APPLIED AND ENVIRONMENTAL MICROBIOLOGY, Dec. 2009, p. 7469–7481 Vol. 75, No. 230099-2240/09/$12.00 doi:10.1128/AEM.02146-08Copyright © 2009, American Society for Microbiology. All Rights Reserved.

Identification of Two Aflatrem Biosynthesis Gene Loci inAspergillus flavus and Metabolic Engineering ofPenicillium paxilli To Elucidate Their Function�

Matthew J. Nicholson,1 Albert Koulman,2§ Brendon J. Monahan,1† Beth L. Pritchard,3Gary A. Payne,3 and Barry Scott1*

Centre for Functional Genomics, Institute of Molecular BioSciences, Massey University, Palmerston North, New Zealand1;AgResearch Grasslands, Tennent Drive, Palmerston North, New Zealand2; and Department of Plant Pathology,

North Carolina State University, Raleigh, North Carolina 27695-75673

Received 17 September 2008/Accepted 28 September 2009

Aflatrem is a potent tremorgenic toxin produced by the soil fungus Aspergillus flavus, and a member of astructurally diverse group of fungal secondary metabolites known as indole-diterpenes. Gene clusters forindole-diterpene biosynthesis have recently been described in several species of filamentous fungi. A searchof Aspergillus complete genome sequence data identified putative aflatrem gene clusters in the genomes of A.flavus and Aspergillus oryzae. In both species the genes for aflatrem biosynthesis cluster at two discrete loci; thefirst, ATM1, is telomere proximal on chromosome 5 and contains a cluster of three genes, atmG, atmC, andatmM, and the second, ATM2, is telomere distal on chromosome 7 and contains five genes, atmD, atmQ, atmB,atmA, and atmP. Reverse transcriptase PCR in A. flavus demonstrated that aflatrem biosynthesis transcriptlevels increased with the onset of aflatrem production. Transfer of atmP and atmQ into Penicillium paxilli paxPand paxQ deletion mutants, known to accumulate paxilline intermediates paspaline and 13-desoxypaxilline,respectively, showed that AtmP is a functional homolog of PaxP and that AtmQ utilizes 13-desoxypaxilline asa substrate to synthesize aflatrem pathway-specific intermediates, paspalicine and paspalinine. We propose ascheme for aflatrem biosynthesis in A. flavus based on these reconstitution experiments in P. paxilli andidentification of putative intermediates in wild-type cultures of A. flavus.

The soil fungus Aspergillus flavus is an opportunistic patho-gen that can infect a variety of plant and animal hosts includinghumans (31). Despite identification of a large number of sec-ondary metabolite genes and gene clusters in the genome of A.flavus (25) and the closely related Aspergillus oryzae genome(21), few of these pathways have been characterized. Aflatremand its isomer �-aflatrem are indole-diterpenes produced by A.flavus (9, 10, 32). Indole-diterpenes are a structurally diversegroup of secondary metabolites produced by disparate mem-bers of the Eurotiomycete and Sordariomycete classes of fila-mentous fungi including Aspergillus and Penicillium spp. of theformer and Epichloe and Neotyphodium spp. of the latter (28).The majority of metabolites in this group share a commonstructural core consisting of a tetracyclic diterpene derivedfrom geranylgeranyldiphosphate (GGPP) (7), fused to an in-dole moiety, most likely derived from indole 3-glycerol phos-phate (5). These precursors combine to form paspaline, thefirst stable indole-diterpene required for paxilline biosynthesis(22, 28, 29). More complex indole-diterpenes generally consistof a paxilline-like core modified with a variety of decorations

including different patterns of prenylation, hydroxylation, ep-oxidation, acetylation, and ring rearrangements (24). Aflatremand its isomer �-aflatrem both consist of a paxilline-like corewith an additional prenyl group on the indole moiety and anacetal group on the diterpene skeleton as shown in Fig. 1.

Like many other indole-diterpenes, aflatrem is a potentmammalian tremorgen (9, 10). The mechanisms by whichtremorgenicity is effected are not yet fully understood but maybe related to known neurological effects of aflatrem whichinclude modulation of neurotransmitter release in the centralnervous system (36, 38) and inhibition of BK channels in theperipheral nervous system (17).

The adoption of Penicillium paxilli as a model experimentalsystem for investigating indole-diterpene biosynthesis has en-abled characterization of the genes required for paxilline bio-synthesis, paving the way for the identification and character-ization of indole-diterpene biosynthesis gene clusters in lesstractable fungi such as Neotyphodium lolii and Epichloe festucae(17, 42, 43). Paxilline biosynthesis in P. paxilli requires theproducts of seven clustered genes (paxG, paxA, paxM, paxB,paxC, paxP, and paxQ) (28, 29). The products of four of thesegenes, a GGPP synthase (PaxG), a prenyltransferase (PaxC), aflavin adenine dinucleotide (FAD)-dependent monooxygenase(PaxM), and a protein of unknown function (PaxB), are allrequired for the biosynthesis of paspaline (29). This product issubsequently converted to paxilline by the sequential action oftwo cytochrome P450 monooxygenases, PaxP and PaxQ (22,28). The structural similarity of paxilline and aflatrem (Fig. 1)suggests that biosynthesis of these compounds proceeds viasimilar pathways involving the products of orthologous genes.

* Corresponding author. Mailing address: Centre for FunctionalGenomics, Institute of Molecular BioSciences, Massey University, Pri-vate Bag 11 222, Palmerston North, New Zealand. Phone: 646 3505168. Fax: 646 350 5688. E-mail: d.b.scott@massey.ac.nz.

§ Present address: MRC Human Nutrition Research, Elsie Widdow-son Laboratory, Fulbourn Road, Cambridge CB1 9NL, United King-dom.

† Present address: CSIRO, Clayton, Melbourne, Victoria, Aus-tralia.

� Published ahead of print on 2 October 2009.

7469

on Septem

ber 18, 2020 by guesthttp://aem

.asm.org/

Dow

nloaded from

By comparison with the pax gene cluster in P. paxilli, a com-plete aflatrem biosynthesis cluster would therefore be expectedto contain homologs of all seven paxilline biosynthesis genes,plus a small number of aflatrem-specific genes necessary foradditional modifications. Cloning of a secondary metaboliteGGPP synthase-encoding gene and chromosome walking iden-tified an atm locus (ATM1) containing a cluster of three puta-tive genes for aflatrem production in A. flavus NRRL6541 (44).This locus contains homologs of paxG, paxM, and paxC, des-ignated atmG, atmM, and atmC, respectively. Furthermore, itwas demonstrated that atmM is a functional ortholog of paxMand that the induction of atm gene expression corresponded tothe onset of aflatrem biosynthesis. Although ATM1 includedcandidate genes for some of the early steps required for afla-trem biosynthesis, homologs of four genes known to be neces-sary for later steps in paxilline synthesis in P. paxilli (paxP,paxQ, paxA, and paxB) were not identified.

Complete genome sequences are now available for severaldifferent aspergilli including A. flavus and its close relative A.oryzae (21, 25), enabling rapid identification of genes and geneclusters and predictions of associated biosynthesis potential.The aims of this study were to (i) search the Aspergillus genomedatabases for putative genes required for indole-diterpene bio-synthesis, (ii) characterize the aflatrem biosynthesis pathway inA. flavus by the identification of biosynthesis intermediates,and (iii) propose a scheme for aflatrem biosynthesis based onthe chemical and genetic data. This study identified two ATMloci in A. flavus on separate chromosomes and demonstratedthrough metabolic engineering of P. paxilli that the proposedaflatrem biosynthesis steps from paspaline through paspalininecan be reconstituted in this fungus.

MATERIALS AND METHODS

Fungal strains and growth conditions. Cultures of A. flavus strains NRRL6541and NRRL3357 were maintained on 2.4% Difco potato dextrose agar (BectonDickinson, Maryland) plates or as spore suspensions in 10% (vol/vol) glycerol at�80°C. For aflatrem production, 100-ml Erlenmeyer flasks containing 25 ml ofYEPGA medium (22) were inoculated with 5 � 106 spores and grown withshaking (200 rpm) for 48 h at 30°C. Aliquots of 2 ml were used to inoculate250-ml Erlenmeyer flasks containing 50 ml of aflatrem production medium (44),which were grown without agitation at 29°C in the dark until harvesting. Themycelial mat that formed on the surface of the liquid was retrieved using aspatula and washed in Milli-Q water (Millipore, Massachusetts). Approximately250 mg of mycelium was collected for RNA preparation, and the remainder wasfreeze-dried for indole-diterpene analysis. Fungal samples were stored at �80°Cprior to drying or analysis. For isolation of genomic DNA, 25 ml of CDYEmedium (41) was inoculated with 5 � 106 spores and grown with shaking (200rpm) for 48 h at 30°C. Mycelium was harvested, washed in Milli-Q water (Mil-lipore), and freeze-dried. Strains of P. paxilli were routinely grown in aspergilluscomplete medium at 22°C for 4 to 6 days as previously described (29). Penicilliumcultures were grown in submerged liquid culture for isolation of genomic DNA,preparation of protoplasts, and indole-diterpene analysis as previously described(29).

