In Copyright - Non-Commercial Use Permitted Rights / License: …23887/et… · CurriculumVitae 75. Abstract Inorderto analyze theresponsetooxidative stress of strictly anaerobeClostrid¬

Research Collection

Doctoral Thesis

Response of Clostridium perfringens to oxidative stress

Author(s): Geissmann, Thomas Andreas

Publication Date: 2000

Permanent Link: https://doi.org/10.3929/ethz-a-004099473

Rights / License: In Copyright - Non-Commercial Use Permitted

This page was generated automatically upon download from the ETH Zurich Research Collection. For moreinformation please consult the Terms of use.

ETH Library

https://doi.org/10.3929/ethz-a-004099473

http://rightsstatements.org/page/InC-NC/1.0/

https://www.research-collection.ethz.ch

https://www.research-collection.ethz.ch/terms-of-use

Diss. ETHNo. 14000

Response of Clostridium perfringens

to Oxidative Stress

A dissertation submitted to the

SWISS FEDERAL INSTITUTE OF TECHNOLOGY ZURICH

(ETHZ)

for the degree of

Doctor of Natural Sciences

presented by

Thomas Andreas Geissmann

Dipl. Lm.-Ing. ETH

born Dec. 9, 1970 in Zurich

citizen of Sissach BL and Mandach AG

accepted on the recommendation of

Prof. Dr. Michael Teuber, examiner

Prof. Dr. Daniele Touati, co-examiner

PD Dr. Leo Meile, co-examiner

Zurich, 2000

Contents

Abstract 1

Zusammenfassung 3

1 Introduction 5

1.1 Superoxide dismutase and catalase in strict anaerobes 7

1.2 Superoxide reductase 8

1.3 Rubrerythrin 9

1.4 Regulatory systems involved in oxidative stress response 12

1.5 Aim of this work 15

2 Materials and Methods 17

2.1 Bacterial strains and growth conditions 17

2.2 Transformation of C. perfringens 18

2.3 DNA techniques 21

2.4 RNA techniques 26

2.5 Protein techniques 28

3 Results 29

3.1 Cloning and sequencing of the sod gene region from C. perfringens 29

3.2 Northern and primer extension analyses of the rbr and sod genes 31

3.3 Transcription of sod and rbr is not induced by oxygen 33

3.4 Construction and characterization of a rbr deletion mutant to study potentialrole of rbr in oxygen stress handling 36

3.5 Transcriptional analysis of the rbr mutant 42

3.6 Screening for rbr genes in various bacteria 43

IV

4 Discussion 49

4.1 The sod gene of C. perfringens 49

4.2 The relationship between rubrerythrins 50

4.3 The rubrerythrin gene clusters 52

4.4 The physiological function of rubrerythrin 53

4.5 Concluding remarks 56

5 References 57

Acknowledgments 73

Curriculum Vitae 75

Abstract

In order to analyze the response to oxidative stress ofthe strictly anaerobe Clostrid¬

ium perfringens, we cloned a sod gene, coding for superoxide dismutase, and analyzed

its transcription under different oxidative stress environments in C perfringens. We

detected no induction by oxidative stress but a dependence on the growth phase, as sod

transcription reached its maximum during transition from log phase to stationary

phase.

The metalloprotein rubrerythrin is also believed to be involved in oxidative stress

response, but its exact physiological function is unknown. Rubrerythrin seems to be a

protein unique ofthe anaerobic world, as its gene was only found in anaerobic procary-

otes up to now. By a PCR approach with degenerated primers, several aerobic and

anaerobic bacteria were screened, but we could amplify part of the rbr gene only from

the strict anaerobes Bacteroides fragilis, Fusobacterium nucleatum and Clostridium

acetobutylicum, but not from any aerobic or facultative aerobic bacteria.

For further analyses of the role of rubrerythrin, we constructed a chromosomal rbr

mutant by homologous recombination. Phenotypic characterizations of the mutant re¬

vealed no significant differences in growing and survival between the mutant strain

TAG1 and the parent strain 13 when exposed to air. But the survival rate of strain

TAG1 was 10-to-100-fold lower than strain 13 when exposed to different concentra¬

tions of hydrogen peroxide. Furthermore, transcriptional analyses revealed that rbr is

transcribed indifferently under aerobic or anaerobic environment, but it is strongly re¬

pressed under hydrogen peroxide stress. Surprisingly, the transcription ofthe truncated

rbr of the mutant strain TAG1 was not influenced by hydrogen peroxide. This led us

to the assumption, that rubrerythrin is part of the hydrogen peroxide sensing and regu¬

lation mechanism in C perfringens, and that the transcription of the rbr gene is auto-

regulated.

Zusammenfassung

Um die Antwort auf oxidativen Stress des strikten anaerobier Clostridium perfrin¬

gens näher zu Untersuchen, wurde das sod Gen, welches für eine Superoxid Dismutase

kodiert, geklont und sequenziert. Die Transkription diese sodGens wurde bei verschie¬

denen oxidativen Stressbedingungen untersucht. Dabei wurde keine Abhängigkeit der

Transkription zu den Stressbedingungen gefunden, jedoch wurde die Transkription

von der Zeilwachstumsphase beeinflusst. Die Transkription von sodwar während dem

Übergang vom exponentiellen zum stationären Wachstum am grössten.

Es wird vermutet, dass auch das Metalloprotein Rubrerythrin bei der Bewältigung

von oxidativen Stress beteiligt ist, obwohl dessen genaue physiologische Funktion

noch unbekannt ist. Rubrerythrin scheint ausschliesslich in der anaeroben Welt vorzu¬

kommen, bis heute wurde das entsprechende Gen rbr nur bei strikt anaeroben Proka-

ryonten gefunden. Mittels einem PCR Ansatz mit degenerierten Primern wurden

verschiedene aerobische und anaerobische Bakterien auf ein mögliches rbr Gen unter¬

sucht. Dabei konnte nur bei den strikt anaerobiern Bacteroidesfragilis, Fusobacterium

nucleatum und Clostridium acetobutylicum ein rbr Fragment nachgewiesen werden,

nicht aber bei Aerobiern oder fakultativen Aerobiern.

Um die Rolle von Rubrerythrin weiter zu analysieren, haben wir eine chromosoma¬

le rbr Mutante mittels homologer Rekombination konstruiert. Die phänotypische Cha¬

rakterisierung zeigte keine signifikante Unterschiede zwischen der Mutante TAG1 und

dem Wildtyp Stamm 13 im Wachstum oder Überleben, auch wenn diese Luftsauerstoff

ausgesetzt waren. Die Überlebensrate warjedoch für den Stamm TAG1 10 bis lOOmal

geringer als für den Stamm 13, wenn diese verschiedenen Konzentrationen von Was¬

serstoffperoxid ausgesetzt waren. Weitere Studien zeigten keinen Einfluss von Sauer¬

stoff auf die Transkription des rbr Gens, unter Wasserstoffperoxid Stress hingegen,

wurde das rbr Gen stark reprimiert. Aber überraschenderweise wurde die Transkripti¬

on des unvollständigen rbr Gens nicht durch Wasserstoffperoxid beeinflusst. Das deu¬

tet darauf hin, dass das Rubrerythrin an der Wasserstoffperoxid-Kontrolle und -

4

Regulation in C perfringens beteiligt ist. Wobei die FeS4-Seite der eigentliche Was¬

serstoffperoxid Sensor sein könnte, der Änderungen auf die Struktur der Dimetall-Sei-

te bewirken könnte. Das erste entdeckte Gen, das durch Rubrerythrin reguliert wird, ist

das eigene Gen rbr, welches durch Wasserstoffperoxid reprimiert wird.

A Introduction

Since oxygen was produced by photosynthesis and released into our atmosphere,

two completely different ways-of-life have been established: the aerobic way that prof¬

its from oxygen in energy production and the anaerobic way avoiding oxygen when¬

ever possible. Aerobic organisms have a more efficient energy metabolism as

compared to that of most anaerobes because of the high reduction potential of molec¬

ular oxygen, which serves as the terminal electron acceptor for respiration. This advan¬

tage, however, comes with a price because oxygen reduction is not always complete,

and result in rather unpleasant species such as the superoxide anion and hydrogen per¬

oxide. There is no doubt that production of both superoxide and hydrogen peroxide

poses a threat to all organisms which encounter molecular oxygen. This threat that is

amplified by the possible interaction of these substances to produce hydroxyl radical,

which is one of the most potent oxidants known (Beauchamp and Fridovich, 1970).

Thus, aerobic organisms have developed mechanisms to protect themselves from ox¬

ygen toxicity. These involve the enzymes superoxide dismutase (SOD, Eq. 1), catalase

(Eq. 2) and/or unspecific peroxidases (Eq. 3, whereas R stands for an unspecific proton

donor):

202- + 2H+^H202 + 02 (1)

2H202^02 + 2H20 (2)

H202 + RH2 -> R + 2H20 (3)

Although anaerobic organisms inhabit oxygen free ecosystems, they cannot avoid

periodical exposition to air. This could be the reason, that in some anaerobic bacteria

oxygen defense enzymes have been found (see below). However, the role of the oxy¬

gen defense enzymes in anaerobes is still enigmatic, and despite the classical SOD and

catalase, other uncommon proteins have recently been discovered and associated to an

oxygen defense system. These include superoxide reductases and rubrerythrin (see be¬

low). An overview of the occurence of these genes is given in Table 1.

6

TABLE 1. Overview of known genes of oxygen scavenging related proteins from

anaerobic and microaerophil bacteria, sod. superoxide dismutase; kat: catalase; sor:

superoxide reductase; rbr: rubrerythrin. + means that the gene is sequenced. - means

that the gene does not exist in this organism (only indicated for completely sequenced

genomes). + in parentheses means that the enzyme is characterized but the gene is not

sequenced.

Strain Comment sod kat sor rbr

Bacteroidesfragilis

Campylobacterjejuni

Chlorobium tepidum

Clostridium acetobutylicum

Clostridium difficile

Clostridium perfringens

Desulfoarculus baarsii

Desulfovibrio desulfofuricans

Desulfovibrio gigas

Desulfovibrio vulgaris

Fusobacterium nucleatum

Geobacter sulfurreducens

Moorella thermoacetica

Spirillum volutans

Porphyromonas gingivalis

Treponemapallidum

Thermotoga maritima

Archaeoglobusfulgidus

Methanobacterium thermoau-

totrophicum

Methanococcusjannaschii

Pyrococcus abyssi

Pyrococcusfuriosus

complete genome

unfinished genome8

unfinished genome

unfinished genome1

unfinished genome8

complete genomeac

complete genomeae

complete genome

complete genome

+e

+

+

+J

unfinished genome8 +

complete genomey

complete genomeaa

complete genome

I ad

+

+

+

+

+

+

+c

+

+i +m

(+)n (+)°

(+)p (+)p +q (+y

+s +t +u +v

+c

+

_i_W

+x

+

+

+

+

+

+

+ag +ag

a (Lay and Gregory, 1992)b (Rochae/a/., 1996)

7 Introduction

c (this study)d (Parkhille/a/.,2000)e (Purdy and Park, 1994)f (Grant and Park, 1995)

g (http //www tigr org/)h (http //www cric com/)l (http //www sanger ac uk/)

j (Geissmann e/ al., 1999)k (Lehmann et al, 1996)1 (Lombarde/a/., 2000a)

m (Touati, unpublished)n (Mourae/a/., 1990)

o (Moura, unpublished)

p (Dos Santos e/ a/., 2000)

q (Chen et al, 1994)

r (Ravie/a/., 1993)

s (Shenvi and Kurtz Jr, 1997)

t (Kitamurae/a/., 1998)

u (Brumlrk and Voordouw, 1989)

v (Pnckril et al, 1991, Lumppio et al, 1997)

w (Das and Ljungdahl, 1999)

x (Albane/a/., 1998)

y (Fraser et al, 1998)

z (Lombard et al, 2000b)aa (Nelson et al, 1999)ab (Klenke/a/., 1997)

ac (Smith et al, 1997)ad (Takao et al, 1990, Meile et al, 1995)

ae (Bulte/a/., 1996)af (Heihg, 1999)

ag (Jenney étal, 1999)

1.1 Superoxide dismutase and catalase in strict

anaerobes

SODs are metalloproteins that play a major role in aerobic organisms in protection

against oxidative stress. In E. coli and many other aerobic procaryotes, two cytoplas¬

mic SODs have been identified, a manganese containing SOD (MnSOD) and a iron

containing SOD (FeSOD), encoded by sodA and sodB, respectively. A third and more

distinct type of SOD is located in the periplasma and contains copper and zinc (Cu,Zn-

SOD, encoded by sodC) in the reaction center (reviewed in Touati, 1997).

In the strict anaerobes Bacteroidesfragilis (Lay and Gregory, 1992), Porphyromo-

nas gingivalis (Nakayama, 1990), Methanobacterium thermoautotrophicum (Takao et

al, 1990; Meile étal, 1995), Desulfovibrio vulgaris (Shenvi and Kurtz Jr., 1997) and

Clostridium perfringens (Geissmann et al, 1999, see below) genes coding for SOD

8

were found. They belong to the cytoplasmic MnSOD/FeSODs. The role of SODs in

anaerobes is not evident as during detoxifying superoxide new dioxygen is generated

(Eq. 1). In the complete genome sequences of Archaeoglobusfulgidus (Klenk et al,

1997), Methanococcusjannaschii (Bult et al, 1996), Pyrococcus horikoshii (Kawara-

bayasieâ/., 1998), Thermotoga maritima (Nelson et al, 1999), Treponemapallidum

(Lombard et al, 2000b), Pyrococcus abyssi (Heilig, 1999) and P. furiosus (Jenney et

al, 1999) genes coding for known SODs are absent.

Catalases or peroxidases in strict anaerobes are known so far only from Archaeo¬

globusfulgidus (Klenk et al, 1997), Bacteroidesfragilis (Rocha et al, 1996) and Des¬

ulfovibrio vulgaris (Kitamura et al, 1998).

1.2 Superoxide reductase

Recent discoveries showed a new way for detoxifying reactive oxygen species that

is independent of the SOD- and catalase-based system of the aerobic world: Instead of

SOD, a superoxide reductase (SOR) from the anaerobe Pyrococcusfuriosus was found

to eliminate superoxide anions by reduction (Eq. 4, Jenney et al, 1999):

02- + 2H+ + Rdred -> H202 + Rdox (4)

The electron donor is probably rubredoxin (Blake et al, 1991), which is reduced by

aNAD(P)H:oxidoreductase (Ma and Adams, 1999). The SOR presented strong homol¬

ogies to neelaredoxin, a small protein characterized as a novel superoxide dismutase

from Desulfovibrio gigas (Silva et al, 1999). The SOR from P. furiosus forms a ho-

motetramer, with each subunit (14 kDa) adopting an immunoglobulin-like ß-barrel

fold that coordinates a mononuclear, non-heme iron center (Yeh etal, 2000). A similar

function of superoxide reductase was proposed for desulfoferrodoxin (Dfx, Pianzzola

et al, 1996; Liochev and Fridovich, 1997; Romäo et al, 1999). Dfx is a homodimer,

with each subunit (14 kDa) containing two mononuclear iron centers. Center I contains

a mononuclear ferric iron coordinated by four cysteines in a distorted rubredoxin-type

center. Center II has a ferrous iron with square pyramidal coordination by four nitro¬

gens from histidines as equatorial ligands and one sulfur from a cysteine as the axial

ligand (Coelho etal, 1997). Further analyses revealed that center II can act as a super-

9 Introduction

oxide reductase, while the function of center I remains unclear (Lombard et al, 2000a).

Another SOR isolated from the microaerophilic Treponema pallidum was similar to

both neelaredoxin and desulfoferrodoxin. It forms a homodimer with each subunit (14

kDa) containing a Dfx-center-II-like mononuclear, non-heme ferrous center, but lacks

the rubredoxin-like center I (Lombard et al, 2000b). This protein showed strong SOR

activity as well, and was suggested to be the unique defense system in T pallidum

against superoxide stress.

Although the superoxide anions can be scavenged by SOR or SOD, the anaerobic

method of detoxifying reactive oxygen species remains unsolved, and poses several

puzzling questions: (i) what is the advantage of either SOD or SOR? (ii) What enzymes

are responsible to remove the produced hydrogen peroxide? (iii) What is the role of an

other metalloprotein from anaerobic bacteria called rubrerythrin?

