ludwig H Kremmer ESchwantes A Staib C Sutter G 2010 Viral host-range factor C7 or K1 isessential for modified vaccinia virus Ankara late gene expression in humanand murine cells irrespective of their capacity to inhibit protein kinaseR-mediated phosphorylation of eukaryotic translation initiation factor 2alpha J Gen Virol 91470 ndash 482 httpdxdoiorg101099vir0015347-0

13 Liu J Rothenburg S McFadden G 2012 The poxvirus C7L host rangefactor superfamily Curr Opin Virol 2764 ndash772 httpdxdoiorg101016jcoviro201209012

14 Meng XZ Chao J Xiang Y 2008 Identification from diverse mammalianpoxviruses of host-range regulatory genes functioning equivalently to vac-cinia virus C7L Virology 372372ndash383 httpdxdoiorg101016jvirol200710023

15 Liu J Wennier S Zhang LL McFadden G 2011 M062 is a host rangefactor essential for myxoma virus pathogenesis and functions as an antag-onist of host SAMD9 in human cells J Virol 853270 ndash3282 httpdxdoiorg101128JVI02243-10

16 Bradley RR Terajima M 2005 Vaccinia virus K1L protein mediateshost-range function in RK-13 cells via ankyrin repeat and may interactwith a cellular GTPase-activating protein Virus Res 114104 ndash112 httpdxdoiorg101016jvirusres200506003

17 Meng XZ Xiang Y 2006 Vaccinia virus K1L protein supports viral rep-lication in human and rabbit cells through a cell-type-specific set of its

ankyrin repeat residues that are distinct from its binding site for ACAP2Virology 353220 ndash233 httpdxdoiorg101016jvirol200605032

18 Li YC Meng XZ Xiang Y Deng JP 2010 Structure function studies ofvaccinia virus host range protein K1 reveal a novel functional surface forankyrin repeat proteins J Virol 843331ndash3338 httpdxdoiorg101128JVI02332-09

19 Shisler JL Jin XL 2004 The vaccinia virus K1L gene product inhibits hostNF-B activation by preventing IB degradation J Virol 783553ndash3560httpdxdoiorg101128JVI7873553-35602004

20 Willis KL Patel S Xiang Y Shisler JL 2009 The effect of the vaccinia K1protein on the PKR-eIF2 alpha pathway in RK13 and HeLa cells Virology39473ndash 81 httpdxdoiorg101016jvirol200908020

21 Meng XZ Schoggins J Rose L Cao JX Ploss A Rice CM Xiang Y2012 C7L family of poxvirus host range genes inhibits antiviral activitiesinduced by type I interferons and interferon regulatory factor 1 J Virol864538 ndash 4547 httpdxdoiorg101128JVI06140-11

22 Liu J McFadden G 2015 SAMD9 is an innate antiviral host factor withstress response properties that can be antagonized by poxviruses J Virol891925ndash1931 httpdxdoiorg101128JVI02262-14

23 Koumlnig R Chiang C Tu BP Yan SF DeJesus PD Romero A BergauerT Orth A Krueger U Zhou Y Chanda SK 2007 A probability-basedapproach for the analysis of large-scale RNAi screens Nat Methods4847ndash 849 httpdxdoiorg101038nmeth1089

24 Sivan G Martin SE Myers TG Buehler E Szymczyk KH OrmanogluP Moss B 2013 Human genome-wide RNAi screen reveals a role fornuclear pore proteins in poxvirus morphogenesis Proc Natl Acad Sci U SA 1103519 ndash3524 httpdxdoiorg101073pnas1300708110

25 Fuerst TR Niles EG Studier FW Moss B 1986 Eukaryotic transient-expression system based on recombinant vaccinia virus that synthesizesbacteriophage T7 RNA polymerase Proc Natl Acad Sci U S A 838122ndash 8126 httpdxdoiorg101073pnas83218122

26 Schoggins JW Wilson SJ Panis M Murphy MY Jones CT Bieniasz PRice CM 2011 A diverse range of gene products are effectors of the typeI interferon antiviral response Nature 472481ndash 485 httpdxdoiorg101038nature09907

27 Lemos de Matos A Liu J McFadden G Esteves PJ 2013 Evolution anddivergence of the mammalian SAMD9SAMD9L gene family BMC EvolBiol 13121 httpdxdoiorg1011861471-2148-13-121