Isolation, PCR amplification, and sequencing of genomic DNA. GenomicDNA was isolated from freeze-dried mycelia by using the method of Yoder (40).Genomic DNA was amplified using the TripleMaster PCR system (Eppendorf,Hamburg, Germany). Reactions were each performed in a 50-�l volume thatcontained 1� High Fidelity buffer with a final concentration of 4 mM magnesiumacetate, a 200 �M concentration of each deoxynucleoside triphosphate (dNTP),2 U TripleMaster polymerase mix, a 400 nM concentration of each primer, and50 ng of genomic DNA. Thermal cycling was performed in a Mastercyclergradient thermocycler (Eppendorf) under the following conditions: 2 min at 94°Cfollowed by 30 cycles of 94°C for 30 s, 65°C for 30 s, and 72°C for 3 min, with afinal elongation for 10 min at 72°C. Primers used for amplification of atm clustersequences are shown in Table 1. PCR products were purified using the WizardSV gel and PCR cleanup system (Promega, Wisconsin) prior to sequencing. Atleast two independent PCR mixtures were combined and sequenced directly onboth strands using the dideoxynucleotide chain termination method with theBig-Dye Terminator (version 3.1) cycle sequencing kit (Applied Biosystems,California) and separated using an ABI3730 genetic analyzer (Applied Biosys-tems).

Preparation of complementation constructs and transformation of P. paxilli.Genomic DNA containing atmP was amplified from A. flavus strain NRRL6541by using Platinum pfx50 polymerase (Invitrogen) with primers NcoI-atmPF1 andEcoRI-atmPR1 for atmP and NcoI-atmQF1 and EcoRI-atmQR1 for atmQ (Ta-ble 1). Reactions were performed in 50 �l containing 1� pfx50 buffer, 200 �Mof each dNTP, 2 U polymerase, 400 nM of each primer, and 50 ng of genomicDNA under the following conditions: 94°C for 2 min followed by 30 cycles of94°C for 15 s and 68°C for 75 s, with a final elongation for 10 min at 68°C. Thebase vector pPN1851, which contains 850 bp of the promoter region for P. paxillipaxM (43), and the atmP and atmQ amplification products were each digestedwith restriction enzymes EcoRI and NcoI and purified as described for PCRproducts (above). The purified digestion products were ligated together so thatatmP and atmQ were cloned separately into pPN1851 to produce pCP5 (atmP)and pCQ16 (atmQ) under the control of the paxM promoter. Protoplasts of P.paxilli paxP and paxQ deletion mutant strains LMP1 and LMQ226 were preparedand cotransformed with 5 �g of either pCP5 (LMP1) or pCQ16 (LMQ226) and5 �g of pII99 as described previously (29). Transformants were selected onregeneration medium supplemented with 150 �g/ml Geneticin (Roche AppliedScience).

Bioinformatics and genomic sequences. Sequence reads were analyzed usingthe PHRED algorithm and assembled into contigs using the PHRAP algorithmin MacVector Assembler 1.1 (MacVector Inc., 2007) to a minimum confidencescore of PHRED 40 for every nucleotide position. Database searches wereperformed at the Broad Aspergillus Comparative Database website (http://www.broad.mit.edu/annotation/genome/aspergillus_group/MultiHome.html) usingtBLASTn against Aspergillus comparative genomic sequence and at the NationalCenter for Biotechnology Information website (http://www.ncbi.nlm.nih.gov/BLAST/) using BLASTp against the nonredundant protein and Swiss-Prot da-tabases. Identity and similarity scores were calculated after ClustalW alignmentof sequences using MacVector version 9.5 (MacVector Inc.). Genome annota-tions and numbering are given in accordance with the Broad Aspergillus Com-parative Database. Genome sequence for A. flavus NRRL3357 is available atwww.aspergillusflavus.org. Genomic regions for ATM1 and syntenic regions from

FIG. 1. Chemical structures of paxilline (A), aflatrem (B), and�-aflatrem (C).

7470 NICHOLSON ET AL. APPL. ENVIRON. MICROBIOL.

on Septem

ber 18, 2020 by guesthttp://aem

.asm.org/

Dow

nloaded from

other genomes include A. flavus NRRL3357 contig 9 positions 1914683 to1949498; A. oryzae contig 17 positions 1730789 to 1767501; Aspergillus nigercontig 5 positions 2137819 to 2151260, contig 11 positions 1578481 to 1568987,contig 19 positions 432796 to 435876, and contig 4 positions 703107 to 698299;Aspergillus clavatus contig 78 positions 890720 to 895084; Neosartorya fischericontig 576 positions 394080 to 408036 and contig 578 positions 655741 to 650224;Aspergillus fumigatus chromosome 7 positions 164760 to 178480; Aspergillus ter-reus supercontig 9 positions 218784 to 231776; and Aspergillus nidulans contig 112positions 177193 to 190274. For ATM2, genomic regions include A. flavusNRRL3357 contig 5 positions 1938653 to 1963908, A. oryzae contig 22 positions1879902 to 1905024, A. clavatus contig 87 positions 633315 to 623528, A. fumiga-tus chromosome 2 positions 2418299 to 2411172, N. fischeri contig 580 positions3775271 to 3766934, A. terreus supercontig 15 positions 968338 to 975158 and996821 to 998736, A. nidulans contig 104 positions 182943 to 177146, and A. nigercontig 18 positions 575746 to 580865.

Indole-diterpene analysis. Freeze-dried fungal biomasses collected from sta-tionary aflatrem production medium cultures (A. flavus) or submerged liquidcultures (P. paxilli) were each homogenized in 30 ml of a 2:1 mixture of chloro-form-methanol to extract the indole-diterpenes. For semiquantitative analysis ofaflatrem, equal weights (14.6 g � 1 g) of A. flavus biomass were used. After beingmixed for 1 h, samples were centrifuged at 18,000 � g in a bench top centrifugefor 10 min to pellet the insoluble material. A 2-ml aliquot of each extract wasevaporated under a stream of nitrogen gas and then redissolved in 1.0 ml ofmethanol. Samples of 10 �l were analyzed by reverse-phase high-performanceliquid chromatography (HPLC) using a Dionex Summit (Dionex Corporation,California) with a Luna (Phenomenex, California) C18 column (4.6 � 250 mm,5 �m). Methanol-water (85:15) was routinely used as the mobile phase with aflow rate of 1.5 ml/min. For P. paxilli extracts from the atmQ complementationexperiments, the mobile phase was methanol-water (75:25) with a flow rate of 1.2ml/min. All samples and solvents were filtered through 0.45-�m nylon filters(Millipore) before analysis. Eluted products were analyzed by UV spectropho-tometry at either 230 or 280 nm. Three major A. flavus indole-diterpene peakswere collected and analyzed by liquid chromatography-mass spectrometry (LC-MS) along with whole-cell extracts from A. flavus wild-type and atmP- andatmQ-containing derivatives of P. paxilli paxP and paxQ deletion mutants. LC-tandem MS (LC-MS/MS) analysis was performed on a Thermo Finnigan Sur-veyor (Thermo Finnigan, California) HPLC system equipped with a Luna (Phe-nomenex) C18 column (150 � 2 mm, 5 �m) at a flow rate of 200 �l/min with asolvent gradient starting with acetonitrile-water (60:40) in 0.1% formic acid andincreasing to 95% acetonitrile over 30 min followed by a column wash with 99%acetonitrile. Mass spectra were determined with a linear ion trap mass spectrom-eter (Thermo LTQ; Thermo Finnigan, California) using electrospray ionizationin positive mode. The spray voltage was 5.0 kV, and the capillary temperaturewas 275°C; sheath gas, auxiliary gas, and sweep gas were set to 20, 5, and 10(arbitrary units), respectively, and other parameters were optimized automati-cally while infusing paxilline at 10 �l/min. The mass spectrometer either was set

up in data-dependent mode, collecting fragmentation data on the predominantions in the chromatogram, or was set up in single-reaction-monitoring mode,collecting and fragmenting selected ions to determine their presence or absence.

RNA isolation and cDNA synthesis and analysis. Mycelial samples were storedat �80°C prior to processing. Total RNA was isolated from mycelia using theFastRNA Pro Green kit (QBioGene, California) and FastPrep machine (QBio-Gene) per the manufacturer’s instructions and quantified using a nanophotom-eter (Implen, Munich, Germany). Samples of RNA were each treated withDNase I for 30 min at 37°C in a 50-�l reaction volume that contained 30 U ofDNase I (Roche, Auckland, New Zealand), 1� DNase I buffer (Roche), 2 mMof dithiothreitol, 20 units of RNase inhibitor (Invitrogen, Auckland, New Zeal-and), and �30 �g of RNA. Reactions were stopped by incubating the reactionmixtures at 75°C for 10 min. First-strand cDNA synthesis was performed asfollows: a 10.8-�l volume containing 1 �g of DNase-treated RNA and 25 ng ofoligo(dT) was incubated at 65°C for 10 min. A reaction premix of 8.2 �l con-taining 2� reverse transcription buffer (Roche), 10 mM of dithiothreitol, 1 mMof each dNTP, and 8 U of RNase inhibitor (Invitrogen) was then added to theRNA-oligo(dT) premix, followed by 50 U of Expand reverse transcriptase(Roche). Reaction mixtures were incubated at 43°C for 60 min. Resulting cDNAwas diluted 1/10 and used for PCR. Gene-specific amplifications of the cDNAwere carried out in 25-�l reaction mixtures that contained 1� PCR buffer(Invitrogen) with a final concentration of 4 mM MgCl2, 200 �M of each dNTP,0.5 U Platinum Taq polymerase (Invitrogen), 200 nM of each primer, and 1 �l oftemplate cDNA. Thermal cycling was performed in a Mastercycler gradientthermocycler (Eppendorf) with the following conditions: 2 min at 94°C followedby 35 cycles of 94°C for 15 s, 55°C for 30 s, and 72°C for 1 min, with a finalelongation for 10 min at 72°C. Primers that were used for amplification of cDNAare shown in Table 1.

