Identification of Three New Splice Variants of the SNARE Protein SNAP-23

Io

AH*GI

R

pfdtSfvhnTwfipsi

ccsbTtppctutmhw

F

Biochemical and Biophysical Research Communications 285, 320–327 (2001)

doi:10.1006/bbrc.2001.5144, available online at http://www.idealibrary.com on

0CA

dentification of Three New Splice Variantsf the SNARE Protein SNAP-23

lok Shukla,* Thomas Juhl Corydon,† Søren Nielsen,‡ans Jurgen Hoffmann,*,1 and Ronald Dahl*

Department of Respiratory Diseases, Aarhus University Hospital, DK-8000 Aarhus, Denmark; †Department of Humanenetics, University of Aarhus, DK-8000 Aarhus, Denmark; and ‡Department of Cell Biology,

nstitute of Anatomy, University of Aarhus, DK-8000 Aarhus, Denmark

eceived June 8, 2001

(synaptosomal-associated protein of 25 kDa) in thep

ltlSflcSpwSi

hSchehislIbSmhkH

ipbgic

SNAP-23 has an important role in protein-traffickingrocesses in mammalian cells and until yet two iso-orms of SNAP-23 (SNAP-23a and SNAP-23b) have beenescribed. In the present report, we have identifiedhe existence of three new SNAP-23 isoforms (namedNAP-23c, SNAP-23d, and SNAP-23e), which ariserom alternative splicing. By RT-PCR all five spliceariants were shown to be expressed in four differentuman inflammatory cells (eosinophils, basophils,eutrophils, and peripheral blood mononuclear cells).ransfection of the human basophilic KU-812 cell lineith plasmid constructs containing the cDNAs of theve splice variants located SNAP-23a and SNAP-23brimarily in the plasma membrane. The other threeplice variants were localized both intracellularly andn the plasma membrane. © 2001 Academic Press

Key Words: SNAP-23; exocytosis; alternative splicing.

Most of the proteins participating in regulated exo-ytosis were first biochemically characterized andloned from neurons. The physical contact between themall vesicles and the plasma membrane is believed toe mediated by specific protein–protein interaction.he SNARE (soluble N-ethylmaleimide-sensitive fac-or attachment receptor) hypothesis attempts to ex-lain this interaction. The original SNARE hypothesisostulates that vesicular trafficking in a mammalianell involve a unique vesicle-bound ligand (v-SNARE)hat specifically recognizes and interacts with twonique receptor target molecules (t-SNAREs) found inhe plasma membrane. In synapses a vesicle associatedembrane protein called VAMP-1 (or synaptobrevin-1)as been identified as a v-SNARE, which interactsith the t-SNAREs syntaxin-1 and SNAP-25

1 To whom correspondence and reprint requests should be addressed.ax: 145 89492110. E-mail: [email protected].

320006-291X/01 $35.00opyright © 2001 by Academic Pressll rights of reproduction in any form reserved.

lasma membrane.SNAP-23 is ubiquitously tissue-expressed homo-

ogue of the t-SNARE SNAP-25, which has 59% iden-ity and 72% similarity to SNAP-25 at the amino acidevel (1). Phylogenetic analysis of SNAP-25 andNAP-23 sequences suggests that SNAP-23 has arisen

rom duplication of SNAP-25 gene in the vertebrateineage (2). In vitro it has been shown that the bindingharacteristics of SNAP-23 are identical to that ofNAP-25 in that it heteromerizes with each of thelasma membrane syntaxins (i.e., 1, 2, 3, and 4) (3),ho are t-SNAREs (1). In addition, in analogy toNAP-25, binding of SNAP-23 to syntaxin 4 was inhib-

ted by Munc-18 (3).The SNAP-23 cDNA was originally cloned from a

uman B-cell cDNA library (1). SubsequentlyNAP-23 cDNA has been isolated from melanomaells (4), mouse adipocytes (5), and two isoforms fromuman neutrophils and HL-60 cells (6). SNAP-23 isxpressed in several nonneuronal tissues includingeart, lung, liver muscle, pancreas, and kidney, and