1.3 Rubrerythrin

Rubrerythrin (Rr) was first isolated from the anaerobic sulfate-reducing bacterium

Desulfovibrio vulgaris. Primary spectroscopic analyses revealed that this protein is a

non-heme metalloprotein with two prosthetic groups; it contains a diiron site similar to

that of hemerythrin and a rubredoxin-like FeS4 center. Due to the unusual combination

of these prosthetic groups, this new protein was named rubr-erythrin (LeGall et al,

1988). Independent sequencing of the Rr protein (Van Beeumen et al, 1991) and its

gene {rbr) (Prickril etal, 1991) yield an identical 191-residue amino acid sequence.

From another anaerobic bacterium, Clostridium perfringens, a similar protein was iso¬

lated and its gene sequenced (Lehmann etal, 1996). Both proteins were isolated as ho-

modimers with a subunit molecular weight of about 21,500 or 22,000, respectively (the

Rr from C perfringens has 4 additional amino acids). The amino acid sequences of

these Rrs are up to 52% identical, and up to 82% similar to each other.

10

1.3.1 The structure of rubrerythrin

Due to the surprising combination of the two iron centers, intensive investigations

were initiated to determine the structure of Rr in detail. Spectroscopic analyses have

shown that Rr can accommodate up to six irons per homodimer and that they are ar¬

ranged in diiron-oxo sites and in rubredoxin-like sites, respectively (Ravi etal, 1993;

Yienketal, 1993; Guptaeâ/., 1995; Dave et al, 1994).

The diiron-oxo site is located in the N-terminal part where two EXXH motifs are

present (in the Rr from C perfringens another additional EXXH motif is present). The

identical motifs are also found in other diiron-oxo/hydroxo sites such as in ferritin (re¬

viewed in Theil, 1987; Harrison et al, 1998), ribonucleotide reductase R2 protein

(Nordlund and Eklund, 1993), methane monooxygenase (Rosenzweig et al, 1993;

Rosenzweig etal, 1995) or stearoyl-CoAÀ -desaturase (Lindqvist etal, 1996; Shan-

kYmetal, 1994).

The C-terminal FeS4 site possesses two rubredoxin-like CXXC iron binding motifs.

In contrast to the rubredoxins that have a spacing of 15-25 aa between the two CXXC

motifs, the Rrs from C perfringens and D. vulgaris have an identical spacing of 12 aa.

X-ray crystallography of 2.1 Â resolution of recombinant and reconstituted D. vul¬

garis Rr established the iron sites of Rr. However, in contrast to other diiron proteins,

the diiron site of the reconstituted Rr does not use the His from the first EXXH motif

as ligand, one more Glu appeared as ligand instead (deMaré et al, 1996). Sieker et al.

(1999; 2000) used native Rr and reported that in their crystallographic analysis both

His are required for metal binding and the Glu is not a ligand. These small conforma¬

tional alterations are sufficient to change from a hexacoordinate to a tetracoordinate

metal and to the iron being substituted by zinc. The consequences are that Rr may be

able to change the ligand arrangements in one of its binding sites to bind different kinds

of metals under different conditions. This flexibility in changing the binuclear metal

structure has also been shown by a Glu to Ala mutation that transformed this site closer

to that in ribonucleotide reductase (deMaré et al, 1997). In addition, the native ru¬

brerythrin possesses an extra N-H-S bond in the FeS4 center formed by a side chain

11 Introduction

FIG 1 Ribbon diagram of the C perfringens rubrerythrin subumt It shows the hemerythrm-likehelical region in the N-termmal part and the rubredoxm-hke ß-sheet region in the C-termmal partSolid circles represent iron atoms The drawing was generated using RASMOL (Sayle and Milner-

White, 1995) and the coordinates were calculated by comparative protein modelling at SWISS-

MODEL (Guex et al, 1999) using D vulgaris Rr data (deMaré et al, 1996) as template

of AsnlôO A possible reason for the shift in redox potential for this rubredoxin-like

center (Sieker et al, 2000) Eq is +230 mV for rubrerythrin and 0 mV for the rubre-

doxin from the same organism D. vulgaris (LeGall etal, 1988)

As the structure of the binuclear metal center differs substantially, it is not clear

which structure (if either) is physiologically relevant

1.3.2 The physiological role of rubrerythrin

Although the structure of rubrerythrin is known in detail, its physiological function

remains uncertain The reduction potentials of both types of iron sites in Rr (> 200 mV

versus NHE) are too high to participate in any known electron transfer pathways of

anaerobic microorganisms (Hansen, 1994)

12

The ferritin-like diiron-oxo sites led to testing Rr for ferroxidase activity. Indeed,

ferroxidase activity could be measured, but surprisingly not the diiron-oxo site itself

although both the diiron-oxo site and the FeS4 site are necessary (Bonomi etal, 1996).

Ferritins are iron storage proteins; typically, 24 subunits form a spherical protein shell

have a central cavity that can accommodate up to 4500 iron atoms. Rr forms a ho-

modimer in solution or a tetramer when crystallized but a larger oligomer has never

been found, thus Rr is probably not an iron storage protein. Furthermore, the biological

relevance of the ferroxidase activity in anaerobes is not clear. It was hypothesized that

Rr plays a role as a scavenger of oxygen radicals. Lehmann et al. (1996) could com¬

plement a sodAsodB E. coli mutant and detected SOD activity of the purified enzyme.

But, the reaction rate was only low compared to classical SODs, therefore the SOD ac¬

tivity is presumably not of physiological significance. Recently, NADH peroxidase ac¬

tivity of Rr was described, but again the activity was magnitudes lower than that of

horseradish peroxidase and the function of Rr in vivo remains to be established

(Coulter et al, 1999; 2000). Rr from D. vulgaris does not bind 02, nor does it show

catalase, phosphatase, methane monooxygenase or ribonucleotide reductase activity

(Gupta et al, 1995; Pierik et al, 1993). It was mentioned that rubrerythrin could be an

"ur-protein" of anaerobic procaryotes already present before the evolutionary division

of the Archaea from the Bacteria (Lehmann et al, 1996). Due to the unusual plasticity

of Rr toward the binding of metals, it could act as a "proteo-protein" with multiple ac¬

tivities in D. vulgaris (Sieker et al, 2000). However, in respect to the recent discover¬

ies of SORs, rubrerythrin is believed to be a part of the anaerobic defense mechanism

against oxidative stress.

1.4 Regulatory systems involved in oxidative stress

response

The regulation of the defenses against oxidative stress is best studied in E. coli, but

it is beginning to be explored in several organisms, including anaerobes. The findings

pointed to similarities and also interesting differences between E. coli and other bacte¬

ria. Because of the complexity of the regulatory network, only an overview of the ma¬

jor regulatory systems \nE. coli and some remarkable differences in other procaryotes

13 Introduction

are described below. For further readings on the general regulation of the response to

oxidative stress see Storz and Imlay (1999), Jamieson and Storz (1997) or Ahern and

Cunningham (1995).

1.4.1 SoxRS

The SoxRS regulon of E. coli is a two-component, two-stage regulon, where the

first component, SoxR, is both the sensor of oxidative stress and transcriptional activa¬

tor of soxS. SoxS, the second component of the system, evokes the defence response

of the regulon by activation of at least 14 member genes including sodA,fumC (oxy¬

gen-stable fumarase C), acnA (oxygen-stable aconitase A), nfo (endonuclease IV), fur

(ferric uptake regulator) and zwf(glucose 6-phosphate dehydrogenase) (Greenberg et

al, 1990; Tsaneva and Weiss, 1990; Mito etal, 1993; Fawcett and Wolf, 1994).

It was suggested that SoxR senses the onset of oxidative stress by either increased

superoxide levels or by a decreased NADPH/NADP+ ratio (Nunoshiba et al, 1992;

Hidalgo and Demple, 1994; Liochev et al, 1999; Liochev and Fridovich, 1992), but

other findings pointed to a more complex mechanism, as SoxR is also activated by ni¬

tric oxide or desulfoferrodoxin (Nunoshiba etal, 1993; Gaudu etal, 2000). However,

one important component ofthe SoxRS regulation system, the SoxR reductase, has not

yet been identified.

1.4.2 OxyR

OxyR activates the expression of at least 9 hydrogen-peroxide-inducible proteins in

E. coli and Salmonella typhimurium, including hydroperoxidase I (katG), alkyl hydro¬

peroxide reductase (aphCF), gluthathione peroxidase (gorA) and a nonspecific DNA-

binding protein (dps) (Christmane^ al, 1985; Altuvia et al., 1994). OxyR has also been

shown to be a repressor and moreover, behaves as a transcriptional autorepressor, too

(Bölker and Kahmann, 1989; Christman et al, 1989). Direct oxidation of OxyR by

H202 is the mechanism whereby the cell senses oxidative stress and induces the OxyR

14

regulon, as OxyR activates transcription only in the oxidized form (Storz etal, 1990).

The tetrameric OxyR is activated through the formation of a disulfide bond and is in¬

activated by the enzymatic reduction with glutaredoxin 1 (Zheng et al, 1998).

1.4.3 Fur

There is a close relationship between iron metabolism and oxidative stress. Iron is

an important element for living organisms, since many metabolic enzymes have iron

as a cofactor in their active sites. On the other hand, through the Fenton reaction, iron

also promotes the formation of hydroxyl radicals in the presence of hydrogen peroxide

(Eq. 5):

H202 + Fe2+ -^ Fe3+ + OH* +OH" (5)

Thus, cells have evolved regulatory systems to ensure the sufficient uptake of iron

to meet their physiological requirements, yet at the same time minimize iron toxicity.

Fur negatively regulates many genes involved in ferric iron uptake from the environ¬

ment (reviewed in Blattner et al, 1997; Braun, 1997). The overlap between oxidative

stress response and iron metabolism is given by the induction offur through SoxRS

and OxyR (Zheng et al, 1999; reviewed in Touati, 2000). On the otherhand, Fur reg¬

ulates itself oxidative stress response enzymes like SODs, whereas sodA is repressed

(Tardât and Touati, 1993; Tardât and Touati, 1991), and sodB is induced by Fur (Du-

brac and Touati, 2000). Direct evidence that loss of iron regulation led to oxidative

stress and consequent deleterious effects was provided by a study ofE. colifur mutants

(Touati etal, 1995).

Fur is a dimeric metalloprotein that binds two non equivalent zinc atoms per mono-

9-1-

mer and needs one Fe as a cofactor. The function of zinc binding to Fur appears to

involve stabilization of protein architecture as well DNA affinity (Jacquamet et al.,

1998; Althaus etal, 1999).

15 Introduction

1.4.4 Differences in regulation between E. coli and other pro¬

caryotes

Despite the well characterized SoxRS regulon of E. coli, little is known of the ex¬

istence of this regulon in other bacteria. Proteins homologous to SoxR have only been

reported for other gram-negative bacteria like Pseudomonas aeruginosa (Liao et al,

1996), Salmonella typhimurium (Fair and Kogoma, 1991) or Chromobacterium viola-

ceum (Kolibachuk and Dennis, 1998). In the complete genome sequences of other bac¬

teria no ORFs with homologies to SoxR/SoxS have been yet identified and differences

in oxygen stress response of SODs from gram-positive bacteria are pointing to a dis¬

tinct regulation mechanism (see Results and Discussion).

There are further forms of evidence for regulatory systems different from that in E.

coli, e. g. the repressor PerR that was found in the gram-positives Bacillus subtilis

(Bsat et al, 1998) and Streptococcus pyogenes (King et al, 2000). PerR is a Fur-like

repressor but it has peroxide sensing possibilities, too. The mechanism for peroxide

sensing seems to be quite distinct to that of OxyR. Instead of the H202-catalyzed dis¬

ulfide bond formation that activates OxyR, it is postulated that PerR activity might be

regulated by metal-catalyzed oxidation of the protein or by a change of the oxidation

of a bound metal ion (Bsat etal, 1998).

Régulons against oxidative stress in strictly anaerobic organism are not yet estab¬

lished, but the adaptive response to H202 of Bacteroidesfragilis shows that regulation

mechanisms for detoxifying reactive oxygen species are not limited to aerobic bacteria

(Rocha and Smith, 1998; 1999). The additional characterization of regulators from

bacteria other than E. coli may bring to light novel mechanisms of redox-sensing.

1.5 Aim of this work

It was the purpose of this thesis to investigate the behavior of Clostridia in an oxidative

stress environment and their defenses mechanisms against this stress. Important en¬

zymes against oxidative stress are superoxide dismutases. In this study, the cloning and

analyzing of the sod gene from C perfringens is presented. Rubrerythrin is another

protein that is suggested to play a role in the oxidative stress response system, but its

16

physiological function is unknown (Lehmann et al, 1996). Therefore, this study con¬

centrates on the investigation of the physiological function of rubrerythrin. We con¬

structed and characterized a rbr mutant that brought new knowledge and new questions

as well.

2 Materials and Methods

2.1 Bacterial strains and growth conditions

All Clostridium perfringens strains were derivatives of strain 13 (Mahony and

Moore, 1976), except strain NCIMB 8875 (National Collections of Industrial and Ma¬

rine Bacteria, Aberdeen, Scotland) from which rubrerythrin was initially isolated and

cloned (Lehmann et al, 1996). The strains and their characteristics are listed in

Table 2. C perfringens strains were grown in Brain Heart Infusion broth or agar (BHI;

Biolife S.r.l., Milano, Italy). The media were supplemented with 0.05% (w/v) cysteine

hydrochloride, erythromycin (50|ig/ml) or chloramphenicol (30|ig/ml) as required.

The C perfringens strains were incubated in an anaerobic gas chamber (Coy Labora¬

tories, Ann Arbor, MI, USA) under an atmosphere of nitrogen containing 5% (v/v) hy¬

drogen at 37°C. Oxidative stress was produced by aerotation and/or the addition of

paraquat or hydrogen peroxide. The different procedures are described in Results.

TABLE 2. Clostridium perfringens strains used in this study

Relevant characteristic(s) Reference

Csr, Nmr, Kmr NCIMB

Type A, (f)9 recipient

Strain

C perfringens NCIMB8875

C perfringens 13

C perfringens TAG1

C perfringens TAG2

C perfringens TAG3

strain 13 rbr::pCVM\,

strain TAGl(pRr750)

strain TAGl(pRub 1750)

(Mahony and

Moore, 1976)

This study

This study

This study

For routine cloning and propagation of recombinant plasmids, the Escherichia coli

strain XL 1 -Blue (Bullock et al., 1987) was used. E. coli strains were grown in LB broth

or agar (Sambrook etal, 1989) under aerobic conditions at 37°C. The media were sup¬

plemented with ampicillin (50|ig/ml), tetracycline (20|ig/ml), erythromycin (150|ig/

18

ml) or chloramphenicol (30|ig/ml) as required. The sodA sodB E. coli strain QC774

(Carlioz and Touati, 1986) was grown in minimal medium M63 supplemented with

0.4%) glucose and thiamin (1 |lg/ml) (Miller, 1972). The plasmids used in this study are

listed in Table 3.

All strains used for rbr screening are listed in Table 5 (p. 30). From most of these

strains, chromosomal DNA preparations were from our laboratory stock. Bacteroides

sp., Fusobacterium sp., Porphyromonas sp. and Veillonella sp. were grown in FUM

medium (Gmiir and Guggenheim, 1983) under anaerobic conditions at 37 °C.

2.2 Transformation of C. perfringens

Plasmid transformation of C perfringens strain 13 was performed by electropora-

tion according to protocols described earlier (Kim and Blaschek, 1989; Chen et al,

1996). For the homologous recombination experiments, the conditions were modified

as follows. A 6-h-old, late-stationary-phase cell culture of C perfringens was harvest

by centrifugation (Beckman J2-21, rotor JA-14, Beckman Instruments, Palo Alto, CA,

U.S.A) at 6,000 rpm (5,500 g) at 4°C for 15 min. The cell pellet was washed with 15%

(vol/vol) glycerol and suspended in 1/20 of a volume ofthe same buffer to give ca. 10

to 10 cells per ml. Cell suspension (40 |il) was mixed with 5 |il ofDNA (ca. 5 |ig) in

the precooled electroporation cuvette (2 mm spacing) and incubated for 10 min. on ice.

The chilled cell mixture was shocked in a Pulse Controller apparatus (Bio-Rad Lab¬

oratories, Richmond, Calif.) set at 2,500 V, 25 |iF and 200 Q. Following postelec-

troporative incubation for 10 min. on ice, the cells were diluted into 1 ml of BHI

medium and incubated for 3-4 h at 37°C. Then, the culture was added to 9 ml of BHI

medium supplemented with 25 |lg/ml erythromycin or 20 |lg/ml chloramphenicol and

incubated over night at 37°C. The culture was centrifuged, resuspended, plated onto

BHI selective plates and incubated overnight.