Nucleotide sequence accession numbers. The sequence with nucleotide acces-sion number AY559849 containing A. flavus NRRL6541 ATM1 has been updatedto include new sequence flanking the cluster, and sequence for ATM2 has beendeposited with accession number AM921700. A 2,772-bp sequence covering thegenomic sequence gap in A. flavus NRRL3357 has been deposited under acces-sion number AM911677.

RESULTS

Identification of aflatrem gene clusters in A. flavus and A.oryzae. A search of Aspergillus complete genome sequence da-tabases using tBLASTn with the amino acid sequences en-coded by three linked genes, atmG, atmC, and atmM, proposedto be required for aflatrem production in A. flavus NRRL6541(44), identified the presence of highly similar sequences in thegenomes of A. flavus NRRL3357 and A. oryzae RIB40. A

TABLE 1. Oligonucleotide primers used for amplification of gDNA and cDNA

TargetForward primer Reverse primer Product size (bp)

Name Sequence Name Sequence Genomic cDNA

Sequencegap

3357SG1f GCAAGCACGAGTCGACAAGGTGTTGGA 3357SG2r GTTTCGGTCGCCACATAATATCCGACAA 2,963

ATM1 Atm1F1 CCAGGCACATCTTGTCCGACTCTGGAA Atm1R1 CAAATCCAGCACACCGCAGCTTGGCTA 4,589Atm2F1 CATGTCTTGCTCGGGATAGTGCATCA Atm2R1 ACACGACTGCAGTCACTTGTGATGCCA 5,362Atm2F2 GAAGGAGGTGATGGTAGATGAATGACA Atm2R2 TACGGAGTCCATGTTGTAGAAAGGCTT 5,073

ATM2 Atm2F3 GAGCGATCCGTAGACCATGCCGACATA Atm2R3 TTCTTCGGGAGACTGGGTCGGCTTTCA 4,957Atm2F4 AACATCTCGAACGGGATGGACAGCGTT Atm2R4 TGCTGTACTGCTATAATGAGAGTGTCA 5,140KTR2 CAACAAAATAGCATGATCCAACGCATG Atm2R5 CAATCAGGTCGTGGACACAGACATCGT 6,096

atmP NcoI-atmPF1 ATAGCCATGGACAAATTGACCGCCA EcoRI-atmPR1 TCACGAATTCACCGTAATCGAGGCAGA 1,976atmQ NcoI-atmQF1 TCGTCCATGGATCGACTATTGGAGAGAA EcoRI-atmQR1 TCAAGAATTCTCCGTGTCTTGGTTATTGA 2,380AF108 AF108F1 TGGCCAGCTGACTATTGAAGA AF108R2 GGCAGTATTATCCCAGTCGTT 810 591AF109 AF109F1 GGAACGCTTCCACGAACAACA AF109R1 GGATCCCCTTGGAAGTTACTA 832 780AF110 AF110F1 ACTCTCGCTCTTGCTCTCCAT AF110R1 CGCATTAAGCTCCAACACCTT 1,031 1,031atmG AF25 TGCATCCTCGCTCTCTTCAA 3357SG3f CTTGGGGCGATTGAGCTCT 534 380atmC atmCF TCGGATATTATGTGGCGACC atmCR GTTGCCGCCTCTGTTGCCTT 888 776atmM AF79 GTTATCCGCTCTGAGATGTG AF80 CTGTCATAGACGTAACCTCC 443 375atmD atmDR1 GGTAATCCCGTACATCCATAG Atm2-1R7 GACGGAACACCCGCCGAAG 883 883atmQ Atm2-2F3 GAAGACGAACGTTCCTTCG Atm2-2R4 GCTGCTAAGTTTTGCAGCG 640 479atmB atmBF1 TGGACGGATTTGGCTCATCAC Atm2-2F7 GCTGTGTATATGACGCCCA 280 280atmA Atm2-3F2 GCCACCATGTCGGCTTATC Atm2-3R3 GAGAGACTGGATCTTAGAC 617 551atmP Atm2-3F4 TCCGTCCGAGGTAGAGAAT atmPR1 CTAGGCGGAGGAAAACCTCAT 751 530�-Tubulin AFtub1 CTTCTTCATGGTTGGCTTCG AFtub3 GGTGGAGGACATCTTGAGAC 369 307

VOL. 75, 2009 AFLATREM GENE CLUSTERS IN A. FLAVUS AND A. ORYZAE 7471

on Septem

ber 18, 2020 by guesthttp://aem

.asm.org/

Dow

nloaded from

sequence gap of 1,959 bp on contig 9 of the genome se-quence of strain NRRL3357 was closed by directly sequenc-ing a PCR product that covered this region. A PCR productwas also sequenced to extend the existing �39-kb genomicsequence of the ATM1 locus in strain NRRL6541 by a fur-ther 4 kb. A comparison of this �43-kb sequence in NRRL3357, NRRL6541, and RIB40 showed that the sequences were�97% identical and contained intact copies of atmG, atmC,and atmM.

The ATM locus described above contained putative or-thologs of only three of seven genes that are necessary forpaxilline biosynthesis in P. paxilli. Searching the A. flavus andA. oryzae complete genome sequences by using the amino acidsequences encoded by the four remaining paxilline biosynthe-sis genes (paxA, paxB, paxP, and paxQ) identified a secondlocus, ATM2, that contained homologs of these four genes andanother gene from the pax gene cluster (paxD), which is re-quired for a postpaxilline modification (B. Scott et al., unpub-lished data). Six overlapping PCR products amplified fromgenomic DNA of strain NRRL6541 were sequenced to providea contiguous sequence of �25 kb covering this region. Com-parison of the sequences corresponding between all three ge-nomes revealed �97% identity, with the exception of the in-tergenic region immediately 3� of atmD. This �4-kb region was�96% identical for NRRL3357 and RIB40 but differed forNRRL6541, particularly over a region of approximately 1.5 kb

where NRRL6541 sequence had no detectable similarity withthe other two genomes.

Genomic comparisons of predicted genes in and aroundboth clusters across all three strains enabled refinement ofgene predictions resulting in the A. flavus/A. oryzae consensussequences represented in Fig. 2. Known or predicted functionsfor gene products based on similarity with characterized pro-teins are detailed in Table 2. The genes atmG, atmC, and atmMat ATM1 are proposed to encode a GGPP synthase, a prenyl-transferase, and an FAD-dependent monooxygenase, respec-tively (44). Genes at ATM2 are putative orthologs of other paxgenes and have been designated atmD, atmQ, atmB, atmA, andatmP. atmA and atmB are putative orthologs of paxA and paxB,respectively, and are predicted to encode polytopic membraneproteins whose precise functions in aflatrem biosynthesis areunknown. However, paxA and paxB are both required for pax-illine biosynthesis in P. paxilli (Scott et al., unpublished). atmBcontained one intron in the same relative position as the intronin paxB, and the protein products of these genes shared 61%amino acid identity (77% similarity). atmA also contained asingle intron in the same relative position as the intron in paxA,and amino acid identity between these two proteins was 29%(49% similarity). atmP and atmQ are both predicted to encodecytochrome P450 monooxygenases and are putative orthologsof paxP and paxQ, respectively. The products of each of thesegenes contained all of the functional domains expected for

FIG. 2. Physical maps of ATM1 (A) and ATM2 (B) aflatrem biosynthesis loci in A. flavus and A. oryzae and syntenic regions from otherAspergillus genomes. Arrows represent the positions and transcriptional orientations of genes. The top lines of panels A and B show consensus genepredictions for A. flavus NRRL6541, A. flavus NRRL3357, and A. oryzae RIB40. Genes for other genomes are shown according to annotations asdetailed at the Broad Fungal Genome Initiative website with the exception of the atmB-like sequences for A. niger and A. clavatus, for which therewere no automated predictions. In some cases, such as for the homolog of gene AF205 in A. fumigatus, the corresponding gene predictions do notmatch the full-length A. flavus/A. oryzae predictions; however, homology exists over the areas covered by the shaded bands. Proposed aflatrembiosynthesis genes are shown in red. An atmB relic between atmC and atmM at the ATM1 locus matches a similar relic in A. clavatus and an intactatmB-like gene in A. niger.