nitially SNAP-23 was reported to be located exclu-ively at the plasma membrane of different cellseading to the notion that it acts as a t-SNARE (1, 4).n the beginning, the focus was on the plasma mem-rane since initial in vitro experiments showed thatNAP-23 could bind equally to each of the plasmaembrane syntaxins. However, recently SNAP-23as been detected in intracellular vesicles in ratidney cells (4), and in endosomal compartments inepG2 and HT4 (7).SNAP-23 behaves as an integral membrane protein

n all of the cell types examined (4, 5, 8–11). This isresumably because the protein is bound to the mem-rane through a series of thioester-linked palmitoylroups attached to a conserved cluster of cysteine res-dues in the center of SNAP-23 (12–16). If two or moreysteine residues in the cysteine-rich domain of mouse

SNAP-23 are deleted, it is found in the cytosol rathertattrps

fitiliSnpcsd

mtinab(grSTtapppS2g

eitticKdtK

M

bd

rated with paramagnetically labeled anti-CD16 beads into a neutro-pibtlf

(

(

(

(

AG

TT

TG

tPp

uGPtlim

pCco1ba7

anfpr

eep(

lcvT

Vol. 285, No. 2, 2001 BIOCHEMICAL AND BIOPHYSICAL RESEARCH COMMUNICATIONS

han associated with the plasma membrane (15). Ex-mination of this domain reveals almost complete iden-ity between human, rat and mouse SNAP-23. Fur-hermore this region is similar to the correspondingegion of SNAP-25, although SNAP-25 possesses fourotential palmitoylation sites whereas SNAP-23 pos-esses five potential palmitoylation sites.SNAP-23 participates in non-neuronal protein traf-

cking processes including the translocation of GLUT4o the plasma membrane in adipose cells (11), traffick-ng between endosomes and plasma membrane in po-arized epithelial cells (10), and compound exocytosisn mast cells (9). In cell-types where SNAP-25 andNAP-23 are coexpressed, the function of SNAP-23 isot clearly understood. Transfected SNAP-23 can re-lace SNAP-25 in the insulin release process in a pan-reatic beta-cell line, but the level of functional recon-titution is poor, suggesting that SNAP-23 has otheristinct, yet mechanistically similar, functions (17).Alternative splicing appears to represent a commonechanism for generating diversity of the SNARE pro-

eins. SNAP-25 and SNAP-23, which each have twosoforms, are generated by alternative splicing. Neuro-al SNAP-25 exists itself as two isoforms, SNAP-25and SNAP-25b, which are identical in length and differy nine amino acids over a sequence of 32 amino acids18). The isoforms arise from a single, highly conservedene by alternative splicing of exons 5a and 5b. Thisegion codes for the membrane-associated domain ofNAP-25, which contains the cysteine-cluster (13, 15).he disposition of these cysteine residues differs in thewo SNAP-25 isoforms (both containing four cysteines)nd this change in fatty acylation domains has beenroposed to affect their ability to associate with thelasma membrane. RT-PCR analysis of human neutro-hils resulted in the identification of a truncatedNAP-23 mRNA encoding a SNAP-23 isoform (SNAP-3b) lacking amino acids 90–142 from the central re-ion of the SNAP-23 molecule (6).The aim of this study was to determine SNAP-23-

xpression in inflammatory cells. This study shows thedentification of three new SNAP-23 splice variants. Byhe use of a specific splice variant RT-PCR technique,he mRNAs of five SNAP-23 splice variants are foundn human eosinophils, peripheral blood mononuclearells, neutrophils, brain and in the human cell linesU-812 (basophilic) and AML-14 (eosinophilic). In ad-ition the cellular localization of the splice variants inhe KU-812 cell line has been examined in transfectedU-812 cells.

ETHODS

Purification of RNA. Whole blood was separated into peripherallood mononuclear cells (PBMCs) and granulocyte fractions by gra-ient centrifugation. After hemolysis the granulocytes were sepa-

321

hil and an eosinophil fraction (19). Total RNA was immediatelysolated from PBMCs, neutrophils and eosinophils using RNeasylood kit (Qiagen GmbH, Germany). This kit was also used to isolateotal RNA from the two human cell lines KU-812 (a basophilic celline) and AML-14 (an eosinophilic cell line). Total RNA from humanetal brain was from Clontech.