TABLE 3. Recombinant plasmids and their characteristics.

Plasmid Relevant characteristics Reference

pUC18

pGEM-T Easy

pTGll

pIT4

pTG1920

pJIR750

pJIR751

pERMBP

pRr

pRubl

pRub21

pRub3

pARr

Apr, LacZ', cloning vector

Apr, LacZ', PCR cloning vector

Apr, 1.9-kb EcoRI-EcoRI fragment in

pUC18 carrying a partial sod gene of


Apr, 0.8-kb EcoRI-Xbal fragment in

pUC18 carrying a partial sod gene of


Apr, 1.2-kb PCR product of primers

tg 19/20 and C perfringensNCIMB8875 DNA in XballPstl sites

of pUC18 (complete sod gene)

Cmr, LacZ', C perfringens-E. coli

shuttle vector

Emr, LacZ', C perfringens-E. coli

shuttle vector

Apr, Emr, 1.6-kb Nhel-Haelll frag¬ment (ermBP) from pJIR751 in Smal

siteofpUC18

Apr, 1.6-kb Hindlll-Ndell fragment in

pUC18 carrying the complete rbr gene

of C perfringens NCIMB8875

Apr, 1.1-kb Hindlll-Hindlll fragmentin pUC18 carrying a partial rbr gene

of C perfringens NCIMB8875

Apr, 2.0-kb Ndell-Ndell fragment in

pUC18 carrying a partial rbr gene of


Apr, 0.9-kb Hindll-Ndell fragment in

pUC18 carrying a partial rbr gene of


Apr, Emr, pRub3 with an 1.6-kb Pstl-

Kpnl fragment from pERMBP and an

1.8-kb Pstl-EcoRI fragment from

pRub21

(Yanisch-Perron etal,

1985)

Promega, Madison, WI

(Geissmann etal,

1999)

(Geissmann etal,

1999)

(Geissmann etal,

1999)

(Bannam and Rood,

1993)

(Bannam and Rood,

1993)

This study

(Lehmann et al, 1996)



(Lehmann etal., 1996)

(Tripod, 1998)

20

TABLE 3. (continued) Recombinant plasmids and their characteristics.

Plasmid Relevant characteristics Reference

pTAG100/101

pCVMl

pIRl

pON2

pON3

pON4

pRr750

pRubl750

Apr, 0.5-kb PCR product of primers

tglOO/tglOl and C perfringens strain

13 DNA in pGEM-T Easy (rbr frag¬

ment)

Emr, 2.7-kb Spel-Sphl fragment from

pJIR751 and a 0.5-kb fragment from

pTG100/101

Apr, 487-bp PCR product of primers

tg 100/101 and C acetobutylicumDNA in pGEM-T Easy (rbr fragment)


tg 100/101 and/7, nucleatum subsp.

polymorphum DNA in pGEM-T Easy

(rbr fragment)


tg 100/101 and/7, nucleatum subsp.vincentii DNA in pGEM-T Easy (rbr

fragment)


tg 100/101 and B. fragilis DNA in

pGEM-T Easy (rbr fragment)

Cmr, I .&-kb EcoRl-Pvul fragmentfrom pRr in pJIR750 (complete rbr

cds)

Cmr, 1.0-kb Hindlll-Hindlll fragmentfrom pRr in pJIR750 (rbr fragment)

This study

(von Meyenburg,

1998)

(Roulet, 1998)

(Nussli, 1999)

(Nussli, 1999)

(Nussli, 1999)

This study

This study


2.3 DNA techniques

If not otherwise indicated, all DNA manipulations were done according to standard

protocols (Sambrooke^ al, 1989).

2.3.1 Isolation of total chromosomal DNA from C. perfrin¬

gens

Cells from 100 ml BHI broth cultures with an optical density (OD) at 600 nm of 0.8

were harvest by centrifugation (Beckman J2-21, rotor JA-14, Beckman Instruments,

Palo Alto, CA, U.S.A) at 6,000 rpm (5,500 g) at 4°C for 15 min. Pelleted cells were

suspended in 2.5 ml of 6.7% (w/v) sucrose in 50 mM Tris, 1 mM EDTA, pH 8.0). After

incubation of the cell suspension for 15 min. at 37°C, 625 ml of lysozyme solution (20

mg/ml lysozyme (Fluka) in 25 mM Tris, pH 8.0) were added and the cell suspension

was incubated again for 10 min. at 37°C. Then, 312,5 ml of 0.5 M EDTA in 50 mM

Tris, pH 8.0 and 187.5 ml of 20% (w/v) SDS in 50 mM Tris, 20 mM EDTA, pH 8.0

were added, immediately mixed and further incubated for 20 min. at 37°C. The lysate

was extracted by addition of 4 ml phenol saturated with 3% sodium chloride and sub¬

sequent gentle shaking and waiting for 5 min. Phase separation was obtained by cen¬

trifugation (Beckman J2-21, rotor J-17), by 5,000 rpm (3,400 g) at 4°C for 5 min.

Remaining phenol was extracted from the DNA containing aqueous phase by adding

1 volume methylene chloride/isoamyl alcohol (24:1, v/v) and centrifuging (Beckman

J2-21, rotor J-17) by 5,000 rpm (3,400 g) at 4°C for 5 min. This procedure was repeated

three times. Finally, DNA was precipitated by ethanol.

2.3.2 Small scale plasmid DNA isolation from E. coli

Plasmid DNA isolation from E. coli was carried out according to the boiling method

(Sambrookera/., 1989).

22

2.3.3 Large scale plasmid DNA isolation from E. coli

Recombinant plasmid DNA was isolated from E. coli strains using the Wizard

Plus Midipreps DNA Purification System (Promega).

2.3.4 Agarose gel electrophoresis

Digested DNA was separated in 0.8%> agarose gels prepared in lx TAE buffer (40

mM Tris, 20 mM acetic acid, 1 mM EDTA, pH 8.0). A 1-kb ladder (Gibco BRL) was

used as DNA size marker. Electrophoresis in horizontal agarose gels was performed in

lx TAE buffer (pH 8.0) at 100 V (Gel Electrophoresis Apparatus GNA 100, Pharmacia

LKB, Uppsala, Sweden). The agarose gels were stained in a 5 |il/ml ethidium bromide

solution for 10 min. and then incubated in a water bath for 20 min. to remove the sur¬

plus of ethidium bromide. The DNA in the agarose gels was visualized by ultraviolet

light illumation (302 nm) and photographed with a digital imaging system (Alphalm-

ager; Alpha Innotech Corp., San Leandro, Calif).

2.3.5 Quantification of DNA

DNA was quantified by gel electrophoresis of the sample together with defined

amounts of À-DNA (Gibco) followed by densitometric analysis with the digital imag¬

ing system (Alphalmager; Alpha Innotech Corp., San Leandro, Calif).

2.3.6 Restriction endonuclease digests of DNA

All endonuclease digests were performed using the OPA-buffer (Amersham Phar¬

macia Biotech) with the conditions recommended by this supplier. Enzymes from oth¬

er suppliers were used with the same buffer system. Digests were analyzed by gel

electrophoresis.


2.3.7 Ligation of DNA and transformation of E. co//'XL1-Blue

Insert DNA and pUC18 vector DNA were digested with the appropriate restriction

enzymes, separated by low-melting-point agarose gel electrophoresis at 80 V, purified

by phenol extraction and ethanol precipitation. Ligation was done in lx OPA-buffer

containing 1 mM ATP and 7.5 Weiss units of Bacteriophage T4 DNA ligase (Amer¬

sham Pharmacia Biotech) overnight at 4°C. PCR products were cloned using the

pGEM-T Easy Vector System (Promega).

E. coli XLl-Blue cells were transformed by electroporation, using a Gene Puiser

and a Pulse Controller apparatus (Bio-Rad Laboratories, Richmond, Calif.) set at

2,500 V, 25 uF and 200 Q.

2.3.8 Labeling of oligonucleotides with [y-32P]ATP

5 pmol of the respective oligonucleotide were labeled with radioactive [y- P]ATP

(6000 Ci/mmol, NEN life science) using T4 kinase (Amersham Pharmacia Biotech).

The probe was purified using NAP-columns (Amersham Pharmacia Biotech) to re¬

move non-incorporated radioactivity. Prior to use, the probe was denatured for 5 min.

at 95 °C and kept on ice before it was added to the hybridization solution.

2.3.9 Labeling of DNA-fragments with [a-32P]dATP

200-500 ng of the respective DNA-fragment were labeled with radioactive

[a- P]ATP (3000 Ci/mmol, NEN life science) according to the random priming tech¬

nique of Feinberg and Vogelstein (1983). To remove surplus radioactivity, the probe

was purified using a NICK-column (Amersham Pharmacia Biotech). Prior to use, the

probe was linearized for 5 min. at 95 °C and kept on ice.

24

2.3.10 Southern blotting

DNA transfer from agarose gels to Zeta-blot membranes (BioRad) was achieved

with the Southern blotting technique using 0.4 N NaOH as transfer solution and a vac¬

uum blotting equipment (Biometra, Göttingen, Germany). DNA was fixed to the mem¬

branes by incubating them for 2 h at 80°C. Before hybridization, the membranes were

incubated in a Micro-4 oven (Hybaid) at hybridization temperature with 30 ml prehy¬

bridization solution (5x SSC; 5x Denhardts; 0.25 mg/ml sssDNA; 0.05 M sodium

phosphate buffer, pH 6.5). After 3 hours, the prehybridization solution was discarded

and 30 ml of hybridization solution (5x SSC; lx Denhardts; 0.5 mg/ml sssDNA; 0.04

M sodium phosphate buffer, pH 6.5) containing the labeled probe were added.

The membranes were washed four times for 30 min. in 2x SSC with 0.1 % SDS at

hybridization temperature. The wet membranes were sealed into plastic bags and the

labeled bands were visualized on X-ray films (Fuji RX, Fuji Photo Films Co LTD, Ja¬

pan).

2.3.11 Polymerase chain reactions

All oligonucleotide primers were synthesized by Microsynth (Balgach, Switzer¬

land) and are listed in Table 4.

Target DNA was amplified in 0.2 ml thin-walled tubes using thermocyclers

equipped with heated lids (Personal Cycler; Biometra, Göttingen, Germany). A stan¬

dard 50-nl reaction mixture contained 0.2 mM each of dATP, dCTP, dGTP, dTTP, 1

Unit Taq DNA Polymerase, 5 \i\ lOx standard PCR-buffer (all from Amersham Phar¬

macia Biotech), sterile bidistilled water, desired primers (1 |iM up to 100 |iM, depend¬

ing upon specific or degenerated primers used) and template DNA (usually 0.5 \i\ cells

of an overnight culture). For high quantities of probes, a mastermix that contained all

components (no template DNA) was prepared and distributed to the reaction tubes. Af¬

ter an initial heating for 5 min. at 95 °C, the reaction mixture was run through 35 cycles

of denaturation for 15 sec. at 95 °C, annealing for 30 sec. and elongation at 72 °C.


TABLE 4. Synthetic oligonucleotides used for PCR

Name Sequence (5'-3') Target/Source

lml 6 CCITAYICITAYGAYGCIYTIGARCC

lml 7 RTARTAIGCRTGYTCCCAIACRTC

tgl9 CAACAATAAGTATAATAGCC

tg20 GAATCCTGCAGCTTTTCTC-

CCTAAG

rbrl ATGAAAAGTTTAAAAGGTAC

rbrlrev TTAATAAGTTTCTTTGAAAAC

tglOO TTYGCIGGIGARWSICARGC

tglOl GGRCAYTTYTCIGGIGCYTC

ermBl CGAGTGAAAAGGTACTCA

ermBlr GCTCATAAGTAACGGTAC

clprl84 AAAGATGGCATCATCATTCAAC

clpr462 TACCGTCATTATCTTCCCCAAA

partial sod, degenerated /

(Geissmann et al, 1999)

partial sod, degenerated /

(Geissmann et al, 1999)

complete sod I this study

complete sod I this study

complete rbr, specific for

C perfringens I this study

complete rbr, specific for

C perfringens I this study

partial rbr, degenerated /

this study

partial rbr, degenerated /

this study

partial ermB I (Perreten et

al, 1998)

partial ermB I (Perreten et

al, 1998)

partial 16S rRNA specificfor C perfringens I (Wang

etal, 1994)

partial 16S rRNA specificfor C perfringens I (Wangetal, 1994)

Whereas the annealing temperature (TA) was calculated using a simple formula (TA =

[no. of GC] x 4°C + [no. of AT] x 2°C) and the elongation time was 1 min. for 1-kb of

amplicon size.

For amplicons longer than 2-kb, 0,1 Unit of Pfu polymerase (Stratagene) and 50

mM MgCl2 was added.

26

2.3.12 Nucleotide sequence determination and analysis

Both strands of cloned DNA were sequenced with a laser fluorescent detection sys¬

tem (ALFexpress; Pharmacia Biotech AB, Uppsala, Sweden) according to the manu¬

facturer's protocol. Nucleotide sequences were analyzed with the Genetics Computer

Group (GCG) version 10 sequence analysis software package (University of Wiscon¬

sin, Madison).

2.4 RNA techniques

If not otherwise indicated, all RNA manipulations were done according to standard

protocols (Sambrooke^ al, 1989).

2.4.1 Isolation of total RNA

Total RNA at the end of the exponential-phase cultures of C perfringens was iso¬

lated by a modification of the procedure of Oelmueller etal. (1990). Cells from a 3-ml

culture were harvested within 15 sec, washed with ice-cold AE-buffer (20 mM sodium

acetate [pH 5.5], ImM EDTA), resuspended in 0.5 ml of ice-cold AE-buffer and added

at once to 1 ml of phenol-chloroform-solution (24 volumes of phenol equilibrated with

AE-buffer, 24 volumes of chloroform, 1 volume of isoamyl alcohol, 0.1 % [wt/vol] 8-

hydroxyquinoline, 0.1 % [wt/vol] sodium dodecyl sulfate) preincubated at 60°C.

Keeping this temperature for 10 min. constant, the tubes were shortly mixed at 1-

minute-intervals. The phenol-chloroform extraction was repeated three times at room

temperature and the RNA was finally precipitated after the addition of 2.5 volumes of

ethanol (96 %>, vol/vol), washed with ethanol (70 %>, vol/vol), and dried. For storage,

the pellet was resuspended in 100%> formamide. The concentration was determined by

the ethidium bromide fluorescent quantification method as described above (2.3.5).


2.4.2 Northern and slot blot analysis

Total RNA was separated in 1.5% (wt/vol) denaturing agarose gels containing 20

mM guanidine thiocyanate as an alternative to gels containing formaldehyde (Goda

and Minton, 1995). Transfer to quaternary amine derivatized nylon membranes (Zeta-

Probe; Bio-Rad) was done as recommended by the manufacturer. Hybridization was

done by a modification ofthe procedure of Church and Gilbert (1984). The membranes

were prehybridized for one hour in hybridization solution (1 mM EDTA, 0.5 M

NaH2P04 [pH 7.2], 7% [wt/vol] sodium dodecyl sulfate [SDS]). The solution was re¬

placed, and the radio labelled DNA fragments were added and incubated overnight at

60°C. After hybridization the membranes were treated twice with washing solution (1

mM EDTA, 40 mM NaH2P04 [pH 7.2]) containing 5% (wt/vol) SDS at 60 °C, fol¬

lowed by two washes with washing solution containing 1% SDS at 60 °C. Size deter¬

mination was done by using an RNA ladder (0.46, 0.75, 1.3, 1.7, and 4.1-kb; New

England BioLabs).

Slot blots were done with a "Minifold SRC 60-D" (Schleicher&Schuell, Dassel,

Germany) and the membranes were handled as described above.

2.4.3 Primer extension analysis

Primer tg6 (5'-AATCTGGATACATTAATG-3') or Rub5 (5'-AGATTTTCAG-

CAGTTTTA-3') were used for primer extension analysis. Approximately 0.1 pmol of

end labelled oligonucleotide was annealed to 30 \ig of total RNA in 30 \i\ of hybridiza¬

tion buffer (40 mM piperazine-N,N-bis[2-ethanesulfonic acid] [PIPES, pH 6.4], 1 mM

EDTA, 0.4 M NaCl, 80% [vol/vol] formamide) at 85°C for 5 min., slowly cooled to

30°C and incubated overnight at 30°C. After an ethanol precipitation step, the an¬

nealed primer was extended by 400 units of reverse transcriptase (SuperScript II; Gib¬

co BRL) with 0.5 mM of each deoxynucleoside triphosphates (dATP, dCTP, dGTP

and dTTP) in 100 ml of elongation buffer (1 'first strand buffer [Gibco BRL], 10 mM

DTT, 40 units of RNase inhibitor [Boehringer Mannheim]) at 42 °C for one hour. The

extension product was precipitated in ethanol and was separated by electrophoresis on

a sequencing gel together with a nucleotide sequence reaction which had been carried

28

out with the appropriate plasmid-DNA and with the same primer. Radioactively la¬

belled DNA sequencing was done with a "Sequenase" kit (T7 DNA Polymerase, Unit¬

ed States Biochemical, Cleveland, Ohio).