7472 NICHOLSON ET AL. APPL. ENVIRON. MICROBIOL.

on Septem

ber 18, 2020 by guesthttp://aem

.asm.org/

Dow

nloaded from

cytochrome P450s including heme-binding domains identicalto PaxP and PaxQ (HFGLGRYAC for AtmP and QFGDGRHTC for AtmQ) (11, 22). atmP contained five intronsidentical in the same relative positions as the introns in paxP,and the gene products shared 61% identity (70% similarity).atmQ contained eight introns that were identical in the samerelative positions as eight of the nine introns in paxQ. Thefourth intron 5� of paxQ does not have an equivalent in atmQsuch that the fourth exon of atmQ was equivalent to the fourthand fifth exons of paxQ. The protein products of paxQ andatmQ share 55% amino acid identity (70% similarity). atmD,which is predicted to encode an aromatic prenyltransferase, isa putative ortholog of paxD. Like paxD, atmD was devoid ofintrons. The predicted protein products share 29% amino acididentity (46% similarity). AtmD was also similar to other char-acterized aromatic prenyltransferases including the dimethyl-allyl tryptophan synthase DmaW from Neotyphodium sp. strainLp1 (24% amino acid identity; 37% similarity) (37) andFGAPT1, a prenyltransferase from A. fumigatus (22% identity;35% similarity) (35). However, none of the functional motifsthat are characteristic of trans-prenyltransferases (20) could beidentified in AtmD.

The amino acid products of all atm genes were found to beat least 95% identical to their orthologs within the three A.flavus/A. oryzae strains investigated. Furthermore, all predictedatm genes in these three genomes appear to have open readingframes capable of encoding functional proteins, with the ex-ception of atmQ in the genome of A. oryzae. The product of

this gene contained a single nucleotide insertion in exon 7 thatwill lead to the synthesis of a nonfunctional protein product.

Seven genes located 3� of atmG in ATM1 are predicted toencode two aromatic hydroxylases/monooxygenases (AF104and AF110), an esterase (AF105), a conserved hypotheticalprotein of unknown function (AF106), two transcription fac-tors (AF107 and AF109), and a dehydrogenase (AF108) (Fig.2). Four genes 3� of atmM are predicted to encode an integralmembrane protein involved in pathogenesis (AF114), a cyto-chrome P450 monooxygenase (AF115), an acetyltransferase(AF116), and a necrosis-inducing protein (AF117). Genes thatare predicted to encode an ion transporter (AF205), a carbox-ylic acid transporter (AF211), and an esterase (AF212) flankthe ATM2 locus and, based on their predicted function, areunlikely to be required for aflatrem biosynthesis.

The two ATM loci in A. oryzae are located approximately 85kb from the end of the short arm of chromosome 5 (ATM1)and close to the middle of chromosome 7 (ATM2) (Fig. 3). Thechromosomal location of the two loci in the genome of A.flavus NRRL3357 matches that of A. oryzae RIB40 (25) (G. A.Payne et al., unpublished data). The higher density of second-ary metabolite-type genes around ATM1 than around ATM2 isconsistent with the observation that genes for secondary me-tabolism tend to be enriched in telomere-proximal regions offungal genomes (8, 23).

atm cluster remnants in other Aspergillus genomes.tBLASTn searches identified putative gene homologs in otherAspergillus genomes. Tables 3 and 4 summarize the genomic

TABLE 2. Known and predicted functions of genes at ATM locia

Gene

Closest characterized match identified by BLASTp

Predicted function/commentSpecies and protein Accession

no. E value Function

AF104 Pseudomonas putidaNahG

AAA25897 2e-21 Salicylate hydroxylase Aromatic hydroxylase withdecarboxylase domain

AF105 Rhodococcus sp. CocE Q9L9D7 2e-17 Cocaine esterase EsteraseAF106 Fungal conserved hypotheticalAF107 Xenopus laevis Krox20 Q08427 2e-12 Transcription factor Transcription factorAF108 Homo sapiens BLVRB NP_990721 3e-06 NADH-flavin reductase Hydroxylase/dehydrogenaseAF109 Neurospora crassa

ACU-15PI7000 1e-05 Transcriptional activator—regulates

acetate utilizationFungal conserved hypothetical;

transcription factor domainsAF110 Pseudomonas putida

NahGAAA25897 1e-15 Salicylate hydroxylase Aromatic hydroxylase/monooxygenase

atmG P. paxilli PaxG AAK11531 8e-97 GGPP synthase GGPP synthaseatmC P. paxilli PaxC AAK11529 2e-108 Prenyltransferase PrenyltransferaseatmM P. paxilli PaxM AAK11530 7e-140 Monooxygenase MonooxygenaseAF114 Blumeria graminis AAL56992 5e-29 Essential for pathogenesis Pathogenesis/penetrationAF115 Mus musculus Cyp8b1 NP_034142 5e-12 Cytochrome P450 monooxygenase Cytochrome P450 monooxygenaseAF116 Fusarium sporotrichioides

TRI101AAD19745 2e-09 Trichothecene acetyltransferase Acetyltransferase

AF117 Botrytis elliptica NEP1 ABB43265 4e-84 Necrosis- and ethylene-inducing protein Necrosis-inducing proteinAF205 Debaryomyces

occidentalis Trk1CAB91046 1e-112 Potassium ion transporter Ion transporter

atmD P. paxilli PaxD AAK11526 9e-56 Aromatic prenyltransferase Aromatic prenyltransferaseatmQ P. paxilli PaxQ AAK11527 7e-174 Cytochrome P450 monooxygenase Cytochrome P450 monooxygenaseatmB P. paxilli PaxB 1e-77 Unknown—required for paxilline

biosynthesisUnknown—required for aflatrem

biosynthesisatmA P. paxilli PaxA 9e-30 Unknown—required for paxilline

biosynthesisUnknown—required for aflatrem

biosynthesisatmP P. paxilli PaxP AAK11528 0 Cytochrome P450 monooxygenase Cytochrome P450 monooxygenaseAF211 S. cerevisiae Jen1p NP_012705 6e-58 Lactate transporter Carboxylic acid transportAF212 A. oryzae AxeA BAD12626 4e-162 Acetyl xylan esterase Esterase

a Boldface denotes proposed atm biosynthesis genes.

VOL. 75, 2009 AFLATREM GENE CLUSTERS IN A. FLAVUS AND A. ORYZAE 7473

on Septem

ber 18, 2020 by guesthttp://aem

.asm.org/

Dow

nloaded from

locations (position on chromosome or contig) and BLASTresults for genes in and around ATM1 and ATM2, respectively.Putative homologs that were linked in other Aspergillus ge-nomes are shaded in Tables 3 and 4 and shown in Fig. 2 toillustrate synteny.

Genomic regions similar to those containing genes AF104 toAF107 3� of atmG in A. flavus were identified in all otherAspergillus genomes with the exception of A. clavatus. A lack ofconserved synteny with other Aspergillus genomes was evidentfor genes AF114 to AF117 found 3� of atmM in A. flavus.Although not linked, homologs of these genes were found inother Aspergillus genomes (Table 3). This observation is con-sistent with the telomere-proximal location of this locus (Fig.3) and the increased levels of genomic reorganization associ-ated with these regions (8, 14). Linked copies of AF108,AF109, and AF110 were not identified in any other genome

besides A. niger, where a syntenic triad of similar genes wasidentified. Linked homologs of some atm genes were also iden-tified in the genomes of A. niger, A. clavatus, and N. fischeri(anamorph Aspergillus fischerianus). In A. niger an atmG-atmCpair was detected in the same order and transcriptional orien-tation as seen in A. flavus/A. oryzae, in addition to a secondatmC homolog that was linked to atmB- and atmM-like genes.While the atmC-atmM-like gene pair was syntenic betweenthese genomes, atmB was located in ATM2 in A. flavus and A.oryzae. However, closer examination of the atmC-atmM inter-genic region in A. flavus/A. oryzae identified a relic of atmBcontaining mutations that disrupt the open reading frame. Asimilar triad was also identified in the genome of A. clavatus,which also contained an atmB-like gene relic. Syntenic ho-mologs of atmG and atmM were identified in the genome of N.fischeri. However, these genes are interrupted by the sequenceof an unrelated conserved hypothetical gene.

No synteny was observed in other Aspergillus genomes forgenes at ATM2 (Fig. 2B). However, homologs of the genesflanking this locus were identified in all other Aspergillus ge-nomes with similar syntenic organization which continues be-yond the 25 kb of sequence represented in Fig. 2B (not shown).In A. flavus and A. oryzae the distance between AF205 andAF211 is approximately 19 kb, compared with approximately0.5 to 3 kb for other sequenced Aspergillus genomes.

Analysis of atm gene transcript levels. HPLC analysis ofextracts of A. flavus NRRL6541 grown in stationary culture forup to 19 days detected increasing aflatrem levels from 108 hpostinoculation (Fig. 4A). Peaks representing three differentaflatrem isomers were detected (see below for mass spectral

FIG. 3. Chromosomal locations of ATM1 (top) and ATM2 (bot-tom) in A. oryzae. ATM1 is located approximately 85 kb from the endof chromosome 5. Sizes are shown in Mb.

TABLE 3. tBLASTn results for predicted or known translational products of locus ATM1 genes (AF104 to AF117) in NRRL6541 againstother Aspergillus genomic sequencesa

a Linkage groups within each genome are displayed with similar shading. Each entry contains the following information from top to bottom, respectively: contig orchromosome number, start position on contig, amino acid identity/alignment length using sequence from NRRL6541 as query, and BLAST E value/score.

