12
c.A. ~ ~~, ~~ Indian Institute of Technology Kharagpur ,-. QUESTION-CUM-ANSWERSCRIPT Stamp/Signature of the Invigilator MID-SEMESTER/ END-SEMESTEREXAMINATION I SEMESTER( Autumn / Spring) Roll Number I I Section I Name I Subject Number B S20001 Subject Name Science of living systems Department/ Centre/School I Additional Sheets I Important Instructions and Guidelines for Students 1. You must occupy your seat as per the Examination Schedule/Sitting Plan. 2. Mobile phones or any such electronic gadgets, even in the switched off mode, are strictly banned. 3. Loose papers, class notes, books or any such materials must not be in your possession; even if they are irrelevant to the subject you are taking examination. 4. Data book, codes, graph papers, relevant standard tables/charts or any other materials are allowed only when instructed by the paper-setter. 5. Use of instrument box, pencil box and non-programmable calculator is allowed during the examination. However, the exchange of these items or any other papers (including question papers) ls'not permitted. 6. Write on both sides of the answer-script and do not tear off any page. Use last page(s) of the answer-script for rough work. If the answer-script contains torn or distorted page{s), report to the invigilator. 7. It is your responsibility to ensure that you have signed the Attendance Sheet. Keep your Admit Card and Identity Card on the desk for checking by the invigilators. 8. During examination, you may leave the Examination Hall for a very short period for wash room or drinking water. Record your absence from the Examination Hall in the register provided. Smoking and the consumption of any kind of beverages are strictly prohibited inside the Examination Hall. 9. Do not leave the Examination Hall without submitting your answer-script to the invigilator. In any case, you are not allowed to take away the answer-script with you. After the completion of the examination, do not leave your seat until the invigilators collect all the answer-scripts. 10. During examination, either inside or outside the Examination Hall, gathering information from any kind of sources or exchanging information with others or any such attempt will be treated as 'unfair means'. Don't adopt unfair means and also don't indulge in unseemly behavior. Violation of any of the above instructions may lead to severe punishment. Signature of the Student To be Filled by the Examiner Question Number 1 2 3 4 5 6 7 8 9 10 Total Marks Obtained Marks Obtained (in words) Signature of the Examiner Signature of the Scrutineer - - - i -

Important Instructions andGuidelines for Students

  • Upload
    others

  • View
    3

  • Download
    0

Embed Size (px)

Citation preview

Page 1: Important Instructions andGuidelines for Students

c.A. ~

~~,

~~ Indian Institute of Technology Kharagpur,-. QUESTION-CUM-ANSWERSCRIPT Stamp/Signature of the Invigilator

MID-SEMESTER/ END-SEMESTEREXAMINATION I SEMESTER( Autumn / Spring)

Roll Number I I Section I Name ISubject Number B S 2 0 0 0 1 Subject Name Science of living systems

Department/ Centre/School I Additional Sheets IImportant Instructions and Guidelines for Students

1. You must occupy your seat as per the Examination Schedule/Sitting Plan.

2. Mobile phones or any such electronic gadgets, even in the switched off mode, are strictly banned.

3. Loose papers, class notes, books or any such materials must not be in your possession; even if they areirrelevant to the subject you are taking examination.

4. Data book, codes, graph papers, relevant standard tables/charts or any other materials are allowed onlywhen instructed by the paper-setter.

5. Use of instrument box, pencil box and non-programmable calculator is allowed during the examination.However, the exchange of these items or any other papers (including question papers) ls'not permitted.

6. Write on both sides of the answer-script and do not tear off any page. Use last page(s) of the answer-scriptfor rough work. If the answer-script contains torn or distorted page{s), report to the invigilator.

7. It is your responsibility to ensure that you have signed the Attendance Sheet. Keep your Admit Card andIdentity Card on the desk for checking by the invigilators.

8. During examination, you may leave the Examination Hall for a very short period for wash room or drinkingwater. Record your absence from the Examination Hall in the register provided. Smoking and theconsumption of any kind of beverages are strictly prohibited inside the Examination Hall.

9. Do not leave the Examination Hall without submitting your answer-script to the invigilator. In any case, youare not allowed to take away the answer-script with you. After the completion of the examination, do notleave your seat until the invigilators collect all the answer-scripts.