PCR primers.

SNAP-23, upper I-PCR: 59- GGTCGGAGAGGAGTGGCCT (primer 1)SNAP-23 a/b/e, lower I-PCR: 59-GGAGCTACGGAA (primer 2)SNAP-23 c/d, lower I-PCR: 59-CCTTCTTCCATATTAT (primer 3)SNAP-23, upper II-PCR: 59- CATCATGGATAATCTGTCAT (primer 4)SNAP-23 a/b, lower II-PCR: 59-GCAGTAGCTTTAGCTGTCAA

primer 5)SNAP-23 c, lower II-PCR: 59-CTCTGTTGGTGTCAGCCCTTTTGTT

primer 6)SNAP-23 d, lower II-PCR: 59-CTCTGTTGGTGTCAGCCTATTACAT

primer 7)SNAP-23 e, lower II-PCR: 59-GAGTTTCTTTGCTCTATTACAT

primer 8)SNAP-23, upper FLAG-PCR: 59-CGAGCTCGGATCCACTAGTASNAP-23 a/b/e, lower FLAG-PCR: 59-CGAAGCATAGGACTCG-

GTTACTTGTCATCGTCGTCCTTGTAGTCAGCAGCAGCAGCGCT-TCAATGAGTTTCTTTGCTSNAP-23 c, lower FLAG-PCR: 59-CGAAGCATAGGACTCGAG-

TACTTGTCATCGTCGTCCTTGTAGTCAGCAGCAGCAGCGCCC-TTTGTTCATCCAGCATSNAP-23 d, lower FLAG-PCR: 59-CGAAGCATAGGACTCGAG-

TACTTGTCATCGTCGTCCTTGTAGTCAGCAGCAGCAGCAGGA-GAGCTACGGAAGTGA

RT-PCR. The starting material was total RNA extracted fromhe different cells. To increase the sensitivity of the PCRs, the firstCR (I-PCR) was followed by a second PCR (II-PCR) with nestedrimers and the first PCR-product as template.cDNA was synthesized from RNA-samples containing 2 mg RNA by

sing Expand reverse transcriptase (Boehringer Mannheim GmbH,ermany) together with dNTP (1 mM of each dNTP, Amersham–harmacia Biotech, Piscataway, NJ) as described by the manufac-urer. RNA in water was diluted (by tapping) with 20 pmol of theower I-PCR-primer to a volume of 11 ml. The reaction mixture wasncubated at 65°C for 5 min to allow the primer to anneal to the

RNA. cDNA was then synthesized at 42°C for 1 h.PCR was performed in a total volume of 50 ml with 20 pmol of each

rimer, 200 mM of each dNTP, 13 reaction buffer (Qiagen, Valencia,A), 2.5 units of HotStar Taq DNA polymerase (Qiagen) and 2 ml of

DNA. Thus the quantity of cDNA amplified corresponded to 0.2 mgf RNA in the RT-PCR. Temperature cycling conditions consisted of5 min at 95°C (to activate HotStar Taq DNA polymerase) followedy 30 cycles for 30 s at 94°C (denaturation), 45 s at 53 °C (annealing),nd 1 min at 72°C (extension), with a final extension for 7 min at2°C.Several control experiments were performed: (i) RNA was directly

mplified, without reverse transcriptase, to be sure that products areot the result of amplification of genomic DNA; (ii) Negative controlsor the RT-step (no added RNA) and the PCR (no added DNA) wereerformed to control for contamination of the reagents for theseeactions.For analysis, 2 ml of the RT-PCR products was size-fractionated by

lectrophoresis through a 2% agarose gel (containing 0.5 mg/mlthidium bromide) in 13 Tris–acetate/EDTA buffer. After electro-horesis the product bands were photographed under UV lightEagleEye II Stratagene).