7474 NICHOLSON ET AL. APPL. ENVIRON. MICROBIOL.

on Septem

ber 18, 2020 by guesthttp://aem

.asm.org/

Dow

nloaded from

evidence), and the two major aflatrem products were presentin a 2:1 ratio in all samples. This is consistent with the obser-vation that A. flavus NRRL6541 consistently produces aflatremand �-aflatrem in a 2:1 ratio (Jan Tkacz, personal communi-cation), indicating that these peaks represented aflatrem and�-aflatrem, respectively. Semiquantitative analysis of steady-state levels of atm transcripts using reverse transcriptase PCRis shown in Fig. 4B. The onset of expression of atmG, atmC,and atmM transcripts at ATM1 correlated with the onset ofaflatrem biosynthesis at 108 h postinoculation. While mRNAtranscripts at ATM2 were detected much earlier at 48 (atmQ,atmB, and atmA) or 60 (atmD and atmP) h postinoculation,with the exception of atmQ the steady-state levels of the tran-scripts for the genes at this locus correlated with the onset ofaflatrem biosynthesis at 108 h. Low levels of aflatrem weredetected by HPLC in 19-day extracts from A. flavusNRRL3357 grown in stationary culture (not shown).

Chemical analysis of indole-diterpene biosynthesis prod-ucts. LC-MS analysis identified a range of indole-diterpenes inchemical extracts from 19-day cultures of A. flavus NRRL6541as shown in Fig. 5. Known indole-diterpenes that were identi-fied using single reaction monitoring included paspalicine (m/z 418), 13-desoxypaxilline (m/z 420), PC-M6 (m/z 422),paspaline (m/z 422), paspalinine (m/z 434), and threeaflatrem isomers (m/z 502), two of which were likely to beaflatrem and �-aflatrem. The third aflatrem isomer is likely tobe an alternative prenylated derivative of paspalinine. Basedon data-dependent fragmentation, we were able to identifynovel indole-diterpenes including hydroxyaflatrem (m/z 518)and a compound that is likely to be the paxitriol version ofpaspalinine (m/z 436), which we named paspalininol. Threemajor indole-diterpene peaks seen in HPLC traces with reten-tion times of 7.9, 9.8, and 11.8 min (Fig. 4A) were purified andanalyzed by LC-MS and shown to correspond to aflatrem,

FIG. 4. Transcript expression analysis of aflatrem biosynthesisgenes in A. flavus NRRL6541 (A) Reverse-phase HPLC analysis ofindole-diterpenes in culture extracts detected at 280 nm showing theonset of aflatrem production. (B) Reverse transcriptase PCR analysisof steady-state levels of atm transcripts from cultures grown for 36 to120 h. Total RNA was isolated from fungal mycelia and, followingreverse transcription, was amplified by PCR using primers specific foreach of the genes shown.

TABLE 4. tBLASTn results for predicted translational products of locus ATM2 genes (AF205 to AF212) in NRRL6541 against otherAspergillus genomic sequencesa

a Linkage groups within each genome are displayed with similar shading. Each entry contains the following information from top to bottom, respectively: contig orchromosome number and start position on contig, amino acid identity/alignment length using sequence from NRRL6541 as query, and BLAST E value/score.

VOL. 75, 2009 AFLATREM GENE CLUSTERS IN A. FLAVUS AND A. ORYZAE 7475

on Septem

ber 18, 2020 by guesthttp://aem

.asm.org/

Dow

nloaded from

�-aflatrem, and a prenylated derivative of paspalinine, respec-tively. Nineteen-day cultures of A. flavus NRRL3357 containedindole-diterpene profiles similar to that of strain NRRL6541but at 50- to 100-fold lower levels.

Complementation of P. paxilli paxP and paxQ deletion mu-tants with atmP and atmQ. Due to the difficulty of being ableto generate a deletion derivative of an atm gene in A. flavus,several steps in the proposed aflatrem biosynthesis pathwaywere reconstituted in P. paxilli. We previously showed thatatmM, from locus ATM1, can complement paxM to restorepaxilline biosynthesis in P. paxilli (44). Using the same ap-proach, we tested whether atmP and atmQ from locus ATM2could complement paxP and paxQ, respectively. In P. paxilli

PaxP catalyzes the conversion of paspaline to 13-desoxypaxil-line via PC-M6 and PaxQ catalyzes the conversion of 13-des-oxypaxilline to paxilline (28). Protoplasts of P. paxilli paxP(LMP1) and paxQ (LMQ226) were cotransformed with pII99(Genr) and pCP5 or pCQ16, plasmids containing the atmP andatmQ genes from A. flavus NRRL6541 under the control of thepaxM promoter. Mycelial extracts of Genr transformants foundby PCR to contain either atmP (PN2732) or atmQ (PN2733)were then analyzed for the presence of indole-diterpenes bynormal-phase thin-layer chromatography (data not shown) andreverse-phase HPLC (Fig. 6 and 7). P. paxilli AtmP-containingtransformants were shown to synthesize predominantly paxil-line but also contained PC-M6 and 13-desoxypaxilline (Fig. 6).This experiment demonstrates that atmP can complementpaxP and that AtmP can convert paspaline to 13-desoxypaxil-line. Thin-layer chromatography analysis of extracts of the P.paxilli AtmQ-containing transformants showed that theylacked paxilline but instead had two unidentified indole-diter-penes. HPLC analysis confirmed the presence of indole-diter-penes in these extracts with the predominant compound iden-tified from an authentic standard as paspalinine (18.3 min), but13-desoxypaxilline (33.3 min) and an unidentified indole-diter-pene (38.8 min) were also present (Fig. 7). LC-MS analysis offractions collected at 18.3 and 38.8 min confirmed that thesepeaks corresponded to paspalinine (MS1, m/z 434; MS2,m/z 419, loss of methyl) and paspalicine (MS1, m/z 418;MS2, m/z 403, loss of methyl) (data not shown). This exper-iment demonstrated that AtmQ is not a functional ortholog ofPaxQ. Unlike PaxQ, which catalyzes the conversion of 13-desoxypaxilline to paxilline, AtmQ converts 13-desoxypaxillineto paspalicine and paspalinine, proposed intermediates uniqueto aflatrem biosynthesis.

DISCUSSION

We have identified two loci in A. flavus and A. oryzae that areinvolved in indole-diterpene biosynthesis. The reconstitutionin P. paxilli of biosynthesis steps from paspaline to paspalinine,a proposed intermediate for aflatrem biosynthesis, providesvery strong evidence that these two loci encode gene productsnecessary for the biosynthesis of aflatrem. The genome of A.oryzae is rich in secondary metabolite gene clusters (21), butmany of these genes appear not to be expressed under normalgrowth conditions (1), and we did not detect expression of A.oryzae ATM1 genes (atmG, atmC, and atmM) under growthconditions that induce aflatrem biosynthesis in A. flavus (notshown). Furthermore, the identification in A. oryzae of aframeshift mutation in atmQ suggests that the ability to syn-thesize aflatrem has been permanently lost by this fungus.Among the apparent ATM locus gene remnants in the ge-nomes of other aspergilli were apparent functional homologsof paxG, paxC, paxB, and paxM in A. niger (Fig. 2). Previouslywe showed that these four genes are sufficient to mediatepaspaline biosynthesis in P. paxilli (29). Whether A. niger syn-thesizes paspaline or any other indole-diterpenes remains to bedemonstrated.

With the advent of whole-genome sequencing, the mecha-nisms underpinning the evolution and regulation of secondarymetabolite gene clusters in filamentous fungi are beginning tobe understood. In most cases, the genes for a secondary me-

FIG. 5. Chromatogram showing the elution times for indole-diter-penes detected in A. flavus NRRL6541. The top line shows the UVtrace at 275 nm. Subsequent lines show LC-MS/MS traces for 418, 420,422, 434, 436, and 502 ions containing either 130 or 198 m/z fragmentscharacteristic of indole or prenylated indole moieties, respectively.

7476 NICHOLSON ET AL. APPL. ENVIRON. MICROBIOL.

on Septem

ber 18, 2020 by guesthttp://aem

.asm.org/

Dow

nloaded from

tabolite pathway are clustered at a single genomic locus (13),and such clusters are enriched in telomere-proximal regions offungal genomes (8, 13, 14, 23). In both A. flavus and A. oryzae,the atm genes are clustered at two chromosomal loci. TheATM1 locus, containing atmG, atmC, and atmM, is telomereproximal on chromosome 5, while the ATM2 locus, containing

atmD, atmQ, atmB, atmA, and atmP, is telomere distal onchromosome 7. Of the two other indole-diterpene gene clus-ters identified to date, the pax cluster in P. paxilli and the ltmcluster in N. lolii, both are located at a single genomic locus,although the ltm cluster is disrupted by long stretches of AT-rich retrotransposon relic sequences (42, 43). The genes for

FIG. 6. HPLC analysis of indole-diterpenes from a P. paxilli paxP mutant complemented with atmP. Traces include LMP1 (P. paxilli paxPdeletion mutant), LMP1 complemented with pCP5 (atmP complementation construct), wild-type (WT) P. paxilli, and indole-diterpene standards.

FIG. 7. HPLC analysis of indole-diterpenes from a P. paxilli paxQ mutant containing atmQ. Traces include LMQ226 (P. paxilli paxQ deletionmutant), LMQ226 with pCQ16 (atmQ construct), and indole-diterpene standards.