2.5 Protein techniques

2.5.1 Preparation of protein extracts and SOD assay

Protein extracts and SOD activity measurements were carried out as described pre¬

viously (Lehmann et al, 1996). Quantitative SOD activity was measured by the inhi¬

bition of the autooxidation of pyrogallol (Marklund and Marklund, 1974). Qualitative

SOD activity was determined by activity staining of native Polyacrylamide gels with a

staining solution containing riboflavin (0.14 mM) and nitro-blue-tetrazolium (2.45

mM) (Beauchamp and Fridovich, 1971).

*3 Results

3.1 Cloning and sequencing of the sod gene regionfrom C. perfringens

In order to clone the complete sod gene from C perfringens NCIMB8875, a frag¬

ment from its genome was amplified by PCR using the primer pair lml6 (5'- CCI TAY

ICI TAY GAY GCI YTI GAR CC -3') and Im 17 (5'- RTA RTA IGC RTG YTC CCA

IAC RTC -3'). These primers were deduced from an amino-acid-sequence alignment

from known SODs similar as described above for the screening of rbr genes. A South¬

ern blot of C perfringens chromosomal DNA cut with EcoBl and probed with the la¬

belled PCR product generated three signals of 1.9-kb, 2.1-kb and 0.1-kb in size,

respectively. Since the PCR product was cleaved by EcoRI, we decided to clone the

corresponding DNA fragments from the genome. We cloned the 1.9-kb fragment in

pUC18 to yield plasmid pTGl 1, whereas we failed to clone the 2.1-kb fragment. How¬

ever, it was possible to clone part of this fragment, namely a 0.9-kb EcoRI-Xbal frag¬

ment as an insert in plasmid pIT4. Primer tgl9 and primer tg20 were deduced from

pTGl 1 and from pIT4, respectively, to yield a 1.2-kb PCR product using genomic

DNA of C perfringens as template. This fragment was finally cloned in pUC18 to

yield plasmid pTGl920.

The nucleotide sequence of the DNA cloned in pTGl 1, pIT4 and pTG1920 was de¬

termined and searched for open reading frames. The deduced amino sequence of a 684-

bp open reading frame extending from nucleotides 114 to 798 (Fig. 2) showed exten¬

sive homology to amino acid sequences typically conserved in Mn-SODs or Fe-SODs.

We calculated 54.0% identity to Mn-SOD from Bacillus subtilis (Inaoka et al, 1998);

51.2% identity to Mn-SOD from Listeria monocytogenes (Brehm et al, 1992) and

44.0% identity to Mn-SOD from E. coli (Takeda and Avila, 1986). Therefore, the cod¬

ing region of this polypeptide was designated sod. The gene is preceded by a perfect

ribosome binding site containing a box of 7 nucleotides complementary to the 3'-end

30

TAAAAATGAAATATTTCAATTTAAAGAAGGGGTTTTAAAGAGTACATTAATAACAACAAT -214

AAGTATAATAGCCATAGTTAATATTGTTTATGCACTTTTTCTAGAAAAATTAGATTTTGA -154

AGACATAAAGTGGATAAGTATTGTCTTAACTTTATTTATAATGAATAGCAATGTTATTAA -9 4

-35

TGGAACAATAAACAGTTTATACATAATTCAAAGTAAGGATGGATTAAATTTAATTATTAC - 3 4

-10 sod mKNA start^^^

CTTAATAATTGTTTTAGGTATATTTTTTATTAGCTATTATATATTTAAAACTTTGATTTT +2 7—:

>

ACAAAGTATTAAATTAAAAAAATAAATATAAAAATAGGTATTGGGAAGAATAATAATAAA +87

****** sod

TTATTTCAAATATGAGGAGGTAAAAAATGAAAAATAATTTTTTAAAACACAAAAAAAGTC +147

MKNNFLKHKKSP

tg6CATTAATGTATCCAGATTACTGTGGATCATCTTCAACTAAAGGGGAAGGTTTTAAATTAA +2 07

LMYPDYCGSSSTKGEGFKLK

AACCTTTAGATTATCCTTATGATGCTTTAGAGCCATCAATAGATGCAGAAACAGTAAAAA +2 67

PLDYPYDALEP SIDAETVKI

lml 6

TTCATCATGACAAACATCAACAAGCTTATGTAGATAAGTTAAATAAAGCTTTAGAAAAAC +32 7

HHDKHQQAYVDKLNKALEKH

ATCCTGAGCTTTATGGCAAAAGCTTATACGATATTTTAAGCAATTTAGATGATATGCCAG +3 8 7

PELYGKSLYDILSNLDDMPE

AGGATATTATGGCTGATTTAGTAAATCAAGGTGGTGGAGTTTATAACCATGAATTCTACT +447

DIMADLVNQGGGVYNHE FYW

GGAGCATTTTAGGAAAAGGATGTAATAGACCAGTTGCTGAAATAGCAGATGCATATGACA +5 07

SILGKGCNRPVAEIADAYDR

GAGATTTTGGTTCTTTTGAAGAATTCAAAGAAAAGTTTAAACAATGTGGAATCTCTACCT +5 67

DFGSFEEFKEKFKQCGISTF

TTGGTTCAGGTTGGGCATGGTTAGTTAGTGATAAAGATGGAAAGTTAGAAATCATGTCAA +627

GSGWAWLVSDKDGKLEIMST

CTAAGGATCAATCATCTCCTATTTCTTTAGGATTAATTCCTATATTAACAATGGATGTTT +68 7

KDQSSPISLGLIPILTM D V W

GGGAACATGCTTATTATTTAAAATATCAAAATAGACGTCCAGAGTATATAGACTATTTCT +7 47

E H A Y Y L KYQNRRPEYIDYFF

lml 7

TCGATATAATAAACTGGAAAAAGTGTGAAGAATATTATAACAATAGATAATAGAAAAATA +8 07

DI INWKKCEEYYNNR*

TTATAAAATATGTAATAAATCATAGAAAGAGCGTGTATTAAAGTGGTTTTTAAAATAAAA +867

TTTACTTTAATACACGCTTTTTTAAATATTATATGGTAATATTTGTAAAATTATTGTAGT +92 7

ATACATATTATGTGAATGGTAAATTTAAAATTATACTTAGGGAGAAAAGCTGTTAAGTTT +9 8 7

FIG 2 Nucleotide sequence of the sod gene from C. perfringens and the predicted ammo acids of

the encoded superoxide dismutase and the sod promoter region The underlined ammo acids are highlyconserved among SODs and indicate the region from which oligonucleotides lml6 and lml7 were

derived The overlmed nucleotide sequence indicates the complementary sequence of the primer (tg6)used for primer extension analysis A potential nbosome binding site is marked by asterisks The

consensus promoter sequences (-35 and -10) are bold underlined, and the transcription start point is

marked by an arrow Bold ammo acids indicate the N-termmus, which is unusually expanded comparedto other Mn-and Fe-SODs

31 Results

ofthe 16S rRNA of C. perfringens. However, the size of 227-amino-acid sequence en¬

coded by sod is longer than that of other bacterial and archaeal Mn- and Fe-SODs. Se¬

quence alignment with these organisms revealed that the N-terminus of the C

perfringens SOD is extended by 26 amino acids, which is a structural feature postulat¬

ed so far only for an Acinetobacter SOD (Geissdörfer et al, 1997). Finally, the gene

was transformed into E. coli QC774 (Carlioz and Touati, 1986), which resulted in high

SOD activity and functional complementation of this sodA sodB mutant (data not

shown).

3.2 Northern and primer extension analyses of the

rbr and sod genes

sod and rbr Northern hybridizations revealed each a single sharp signal correspond¬

ing to mRNA transcripts of approximately 800 nucleotides (Fig. 3). Thus, the sod and

the rbr genes are transcribed in C perfringens as monocistronic opérons. This is in

contrast to the rbr gene from D. vulgaris, where rbr is co-transcribed with genes en¬

coding a Fur-like and a Rubredoxin-like protein (Lumppio et al., 1997). The transcrip¬

tion start point of the sod gene was then located by primer extension analysis 113

nucleotides upstream ofthe translational initiation codon. No other apparent transcrip¬

tional start sites were detected (Fig. 4). A good -10 promoter sequence (TATATT,

bases in bold correspond to the consensus sequence) is evident upstream of the tran-

sod rbr

m °-8-kb

FIG 3 Northern blot analysis of the C. perfringens sod and rbr genes

32

sod rbr

FIG 4 Mapping of the 5' end of the sod and rbr transcripts of C perfringens by primer extension

analysis Primer extension products (pe) are shown right to the corresponding sequencing ladder on a

6% (wt/vol) sequencing gel Transcription start point is boxed for the sod operon (left) and the three

potential start points are numbered for the rbr operon (right) The numbers given to the nucleotides

correspond to the numbering of the nucleotides in Fig 5

scriptional start site and a moderate -35 promoter (TTACCT) is found 16 bases farther

upstream (Fig 2) In repeatable primer extension experiments of the rbr gene, three

major signals were always detected (Fig 4), independent of growth phase (mRNA

from log and stationary phase was analyzed) The most probable transcription start

point was found 107 nucleotides upstream ofthe initiation codon Next to this site pro¬

moter consensus sequences (TATTAT and TTGAAA) were found (Fig 5) The other

signals at position -58 and -26 were weaker and their upstream regions had only low

similarity to promoter consensus sequences, thus they might represent degradation

products In particular, the strong signal at -58 corresponds to a G in the loop of a pre¬

dicted large stem-loop structure (Fig 5)

33 Results

TTC7A7A7A7AAGTACTTGA7AATTTTCCCC7A7AAGTGATATTATA -112

-107 rbr mRNA start

AATTATATAAGGAATAACAATTATTAATTAATATGGCTTA -7 2

-58

AAAATTATTTATTTGGAAAAATAATTTTAATTGTGTTTTT -3 2

-26 ****** rbr

TCAAATAAGTGATTGTAGGAGGTTTTTTATTATGAAAAGT + 9

MKS

Rub5

TTAAAAGGTACTAAAACTGCTGAAAATCTAATGAAATCAT +4 9

LKGTKTAENLMKSF

FIG 5 Nucleotide sequence of the rbr promoter region from C. perfringens The overlmed

nucleotide sequence indicates complementary sequence of the primer used for primer extension

analysis A potential nbosome binding site is marked by asterisks Possible consensus promoter

sequences are bold underlined, and the transcription start point is marked by an arrow A predicted

stem-loop structure, that might resulted in a preferred processing site a position -58, is double

underlined (+ would be bulges)

3.3 Transcription of sod and rbr is not induced by

oxygen

RNA slot blots were done with total RNA isolated from anaerobically grown and

from oxidatively stressed cells. Total RNA was isolated every 30 min. during exponen¬

tial- and stationary-phase growth, the RNA concentration was equilibrated, and slot

blots were done with five different dilutions (10, 5, 1,0.5 and 0.1 |ig). The same mem¬

branes were subsequently hybridized with sod or rbr probes, and 16S rRNA was hy¬

bridized as a control. Spot densities of the radiograms were measured with a digital

imaging system (Alphalmager, Alpha Innotech Corp., San Leandro, CA). C per¬

fringens cultures stressed by both oxygen and paraquat had the same growth rate as the

anaerobically inoculated cells, but their morphology changed from normal 5-|im-long

rods to up to 100-|im-long threads (Fig. 6). Mn-SODs are part of the defense mecha¬

nism against reactive oxygen species. It was expected that oxidative stress would result

34

FIG 6 C perfringens grown under either anaerobic (A) or under moderate oxidative stress (0 1

mM Paraquat, 40 ml/1 02) (B) conditions

in an induction ofsodtranscription, as it is reported for sodA genes from gram-negative

bacteria (Touati, 1988) However, a slight decrease in sod transcription was measured

(Fig 7A) The negative shift was only about twofold, and since experimental inaccu¬

racy might be present, this negative shift was not considered significant Indeed, the

soJmRNA level of C perfringens increased during exponential growth and reached a

maximum at the entry into stationary phase, independently of whether C perfringens

35 Results

was grown under anaerobic or moderate oxidative stress conditions (Fig. 7A). The sod

transcript was 10-fold higher and decreased during stationary phase but remained still

more than 5-fold higher than during exponential growth. Interestingly, rubrerythrin

transcription was influenced neither by oxidative stress nor by growth phase, and the

rbr mRNA level decreased slightly during stationary phase (Fig. 7B).

A)

B)

100

c

CD-I—«

0 10>^—«

TO

CD

CD

Q

O

0,1

100

c

CD

CD>

CD

CD

Q

O

10

0,1+

0

-to'

ô^-

+ +

200 400

time [min]

600

ibs:

*>

i^t

i_

200 400 600

time [min]

FIG 7 sod (A) and rbr (B) transcripts during log and stationary phase of C. perfringens grown

under anaerobic () or moderate oxidative stress (D) conditions Relative intensities were determined

by densitometry analysis Growth was followed by spectrophotometry at 600 nm (+)

36

3.4 Construction and characterization of a rbr dele¬

tion mutant to study potential role of rbr in oxy¬

gen stress handling

A strategy used for gene replacement mutagenesis is that of homologous recombi¬

nation. To insertionally inactivate a chromosomal gene by a single crossover event, an

internal fragment of the gene to be inactivated is cloned into a suicide vector. That is,

a vector that is unable to replicate in the target strain. An antibiotic resistance gene that

is expressed in the target strain can be added as a marker. The resulting plasmid can

then be used to transform the strain to antibiotic resistance. The only way in which re¬

sistant transformants could be obtained is if the plasmid has been integrated into the

chromosome by homologous recombination.

3.4.1 Construction and application of the suicide vector

pJIR751 (Bannam and Rood, 1993) was used as the starting point for directed mu¬

tagenesis. pJIR751 is rather a shuttle vector than a suicide plasmid, but it was suitable

for its ermBP gene. The source plasmid for the rbr gene was pTAG100/101, a pUC18

derivative with a 480-bp PCR product of the primers tglOO and tglOl containing an

internal fragment of the rbr gene. The rep and oriCP of pJIR751 were replaced with

the rbr fragment of pTG100/101 using Spel and Sphl. The resulting vector pCVMl

was 3.3-kb in size as expected and was further analyzed by digestion analysis (von

Meyenburg, 1998). pCVMl carries the oriEC, ermBP and a rbr fragment but not the

rep and oriCP ofC perfringens, thus it is the desired suicide plasmid for a single cross¬

over event.

5 |ig of pCVMl was used for transforming competent C perfringens strain 13 ac¬

cording to the protocol of Kim and Blaschek (1989). Unfortunately, no transformants

were recovered, so the protocol was modified at several steps. The postelectroporative

incubation was prolonged from 1 h to 4 h, and possible mutants were first enriched

overnight in BHI fluid medium containing 20|ig/ml erythromycin, before they were

selected on BHI plates containing 50|ig/ml erythromycin. Control electroporations

with the shuttle vector pJIR751 had also shown that freshly earned cells were more

37 Results

competent as deep frozen pellets, therefore the competent cells were freshly produced

for every transformation experiment. Under these optimized conditions, up to 50 eryth¬

romycin resistant colonies were obtained per electroporation assay.