10. During examination, either inside or outside the Examination Hall, gathering information from any kind ofsources or exchanging information with others or any such attempt will be treated as 'unfair means'. Don'tadopt unfair means and also don't indulge in unseemly behavior.

Violation of any of the above instructions may lead to severe punishment.

Signature of the Student

To be Filled by the Examiner

Question Number 1 2 3 4 5 6 7 8 9 10 Total

Marks Obtained

Marks Obtained (in words) Signature of the Examiner Signature of the Scrutineer-

- - i -

Page 2: Important Instructions andGuidelines for Students

-.------:---~---------

PLEASE READ THE FOLLOWING INSTRUCTIONS CAREFULLY.

§t. Students have to answer all questions in the corresponding question paper-cum answerscript in 2 hrs time.

§2. No query will be entertained regarding the questions during the examination.

§3. No separate answer script is permissible. Space for rouqh work is provided.

§4. Tick the correct answer for the multiple choice questions. There is ONE correct answer.

§5. For descriptive or quantitative questions, write the answer in the space provided belowthe question. Write your answers briefly.

§6. There is no negative marking.

§7. Three letter and one letter codes for amino acids are provided at the end of the questionpaper.

Page 3: Important Instructions andGuidelines for Students

PART-IChoose (tick) the (ONE) correct answer OR write in few words (30 marks):1. In DNA double helix, the two DNA chains are held together by(A) covalent bonds between the pair of bases(B) hydrogen bonds between the pair of bases(C) ionic bonds between the pair of bases(D) all of the above

2..The coding region of a gene is 102 nucleotides long, including both start and stop codons.Which of the following would be the most likely effect of a single nucleotide deletion atposition 76 in the coding region?

(A) There would be no effect on the polypeptide(B) The entire amino acid sequence of the polypeptide would change(C) There would be changes only in the first 25 amino acids(D) There would be changes only after the first 25 amino acids.

3. One undergrad student is repeating Anfinsen's experiment with an enzyme that has eightcysteine residues and forms four disulfide bonds. What is the total number of possibledisulfide bonds when they are formed randomly in the denatured protein?

(A) 105 (B) 15 (C) 720 (D) 3

4. State TRUE or FALSE(A) Proteins fold with their hydrophilic amino acids on the surface and hydrophobic

amino acids in the core(B) Glycine and alanine both have same number of chiral centers.

5. A genetic analysis of an unknown infectious agent reveals that it contains only nucleotidesG, A, U and C, in the proportion 30 %,35 %, 15 % and 20 %, respectively. Based onthis information, this infectious agent is most likely a

(A) Double-stranded DNA virus (B) Single-stranded DNA virus(C) Single-stranded RNA virus (D) Not enough information is provided

6. State TRUE or FALSE(A) Human is the most evolved organism because the genome size of human is the

biggest among all organisms.(B) Central dogma of molecular biology states that protein is translated directly from DNA

7. Which of the following statement is TRUE for prokaryotes?(A) Transcription and translation are coupled process(B) Transcription and translation are not coupled process(C) Transcription and translation occur in separate compartments(D) Transcription produces only monocistronic mRNA

8. Tetracycline inhibits(A) Cell wall synthesis (B) DNA synthesis(C) RNA synthesis (0) Protein synthesis9. State the length of peptide (number of amino acids) synthesized from the following mRNA

5 'AUGGUAAACAGCGCCAGCGGCUAA 31Start and stop codons are shown as underlined.

(A) 8 amino acids (8) 7 amino acids.(C) 6 amino acids (0) 24 amino acids.

Page 4: Important Instructions andGuidelines for Students

1O.Naturally occurring proteins contain which form of amino acid(A) O-form (8) L-form(C) both 0- and L-forms (0) cannot be predicted

11. Which parts of amino acids are involved in peptide bonds?(A) The carboxyl group on one amino acid and the sidechain of the following one.(8) The sidechain of first and carboxyl group on second amino acid.(C) The amino group on one amino acid and the carboxyl group on the next amino acid.(0) The carboxyl group of first and the amino group of the next amino acid.