The different SNAP-23-bands were purified from the gel and thenigated into pCR2.1-TOPO vector and cloned into pCR2.1-TOPO-ompetent bacteria following the manufacturer’s instructions (In-itrogen, Carlsbad, CA). Also the entire PCR-product was used in theOPO-cloning. Positive clones were sequenced in both sense and

antisense direction with the ThermoSequenase kit (Amersham LifeSeb

awFmslPimpthsFFwewwtui

KDRFFaSw(Patawl2smL

R

I

fegppt(fuet

sbessi

evrFTtih2

tta(TPiaBbss

aoa[PwwPc


cience, Cleveland, OH) on a 381 Sequenator (Amersham Life Sci-nce, Buckinghamshire, UK). Sequence analysis was done using thelast program from NCBI.

Preparation of SNAP-23 plasmid constructs. For construction ofplasmid containing the entire coding region of SNAP-23-cDNAsith a immediately downstream added DNA sequence encoding theLAG-epitope [DYKDDDDK recognized by the anti-FLAG series ofonoclonal mouse antibodies (Sigma)], the SNAP-23-TOPO con-

tructs were used. Two primers were used in PCR-amplification toift the SNAP-23-fragments from the SNAP-23-TOPO constructs.rimers were designed as follows: One upper primer which hybrid-

zed to a vector sequence in the pCR2.1-TOPO vector upstream of theultiple cloning site and thus the inserts. Another three lower

rimers hybridized to a stretch of DNA of the five isoforms encodinghe last amino acids (about 21–22 bases). Immediately following thisybridizing stretch of DNA, the primers were designed to contain aequence encoding an alanine spacer of four residues followed by theLAG epitope, a stop codon, and finally a XhoI restriction site.ollowing PCR, the resulting fragments were gel-purified, digestedith appropriate restriction enzymes (XhoI and BamHI) and sticky-nd ligated into the purified expression vector pcDNA3.1. Coloniesere obtained upon bacterial transformation and appropriate clonesere selected based on PCR using insert-specific primers. One par-

icular clone was isolated and purified plasmid DNA was sequencedsing primer sequence sites in the pcDNA3.1 vector (confirming the

nsert sequences).

Expression of SNAP-23 splice variants in the KU-812 cell line.U-812 cells were either grown in 75-cm2 flasks (Nunc, Roskilde,enmark) or 10-cm2 slide flasks (Nunc) at 37°C and 5% (v/v) CO2 inPMI 1640 (In Vitro, Copenhagen, Denmark) containing 10% (v/v)CS. The cells were transfected with the plasmid constructs usinguGENE 6 transfection reagent (Roche Diagnostic Corp., U.S.A.). Asnegative control for SNAP-23-expression the vector without the

NAP-23-cDNA insert was used. 24 h posttransfection, the cellsere rinsed thoroughly in PBS and fixed for 5 min on ice in a cold 4%

w/v) paraformaldehyde solution. Following an additional wash inBS, the cells were permeabilized by treatment with cold 70% eth-nol for 20 min. An immunofluorescence staining procedure washen performed, incubating the cells with the anti-FLAG monoclonalntibody (Sigma) for 1 h, washing 3 3 5 min in PBS and incubatingith a secondary FITC-conjugated rabbit anti-mouse antibody (Mo-

ecular Probes, U.S.A.) for an additional 1 h. Cells were finally rinsed3 5 min in PBS and nuclei were stained with Hoechst nuclear stain

olution (1 mg/ml) (Sigma). Following a final wash in PBS, cells wereounted with antifade. The microscopy was carried out using aeica TCS 4D confocal laser scanning microscope.

ESULTS

dentification of Five SNAP-23 Isoforms in FourDifferent Inflammatory Cells by RT-PCR

Initially the aim was to identify SNAP-23 in dif-erent inflammatory cells. Therefore two set of prim-rs were constructed spanning the entire coding re-ion of SNAP-23a and nested RT-PCR waserformed using total RNA from human eosinophils,eripheral blood mononuclear cells (PBMCs), neu-rophils, brain and from the human cell lines KU-812basophilic) and AML-14 (eosinophilic). Total RNArom human brain was used as positive control. Fig-re 1 shows that SNAP-23a is identified in all thexamined cells. The same result was obtained usingotal RNA from primary eosinophil cells (data not

322

hown). Besides the SNAP-23a-band several otherands are observed in Fig. 1. These DNA-bands werexcised from the gel and gel-purified, followed byequencing of the DNA. Only one DNA band could beequenced, and this turned out to be the alreadydentified SNAP-23b (Fig. 1).