VOL. 75, 2009 AFLATREM GENE CLUSTERS IN A. FLAVUS AND A. ORYZAE 7477

on Septem

ber 18, 2020 by guesthttp://aem

.asm.org/

Dow

nloaded from

dothistromin biosynthesis in Dothistroma septosporum are alsoseparated into several miniclusters, although all are located ona 1.3-Mb minichromosome (45). The only other known fungalsecondary metabolite biosynthesis pathways for which thegenes are located at discrete genomic regions are those forT-toxin biosynthesis in Cochliobolus heterostrophus and for tri-chothecene biosynthesis in Fusarium spp. In the heterothallicfungus C. heterostrophus, the genes for T-toxin biosynthesis arelocated on two chromosomes. These genes are inherited to-gether as their respective chromosomes contain reciprocaltranslocations and form a four-arm linkage group with theT-toxin genes at the translocation breakpoint (18). In Fusariumspp. the genes for trichothecene biosynthesis are split betweenthree coregulated loci including a core cluster of 10 or 11 genes(3), a two-gene minicluster (4), and a third locus with a singletrichothecene gene (Tri101) (15). Genes in the outlying mini-clusters appear to have been recruited for trichothecene bio-synthesis more recently than those in the core cluster, andTri101 appears to have evolved separately, suggesting thatthese genes have never been located at a single locus (4, 16).The physical arrangement of atm genes in A. flavus and A.oryzae is likely to have arisen by fragmentation of a singleancestral cluster. In support of this hypothesis, identification ofan atmB relic at ATM1 suggests that duplication of atmB pre-ceded or accompanied cluster fragmentation, thus giving riseto a copy of atmB at each ATM locus. Furthermore, the phys-ical position of ATM2 in an otherwise syntenic genomic region(Fig. 2B) suggests a relatively recent insertion event that tookplace after A. flavus and A. oryzae separated from the otheraspergilli.

Enrichment of secondary metabolite gene clusters in telo-mere-proximal regions of fungal genomes (8, 14, 23) suggeststhat the rapid structural evolution seen in these regions (8, 14)is a major facilitator of the birth, development, and demise ofgene clusters and may thus account for discontinuous phylo-genetic distribution of secondary metabolism biosynthesis ca-pability in monophyletic fungal lineages (2). Identification ofATM loci remnants in the genomes of other aspergilli (Fig. 2A)suggests that indole-diterpene biosynthesis ability is an ances-tral trait. Subtelomeric genomic reorganization was particu-larly evident in the sequences surrounding ATM1 where thetelomere-distal (atmG) flank displayed a high degree of syn-tenic conservation with other aspergillus genomes, while therewas no detectable synteny for genes on the telomere-proximal(atmM) flank (Fig. 2A). In Saccharomyces cerevisiae genomiccomparisons demonstrated that boundaries of subtelomeres(which ranged from �7 to �52 kb) were defined by differencesin number, order, and orientation of genes in telomeric regions(14). The ATM1 locus was �86 and �102 kb from the chro-mosome ends and appears to define the subtelomeric bound-aries in A. oryzae and A. flavus, respectively.

By analogy with the pathway for paxilline biosynthesis in P.paxilli (22, 28, 29, 41), the identification of biosynthesis inter-mediates by LC-MS, and genetic complementation experi-ments involving atmM, atmP, and atmQ, a proposed pathwayfor aflatrem biosynthesis in A. flavus is presented in Fig. 8.Chemical and genetic evidence suggests that the biosynthesisof paspaline in A. flavus proceeds via the same pathway as in P.paxilli involving AtmG, AtmC, AtmM, and AtmB as orthologsof PaxG, PaxC, PaxM, and PaxB, respectively (29). The precise

functions of these genes in paspaline biosynthesis are not yetknown. However, it seems likely that synthesis of GGPP byAtmG (a GGPP synthase) precedes condensation of GGPPwith indole 3-glycerol phosphate (5), followed by epoxidationand cyclization by AtmM (a FAD-dependent monooxygenase)and AtmC (a prenyltransferase) to produce paspaline. We alsopropose that AtmB is essential for the biosynthesis of paspal-ine in A. flavus, although as for the role of PaxB in paspalinebiosynthesis by P. paxilli, its biochemical function is unknown(29). We have demonstrated that AtmP, a cytochrome P450monooxygenase, is a functional ortholog of PaxP in P. paxilliand converts paspaline to 13-desoxypaxilline via PC-M6 byremoval of the C-30 methyl group and oxidation at C-10. Incontrast, AtmQ is not a functional ortholog of PaxQ. In P.paxilli, PaxQ catalyzes the conversion of 13-desoxypaxilline topaxilline via oxidation at C-13. In contrast, the reconstitutionexperiments carried out in this study demonstrate that AtmQis a multifunctional cytochrome P450 monooxygenase that cat-alyzes the oxidation of 13-desoxypaxilline, first at C-7 to pro-duce paspalicine and then at C-13 to form paspalinine, thelatter step being equivalent to the oxidation of 13-desoxypax-illine by PaxQ. PaxQ and AtmQ therefore uniquely define theindole-diterpene biosynthesis capability of P. paxilli and A.flavus, respectively. The C-7 oxidation step may represent ei-ther a gain of function in A. flavus (AtmQ) or a loss of functionin P. paxilli (PaxQ) compared with its ancestral state. Theproposed scheme implicates both AtmP and AtmQ in multipleoxidations at different carbon atoms similar to the multiplesteps catalyzed by PaxP in P. paxilli (28). Multifunctional cy-tochrome P450 enzymes that perform sequential oxidationshave also been identified in other fungal secondary metabolismpathways including gibberellin biosynthesis in Fusarium fujiku-roi (27, 34) and trichothecene biosynthesis in Fusarium spp.(33). For the latter, an enzyme from Trichothecium roseum isable to perform only three of four oxidations performed by itsFusarium homolog, thus representing a loss or gain of functionsimilar to what we are proposing for PaxQ/AtmQ.

Finally, we propose that AtmD prenylates paspalinine toform aflatrem. AtmD aligned with a newly described group offungal aromatic prenyltransferases that catalyze prenyl transferonto indole or an indole moiety (39) and include PaxD, whichprenylates the indole group of paxilline in P. paxilli (Scott et al.,unpublished), and a dimethylallyl tryptophan synthase fromNeotyphodium sp. (37). Unlike trans-prenyltransferases, theseproteins typically do not contain a DDXXD substrate-bindingmotif and their function is not dependent on divalent metalions. The structure of aflatrem suggests that AtmD functionsin a “reverse” manner, i.e., DMAPP is linked via its C-3 asopposed to C-1 or C-2 for “regular” prenyl transfer (35).The identification of three aflatrem isomers which differ in thepositions and/or arrangements of the prenyl groups on theindole moiety suggests catalytic promiscuity for AtmD as re-ported for an aromatic prenyltransferase required for naphter-pin biosynthesis in Streptomyces sp., where prenyl transfer oc-curs preferentially at one of two possible sites on the substratemolecule (19).

Detection of paspalininol (a paxitriol version of paspalinine)suggests a possible side reaction involving the oxidation ofPC-M6 at C-13 and C-7 by AtmQ to produce this compound,most likely with paspalicinol as an intermediate, but this pax-

7478 NICHOLSON ET AL. APPL. ENVIRON. MICROBIOL.

on Septem

ber 18, 2020 by guesthttp://aem

.asm.org/

Dow

nloaded from

itriol version of paspalicine was not detected (Fig. 8). C-13oxidation of PC-M6 has been demonstrated for PaxQ in P.paxilli; however, PaxQ could accept only �- and not �-PC-M6as a substrate (28). Similar experiments could be carried out byfeeding these isomers to the P. paxilli pax gene cluster deletionmutant, containing an ectopically integrated copy of atmP, todetermine the substrate stereospecificity of AtmP.

The coordinate increase in the steady-state level of mRNAfor seven of the eight atm genes with the onset of aflatrembiosynthesis suggests that the atm genes at both ATM loci arecontrolled by the same positive regulator, despite their lack ofphysical proximity. However, the low-level expression of telo-mere-distal (ATM2) genes at earlier time points when telo-mere-proximal (ATM1) gene transcripts were not detectedsuggests that locus-specific regulation may also be important.Transcriptional regulation of secondary metabolite biosynthe-sis genes in filamentous fungi is mediated by a complex inter-play of several regulatory mechanisms. In some cases, such asfor aflatoxin and trichothecene biosynthesis, a pathway-specificregulator gene is embedded in the cluster (16, 26). However,no such regulator was identified at either of the ATM gene locior in the PAX and LTM gene loci (41, 43). AF109, a genepresent 3� of atmG at ATM1, encodes a putative GAL4-typetranscription factor, but besides physical proximity to atmgenes, there is no evidence to suggest that this gene has anyrole in aflatrem biosynthesis. Furthermore, this gene formspart of a highly conserved gene triplet also identified in A.niger, suggesting that these three genes are involved in an

unrelated process. Differential regulation of the two ATM lociprior to the onset of aflatrem biosynthesis at 108 h may bemediated by a histone deacetylase such as HdaA, which neg-atively regulates telomere-proximal but not telomere-distalsecondary metabolite gene clusters in A. nidulans (30).

The biosynthesis of aflatrem by A. flavus is positively regu-lated by VeA, which also regulates the production of othersecondary metabolites and the formation of sclerotia (6). De-letion of veA results in loss of aflatrem biosynthesis via disrup-tion of transcription of atmG, atmC, and atmM at ATM1 (6).However, the effect of this deletion on expression of genes atATM2 has not yet been tested. The global regulator LaeA hasalso been shown to regulate the biosynthesis of aflatrem andseveral other secondary metabolites in A. flavus, with overex-pression of this protein resulting in the production of aflatremunder conditions that do not induce aflatrem biosynthesis inwild-type cultures (12).