12. When the Lac repressor is bound to the Lac operon(A) lactose but not glucose metabolism occurs(8) access to the promoter by RNA polymerase is blocked and transcription of the

operon does not occur(C) RNA polymerase binds to the promoter but only lacZ is expressed(0) the repressor is unable to bind to allolactose

13. For the macro dipole along an a-helix, the negative end is towards __ terminus of thehelix ..

14. Write the name of a hydrophyllic and a hydrophobic amino acid.

Hydrophillic:

Hydrophobic:

15. Cyclophillin A is an enzyme that catalyzes the cis-trans interconversion of a peptidebond. Which classification of enzymes does cyclophillin A belong to?

(A) Transferase (8) Isomerase(C) Lyase (0) Hydrolase

16. Which of the following CAN NOT be close (adjacent) in primary structure(A) two a-helices (8) parallel l3-strands(C) anti-parallel l3-strands (0) an a-helix and a l3-strand

17. Formation of peptide bond is a(A) ligation reaction(C) hydrolysis reaction

(8)(0)

oxidation reactioncondensation reaction

I (A)(C)

18. Methanol poisoning is treated with ethanol which actually slows down the formation offormaldehyde. This is an example of

Competitive inhibitionAllosteric regulation

(8)(0)

Uncompetitive inhibitionNone of the above

3

Page 5: Important Instructions andGuidelines for Students

19. The curve which shows uncompetitive inhibitor, the line 'A' belongs to uninhibitedenzyme kinetics (symbols has their usual meaning) [Choose correct answer]

/"/"

..../'.........~..~

....

-AB

- - C~D

-0.05 0.00 1/[S] 0.05 0.10

(A) B (B) C (C) o (D) None

20. The rate of protein synthesis in prokaryote is limited by the rate of mRNA synthesis. IfmRNA synthesis occurs at the rate of 51 nucleotides/sec, then the rate of proteinsynthesis occurs at

12 amino acids/see25 amino acids/see

(8)(D)

17 amino acids/see50 amino acids/see

(A)(C)21.Which enzymes removes UV induced thymine dimer(A) Helicase (8) Polymerase(C) Gyrase (D) Photolyase

22. Which of the following RNA participates in translation?(A) mRNA, rRNA and snRNA (B) tRNA , miRNA and mRNA(C) mRNA, rRNA and tRNA (D) rRNA, tRNA and snRNA

23. DNA replication process is(A) Semiconservative, bidirectional, and semi discontinuous(B) Conservative, bidirectional and discontinuous(C) Semiconservative, bidirectional and continuous(D) Semiconservative, unidirectional, and semi discontinuous

24. A nucleotide is made up of(A) Pentose sugar and base(C) Hexose sugar and base

(8)(D)

Hexose sugar, phosphate and basePentose sugar, phosphate and base

25. If the reaction A + BOC is first order with respect to A and first order with respect to B,then the rate equation for the forward reaction would be

(A) Rate=k[A] (B) Rate=k[B](C) Rate=k[A][B] (D) Rate=kA[a]+kB[B]

26. By convention, the sequence of bases in a nucleic acid is usually expressed in thedirection

(A) 5' to 3' (8) 3' to 5'(C) 5' to l' (D) 3' to 1I

Page 6: Important Instructions andGuidelines for Students

27. The enzyme reaction scheme below most closely depicts

E+ S=E·S- E+P

+

(A)(C)

Mixed inhibitionFeedback inhibition

(8)(0)

Uncompetitive inhibitionCompetitive inhibition

28. What role does messenger RNA play in the synthesis of proteins?(A) It catalyses the process(8) It provides the genetic blueprint for the protein(C) It translates the genetic code to a specific amino acid

29. Haemoglobin is an ideal example of protein quaternary structure that transports oxygenin our body. How many protein subunits (i.e. individual tertiary folds) constitute anhaemoglobin?