H/ndlll H/ndlll H/ndlll

strain

13

rbr1ermBlr

H/ndlllSpel

H O

Sphl H/ndlll

_Lj

H/ndlll

Arbr ermBPermB

1,8 kb

or/EC Arbr

2,7 kb

rbrlrev

strain

TAG1

FIG 8 Isolation of a rbr mutant Relevant chromosomal gene regions are shown by horizontal lines

before and after the homologous recombination event occurred The figure indicates the process bywhich the wild-type rbr gene from C. perfringens strain 13 was replaced by the Arbr::ermBP region

from pCVMl to construct the rbr mutant C. perfringens TAGl The primers used for PCR are

indicated by arrows and the distances between them are marked underneath

38

3.4.2 Detection and verification of a rbr mutant

The formation of new DNA junctions by homologous recombination of plasmid

pCVMl with the C perfringens chromosome was monitored by a multiplex PCR ap¬

proach. The primers rbrl and rbrlrev hybridizing outside the rbr fragment and the

primer ermBl hybridizing with the ermBP gene insert were used for this screening

(Fig. 8). Toothpicked colonies were directly used as template for PCR in 25 \i\ reaction

volume. For a homologous recombination, a product of 1,8 kb of the primers rbrl and

ermbl was expected, whereas no fragment of 580 bp should occur. A 580 bp product

would be of the primers rbrl and rbrlrev and represent the intact rbr gene. All in all,

98 erythromycin resistant transformants from three independent electroporations were

screened but none of them had an amplicon of 1.8 kb. But in one reaction the product

12 3 4

[kb]

4,0

3,0

2,0

1,6

1,0

0,5

FIG 9 PCR analysis of chromosomal DNA from C. perfringens TAGl DNA was amplified with

primers rbrl and rbrlrev (lane 2), rbrl and ermBl (lane 3), rbrlrev and ermBlr (lane 4) The PCR

products were run on a 0 8% (wt/vol) agarose gel which was stained with ethidium bromide Lane 1,

1 -kb DNA marker ladder

39 Results

of 580 bp was also missing. This strain was named TAGl and its chromosomal DNA

was purified. The PCR was repeated with the purified DNA as template in 50 \i\ reac¬

tion volume. At this time, a strong signal corresponding to a product of 1,8-kb was ob¬

tained and the rbr product of 580 bp was still missing. Further verification of the

homologous recombination was done with the primers rbrlrev and ermB lr that yielded

a 2,7-kb long amplicon (Fig. 9). Thus, the integration of pCVMl with the ermBP gene

occurred at the desired site and destroyed the rbr gene and function.

Protein Polyacrylamide gel electrophoresis and subsequent staining for SOD activ¬

ity confirmed the absence ofthe rubrerythrin protein. Rubrerythrin forms an achromat¬

ic band like SODs when native gels are stained with nitroblue tetrazolium (Lehmann

et al, 1996). Protein crude extract from C perfringens TAGl showed no achromatic

band even at 50 times higher concentration than protein crude extract from the wild-

type strain (Fig. 10).

FIG. 10: Protein Polyacrylamide gel electrophoresis of C. perfringens strain 13 and strain TAGl.

About 5 |Xg of crude extract of strain 13 (lane 1 ) and about 250 |Xg of crude extract of strain TAG 1 (lane

2) was loaded on a nondenaturating 10% Polyacrylamide gel and stained for SOD activity.

40

3.4.3 Phenotype of C. perfringens TAG1

The growth curves of C perfringens wild type and TAGl under anaerobic condi¬

tions were very similar, but in some experiments, the mutant strain showed a slightly

reduced doubling time. There were no differences observed in colony-forming on BHI

agar plates under anaerobic conditions.

For testing the influence of air, exponentially growing liquid cell cultures were

splitted and one half was transferred from anaerobiosis to air and shaken at 250 rpm at

37 °C. The other half was left in anaerobiosis at 37 °C and used as control. At different

times following air exposure, aliquots were removed, returned to anaerobiosis and in¬

oculated in fresh BHI broth or plated on solid BHI medium. The survival of both the

wild type and mutant strain that had been exposed to air was very similar, indicating a

similar doubling time and final cell density. The rbr mutant showed no higher sensi-

CFU/ml

1.0E+10

1.0E+09

1.0E+01

1.0E+00

50 100 150 200 250

time [min]

300 350 400

FIG 11 Survival after exposure to air plus paraquat (ImM) (squares) of C. perfringens strain 13

(closed symbols) and strain TGA1 (open ssymbols) Samples were returned to anaerobic conditions

after the indicated aeration time and plated immediately at various dilutions on solid BHI

Corresponding anaerobic controls are indicated by diamonds

41 Results

tivity to oxygen than the wild type strain. The same experiment was also repeated with

a supplement of 1 mM paraquat, but no differences were detected between C perfrin¬

gens 13 and TAGl (Fig. 11).

Similar experiments were performed with hydrogen peroxide as stress inducer.

Again, liquid cell cultures were grown under anaerobic conditions until they reached

exponential growth and were then split into different serum flasks containing hydrogen

peroxide in different amounts (0, 2, 3, 4, 5, 6 ppm H202, [1 ppm= 34 |lM]). The

growth rate was traced by measuring the optical density and the survival was deter¬

mined by plating experiments after 1 hour of the hydrogen peroxide treatment. The

comparison of the growth curves was more difficult than anticipated, as several repe¬

titions showed variations in the anaerobic growth ofthe two strains. However, the mu¬

tant strain TAGl was tendentiously more sensitive to hydrogen peroxide than the

CFU survival [%]

1.0E+00

1.0E-01

1,0E-02

1,0E-03

1,0E-04

1,0E-05

1,0E-06

1,0E-07

0 2 3 4 5 6

H202 [ppm]

FIG 12 Relative survival of C. perfringens strain 13 (black bars) and strain TAGl (grey bars)

exposed to H202 (1 ppm = 34 \\M) Anaerobic cultures of wild type and mutant strain in BHI medium

were exposed to different concentrations of H202 After 1 hour of exposure, samples were plated

immediately at various dilutions on solid BHI Surviving cells were counted after overnight incubation

at 37 °C and divided by the corresponding untreated control Data are means from several independent

experiments

42

parent strain (not shown) By the plating experiments, where the relative survival was

calculated by dividing the H202 treated cells by the control, this tendency was con¬

firmed The survival rate was 10 to 100-fold reduced for the rbr mutant compared to

the wild type strain after exposure to different amounts of hydrogen peroxide (Fig 12)

3.5 Transcriptional analysis of the rbr mutant

To study the effect ofhydrogen peroxide on the transcriptional level of rubrerythrin,

slot blots were performed with RNA isolated from the wild type and the mutated strain

The cells were shocked in their mid-exponential growing phase by an addition of 500

|lM H202 mRNA was isolated every 30 min and the concentration of each sample

was equilibrated to 1 |lg/|ll of total RNA RNA was transferred under denaturing con¬

ditions to the membranes in different amounts (1, 10, 20 |ig), and hybridized against

wild type (13) TAG1

rbr+ rbr'

A) B)

w20^ <ÊÊ>miÊ>m^ rbr10 ng

1 ng

probe

C) D)

20 ng

10 ng16S rRNA

control

«Ü» «Ut 1 Hg

30 0 30 60 90 time [mm] -30 0 30 60 90

FIG 13 RNA slot blots of C perfringens strain 13 (panel A and C) and TAGl (panel B and D)500 |jM hydrogen peroxide was added to the BHI medium at mid-exponential growing phase (time

zero as shown at the bottom) and RNA was isolated every 30 mm and blotted in various amounts (1,10 or 20 |Xg as shown in the middle column) The membrane was hybridized against a rbr probe (panelA and B) and subsequently to a 16S rRNA probe as control (panel C and D)

43 Results

an rbr probe and subsequently against a 16S rRNA probe as a control. Surprisingly, the

rbr mRNA level of strain 13 was dramatically down regulated by the H202 treatment,

while the rbr mRNA level of the mutant remained unaltered (Fig. 13).

3.6 Screening for rbr genes in various bacteria

In order to obtain a survey on the distribution of Rrs, a PCR-approach was used to

amplify parts of possible rbr genes in anaerobic and aerobic bacteria. 23 strains were

screened including 11 strict anaerobes (Table 5).

The problem of the PCR-approach and hybridization was, that sequence data were

limited to only two isolated and three putative Rrs. More sequence data would be de¬

sirable to perform a reliable alignment to find a suitable stretch of high conserved ami¬

no acids to generate appropriate oligonucleotides. In addition, the decision for the

selection of useful primers was dependent on the resulting PCR product: the goal was

to amplify as much as possible from the rbr gene. The finally chosen primers tglOO and

tglOl were degenerated from the N- and C-terminal regions (Fig. 14) of the consensus

sequence of sequences from D. vulgaris (Prickril et al, 1991), C perfringens (Leh¬

mann etal, 1996), and of the putative rbr genes from Methanococcusjannaschii (Bult

et al, 1996), Methanobacterium thermoautotrophicum (Smith et al, 1997). Primer

tglOO (5'-TTYGCIGGIGARWSICARGC-3') is 32-fold degenerated and contains 3

inosines, and primer tgl01 (5'-GGRCAYTTYTCIGGIGCYTC-3')is 16-fold degener¬

ated and contains 2 inosines. The expected amplicon was about 450-520 bp of size, de¬

pending on the amount of deletion (or addition, respectively) of amino acids in the

region around amino acid 72 as numbered in Fig. 14 (e. g. C perfringens has 4, M. jan¬

naschii has even 9 additional amino acids in this region compared to the sequence of

D. vulgaris). PCRs were performed at different temperatures (45, 48 and 50°C) or as

a touch down PCR from 50°C to 40 °C during the first 20 cycles. The reactions were

tested for an amplicon of the expected size by agarose gel electrophoresis and verified

by Southern blotting. Hybridization was done at 60 °C with a C perfringens rbr frag¬

ment.

44

TABLE 5. Strains used for rbr screening

Strain Origin"oxygen

sensitivity PCRb Hybr.

Actinomyces georgiae LME anaerobic - +

Arthrobacter globiformis DSM 20124 aerobic + -

Bacillus thuringiensis DSM 2046 aerobic (+) (+)

Bacteroidesfragilis ATCC 25285 anaerobic + +

Bifidobacterium asteroides LME anaerobic (+) -

Bifidobacterium bifidum LME anaerobic - -

Brevibacterium linens LME aerobic + -

Cellulomonas uda DSM 20107 aerobic - +

Clostridium acetobutylicum DSM 792 anaerobic + +

Clostridium butyricum LME anaerobic + +

Clostridium pasteurianum LME anaerobic - +

Enterobacter sp. LME fac. anaerobic - +

Enterococcusfaecalis FO1 LME aerotolerant - -

Fusobacterium nucleatum subsp.

polymorphum

ATCC 10953 anaerobic + +

Fusobacterium nucleatum subsp.vincentii F2

LME anaerobic + +

Lactobacillus acidophilus Wiesby 145 aerotolerant - -

Lactobacillusjohnsonii AC 1 LME aerotolerant - -

Mycobacterium chlorophenolicum DSM 43826 aerobic - -

Nocardia convoluta LME aerobic (+) -

Porphyromonas gingivalis W83 LME anaerobic + +

Propionibacterium freudenreichii LME fac. anaerobic - -

Streptomyces azureus DSM 40106 aerobic (+) +

Veillonella dispar ATCC 17748 anaerobic (+) +

a ATCC American Type Culture Collection, Manassas, USA

DSM Deutsche Sammlung fur Mikroorganismen und Zellkulturen, Braunschweig, GermanyLME Laboratory of Food Microbiology, ETH, Zurich, Switzerland

b + detected, (+) very low signal, - no signal

45 Results

FIG. 14: Alignment of rubrerythrin amino acid sequences from 5 procaryotes. The patterns used for

designing primers tglOO/tglOl are rewritten under the consensus sequence (x). a) Methanococcus

jannaschii Rr, b) and e) Methanobacterium thermoautotrophicum Rr, c) Clostridium perfringens Rr, d)

Desulfovibrio vulgaris Rr. The corresponding references are given in the text.

There were for some strains conflicting results, sometimes a hybridization signal

was detected around 500 bp but no amplicon of this size was found by gel electrophore¬

sis. However, gel electrophoresis and hybridization with a rbr probe from C perfrin¬

gens gave evident results for Clostridium acetobutylicum, Bacteroides fragilis and

Fusobacterium nucleatum. These PCR products were subsequently ligated into

pGEM-T Easy vector, propagated in E. coli XL1-Blue and sequenced. Sequence com-

46

parison revealed that the cloned PCR products have high similarity to the Rr sequence,

therefore it can be assumed that rbr-like genes were amplified. Amino acid sequence

similarity and identity of the amplified DNA fragments compared to the sequence of

Rr from C perfringens are listed in Table 6. Moreover the EXXH motif of the diiron

TABLE 6. Amino acid sequence similarity and identity of amplified DNA fragments

compared to the sequence of Rr from C perfringens (= 100%)

Strain Similarity Identity

Bacteroidesfragilis 74% 57%

Clostridium acetobutylicum 78% 67%

Fusobacterium nucleatum subsp. polymorphum 68% 48%

Fusobacterium nucleatum subsp.vincentii 68% 47%

site is in all sequences present as well as the first CXXC motif ofthe FeS4 site (the sec¬

ond was not amplified). The length ofthe sequences differs in up to 15 amino acids and

all these differences are in the region after the first EXXH motif (Fig. 15). This region

represents the linkage between helix 2 and helix 3 and seems to be very variable in

length. It is remarkable that the Clostridia sequences have the same length and also

within the Gram negatives D. vulgaris and B. fragilis exists an identical length, but 4

amino acids less than of the Gram positives. The sequences of the F. nucleatum sub¬

species are identical in length and differ only in two amino acids. The sequences are

by 15 amino acids shorter than the Clostridia sequences.

47 Results

E A y E K C y

E A y E K C y

E A y E K C y

E A y L K C y

E A y E K C y

CLHPQAFFEV F K E T Y

FIG. 15: Amino acid sequence alignment from amplified rèr-fragments from a) Fusobacterium

nucleatum subsp. polymorphum, b) Fusobacterium nucleatum subsp. vincentii, c) Clostridium

acetobutylicum, e) Bacteroides fragilis and d) is the translated rbr sequence of C perfringens. The

open boxes represent amino acids used as targets for designing the 2 primers tglOO and tglOl. The

EXXH and CXXC motifs discussed in the text are rewritten under the aligned sequences.

T" Discussion

4.1 The sod gene of C. perfringens

Sequence alignment of the SOD from C perfringens with various known SODs re¬

vealed that this SOD belongs to the Mn/Fe-SOD group. But its N-terminus is surpris¬

ingly extended by 26 amino acids. There are similarities to signal sequence features

like a positive charged N-terminus and a putative cleavage site. Interestingly, the hy¬

drophobic core region possesses a proline and an aspartate at position 16 and 17, re¬

spectively, which results usually in defective protein translocation by forming a turn in

the hydrophobic core region (von Heijne, 1990; Gennity etal, 1990). However, a pu¬

tative cleavage site is highly probable after the glycine at position 26 according to the

so-called '(-3, -l)-rule' (von Heijne, 1986). Fusions of the putative signal peptide to ß-

galactosidase and phophatase revealed that they are not secreted to the periplasma (not

shown). Thus, the putative signal peptide is not able to translocate proteins in E. coli.

Analysis ofthe amino acid sequence using SignalP V2.0 (Nielsen etal, 1997) suggest¬

ed the existence of an improbable 8-residue export leader peptide. Substitution of the

proline and aspartate by two methionine revealed to a prediction of a leader peptide of

21-29 amino acids.

The sod mRNA level of C perfringens increased during exponential growth and

reached a maximum at the entry into stationary phase, independently of whether C

perfringens was grown under anaerobic or moderate oxidative stress conditions. This

finding is similar to the observations reported for B. subtilis (Inaoka et al, 1998) and

S. aureus (Clements et al, 1999) or for other enzymes of the defense mechanism

against reactive oxygen species, such as catalase (Michân et al, 1999; Rocha and

Smith, 1997). This led to the conclusion that in C perfringens the regulation of SOD

is substantially different than the well known SoxRS regulation mechanism of sodA in

E. coli. It must be remarked, that the regulation of sodA is very complex and that sodA

is under the control of at least six regulators in E. coli (reviewed in Touati, 1997).

50

4.2 The relationship between rubrerythrins

Nowadays, complete sequenced genomes give capacious information about the

presence of a certain gene in the sequenced organisms. Apparently 32 completed and

53 unfinished microbial genomes (7 archaea, 72 bacteria, 4 eucaryotes) can be inves¬

tigated with BLAST at the National Center for Biotechnology Information (NCBI, ht¬

tp://www, ncbi.nlm.nih.gov/). A search for rubrerythrin yielded several ORFs with

homology to Rr. Together with the sequences described in this study, there are 24 rbr-

like genes known from 18 different organisms, whereas some organisms have more

than one rbr-\ike gene (see below).