28 Chefetz I Ben Amitai D Browning S Skorecki K Adir N Thomas MGKogleck L Topaz O Indelman M Uitto J Richard G Bradman NSprecher E 2008 Normophosphatemic familial tumoral calcinosis iscaused by deleterious mutations in SAMD9 encoding a TNF-alpha re-sponsive protein J Invest Dermatol 1281423ndash1429 httpdxdoiorg101038sjjid5701203

29 Tanaka M Shimbo T Kikuchi Y Matsuda M Kaneda Y 2010 Sterilealpha motif containing domain 9 is involved in death signaling of malig-nant glioma treated with inactivated Sendai virus particle (HVJ-E) or typeI interferon Int J Cancer 1261982ndash1991 httpdxdoiorg101002ijc24965

30 Hershkovitz D Gross Y Nahum S Yehezkel S Sarig O Uitto JSprecher E 2011 Functional characterization of SAMD9 a protein defi-cient in normophosphatemic familial tumoral calcinosis J Invest Derma-tol 131662ndash 669 httpdxdoiorg101038jid2010387

31 Topaz O Indelman M Chefetz I Geiger D Metzker A Altschuler YChoder M Bercovich D Uitto J Bergman R Richard G Sprecher E2006 A deleterious mutation in SAMD9 causes normophosphatemic fa-milial tumoral calcinosis Am J Hum Genet 79759 ndash764 httpdxdoiorg101086508069

32 Li D Burch P Gonzalez O Kashork CD Shaffer LG Bachinski LLRoberts R 2000 Molecular cloning expression analysis and chromosomemapping of WDR6 a novel human WD-repeat gene Biochem Biophys ResCommun 274117ndash123 httpdxdoiorg101006bbrc20003012

33 Xie X Wang Z Chen Y 2007 Association of LKB1 with a WD-repeatprotein WDR6 is implicated in cell growth arrest and p27Kip1 inductionMol Cell Biochem 301115ndash122 httpdxdoiorg101007s11010-006-9402-5

34 Chiba T Inoue D Mizuno A Komatsu T Fujita S Kubota H LuisaTagliaro M Park S Trindade LS Hayashida T Hayashi H Yamaza HHigami Y Shimokawa I 2009 Identification and characterization of aninsulin receptor substrate 4-interacting protein in rat brain implicationsfor longevity Neurobiol Aging 30474 ndash 482 httpdxdoiorg101016jneurobiolaging200707008

siRNA Screening of Host Range Mutants

JulyAugust 2015 Volume 6 Issue 4 e01122-15 reg mbioasmorg 9

on March 14 2020 by guest

httpmbioasm

orgD

ownloaded from

Erratum for Sivan et al ldquoIdentificationof Restriction Factors by HumanGenome-Wide RNA InterferenceScreening of Viral Host Range MutantsExemplified by Discovery of SAMD9 andWDR6 as Inhibitors of the Vaccinia VirusK1LC7L Mutantrdquo

Gilad Sivana Pinar Ormanoglub Eugen C Buehlerb Scott E MartinbBernard Mossa

Laboratory of Viral Diseases National Institute of Allergy and Infectious Diseases National Institutes of HealthBethesda Maryland USAa Division of Preclinical Innovation National Center for Advancing TranslationalSciences National Institutes of Health Bethesda Maryland USAb

Volume 6 no 4 e01122-15 2016 httpsdoiorg101128mBio01122-15 In theResults section (PDF page 3) we mistakenly duplicated the DAPI panel of siSAMD9_1in siSAMD9_3 in Fig 1C The incorrect panel has now been replaced with the correctone The error has no impact on any of the conclusions We apologize for not detectingand correcting this error before publication The revised Fig 1 shows the correctedpanel

Published 31 October 2017

Citation Sivan G Ormanoglu P Buehler ECMartin SE Moss B 2017 Erratum for Sivan et alldquoIdentification of restriction factors by humangenome-wide RNA interference screening ofviral host range mutants exemplified bydiscovery of SAMD9 and WDR6 as inhibitors ofthe vaccinia virus K1LminusC7Lminus mutantrdquo mBio8e01735-17 httpsdoiorg101128mBio01735-17

This is a work of the US Government and isnot subject to copyright protection in theUnited States Foreign copyrights may apply

Address correspondence to Bernard Mossbmossnihgov

Present address Scott E Martin Departmentof Discovery Oncology Genentech Inc SouthSan Francisco California USA

ERRATUM

crossm

SeptemberOctober 2017 Volume 8 Issue 5 e01735-17 reg mbioasmorg 1