Therefore another strategy was used, in which thentire PCR-product was cloned into the pCR2.1-TOPOector. About 40 positive colonies were examined usingestriction enzyme digest, which released the inserts.ive different inserts were identified and sequenced.wo of the inserts were SNAP-23a and SNAP-23b, andhe other three inserts corresponded to until yet un-dentified SNAP-23 isoforms. All these three isoformsad some kind of deletions, when compared to SNAP-3a (Fig. 2A).At this point it was not known, if the presence of

hese three inserts was due to PCR artifacts. Thereforehree lower PCR-primers were designed (primer 6, 7,nd 8; see Fig. 2A), which spanned the regions lackingin comparison with SNAP-23a) in the three inserts.hese three primers were used in a semi-nested RT-CR. The results is shown in Figs. 2A–2D. All three

soforms, which were named SNAP-23c, SNAP-23d,nd SNAP-23e, are present in all the examined cells.ut besides the expected DNA-bands, other DNA-ands were also observed. Sequencing of these bands,howed the presence of SNAP-23a and SNAP-23b inome of the PCR-products.

FIG. 1. Identification of SNAP-23a and SNAP-23b splice vari-nts by RT-PCR. RT-PCR was performed as described under Meth-ds on total RNA isolated from different human inflammatory cellsnd cell lines. The PCR products were generated with the primer sets1 1 2] and [4 1 5]. The PCR-amplified fragments after the nestedCR were resolved on a 2% agarose gel and visualized with stainingith ethidium bromide. The lanes are marked with M, size markerith 100-bp ladder; B, brain; K, KU-812 cell line; A, AML-14 cell line;, PBMCs; N, neutrophils. The PCR bands are marked with lettersorresponding to the variants they represent.

I

2SoeTiSttuw(sfo

E

sp(ifiAfsF2mbit

oiasc6vAa


dentification of the Five SNAP-23 Splice Variantsfrom the Human SNAP-23 Gene

Another way of confirming the existence of SNAP-3c, SNAP-23d and SNAP-23e, is to analyze theNAP-23 gene. Figure 3, which is constructed on basisf the data present in the NCBI-database, shows thexon-intron organization of the human SNAP-23 gene.he SNAP-23 gene consists of seven exons and six

ntrons. When sequencing SNAP-23c, SNAP-23d andNAP-23e cDNAs and comparing these sequences withhe SNAP-23 gene DNA sequence, exon structure ofhe three isoforms could be determined (Fig. 2A). Fig-res 2A and 3 show that the three isoforms (togetherith SNAP-23b) are formed due to alternative splicing

SNAP-23e using an internal splice site) and thereforehould be called splice variants. The existence of theour isoforms can thus be explained by the exon-intronrganization of the human SNAP-23 gene.

FIG. 2. (A) Schematic diagram illustrating the exon organizatiorientation of PCR primer hybridization sites and the expected sizesnternal splice site used by splice variant SNAP-23e. The open arrowrrowheads indicate the stop codons of the splice variants. (B–D) Idpecific RT-PCR. RT-PCR was performed as described under Methodell lines. The PCR products of the splice variants SNAP-23c, SNAP-2], [1 1 7] and [4 1 7] or [1 1 8] and [4 1 8]. The PCR-amplified fragisualized with staining with ethidium bromide. The lanes are marke, AML-14 cell line; P, PBMCs; N, neutrophils. The PCR bands corrre marked with the letters c, d, and e, respectively.