The phylogenetic tree (Fig. 16) of the known Rrs shows two main branches, one

where all bacterial and some archaeal Rrs are located, and the other where the remain¬

ing archaeal Rrs and the nigerythrin from D. vulgaris are allocated. Nigerythrin was

isolated subsequent to the isolation of Rr from D. vulgaris (Pierik et al, 1993; Lump-

pio etal, 1997). Nigerythrin is a slightly larger homodimeric protein with similar iron

sites like Rr, but has a black color ion contrast to the red color of Rr. Another remark¬

able difference is in the Fe4S site, the spacing between the two CysXXCys patterns is

12 amino acids for Rr while it is only 11 amino acids for nigerythrin. This spacing

seems to be conserved, as the proteins from this domain have all 11 amino acids be¬

tween the two CysXXCys motifs. As a result, this group of proteins may be properly

classified as nigerythrins, although as long as the physiological differences between ru¬

brerythrin and nigerythrin are not understood, it is pointless to distinguish between

them. However, in the group of the "real" rubrerythrins, the sequences of the Bacteria

and Archaea are clearly separated. The relation tree implies that rubrerythrins have

evolved as a result of longitudinal gene transfer and may be "ur-proteins" of anaerobic

procaryotes already present before the evolutionary division of the Archaea from Bac¬

teria. Therefore they existed long before the oxygen-respiring organisms developed on

earth (Van Beeumen etal, 1991; Lehmann etal, 1996). It is becoming more and more

obvious that anaerobic microorganisms possess a mechanism for detoxifying reactive

oxygen species that is independent of the classical system of the aerobic world. It it is

also shown, however, that some strict anaerobes such as Bacteroidesfragilis, C per¬

fringens orD. vulgaris possess classical oxygen scavenging enzymes as well. What is

the explanation for this apparent redundancy?

51 Discussion

Cdif

10

Kimura proteinDvul distance

(nigerythrin)

FIG 16 Unrooted phylogenetic tree showing relationships among rubrerythrin

peptide sequences. The sequences were aligned with the program PILEUP, the

Kimura distance matrix was calculated with the program DISTANCES and the tree

was constructed with the Neighbor-joining algorithm of the program GROWTREE

(all programs were from the GCG-package). Aful: Archaeoglobus fulgidus, Bfra:

Bacteroides fragilis, Cjej: Campylobacter jejuni, Chte: Chlorobium tepidum, Cace:

Clostridium acetobutylicum, Cdif: Clostridium difficile, Cper: Clostridium

perfringens, Cthe: Clostridium (Moorella) thermoacetica, Dvul: Desulfovibrio

vulgaris, Fnuc: Fusobacterium nucleatum, Mthe: Methanobacterium

thermoautotrophicum, Mjan: Methanococcus jannaschii, Paby: Pyrococcus abyssi,Pfur: Pyrococcus furiosus, Pgin: Porphyromonas gingivalis, Tmar: Thermotogamaritima. Corresponding accession numbers are listed in Table 1 Chapter 1.

52

4.3 The rubrerythrin gene clusters

As mentioned above, there seems to be a redundancy in some organisms as they

may possess both the traditional and the anaerobic method for detoxifying reactive ox¬

ygen species. What about the rubrerythrins? Archaeoglobusfulgidus has a total of four

rbr-\\ke genes (Table 7)! However, the phylogenetic relationship between these genes

TABLE 7. Organisms that possess more than one rbr-\\ke gene.

Strain Comment

Bacteria

Clostridium difficile Unfinished genome, 2 genes

Desulfovibrio vulgaris 1 rubrerythrin and 1 nigerythrin

Archaea

Archaeoglobusfulgidus Complete genome, 4 genes

Methanobacterium thermoautotrophicum Complete genome, 2 genes

indicates that they are not just duplicated but have evolved by longitudinal gene trans¬

fer. A similar redundancy could be adjudged to the different SODs in aerobic organ¬

isms. It is known that each enzyme has its own defined function and they are regulated

differently (Compan and Touati, 1993; Dubrac and Touati, 2000; Strohmeier Gort et

al, 1999). The same could be proposed for the rubrerythrins. The consideration of the

rbr genes in detail shows that they are members of different combined gene clusters.

To date, only the opérons ofC perfringens (Geissmann etal, 1999) and ofD. vulgaris

(Lumppio et al, 1997) are confirmed experimentally. However, some rbr genes are

clearly adjacent to genes encoding for proteins that are related to oxidative stress re¬

sponse or iron homeostasis, e.-g. superoxide reductases, rubredoxins, ferric uptake reg¬

ulator and ferritin(Table 8).

53 Discussion

TABLE 8. The composition of rubrerythrin gene clusters, dfx: desulfoferrodoxin

(sor), fin: ferritin, fur: ferrie uptake regulator, ngr: nigerythrin, nlr: neelaredoxin

(sor), rbr: rubrerythrin, rdl: rubredoxin-like protein, rub: rubredoxin, sor: superoxidereductase.

Strain gene or gene cluster

C perfringens^ rbr

D. vulgaris fur-rbr-rdl

ngr

Thermotoga maritima rbr-nlr-rub

Archaeoglobusfulgidus ftn-dfx-rbrl-rbrl

rbr3

rbr4

Methanobacterium thermoautotrophicum rbr-dfx

rbr

Methanococcusjannaschii rbr-rub

Pyrococcus abyssi rbr

Pyrococcusfuriosus rbr-rub-sor

a monocistromc operon (Geissmann et al, 1999)b polycistromc operon (Lumppio et al, 1997)

4.4 The physiological function of rubrerythrin

Alban et al. (1998) described a hydrogen peroxide-resistant mutant of the mi-

croaerophilic Spirillum volutans that constitutively expresses a 21.5 kDa protein that

was undetectable and non-inducible in the wild-type cells. The sequenced N-terminal

part showed high similarity to rubrerythrin. However, they have not cloned and se¬

quenced the complete gene encoding for this protein. Due to these results, Coulter et

al. (2000) compared three possible rubrerythrin-catalyzed reactions, namely the fer¬

roxidase, the NADH peroxidase and the aromatic diamine peroxidase reaction. They

found the highest turnover for the NADH peroxidase reaction, and investigations on

the pathway of electron flow revealed a flow of electrons from the FeS4 site over the

diiron center to hydrogen peroxide which is apparently preferred to dioxygen. Both re-

54

suits led to the assumption that rubrerythrin acts as a terminal component of NADH

peroxidase. As the peroxidase activities in vitro are relatively low, it is not evident that

the NADH peroxidase activity represents a general physiological function in vivo. At

this point, it must be mentioned that the experiments were performed with recombinant

but not native rubrerythrin. As shown by Sieker et al. (2000), there are dramatic differ¬

ences in the structure of native and recombinant forms of the metal centres, the dimetal

site of the native Rr consists of one iron and one zinc atom, whereas the recombinant

Rr has a diiron center. These astonishing plasticity of the structure of rubrerythrin may

be a reason for the difficulty in establishing physiological function.

One approach which suggests itself to establish the physiological role is the produc¬

tion and characterization of a mutant. In this study, we report the characterization of a

rubrerythrin mutant that brings up knew knowledge and knew questions as well. The

wild type and rbr strains showed similar growth rates under either anaerobic growth or

moderate oxidative stress conditions. However, hydrogen peroxide in various concen¬

trations significantly reduced the survival rate of the rbr mutant strain. This is similar

to the reported hydrogen peroxide resistance of a Spirillum volutans mutant, which had

an increased NADH peroxidase activity but no increased oxygen tolerance (Alban and

Krieg, 1998). This implies that Rr interacts rather with exogenous H202 than with en¬

dogenous H202 produced by e. g. SOD or SOR reactions.

mRNA analysis revealed some surprising results. While transcription of rbr is not

influenced by dioxygen nor paraquat, hydrogen peroxide repressed the transcription of

the intact rubrerythrin almost completely. Moreover, the truncated rbr gene of TAGl

is not repressed and the transcription is similar to that of the wild type under anaerobic

conditions. The impliation is that rubrerythrin is part of the hydrogen peroxide metab¬

olism and is regulated due its own activity. Possible functions of rubrerythrin are dis¬

cussed below in respect to the following facts:

1. transcription of rbr is down regulated by H202

2. transcription of the truncated rbr is not regulated by H202

3. the mutant strain is more sensitive to H202 than the parent strain

55 Discussion

Peroxidases reduce hydrogen peroxide to water in the presence of an electron donor

R (Eq. 4):

H202 + RH2 -> R + 2H20 (4)

Rubrerythrin would be an ineffective peroxidase as its transcription is downregulat-

ed in the presence of its substrate. Therefore, the physiological role of Rr is unlikely

that of a peroxidase.

The ferroxidase reaction oxidizes ferrous iron and is catalyzed by Rr in vitro

(Bonomi etal, 1996, Eq. 5):

Fe2+ + 02^Fe3++[0]red (5)

where [0]re(j indicates that the product of 02 reduction is unknown (possibly H20).

The repression of rbr could be explained by the fact that in the presence of hydrogen

peroxide the Fenton reaction occurs (Eq. 6):

Fe2+ + H202 -> Fe3+ + OH» +OH" (6)

The Fenton reaction leads to production of hydroxyl radicals which can damage bi¬

ological macromolecules (Beauchamp and Fridovich, 1970; Halliwell and Gutteridge,

1984). As iron homeostasis and oxidative stress are strongly correlated (reviewed in

Touati, 2000), it is obvious that the rbr in the function of a ferroxidase is repressed un¬

der H202 stress, although it is again contradictory that the truncated rbr is not re¬

pressed.

Since in D. vulgaris rbr is cotranscribed with fur, the gene encoding for ferric up¬

take regulator protein (Lumppio et al, 1997), it is suggested that the diiron site in Rr

participates in iron exchange with Fur, thereby modulating the transcriptional regula¬

tory activity of the latter protein, while perhaps serving as a redox sensor via the FeS4

site. The easiness of rubrerythrin to replace zinc by iron or vice versa, respectively

(Sieker et al, 2000), makes rubrerythrin indeed a good candidate for a regulatory pro¬

tein acting together with Fur, since zinc seems to play an important role in Fur in that

not only the stability but also the DNA-binding affinity is zinc dependent (Althaus et

al, 1999). Further investigations in characterization of the rbr mutant are necessary to

discover more about rubrerythrin and possible interactions with other proteins and

genes.

56

OxyR senses hydrogen peroxide by its direct oxidation and formation of a disulfide

bond in E. coli (Zheng et al, 1998). Whereas the PerR, which senses peroxide in Ba¬

cillus subtilis, is probably regulated by a metal-catalyzed oxidation or by a change of

the oxidation of a bound metal ion (Bsat etal, 1998). As Rr is quite distinct from OxyR

or PerR, it could represent a new way for the regulation of the H202 stress response.

In this study we can also present the first discovered gene that is transcriptionally

regulated directly or over a cascade regulatory system by rubrerythrin: it is its own

transcription that is repressed in a hydrogen peroxide rich environment. Transcription¬

al autorepression has been also reported for other regulatory proteins, e. g. OxyR

(Christman et al, 1989; Bölker and Kahmann, 1989) or Fur (De et al, 1988, Chan,

1995 #162). The higher sensitivity to H202 ofthe rbr mutant compared to the wild type

could be caused by deregulation of iron transport as reported consistently for E. coli

(Kammler et al, 1993; Keyer and Imlay, 1996; Touati et al, 1995) and Bacillus sub¬

tilis (Bsat et al, 1998).

4.5 Concluding remarks

The results of the characterization of a rbr mutant presented in this study strongly

promotes the hypothesis that rubrerythrin could act as a hydrogen peroxide sensor, and

regulates either directly or over a cascade of regulatory proteins the transcription of its

own and maybe other proteins connected to the defense system against oxidative

stress. The occurrence of rubrerythrin in anaerobic Archaea and Bacteria, implies that

this protein could be an "ur-protein" which existed long before the oxygen-respiring

organisms developed on earth. The availability of a rbr mutant enables further inves¬

tigations on the function of this unusual metalloprotein.

References

Ahern, H., and R. P. Cunningham. 1995. Genetic regulation of antioxidant defenses

in Escherichia coli and Salmonella typhimurium, p. 435-446. In S. Ahmad (ed.),

Oxidative stress and antioxidant defenses in biology. Chapman and Hall, New

York, N. Y.

Alban, P. S., and N. R. Krieg. 1998. A hydrogen peroxide resistant mutant of Spiril¬

lum volutans has NADH peroxidase activity but no increased oxygen tolerance.

Can. J. Microbiol. 44:87-91.

Alban, P. S., D. L. Popham, K. E. Rippere, and N. R. Krieg. 1998. Identification of

a gene for a rubrerythrin/nigerythrin-like protein in Spirillum volutans by using

amino acid sequence data from mass spectrometry and NH2-terminal sequencing. J.

Appl. Microbiol. 85:875-882.

Althaus, E. W., C. E. Outten, K. E. Olson, H. Cao, and T. V. O'Halloran. 1999

The ferric uptake regulation (Fur) repressor is a zinc metalloprotein. Biochemistry

38:6559-6569.

Altuvia, S., M. Almiron, G. Huisman, R. Kolter, and G. Storz. 1994. The dps pro¬

moter is activated by OxyR during growth and by IHF and Gs in stationary phase.

Mol. Microbiol. 13:265-272.

Bannam, T. L., and J. I. Rood. 1993. Clostridium perfringens-Escherichia coli shut¬

tle vectors that carry single antibiotic resistance determinants. Plasmid 229:233-

235.

Beauchamp, C, and I. Fridovich. 1970. A mechanism for the production of ethylene

from methional. The generation ofthe hydroxyl radical by xanthine oxidase. J. Bac-

teriol. 245:4641-4646.

Beauchamp, C, and I. Fridovich. 1971. Superoxide dismutase: improved assays and

an assay applicable to acrylamide gels. Anal. Biochem. 44:276-287.

5

58

Blake, P. R., J. B. Park, F. O. Bryant, S. Aono, J. K. Magnuson, E. Eccleston, J.

B. Howard, M. F. Summers, and M. W. Adams. 1991. Determinants of protein

hyperthermostability: purification and amino acid sequence of rubredoxin from the

hyperthermophilic archaebacterium Pyrococcusfuriosus and secondary structure of

the zinc adductby NMR. Biochemistry 30:10885-10895.

Blattner, F. R., G. Plunkett, 3rd, C. A. Bloch, N. T. Perna, V. Burland, M. Riley,

J. Collado-Vides, J. D. Glasner, C. K. Rode, G. F. Mayhew, J. Gregor, N. W.

Davis, H. A. Kirkpatrick, M. A. Goeden, D. J. Rose, B. Mau, and Y. Shao. 1997

The complete genome sequence of Escherichia coli K-12. Science 277:1453-1474.

Bölker, M., and R. Kahmann. 1989. The Escherichia coli regulatory protein OxyR

discriminates between methylated and unmethylated states of the phage Mu mom

promoter. EMBO J. 8:2403-2410.

Bonomi, F., D. M. Kurtz, Jr., and X. Y. Cui. 1996. Ferroxidase activity of recombi¬

nant Desulfovibrio vulgaris rubrerythrin. J. Biol. Inorg. Chem. 1:67-72.

Braun, V. 1997. Avoidance of iron toxicity through regulation of bacterial iron trans¬

port. Biol. Chem. 378:779-786.

Brehm, K., A. Haas, W. Goebel, and J. Kreft. 1992. A gene encoding a superoxide

dismutase of the facultative intracellular bacterium Listeria monocytogenes. Gene

118:121-125.

Brumlik, M. J., and G. Voordouw. 1989. Analysis of the transcriptional unit encod¬

ing the genes for rubredoxin (rub) and a putative rubredoxin oxidoreductase (rbo)

in Desulfovibrio vulgaris Hildenborough. J. Bacteriol. 171:4996-5004.

Bsat, N., A. Herbig, L. Casillas-Martinez, P. Setlow, and J. D. Helmann. 1998. Ba¬

cillus subtilis contains multiple Fur homologues: identification of the iron uptake

(Fur) and peroxide regulon (PerR) repressors. Mol. Microbiol. 29:189-198.

Bullock, W. O., J. M. Fernandez, and J. M. Short. 1987 XL 1-Blue: a high efficien¬

cy plasmid transforming recA Escherichia coli strain with beta-galactoside selec¬

tion. BioTechniques 4:376-379.

59 References

Bult, C. J., O. White, G. J. Olsen, L. Zhou, R. D. Fleischmann, G. G. Sutton, J. A.

Blake, L. M. FitzGerald, R. A. Clayton, J. D. Gocayne, A. R. Kerlavage, B. A.

Dougherty, J. F. Tomb, M. D. Adams, C. I. Reich, R. Overbeek, E. F. Kirkness,

K. G. Weinstock, J. M. Merrick, A. Glodek, J. L. Scott, N. S. M. Geoghagen,

and J. C. Venter. 1996. Complete genome sequence ofthe methanogenic archaeon,

Methanococcusjannaschii. Science 273:1058-1073.