(A) 2 (8) 4(C) 8 (0) 16

30. The data in the table-below were collected for an enzyme catalyzed reaction. The Km forthis enzyme is approximately

ISlmM V0 (urnol . min-I)

8 .; 10--<> 802 A 10-:\ 1408/.. 10-:\ 224-l »; 10-3 2772 .: 10-2 2801 ,< 10-1 279

(A) 0.8 x 10-5 mM (8) 2 x 10-5 mM(C) 8 x 10-5 mM (0) 2 x 10-2 mM

5

Page 7: Important Instructions andGuidelines for Students

PART II: Answer the following questions briefly (30 marks):

1. One of your classmates, Vijay, decides to do a research project as a summer intem in amolecular biology laboratory. He has been assigned to work on a Human protein that hasbeen recently discovered by the lab.

a) Using bioinformatics Vijay discovers that the gene sequence has three exons (E1, E2 andE3) and two introns (11 and 12) with the following lengths:E1: 120 bp; E2: 90 bp; E3: 150 bp; 11: 180 bp; 12: 270 bp

Draw a schematic diagram of the mRNA transcript before and after processing. Indicatethe following in your diagrams: 5' and 3' ends, mRNA cap and polyA modifications, andintrons and exons. (4 marks)

What will be the length of the translated protein? (1 mark)

b) In the translated protein sequence, Vijay predicts that a stretch of 11 amino acids mostlikely forms a helix. The sequence is: Leu-Lys-Asp-Phe-Glu-Arg-Leu-lIe-Asp-Glu-lIeUsing the circle below, draw a helical wheel of the 11 amino acids and help Vijay to establishhis hypothesis. The lines in the circle are 20° apart. (3 marks)

L

Page 8: Important Instructions andGuidelines for Students

This protein is amphipathic i.e. one side is hydrophobic and the other is hydrophilic. Draw astraight line through the center of the helix dividing it into hydrophobic and hydrophilic sidesand label the two sides. (1 mark)

2. Explain the differences between Sanger's DNA sequencing and Mullis' polymerase chainreaction in terms of a) nucleotides used, and b) primers used. (4 marks)

3.Given ilGcat = 25 k.l/rnol, ilGuncat = 50 kJ/mol, R = 8.314 JK1mor1 and room temperaturecondition (25°C), calculate the rate enhancement by this enzyme. (2 marks)

7

Page 9: Important Instructions andGuidelines for Students

4.Complete the structure of the nucleotide below by filling in the boxes with the letter of theappropriate functional group i.e. A, B or C. (3 marks)

A. 0 8. C.

D OHD-CH2 ,/0, IT] OH IS' HO--P - OH4'/ H

H ITi 0H N

3' H

D H Phosphate

5.The diagram below depicts the process of replication. You need to label each of theseletters (i.e. A to F) from the following list: (6 marks)

(i) DNA primer(v) 3' end(ix) ligase

(ii) RNA primer(vi) lagging strand(x) Tope-isomerase

(iii) leading strand(vii) polymerase I

(iv) 5' end(viii) Okazaki fragment

Replication of DNA: The Basic Concept

5'B (slngle ~trand ,Qinding) Proteins

Polymerase III

Helicase

3'

E........ Polymerase III........ ........~~,'8

c

Page 10: Important Instructions andGuidelines for Students

6.The diagram below represents heat denaturation curves of nucleic acids. State thedifference between sample A and 8 (both are double stranded DNA samples) in terms oftheir base composition (2 marks)

Heat Denaturationof DNA

AB

100

co•..cog

:; 50•..cogC<11a

75 80Temperature (OC)

85

7.Write down the Michaelis-Menten equation. (4 marks)

Using this equation determine the reaction rate when the substrate concentration [S] is equalto

i) saturation condition i.e. [S] = infinityii) Km/2iii) 2Km

9

Page 11: Important Instructions andGuidelines for Students

One and three letter codes for the 20 natural amino acids:

Amino acid Code Amino acid CodeAlanine A,Ala Methionine M, MetCysteine C, Cys Asparagine N, Asn

Aspartic Acid 0, Asp Proline P, ProGlutamic Acid E, Glu Glutamine Q, GinPhenylalanine F, Phe Arginine R, Arg

Glycine G, Gly Serine S, SerHistidine H, His Threonine T, ThrIsoleucine I, lie Valine V, ValLysine K, Lys Tryptophan W, TrpLeucine L, Leu Tyrosine Y, Tyr

SPACE FOR ROUGH WORK

\0

Page 12: Important Instructions andGuidelines for Students

SPACE FOR ROUGH WORK