323

xpression of SNAP-23:FLAG Fusion Proteinsin Transfected KU-812 Cells

Since no antibody which directly detects one singleplice variant could be made, it was decided to obtainlasmid constructs where a short peptide sequencerecognized by anti-FLAG antibody) had been addedmmediately downstream of the sequence of the iso-orms. After having prepared these plasmid constructs,t was possible to test protein expression directly.ccordingly, cell cultures of KU-812 cells were trans-

ected with the FLAG-tagged constructs and expres-ion of the transgenes was assayed using the anti-LAG monoclonal antibody. As shown in Fig. 4, SNAP-3a and SNAP-23b primarily located to the plasmaembrane. However, the other splice variants seem to

e targeted to the plasma membrane as well as to thentracellular region. No expression of FLAG was de-ected in untransfected control cells (see the SNAP-23a

f transcripts of the five SNAP-23 splice variants. The position andthe PCR products are depicted. The black vertical line indicates theads indicate the start codons of the splice variants, while the filledification of SNAP-23c, SNAP-23d and SNAP-23e splice variants byn total RNA isolated from different human inflammatory cells andand SNAP-23e were generated with the primer sets [1 1 6] and [4 1ts after the seminested PCR were resolved on a 2% agarose gel andith M, size marker with 100-bp ladder; B, brain; K, KU-812 cell line;onding to the splice variants SNAP-23c, SNAP-23d, and SNAP-23e

n oofhe

ents o

3d,mend wesp

pttusowo

D

SasecpsSSaoSiS[2s2hiaf

stt

cCtsNscSwWd(htsfStStvStcSmftme

s


anel in Fig. 4). Overexpression could have saturatedhe cellular targeting machinery and thereby may con-ribute to the observed intracellular staining, whensing the FLAG-tagged constructs of the other fourplice variants. But when cells expressing either highr very low levels of the FLAG-tagged splice variantsere examined closely, no significant difference wasbserved (data not shown).

ISCUSSION

The present study has shown that the gene forNAP-23 is transcribed into at least five splice vari-nts (SNAP-23a–e) at the mRNA level. These fiveplice variants have all been identified in human brain,osinophils, PBMCs and neutrophils and in the humanell lines KU-812 (basophilic) and AML-14 (eosino-hilic) by RT-PCR. The evidence for existence of theplice variants comes also from analysis of the humanNAP-23 gene, since the exon-intron structure ofNAP-23 can explain the existence of the splice vari-nts. They encode proteins that are identical through-ut much of their amino-terminal domain (Fig. 5).NAP-23a, SNAP-23b, SNAP-23d and SNAP-23e are

dentical through to amino acid 88. In comparison withNAP-23a, SNAP-23b has a deletion of 53 amino acids

and an insertion of a serine-residue (6)], while SNAP-3e has a deletion of 115 amino acids. Both have theame eight carboxyl-terminal amino acids as SNAP-3a. Due to a DNA-frameshift SNAP-23d, however,as a different C-terminal of 39 amino acids. SNAP-23c

s identical to the other splice variants through tomino acid 49. A deletion at the DNA-level generates arameshift in the downstream sequence of SNAP-23c

FIG. 3. Exon/intron boundary sequences within the human SNAPite not determined.

324

uch that a stop codon is encountered after the dele-ion. Thus SNAP-23c cDNA encodes a truncated pro-ein of 50 amino acids ending up with a glycine residue.

Recently the crystal structure of the SNARE-omplex was solved (20). It shows that the N- and-terminal helix domains of SNAP-25 participate in

he formation of a parallel coiled-coil structure with theyntaxin (t-SNARE) and VAMP (v-SNARE). The-terminal region of SNAP-25 is predominantly re-

ponsible for interaction with syntaxin and for ternaryomplex assembly, while the C-terminal region ofNAP-25 is predominantly required for interactionith VAMP and stabilization of the ternary complex.ithin these two regions are multiple heptad repeat

omains that are predicted to form a-helical coiled coil21). The N-terminal region contains two sets of sixeptad repeats (H1 and H2) interrupted by a break ofwo amino acids, while the C-terminal contains a set ofeven heptad repeats (named H3). The exons encodingor the H1, H2 and H3 domains of SNAP-25 andNAP-23 exhibit the highest level of amino acid iden-ity between these two proteins, implying thatNAP-23 and SNAP-25 share the same domain struc-ure. The domain structures of the five SNAP-23 spliceariants are illustrated in Fig. 6. SNAP-23a andNAP-23b have all three H-domains, implying thathey can participate in a SNARE-complex, though itan be speculated how the H1 and H2 domains ofNAP-23b can be placed in parallel with the H3 do-ain. Generally it is difficult to assign a functional role