Carlioz, A., and D. Touati. 1986. Isolation of superoxide dismutase mutants in Es¬

cherichia coli: Is superoxide dismutase necessary for aerobic life? EMBO J. 5:623-

630.

Chen, C.-K, C. M. Boucle, and H. P. Blaschek. 1996. Factors involved in the trans¬

formation of previously non-transfomable Clostridium perfringens type B. FEMS

Microbiol. Lett. 140:185-191.

Chen, L., P. Sharma, J. Le Gall, A. M. Mariano, M. Teixeira, and A. V. Xavier.

1994. A blue non-heme iron protein from Desulfovibrio gigas. Eur. J. Biochem.

226:613-618.

Christman, M. F., R. W. Morgan, F. S. Jacobson, and B. N. Ames. 1985 Positive

control of a regulon for defenses against oxidative stress and some heat-shock pro¬

teins in Salmonella typhimurium. Cell 41:753-762.

Christman, M. F., G. Storz, and B. N. Ames. 1989. OxyR, a positive regulator of hy¬

drogen peroxide-inducible genes in Escherichia coli and Salmonella typhimurium,

is homologous to a family of bacterial regulatory proteins. Proc. Natl. Acad. Sei.

USA 86:3484-3488.

Church, G. M., and W. Gilbert. 1984. Genomic sequencing. Proc. Natl. Acad. Sei.

USA 81:1991-1995.

Clements, M. O., S. P. Watson, and S. J. Foster. 1999. Characterization ofthe major

superoxide dismutase of Staphylococcus aureus and its role in starvation survival,

stress resistance, and pathogenicity. J. Bacteriol. 181:3898-3903.

Coelho, A. V., P. Matias, V. Fülöp, A. Thompson, A. Gonzalez, and M. A. Carron-

do. 1997. Desulfoferrodoxin structure determined by MAD phasing and refinement

to 1.9-Â resolution reveals a unique combination of a tetrahedral FeS4 centre with

a square pyramidal FeSN4 centre. J. Bioinorg. Chem. 2:680-689.

60

Compan, L, and D. Touati. 1993. Interaction of six global transcription regulators in

expression of manganese superoxide dismutase in Escherichia coli K-12. J. Bacte-

riol. 175:1687-1696.

Coulter, E. D., N. V. Shenvi, Z. M. Beharry, J. J. Smith, B. C. Prickril, and D. M.

Kurtz, Jr. 2000. Rubrerythrin-catalyzed substrate oxidation by dioxygen and hy¬

drogen peroxide. Inorg. Chim. Acta 297:231-241.

Coulter, E. D., N. V. Shenvi, and D. M. Kurtz, Jr. 1999 NADH peroxidase activity

of rubrerythrin. Biochem. Biophys. Res. Commun. 255:317-323.

Das, A., and L. G. Ljungdahl. 1999. Moorella thermoacetica rubrerythrin gene, com¬

plete cds, EMBL/GenBank direct submission. Accession number AF202316.

Dave, B. C, R. S. Czernuszewicz, B. C. Prickril, and D. M. Kurtz, Jr. 1994. Reso¬

nance Raman spectroscopic evidence for the FeS4 and Fe-O-Fe sites in rubrerythrin

from Desulfovibrio vulgaris. Biochemistry 33:3572-3576.

De, L. V., M. Herrero, F. Giovannini, and J. B. Neilands. 1988. Fur (ferric uptake

regulation) protein and CAP (catabolite-activator protein) modulate transcription of

fur gene in Escherichia coli. Eur. J. Biochem. 173:537-546.

deMaré, F., D. M. Kurtz, Jr., and P. Nordlund. 1996. The structure ofDesulfovibrio

vulgaris rubrerythrin reveals a unique combination of rubredoxin-like FeS4 and fer-

ritin-like diiron domains. Nature Struct. Biol. 3:539-546.

deMaré, F., P. Nordlund, N. Gupta, N. V. Shenvi, X. Y. Cui, and D. M. Kurtz, Jr.

1997. Re-engineering the diiron site in rubrerythrin towards that in ribonucleotide

reductase. Inorg. Chim. Acta 263:255-262.

Dos Santos, W. G., I. Pacheco, M. Y. Liu, M. Teixeira, A. V. Xavier, and J. LeGall.

2000. Purification and characterization of an iron superoxide dismutase and a cata¬

lase from the sulfate-reducing bacterium Desulfovibrio gigas. J. Bacteriol. 182:796-

804.

Dubrac, S., and D. Touati. 2000. Fur positive regulation ofiron superoxide dismutase

in Escherichia coli: functional analysis of the sodB promoter. J. Bacteriol.

182:3802-3808.

61 References

Farr, S. B., and T. Kogoma. 1991. Oxidative stress responses in Escherichia coli and

Salmonella typhimurium. Microbiol. Rev. 55:561-585.

Fawcett, W. P., and R. E. Wolf, Jr. 1994. Purification of a MalE-SoxS fusion protein

and identification of the control sites of Escherichia coli superoxide-inducible

genes. Mol. Microbiol. 14:669-679.

Feinberg, A. P., and B. Vogelstein. 1983. A technique for radiolabelling DNA restric¬

tion endonuclease fragments to high specific activity. Anal. Biochem. 132:6-13.

Fraser, C. M., S. J. Norris, G. M. Weinstock, O. White, G. G. Sutton, R. Dodson,

M. Gwinn, E. K. Hickey, R. Clayton, K. A. Ketchum, E. Sodergren, J. M.

Hardham, M. P. McLeod, S. Salzberg, J. Peterson, H. Khalak, D. Richardson,

J. K. Howell, M. Chidambaram, T. Utterback, L. McDonald, P. Artiach, C.

Bowman, M. D. Cotton, C. Fujii, S. A. Garland, B. Hatch, K. Horst, K. Rob¬

erts, L. Watthey, J. Weidman, H. O. Smith, and J. C. Venter. 1998. Complete

genome sequence of Treponema pallidum, the syphilis spirochete. Science

281:375-388.

Gaudu, P., S. Dubrac, and D. Touati. 2000. Activation of SoxR by overproduction

of desulfoferrodoxin: multiple ways to induce the soxRS regulon. J. Bacteriol.

182:1761-1763.

Geissdörfer, W., A. Ratajczak, and W. Hillen. 1997. Nucleotide sequence of a pu¬

tative periplasmic Mn superoxide dismutase from Acinetobacter calcoaceticus

ADP1. Gene 186:305-308.

Geissmann, T. A., M. Teuber, and L. Meile. 1999. Transcriptional analysis ofthe ru¬

brerythrin and superoxide dismutase genes of Clostridium perfringens. J. Bacteriol.

181:7136-7139.

Gennity, J., J. Goldstein, and M. Inouye. 1990. Signal peptide mutants of Escheri¬

chia coli. J. Bioenerg. Biomembr. 22:233-269.

Gmiir, R., and B. Guggenheim. 1983. Antigenic heterogeneity ofBacteroides inter¬

medin as recognized by monoclonal anitbodies. Infect. Immun. 42:459-470.

Goda, S. K., and N. P. Minton. 1995. A simple procedure for gel electrophoresis and

Northern blotting of RNA. Nucleic Acids Res. 23:3357-3358.

62

Grant, K. A., and S. F. Park. 1995. Molecular characterization of katA from Campy¬

lobacterjejuni and generation of a catalase-deficient mutant of Campylobacter coli

by interspecific allelic exchange. Microbiol. 141:1369-1376.

Greenberg, J. T., P. Monach, J. H. Chou, P. D. Josephy, and B. Demple. 1990. Pos¬

itive control of a global antioxidant defense regulon activated by superoxide-gener-

ating agents in Escherichia coli. Proc. Natl. Acad. Sei. USA 87:6181-6185.

Guex, N., A. Diemand, and M. C. Peitsch. 1999. Protein modelling for all. Trends

Biochem. Sei. 24:364-367.

Gupta, N., F. Bonomi, D. M. Kurtz, Jr., N. Ravi, D. L. Wang, and B. H. Huynh.

1995. Recombinant Desulfovibrio vulgaris rubrerythrin: isolation and characteriza¬

tion of the diiron domain. Biochemistry 34:3310-3318.

Halliwell, B., and J. M. Gutteridge. 1984. Oxygen toxicity, oxygen radicals, transi¬

tion metals and disease. Biochem. J. 219:1-14.

Hansen, T. A. 1994. Metabolism of sulfate-reducing prokaryotes. Antonie Van Leeu-

wenhoek 66:165-185.

Harrison, P. M., P. D. Hempstead, P. J. Artymiuk, and S. C. Andrews. 1998. Struc¬

ture-function relationships in the ferritins. Metal Ions Biol. Syst. 35:435-477.

Heilig, R. 1999. Pyrococcus abyssi complete genome, EMBL/GenBank direct submis¬

sion. Accession number AL096836.

Hidalgo, E., and B. Demple. 1994. An iron-sulfur center essential for transcriptional

activation by the redox-sensing SoxR protein. EMBO J. 13:138-146.

Inaoka, T., Y. Matsumura, and T. Tsuchido. 1998. Molecular cloning and nucle¬

otide sequence of the superoxide dismutase gene and characterization of its product

from Bacillus subtilis. J. Bacteriol. 180:3697-3703.

Jacquamet, L., D. Aberdam, A. Adrait, J. L. Hazemann, J. M. Latour, and I.

Michaud-Soret. 1998. X-ray absorption spectroscopy of a new zinc site in the Fur

protein from Escherichia coli. Biochemistry 37:2564-2571.

63 References

Jamieson, D. J., and G. Storz. 1997. Transcriptional regulators of oxidative stress re¬

sponses, p. 91-115. In J. G. Scandalios (ed.), Oxidative stress and the molecular bi¬

ology of antioxidant defenses. Cold Spring Harbor Laboratory, Cold Spring Harbor,

N. Y.

Jenney, F. E., Jr., M. F. Verhagen, X. Cui, and M. W. Adams. 1999 Anaerobic mi¬

crobes: oxygen detoxification without superoxide dismutase. Science 286:306-309.

Kammler, M., C. Schon, and K. Hantke. 1993. Characterization of the ferrous iron

uptake system of Escherichia coli. J. Bacteriol. 175:6212-6219.

Kawarabayasi, Y., M. Sawada, H. Horikawa, Y. Haikawa, Y. Hino, S. Yamamoto,

M. Sekine, S. Baba, H. Kosugi, A. Hosoyama, Y. Nagai, M. Sakai, K. Ogura, R.

Otsuka, H. Nakazawa, M. Takamiya, Y. Ohfuku, T. Funahashi, T. Tanaka, Y.

Kudoh, J. Yamazaki, N. Kushida, A. Oguchi, K. Aoki, and H. Kikuchi. 1998.

Complete sequence and gene organization of the genome of a hyper-thermophilic

archaebacterium, Pyrococcus horikoshii OT3. DNA Res. 5:55-76.

Keyer, K., and J. A. Imlay. 1996. Superoxide accelerates DNA damage by elevating

free-iron levels. Proc. Natl. Acad. Sei. USA 93:13635-13640.

Kim, A. Y., and H. P. Blaschek. 1989. Construction of an Escherichia coli and

Clostridium perfringens shuttle vector and plasmid transformation of Clostridium

perfringens. Appl. Environ. Microbiol. 55:360-365.

King, K. Y., J. A. Horenstein, and M. G. Caparon. 2000. Aerotolerance and perox¬

ide resistance in peroxidase and PerR mutants ofStreptococcus pyogenes. J. Bacte¬

riol. 182:5290-5299.

Kitamura, M., S. Kojiam, H. Akutsu, I. Kumagai, and T. Nakaya. 1998. Des¬

ulfovibrio vulgaris genes for catalase and hypothetical transmembrane protein, par¬

tial and complete eds, EMBL/GenBank direct submission. Accession number

AB020341.

Klenk, H. P., R. A. Clayton, J. F. Tomb, O. White, K. E. Nelson, K. A. Ketchum,

R. J. Dodson, M. Gwinn, E. K. Hickey, J. D. Peterson, D. L. Richardson, A. R.

Kerlavage, D. E. Graham, N. C. Kyrpides, R. D. Fleischmann, J. Quacken-

bush, N. H. Lee, G. G. Sutton, S. Gill, E. F. Kirkness, B. A. Dougherty, K. McK-

enney, M. D. Adams, B. Loftus, S. Peterson, C. I. Reich, L. K. McNeil, J. H.

64

Badger, A. Glodek, L. Zhou, R. Overbeek, J. D. Gocayne, J. F. Weidman, L.

McDonald, T. Utterback, M. D. Cotton, T. Spriggs, P. Artiach, B. P. Kaine, S.

M. Sykes, P. W. Sadow, K. P. D'Andrea, C. Bowman, C. Fujii, S. A. Garland,

T. M. Mason, G. J. Olsen, C. M. Fraser, H. O. Smith, C. R. Woese, and J. C.

Venter. 1997. The complete genome sequence of the hyperthermophilic, sulphate-

reducing archaeon Archaeoglobusfulgidus. Nature 390:364-370.

Kolibachuk, D. J., and D. E. Dennis. 1998. Chromobacterium violaceum genomic

fragment containing orfD (soxRImerR homolog), EMBL/GenBank direct submis¬

sion. Accession number AF061445.

Lay, K.-N., and E. M. Gregory. 1992. Bacteroidesfragilis iron (Fe) superoxide dis¬

mutase (sod) gene, complete cds, EMBL/GenBank direct submission. Accession

number M96560.

LeGall, J., B. C. Prickril, I. Moura, A. V. Xavier, J. J. G. Moura, and B. H. Huynh.

1988. Isolation and characterization of rubrerythrin, a non-heme iron protein from

Desulfovibrio vulgaris that contains rubredoxin centers and a hemerythrin-like bi-

nuclear iron cluster. Biochemistry 27:1636-1642.

Lehmann, Y., L. Meile, and M. Teuber. 1996. Rubrerythrin from Clostridium per¬

fringens: Cloning of the gene, purification of the protein, and characterization of its

superoxide dismutase function. J. Bacteriol. 178:7152-7158.

Liao, X., I. Charlebois, C. Ouellet, M. J. Morency, K. Dewar, J. Lightfoot, J. Fos¬

ter, R. Siehnel, H. Schweizer, J. S. Lam, R. E. Hancock, and R. C. Levesque.

1996. Physical mapping of 32 genetic markers on the Pseudomonas aeruginosa

PAOl chromosome. Microbiol. 142:79-86.

Lindqvist, Y., W. Huang, G. Schneider, and J. Shanklin. 1996. Crystal structure of

A -stearoyl-acyl carrier protein desaturase from castor seed and its relationship to

other di-iron proteins. EMBO J. 15:4081-4092.

Liochev, S. L, L. Benov, D. Touati, and I. Fridovich. 1999. Induction of the soxRS

regulon of Escherichia coli by superoxide. J. Biol. Chem. 274:9479-9481.

Liochev, S. L, and I. Fridovich. 1992. Fumarase C, the stable fumarase of Escheri¬

chia coli, is controlled by the soxRS regulon. Proc. Natl. Acad. Sei. USA 89:5892-

5896.

65 References

Liochev, S. L, and I. Fridovich. 1997. A mechanism for complementation ofthe sodA

sodB defect in Escherichia coli by overproduction ofthe rbo gene product (desulfo-

ferrodoxin) from Desulfoarculus baarsii. J. Biol. Chem. 272:25573-25575.

Lombard, M., M. Fontecave, D. Touati, and V. Nivière. 2000a. Reaction ofthe des-

ulfoferrodoxin from Desulfoarculus baarsii with superoxide anion. Evidence for a

superoxide reductase activity. J. Biol. Chem. 275:115-121.

Lombard, M., D. Touati, M. Fontecave, and V. Nivière. 2000b. Superoxide reduc¬

tase as a unique defense system against superoxide stress in the microaerophile Tre¬

ponema pallidum. J. Biol. Chem. in press:http://www.jbc.org/cgi/reprint/

M004201200v004201201 .pdf.

Lumppio, H. L., N. V. Shenvi, R. P. Garg, A. O. Summers, and D. M. Kurtz, Jr.

1997. A rubrerythrin operon and nigerythrin gene in Desulfovibrio vulgaris

(Hildenborough). J. Bacteriol. 179:4607-4615.

Ma, K., and M. W. Adams. 1999. A hyperactive NAD(P)H:rubredoxin oxidoreduc-

tase from the hyperthermophilic archaeon Pyrococcus furiosus. J. Bacteriol.

181:5530-5533.

Mahony, D. E., and T. I. Moore. 1976. Stable L-forms of Clostridium perfringens

and their growth on glass surfaces. Can. J. Microbiol. 22:953-959.