Results of this study suggest that all of the structural genesnecessary for biosynthesis of aflatrem in A. flavus are clusteredat two separate loci. We have demonstrated here roles for bothatmP and atmQ in indole-diterpene biosynthesis. Previously wedemonstrated that atmM is a functional ortholog of paxM (44).Taken together, these experiments demonstrate that Atm geneproducts are involved in the synthesis of paspaline and themultistep catalytic steps required for the conversion of paspa-line to paspalinine. A comparison of this reconstituted biosyn-thesis pathway with what is known for indole-diterpene bio-synthesis in P. paxilli suggests that structural differences

FIG. 8. Proposed biosynthesis scheme for aflatrem biosynthesis in A. flavus. The scheme shows the proposed steps catalyzed by the atm geneproducts including the A. flavus-specific major and minor steps catalyzed by AtmQ using 13-desoxypaxilline and �-PC-M6 as the substrate,respectively.

VOL. 75, 2009 AFLATREM GENE CLUSTERS IN A. FLAVUS AND A. ORYZAE 7479

on Septem

ber 18, 2020 by guesthttp://aem

.asm.org/

Dow

nloaded from

between pax and atm biosynthesis gene products are due todifferences in the catalytic abilities of homologous enzymes,and not the action of novel pathway enzymes in one or anotherspecies. The organization of atm genes at two discrete loci, onetelomere proximal and the other telomere distal, offers insightinto the mechanisms underpinning the evolution of secondarymetabolite gene clusters and provides a useful experimentalmodel for investigating the positional and general effects ofsecondary metabolite gene cluster regulation.

ACKNOWLEDGMENTS

We thank Sanjay Saikia for technical advice and Chris Miles, GeoffLane, and Brian Tapper from AgResearch for discussions on thechemistry of indole-diterpene biosynthesis. We also thank Geoff Laneand Karl Fraser for MS analysis of some samples.

This work was funded by the Massey University Research Fund.

REFERENCES

1. Akao, T., M. Sano, O. Yamada, T. Akeno, K. Fujii, K. Goto, S. Ohashi-Kunihiro, K. Takase, M. Yasukawa-Watanabe, K. Yamaguchi, Y. Kurihara,J. Maruyama, P. R. Juvvadi, A. Tanaka, Y. Hata, Y. Koyama, S. Yamaguchi,N. Kitamoto, K. Gomi, K. Abe, M. Takeuchi, T. Kobayashi, H. Horiuchi, K.Kitamoto, Y. Kashiwagi, M. Machida, and O. Akita. 2007. Analysis of ex-pressed sequence tags from the fungus Aspergillus oryzae cultured underdifferent conditions. DNA Res. 14:47–57.

2. Berbee, M. L. 2001. The phylogeny of plant and animal pathogens in theAscomycota. Physiol. Mol. Plant Pathol. 59:165–187.

3. Brown, D. W., R. B. Dyer, S. F. McCormick, D. F. Kendra, and R. D.Plattner. 2004. Functional demarcation of the Fusarium core trichothecenegene cluster. Fungal Genet. Biol. 41:454–462.

4. Brown, D. W., R. H. Proctor, R. B. Dyer, and R. D. Plattner. 2003. Charac-terization of a Fusarium 2-gene cluster involved in trichothecene C-8 mod-ification. J. Agric. Food Chem. 51:7936–7944.

5. Byrne, K. M., S. K. Smith, and J. G. Ondeyka. 2002. Biosynthesis of nodu-lisporic acid A: precursor studies. J. Am. Chem. Soc. 124:7055–7060.

6. Duran, R. M., J. W. Cary, and A. M. Calvo. 2007. Production of cyclopia-zonic acid, aflatrem, and aflatoxin by Aspergillus flavus is regulated by veA, agene necessary for sclerotial formation. Appl. Microbiol. Biotechnol. 73:1158–1168.

7. Fueki, S., T. Tokiwano, H. Toshima, and H. Oikawa. 2004. Biosynthesis ofindole diterpenes, emindole, and paxilline: involvement of a common inter-mediate. Org. Lett. 6:2697–2700.

8. Galagan, J. E., S. E. Calvo, C. Cuomo, L. J. Ma, J. R. Wortman, S. Batzo-glou, S. I. Lee, M. Basturkmen, C. C. Spevak, J. Clutterbuck, V. Kapitonov,J. Jurka, C. Scazzocchio, M. Farman, J. Butler, S. Purcell, S. Harris, G. H.Braus, O. Draht, S. Busch, C. D’Enfert, C. Bouchier, G. H. Goldman, D.Bell-Pedersen, S. Griffiths-Jones, J. H. Doonan, J. Yu, K. Vienken, A. Pain,M. Freitag, E. U. Selker, D. B. Archer, M. A. Penalva, B. R. Oakley, M.Momany, T. Tanaka, T. Kumagai, K. Asai, M. Machida, W. C. Nierman,D. W. Denning, M. Caddick, M. Hynes, M. Paoletti, R. Fischer, B. Miller, P.Dyer, M. S. Sachs, S. A. Osmani, and B. W. Birren. 2005. Sequencing ofAspergillus nidulans and comparative analysis with A. fumigatus and A. oryzae.Nature 438:1105–1115.

9. Gallagher, R. T., J. Clardy, and B. J. Wilson. 1980. Aflatrem, a tremorgenictoxin from Aspergillus flavus. Tetrahedron Lett. 21:239–242.

10. Gallagher, R. T., and B. J. Wilson. 1978. Aflatrem, a tremorgenic toxin fromAspergillus flavus. Mycopathology 66:183–185.

11. Graham-Lorence, S. E., and J. A. Peterson. 1996. Structural alignments ofP450s and extrapolations to the unknown. Methods Enzymol. 272:315–326.

12. Kale, S. P., L. Milde, M. K. Trapp, J. C. Frisvad, N. P. Keller, and J. W. Bok.2008. Requirement of LaeA for secondary metabolism and sclerotial pro-duction in Aspergillus flavus. Fungal Genet. Biol. 45:1422–1429.

13. Keller, N. P., and T. M. Hohn. 1997. Metabolic pathway gene clusters infilamentous fungi. Fungal Genet. Biol. 21:17–29.

14. Kellis, M., N. Patterson, M. Endrizzi, B. Birren, and E. S. Lander. 2003.Sequencing and comparison of yeast species to identify genes and regulatoryelements. Nature 423:241–254.

15. Kimura, M., I. Kaneko, M. Komiyama, A. Takatsuki, H. Koshino, K. Yon-eyama, and I. Yamaguchi. 1998. Trichothecene 3-O-acetyltransferase pro-tects both the producing organism and transformed yeast from related my-cotoxins. Cloning and characterization of Tri101. J. Biol. Chem. 273:1654–1661.

16. Kimura, M., T. Tokai, N. Takahashi-Ando, S. Ohsato, and M. Fujimura.2007. Molecular and genetic studies of fusarium trichothecene biosynthesis:pathways, genes, and evolution. Biosci. Biotechnol. Biochem. 71:2105–2123.

17. Knaus, H.-G., O. B. McManus, S. H. Lee, W. A. Schmalhofer, M. Garcia-

Calvo, L. M. H. Helms, M. Sanchez, K. Giangiacomo, J. P. Reuben, A. B.Smith, G. J. Kaczorowski, and M. L. Garcia. 1994. Tremorgenic indolealkaloids potently inhibit smooth muscle high-conductance calcium-activatedchannels. Biochemistry 33:5819–5828.

18. Kodama, M., M. S. Rose, G. Yang, S. H. Yun, O. C. Yoder, and B. G.Turgeon. 1999. The translocation-associated Tox1 locus of Cochliobolus het-erostrophus is two genetic elements on two different chromosomes. Genetics151:585–596.

19. Kuzuyama, T., J. P. Noel, and S. B. Richard. 2005. Structural basis for thepromiscuous biosynthetic prenylation of aromatic natural products. Nature435:983–987.

20. Liang, P.-H., T.-P. Ko, and A. H. J. Wang. 2002. Structure, mechanism andfunction of prenyltransferases. Eur. J. Biochem. 269:3339–3354.

21. Machida, M., K. Asai, M. Sano, T. Tanaka, T. Kumagai, G. Terai, K.Kusumoto, T. Arima, O. Akita, Y. Kashiwagi, K. Abe, K. Gomi, H. Horiuchi,K. Kitamoto, T. Kobayashi, M. Takeuchi, D. W. Denning, J. E. Galagan,W. C. Nierman, J. Yu, D. B. Archer, J. W. Bennett, D. Bhatnagar, T. E.Cleveland, N. D. Fedorova, O. Gotoh, H. Horikawa, A. Hosoyama, M. Ichi-nomiya, R. Igarashi, K. Iwashita, P. R. Juvvadi, M. Kato, Y. Kato, T. Kin, A.Kokubun, H. Maeda, N. Maeyama, J. Maruyama, H. Nagasaki, T. Nakajima,K. Oda, K. Okada, I. Paulsen, K. Sakamoto, T. Sawano, M. Takahashi, K.Takase, Y. Terabayashi, J. R. Wortman, O. Yamada, Y. Yamagata, H.Anazawa, Y. Hata, Y. Koide, T. Komori, Y. Koyama, T. Minetoki, S. Suhar-nan, A. Tanaka, K. Isono, S. Kuhara, N. Ogasawara, and H. Kikuchi. 2005.Genome sequencing and analysis of Aspergillus oryzae. Nature 438:1157–1161.