or the other three SNAP-23 splice variants due toheir small sizes. They all do not contain the H3 do-ain. Very recently it has been shown, that the pres-

nce of H1 and H2 domains is insufficient to allow

3 gene. §Transcription initiation site not determined. ‡Poly addition
-2

StiSSsptStbcvl

tmS2p

ci2mbSSs

a3


NAP-23 binding to syntaxin and VAMP (22), andherefore these three splice variants cannot participaten a SNARE complex. It is, however, interesting thatNAP-23e shares the same last eight amino acids withNAP-23a. The C-terminal of SNAP-23 and SNAP-25eems to have a regulating function in the exocytosisrocess in different cells. Earlier studies have shownhat the nine residues from the C-terminal region ofNAP-25 are required in the Ca21-triggering of exocy-osis (23). Previously the SNAP-23 C-terminal haseen implicated in GLUT4 trafficking in 3T3-L1 adipo-ytes, since infection of 3T3-L1 cell with a recombinantirus encoding a deletion SNAP-23 mutant lacking theast eight amino acids of SNAP-23 inhibited GLUT4

FIG. 4. Expression of SNAP-23:FLAG fusion proteins in transfend stained by a primary anti-FLAG antibody and a secondary FIT3258. Magnification 3630.

325

rafficking (24). The last eight amino acids of SNAP-23ight have the same role as the nine residues ofNAP-25, and therefore both SNAP-23b and SNAP-3e like SNAP-23a may play a role in the exocytosisrocess.Interestingly, SNAP-23b, SNAP-23d, and SNAP-23e

ontain the cysteine-rich domain of SNAP-23, indicat-ng that they may also be palmitoylated like SNAP-3a. However, earlier it has been shown that pal-itoylation occurs after stable interaction with mem-

rane-bound syntaxins (25). So the interaction ofNAP-23 with syntaxins is responsible for stabilizingNAP-23 on the membranes, where it ultimatelyerves as substrate for membrane-bound palmitoyl-

KU-812 cells. Twenty-four hours posttransfection, cells were fixedconjugated antibody. Nuclear DNA is counterstained with Hoechst

ctedC-

tSttmteS

bcFlmmlt

S

Sn


ransferases. Of the five SNAP-23 splice variants onlyNAP-23a and SNAP-23b will be able to bind to syn-axins optimally, because they both contain all thehree H-domains. Therefore SNAP-23a and SNAP-23bight be more tightly associated to the membranes

han SNAP-23d and SNAP-23e. In transfection-xperiments using KU-812 cells, SNAP-23a, andNAP-23b were primarily located to the plasma mem-

FIG. 5. Aligned amino acid sequences of the five splice varianNAP-23a, are boxed.

FIG. 6. Domain structure of the SNAP-23 splice variants. H, hepNAP-23. Numbers indicate amino acid boundaries of heptad repeaumbers indicate the amino acid numbers in terms of SNAP-23a).

326

rane, while the other three splice variants were lo-ated intracellularly and to the plasma membrane (seeig. 4). The fact that total mass of syntaxin isoforms

ocated in the plasma membrane greatly exceeds theass of syntaxin isoforms present on intracellularembranes (26) can explain the plasma membrane

ocalization of SNAP-23a and SNAP-23b, since exactlyhese two splice variants bind optimally to syntaxins.

The amino acids of the splice variants, which are different from

repeat region. CCCCC, five cysteine residues palmitoylated withingions, cysteine region, and the different splice variants (the upper

ts.

tadt re

The results of this study demonstrate the existenceomittr

R

1

1

T., Baldini, G., and James, D. E. (1998) J. Biol. Chem. 273,

11

1

1

1

1

11

2

2

2

2

2

2

2


f three new splice variants of SNAP-23. It still re-ains to be seen if these proteins play a functional role

n the cells. Therefore, further experiments leading tohe elucidation of the actual functional role of each ofhese proteins will be necessary to understand theirole in cell function.

EFERENCES

1. Ravichandran, V., Chawla, A., and Roche, P. A. (1996) J. Biol.Chem. 271, 13300–13303.

2. Schulz, J. R., Sasaki, J. D., and Vacquier, V. D. (1998) J. Biol.Chem. 273, 24355–24359.

3. Araki, S., Tamori, Y., Kawanishi, M., Shinoda, H., Masugi, J.,Mori, H., Niki, T., Okazawa, H., Kubota, T., and Kasuga, M.(1997) Biochem. Biophys. Res. Commun. 234, 257–262.

4. Wong, P. P., Daneman, N., Volchuk, A., Lassam, N., Wilson,M. C., Klip, A., and Trimble, W. S. (1997) Biochem. Biophys. Res.Commun. 230, 64–68.

5. Wang, G., Witkin, J. W., Hao, G., Bankaitis, V. A., Scherer, P. E.,and Baldini, G. (1997) J. Cell Sci. 110(Pt. 4), 505–513.

6. Mollinedo, F., and Lazo, P. A. (1997) Biochem. Biophys. Res.Commun. 231, 808–812.

7. Chen, F., Foran, P., Shone, C. C., Foster, K. A., Melling, J., andDolly, J. O. (1997) Biochemistry 36, 5719–5728.

8. Gaisano, H. Y., Sheu, L., Wong, P. P., Klip, A., and Trimble, W. S.(1997) FEBS Lett. 414, 298–302.

9. Guo, Z., Turner, C., and Castle, D. (1998) Cell 94, 537–548.0. Leung, S. M., Chen, D., DasGupta, B. R., Whiteheart, S. W., and

Apodaca, G. (1998) J. Biol. Chem. 273, 17732–17741.1. Rea, S., Martin, L. B., McIntosh, S., Macaulay, S. L., Ramsdale,

327

18784–18792.2. Gonzalo, S., and Linder, M. E. (1998) Mol. Biol. Cell 9, 585–597.3. Hess, D. T., Slater, T. M., Wilson, M. C., and Skene, J. H. (1992)

J. Neurosci. 12, 4634–4641.4. Koticha, D. K., Huddleston, S. J., Witkin, J. W., and Baldini, G.

(1999) J. Biol. Chem. 274, 9053–9060.5. Veit, M., Sollner, T. H., and Rothman, J. E. (1996) FEBS Lett.

385, 119–123.6. Vogel, K., and Roche, P. A. (1999) Biochem. Biophys. Res. Com-

mun. 258, 407–410.7. Sadoul, K., Berger, A., Niemann, H., Weller, U., Roche, P. A.,

Klip, A., Trimble, W. S., Regazzi, R., Catsicas, S., and Halban,P. A. (1997) J. Biol. Chem. 272, 33023–33027.

8. Bark, I. C., and Wilson, M. C. (1994) Gene 139, 291–292.9. Hansel, T. T., De Vries, I. J., Iff, T., Rihs, S., Wandzilak, M.,

Betz, S., Blaser, K., and Walker, C. (1991) J. Immunol. Methods145, 105–110.

0. Sutton, R. B., Fasshauer, D., Jahn, R., and Brunger, A. T. (1998)Nature 395, 347–353.

1. Chapman, E. R., An, S., Barton, N., and Jahn, R. (1994) J. Biol.Chem. 269, 27427–27432.

2. Vaidyanathan, V. V., Puri, N., and Roche, P. A. (2001) J. Biol.Chem., in press.

3. Chen, Y. A., Scales, S. J., Patel, S. M., Doung, Y. C., and Scheller,R. H. (1999) Cell 97, 165–174.

4. Kawanishi, M., Tamori, Y., Okazawa, H., Araki, S., Shinoda, H.,and Kasuga, M. (2000) J. Biol. Chem. 275, 8240–8247.

5. Vogel, K., Cabaniols, J. P., and Roche, P. A. (2000) J. Biol. Chem.275, 2959–2965.

6. Low, S. H., Chapin, S. J., Weimbs, T., Komuves, L. G., Bennett,M. K., and Mostov, K. E. (1996) Mol. Biol. Cell 7, 2007–2018.

Documents

Identification of Three New Splice Variants of the SNARE Protein SNAP-23