22. McMillan, L. K., R. L. Carr, C. A. Young, J. W. Astin, R. G. T. Lowe, E. J.Parker, G. B. Jameson, S. C. Finch, C. O. Miles, O. B. McManus, W. A.Schmalhofer, M. L. Garcia, G. J. Kaczorowski, M. Goetz, J. S. Tkacz, and B.Scott. 2003. Molecular analysis of two cytochrome P450 monooxygenasegenes required for paxilline biosynthesis in Penicillium paxilli, and effects ofpaxilline intermediates on mammalian maxi-K ion channels. Mol. Gen.Genomics 270:9–23.

23. Nierman, W. C., A. Pain, M. J. Anderson, J. R. Wortman, H. S. Kim, J.Arroyo, M. Berriman, K. Abe, D. B. Archer, C. Bermejo, J. Bennett, P.Bowyer, D. Chen, M. Collins, R. Coulsen, R. Davies, P. S. Dyer, M. Farman,N. Fedorova, N. Fedorova, T. V. Feldblyum, R. Fischer, N. Fosker, A. Fraser,J. L. García, M. J. García, A. Goble, G. H. Goldman, K. Gomi, S. Griffith-Jones, R. Gwilliam, B. Haas, H. Haas, D. Harris, H. Horiuchi, J. Huang, S.Humphray, J. Jimenez, N. Keller, H. Khouri, K. Kitamoto, T. Kobayashi, S.Konzack, R. Kulkarni, T. Kumagai, A. Lafton, J. P. Latge, W. Li, A. Lord, C.Lu, W. H. Majoros, G. S. May, B. L. Miller, Y. Mohamoud, M. Molina, M.Monod, I. Mouyna, S. Mulligan, L. Murphy, S. O’Neil, I. Paulsen, M. A.Penalva, M. Pertea, C. Price, B. L. Pritchard, M. A. Quail, E. Rabbinowitsch,N. Rawlins, M. A. Rajandream, U. Reichard, H. Renauld, G. D. Robson, S.Rodríguez de Cordoba, J. M. Rodríguez-Pena, C. M. Ronning, S. Rutter,S. L. Salzberg, M. Sanchez, J. C. Sanchez-Ferrero, D. Saunders, K. Seeger,R. Squares, S. Squares, M. Takeuchi, F. Tekaia, G. Turner, C. R. Vazquez deAldana, J. Weidman, O. White, J. Woodward, J. H. Yu, C. Fraser, J. E.Galagan, K. Asai, M. Machida, N. Hall, B. Barrell, and D. W. Denning. 2005.Genomic sequence of the pathogenic and allergenic filamentous fungusAspergillus fumigatus. Nature 438:1151–1156.

24. Parker, E. J., and D. B. Scott. 2004. Indole-diterpene biosynthesis in asco-mycetous fungi, p. 405–426. In Z. An (ed.), Handbook of industrial mycol-ogy, vol. 14. Marcel Dekker, New York, NY.

25. Payne, G. A., W. C. Nierman, J. R. Wortman, B. L. Pritchard, D. Brown,R. A. Dean, D. Bhatnagar, T. E. Cleveland, M. Machida, and J. Yu. 2006.Whole genome comparison of Aspergillus flavus and A. oryzae. Med. Mycol.44(Suppl. 1):9–11.

26. Price, M. S., J. Yu, W. C. Nierman, H. S. Kim, B. Pritchard, C. A. Jacobus,D. Bhatnagar, T. E. Cleveland, and G. A. Payne. 2006. The aflatoxin pathwayregulator AflR induces gene transcription inside and outside of the aflatoxinbiosynthetic cluster. FEMS Microbiol. Lett. 255:275–279.

27. Rojas, M. C., P. Hedden, P. Gaskin, and B. Tudzynski. 2001. The P450-1gene of Gibberella fujikuroi encodes a multifunctional enzyme in gibberellinbiosynthesis. Proc. Natl. Acad. Sci. USA 98:5838–5843.

28. Saikia, S., E. J. Parker, A. Koulman, and B. Scott. 2007. Defining paxillinebiosynthesis in Penicillium paxilli: functional characterization of two cyto-chrome P450 monooxygenases. J. Biol. Chem. 282:16829–16837.

29. Saikia, S., E. J. Parker, A. Koulman, and B. Scott. 2006. Four gene productsare required for the fungal synthesis of the indole diterpene paspaline. FEBSLett. 580:1625–1630.

30. Shwab, E. K., J. W. Bok, M. Tribus, J. Galehr, S. Graessle, and N. P. Keller.2007. Histone deacetylase activity regulates chemical diversity in Aspergillus.Eukaryot. Cell 6:1656–1664.

31. St. Leger, R. J., S. E. Screen, and B. Shams-Pirzadeh. 2000. Lack of hostspecialization in Aspergillus flavus. Appl. Environ. Microbiol. 66:320–324.

32. TePaske, M. R., J. B. Gloer, D. T. Wicklow, and P. F. Dowd. 1992. Aflavarinand �-aflatrem: new anti-insectan metabolites from the sclerotia of Aspergil-lus flavus. J. Nat. Prod. 55:1080–1086.

33. Tokai, T., H. Koshino, N. Takahashi-Ando, M. Sato, M. Fujimura, and M.Kimura. 2007. Fusarium Tri4 encodes a key multifunctional cytochrome

7480 NICHOLSON ET AL. APPL. ENVIRON. MICROBIOL.

on Septem

ber 18, 2020 by guesthttp://aem

.asm.org/

Dow

nloaded from

P450 monooxygenase for four consecutive oxygenation steps in trichoth-ecene biosynthesis. Biochem. Biophys. Res. Commun. 353:412–417.

34. Tudzynski, B., P. Hedden, E. Carrera, and P. Gaskin. 2001. The P450-4 geneof Gibberella fujikuroi encodes ent-kaurene oxidase in the gibberellin biosyn-thesis pathway. Appl. Environ. Microbiol. 67:3514–3522.

35. Unsold, I. A., and S. M. Li. 2006. Reverse prenyltransferase in the biosyn-thesis of fumigaclavine C in Aspergillus fumigatus: gene expression, purifica-tion, and characterization of fumigaclavine C synthase FGAPT1. Chembio-chem 7:158–164.

36. Valdes, J. J., J. E. Cameron, and R. J. Cole. 1985. Aflatrem: a tremorgenicmycotoxin with acute neurotoxic effects. Environ. Health Perspect. 62:459–463.

37. Wang, J., C. Machado, D. G. Panaccione, H.-F. Tsai, and C. L. Schardl.2004. The determinant step in ergot alkaloid biosynthesis by an endophyte ofperennial ryegrass. Fungal Genet. Biol. 41:189–198.

38. Yao, Y., A. B. Peter, R. Baur, and E. Sigel. 1989. The tremorgen aflatrem isa positive allosteric modulator of the gamma-aminobutyric acid receptorchannel in Xenopus oocytes. Mol. Pharmacol. 35:319–323.

39. Yin, W. B., H. L. Ruan, L. Westrich, A. Grundmann, and S. M. Li. 2007.CdpNPT, an N-prenyltransferase from Aspergillus fumigatus: overproduc-

tion, purification and biochemical characterisation. Chembiochem 8:1154–1161.

40. Yoder, O. C. 1988. Cochliobolus heterostrophus, cause of southern corn leafblight. Adv. Plant Pathol. 6:93–112.

41. Young, C., L. McMillan, E. Telfer, and B. Scott. 2001. Molecular cloning andgenetic analysis of an indole-diterpene gene cluster from Penicillium paxilli.Mol. Microbiol. 39:754–764.

42. Young, C. A., M. K. Bryant, M. J. Christensen, B. A. Tapper, G. T. Bryan,and B. Scott. 2005. Molecular cloning and genetic analysis of a symbiosis-expressed gene cluster for lolitrem biosynthesis from a mutualistic endo-phyte of perennial ryegrass. Mol. Gen. Genomics 274:13–29.

43. Young, C. A., S. Felitti, K. Shields, G. Spangenberg, R. D. Johnson, G. T.Bryan, S. Saikia, and B. Scott. 2006. A complex gene cluster for indole-diterpene biosynthesis in the grass endophyte Neotyphodium lolii. FungalGenet. Biol. 43:679–693.

44. Zhang, S., B. J. Monahan, J. S. Tkacz, and B. Scott. 2004. An indole-diterpene gene cluster from Aspergillus flavus. Appl. Environ. Microbiol.70:6875–6883.

45. Zhang, S., A. Schwelm, H. Jin, L. J. Collins, and R. E. Bradshaw. 2007. Afragmented aflatoxin-like gene cluster in the forest pathogen Dothistromaseptosporum. Fungal Genet. Biol. 44:1342–1354.

VOL. 75, 2009 AFLATREM GENE CLUSTERS IN A. FLAVUS AND A. ORYZAE 7481

on Septem

ber 18, 2020 by guesthttp://aem

.asm.org/

Dow

nloaded from