Marklund, S., and G. Marklund. 1974. Involvement of the superoxide anion radical

in the autoxidation of pyrogallol and a convenient assay for superoxide dismutase.

Eur. J. Biochem. 47:469-474.

Meile, L., K. Fischer, and T. Leisinger. 1995. Characterization ofthe superoxide dis¬

mutase gene and its upstream region from Methanobacterium thermoautotrophi¬

cum Marburg. FEMS Microbiol. Lett. 128:247-253.

Michân, C, M. Manchado, G. Dorado, and C. Pueyo. 1999. In vivo transcription of

the Escherichia coli oxyR regulon as a function of growth phase and in response to

oxidative stress. J. Bacteriol. 181:2759-2764.

Miller, J. H. 1972. Experiments in molecular genetics. Cold Spring Harbor Laborato¬

ry, Cold Spring Harbor, NY.

66

Mito, S., Q. M. Zhang, and S. Yonei. 1993. Isolation and characterization of Escher¬

ichia coli strains containing new gene fusions (soiv.lacZ) inducible by superoxide

radicals. J. Bacteriol. 175:2645-2651.

Moura, L, P. Tavares, J. J. Moura, N. Ravi, B. H. Huynh, M. Y. Liu, and J. Le-

Gall. 1990. Purification and characterization of desulfoferrodoxin. A novel protein

from Desulfovibrio desulfuricans (ATCC 2111A) and from Desulfovibrio vulgaris

(strain Hildenborough) that contains a distorted rubredoxin center and a mononu¬

clear ferrous center. J. Biol. Chem. 265:21596-21602.

Nakayama, K. 1990. The superoxide dismutase-encoding gene of the obligately

anaerobic bacterium Bacteroides gingivalis. Gene 96:149-150.

Nelson, K. E., R. A. Clayton, S. R. Gill, M. L. Gwinn, R. J. Dodson, D. H. Haft, E.

K. Hickey, J. D. Peterson, W. C. Nelson, K. A. Ketchum, L. McDonald, T. R.

Utterback, J. A. Malek, K. D. Linher, M. M. Garrett, A. M. Stewart, M. D. Cot¬

ton, M. S. Pratt, C. A. Phillips, D. Richardson, J. Heidelberg, G. G. Sutton, R.

D. Fleischmann, J. A. Eisen, O. White, S. L. Salzberg, H. O. Smith, J. C. Ven¬

ter, and C. M. Fraser. 1999. Evidence for lateral gene transfer between archaea

and bacteria from genome sequence of Thermotoga maritima. Nature 399:323-329.

Nielsen, H., J. Engelbrecht, S. Brunak, and G. von Heijne. 1997. Identification of

prokaryotic and eukaryotic signal peptides and prediction of their cleavage sites.

Protein Eng. 10:1-6.

Nordlund, P., and H. Eklund. 1993. Structure and function of the Escherichia coli

ribonucleotide reductase protein R2. J. Mol. Biol. 231.

Nunoshiba, T., T. deRojas-Walker, J. S. Wishnok, S. R. Tannenbaum, and B.

Demple. 1993. Activation by nitric oxide of an oxidative-stress response that de¬

fends Escherichia coli against activated macrophages. Proc. Natl. Acad. Sei. USA

90:9993-9997.

Nunoshiba, T., E. Hidalgo, C. F. A. Cuevas, and B. Demple. 1992. Two-stage con¬

trol of an oxidative stress regulon: The Escherichia coli SoxR protein triggers re¬

dox-inducible expression of the soxS regulatory gene. J. Bacteriol. 174:6054-6060.

Nussli, O. 1999. Diplomarbeit. Labor für Lebensmittel-Mikrobiologie, ETH Zürich.

67 References

Oelmueller, U., N. Krueger, A. Steinbuechel, and C. G. Friedrich. 1990. Isolation

of prokaryotic RNA and detection of specific messenger RNA with biotinylated

probes. J. Microbiol. Methods 11:73-81.

Parkhill, J., B. W. Wren, K. Mungall, J. M. Ketley, C. Churcher, D. Basham, T.

Chillingworth, R. M. Davies, T. Feltwell, S. Holroyd, K. Jagels, A. V. Karly-

shev, S. Moule, M. J. Pallen, C. W. Penn, M. A. Quail, M. A. Raj andrearn, K.

M. Rutherford, A. H. van Vliet, S. Whitehead, and B. G. Barrell. 2000 The ge¬

nome sequence of the food-borne pathogen Campylobacter jejuni reveals hyper-

variable sequences. Nature 403:665-668.

Perreten, V., N. Giampa, U. Schuler-Schmid, and M. Teuber. 1998. Antibiotic re¬

sistance genes in coagulase-negative staphylococci isolated from food. Syst. Appl.

Microbiol. 21:113-120.

Pianzzola, M. J., M. Soubes, and D. Touati. 1996. Overproduction of the rbo gene

product from Desulfovibrio species suppresses all deleterious effects of lack of su¬

peroxide dismutase in Escherichia coli. J. Bacteriol. 178:6736-6742.

Pierik, A. J., R. B. G. Wolbert, G. L. Portier, M. F. J. M. Verhagen, and W. R.

Hagen. 1993. Nigerythrin and rubrerythrin from Desulfovibrio vulgaris each con¬

tain two mononuclear iron centers and two dinuclear iron clusters. Eur. J. Biochem.

212:237-245.

Prickril, B. C, D. M. Kurtz, Jr., and J. LeGall. 1991. Cloning and sequencing ofthe

gene for rubrerythrin from Desulfovibrio vulgaris (Hildenborough). Biochemistry

30:11118-11123.

Purdy, D., and S. F. Park. 1994. Cloning, nucleotide sequence and characterization

of a gene encoding superoxide dismutase from Campylobacterjejuni and Campy¬

lobacter coli. Microbiol. 140:1203-1208.

Ravi, N., B. C. Prickril, D. M. Kurtz, Jr., and B. H. Huynh. 1993 Spectroscopic

en

characterization of Fe-reconstituted rubrerythrin, a non-heme iron protein with

structural analogies to ribonucleotide reductase. Biochemistry 32:8487-8491.

Rocha, E. R., T. Selby, J. P. Coleman, and C. J. Smith. 1996. Oxidative stress re¬

sponse in an anaerobe, Bacteroidesfragilis: a role for catalase in protection against

hydrogen peroxide. J. Bacteriol. 178:6895-6903.

68

Rocha, E. R., and C. J. Smith. 1997. Regulation ofBacteroidesfragilis katB mRNA

by oxidative stress and carbon limitation. J. Bacteriol. 179:7033-7039.

Rocha, E. R., and C. J. Smith. 1998. Characterization of a peroxide-resistant mutant

of the anaerobic bacterium Bacteroidesfragilis. J. Bacteriol. 180:5906-5912.

Rocha, E. R., and C. J. Smith. 1999. Role of the alkyl hydroperoxide reductase (ah-

pCF) gene in oxidative stress defense of the obligate anaerobe Bacteroidesfragilis.

J. Bacteriol. 181:5701-5710.

Româo, C. V., M. Y. Liu, J. Le Gall, C. M. Gomes, V. Braga, I. Pacheco, A. V.

Xavier, and M. Teixeira. 1999. The superoxide dismutase activity of desulfoferro-

doxin from Desulfovibrio desulfuricans ATCC 2111A. Eur. J. Biochem. 261:438-

443.

Rosenzweig, A. C, C. A. Frederick, S. J. Lippard, and P. Nordlund. 1993. Crystal

structure of a bacterial non-haem iron hydroxylase that catalyses the biological ox¬

idation of methane. Nature 366:537-543.

Rosenzweig, A. C, P. Nordlund, P. M. Takahara, C. A. Frederick, and S. J. Lip¬

pard. 1995. Geometry of the soluble methane monooxygenase catalytic diiron cen¬

ter in two oxidation states. Chem. Biol. 2:409-418.

Roulet, I. 1998. Semesterarbeit. Labor für Lebensmittel-Mikrobiologie, ETH Zürich.

Sambrook, J., E. F. Fritsch, and T. Maniatis. 1989. Molecular cloning: a laboratory

manual, 2nd ed. Cold Spring Harbor Laboratory, Cold Spring Harbor, N.Y.

Sayle, R., and E. J. Milner-White. 1995. RasMol: Biomolecular graphics for all.

Trends Biochem. Sei. 20:374-376.

Shanklin, J., E. Whittle, and B. G. Fox. 1994. Eight histidine residues are catalyti-

cally essential in a membrane-associated iron enzyme, stearoyl-CoA desaturase,

and are conserved in alkane hydroxylase and xylene monooxygenase. Biochemistry

33:12787-12794.

Shenvi, N. V., and D. M. Kurtz Jr. 1997. Desulfovibrio vulgaris superoxide dismu¬

tase (sod) gene, complete eds, EMBL/GenBank direct submission. Accession num¬

ber AF034841.

69 References

Sieker, L. C, M. Holmes, I. Le Trong, S. Turley, M. Y. Liu, J. LeGall, and R. E.

Stenkamp. 2000. The 1.9 Â crystal structure of the "as isolated" rubrerythrin from

Desulfovibrio vulgaris: some surprising results. J. Biol. Inorg. Chem. 5:505-513.

Sieker, L. C, M. Holmes, I. Le Trong, S. Turley, B. D. Santarsiero, M. Y. Liu, J.

LeGall, and R. E. Stenkamp. 1999. Alternative metal-binding sites in rubreryth¬

rin. Nature Struct. Biol. 6:308-309.

Silva, G., S. Oliveira, C. M. Gomes, I. Pacheco, M. Y. Liu, A. V. Xavier, M. Teix-

eira, J. LeGall, and C. Rodrigues Pousada. 1999. Desulfovibrio gigas neelare-

doxin - a novel superoxide dismutase integrated in a putative oxygen sensory

operon of an anaerobe. Eur. J. Biochem. 259:235-243.

Smith, D. R., L. A. Doucette-Stamm, C. Deloughery, H. Lee, J. Dubois, T. Al-

dredge, R. Bashirzadeh, D. Blakely, R. Cook, K. Gilbert, D. Harrison, L. Ho-

ang, P. Keagle, W. Lumm, B. Pothier, D. Qiu, R. Spadafora, R. Vicaire, Y.

Wang, J. Wierzbowski, R. Gibson, N. Jiwani, A. Caruso, D. Bush, H. Safer, D.

Patwell, S. Prabhakar, S. McDougall, G. Shimer, A. Goyal, S. Pietrokovski, G.

M. Church, C. J. Daniels, J.-L Mao, P. Rice, J. Nölling, and J. N. Reeve. 1997

Complete genome sequence ofMethanobacterium thermoautotrophicum AH: func¬

tional analysis and comparative genomics. J. Bacteriol. 179:7135-7155.

Storz, G., and J. A. Imlay. 1999. Oxidative stress. Curr. Opin. Microbiol. 2:188-194.

Storz, G., L. A. Tartaglia, and B. N. Ames. 1990. Transcriptional regulator of oxida¬

tive stress-inducible genes: direct activation by oxidation. Science 248:189-194.

Strohmeier Gort, A., D. M. Ferber, and J. A. Imlay. 1999. The regulation and role

of the periplasmic copper, zinc superoxide dismutase ofEscherichia coli. Mol. Mi¬

crobiol. 32:179-191.

Takao, M., A. Oikawa, and A. Yasui. 1990. Characterization of a superoxide dismu¬

tase gene from the archaebacterium Methanobacterium thermoautotrophicum.

Arch. Biochem. Biophys. 283:210-216.

Takeda, Y., and H. Avila. 1986. Structure and gene expression ofthe Escherichia coli

Mn-superoxide dismutase gene. Nucleic Acids Res. 14:4577-4589.

70

Tardât, B., and D. Touati. 1991. Two global regulators repress the anaerobic expres¬

sion ofMnSOD in Escherichia coli: Fur (ferric uptake regulation) and Arc (aerobic

respiration control). Mol. Microbiol. 5:455-465.

Tardât, B., and D. Touati. 1993. Iron and oxygen regulation of Escherichia coli Mn¬

SOD expression: competition between the global regulators Fur and ArcA for bind¬

ing to DNA. Mol. Microbiol. 9:53-63.

Theil, E. C. 1987. Ferritin: structure, gene regulation, and cellular function in animals,

plants, and microorganisms. Annu. Rev. Biochem. 56:289-315.

Touati, D. 1988. Transcriptional and posttranscriptional regulation of manganese su¬

peroxide dismutase biosynthesis in Escherichia coli, studied with operon and pro¬

tein fusions. J. Bacteriol. 170:2511-2520.

Touati, D. 1997. Superoxide dismutases in bacteria and pathogen protists, p. 447-493.

In J. G. Scandalios (ed.), Oxidative stress and the molecular biology of antioxidant

defenses. Cold Spring Harbor Laboratory, Cold Spring Harbor, N. Y.

Touati, D. 2000. Iron and oxidative stress in bacteria. Arch. Biochem. Biophys. 373:1-

6.

Touati, D., M. Jacques, B. Tardât, L. Bouchard, and S. Despied. 1995. Lethal ox¬

idative damage and mutagenesis are generated by iron in Afur mutants of Escheri¬

chia coli: protective role of superoxide dismutase. J. Bacteriol. 177:2305-2314.

Tripod, I. 1998. Diplomarbeit. Labor für Lebensmittel-Mikrobiologie, ETH Zürich.

Tsaneva, I. R., and B. Weiss. 1990. SoxR, a locus governing a superoxide response

regulon in Escherichia coli K-12. J. Bacteriol. 172:4197-4205.

Van Beeumen, J. J., G. Van Driessche, M. Y. Liu, and J. LeGall. 1991. The primary

structure of rubrerythrin, a protein with inorganic pyrophosphatase activity from

Desulfovibrio vulgaris: Comparison with hemerythrin and rubredoxin. J. Biol.

Chem. 266:20645-20653.

von Heijne, G. 1986. A new method for predicting signal sequence cleavage sites. Nu¬

cleic Acids Res. 14:4683-4690.

von Heijne, G. 1990. The signal peptide. J. Membr. Biol. 115:195-201.

71 References

von Meyenburg, C. 1998. Diplomarbeit. Labor für Lebensmittel-Mikrobiologie, ETH

Zürich.

Wang, R. F., W. W. Cao, W. Franklin, W. Campbell, and C. E. Cerniglia. 1994

A 16S rDNA-based PCR method for rapid and specific detection of Clostridium

perfringens in food. Mol. Cell Probes 8:131-137.

Yanisch-Perron, C, J. Vieira, and J. Messing. 1985. Improved Ml3 phage cloning

vectors and host strains: nucleotide sequences ofthe M13mpl8 and pUC18 vectors.

Gene 33:103-119.

Yeh, A. P., Y. Hu, F. E. Jenney, Jr., M. W. Adams, and D. C. Rees. 2000 Structures

of the superoxide reductase from Pyrococcusfuriosus in the oxidized and reduced

states. Biochemistry 39:2499-2508.

Zheng, M., F. Aslund, and G. Storz. 1998. Activation of the OxyR transcription fac¬

tor by reversible disulfide bond formation. Science 279:1718-1721.

Zheng, M., B. Doan, T. D. Schneider, and G. Storz. 1999 OxyR and SoxRS regu¬

lation offiir. J. Bacteriol. 181:4639-4643.

Acknowledgments

/ thankMichael Teuber andLeo Meilefor their supervision and support ofthis thesis,

andDaniele Touatifor her kind acceptance to co-examine this thesis.

I thankDavidE. Mahonyforproviding C perfringens strain 13 andJulian I. Roodfor

providing the plasmidspJIR750 andpJIR751.

Thanks to all co-workers in the Laboratory ofFoodMicrobiologyfor all their help and

for having contributed to a pleasant atmosphere.

This work was supported by grant 0-20-219-96from ETH Zurich.

Curriculum Vitae

Born December 9, 1970 in Zurich, Switzerland

1977-1986 Primary education in Reinach and Sissach

1986-1990 Secondary education in Liestal

1990 Matura Type C

1991-1996 Study of Food Engineering at the Swiss Federal Institute

of Technology in Zurich

1996 Diploma in Food Engineering at the Swiss Federal Institute

of Technology in Zurich

1996-2000 Scientific collaborator and assistant at the Laboratory of Food

Microbiology at the Swiss Federal Institute of Technology

in Zurich. Ph. D. thesis

Documents

In Copyright - Non-Commercial Use Permitted Rights / License: …23887/et… · CurriculumVitae 75. Abstract Inorderto analyze theresponsetooxidative stress of strictly anaerobeClostrid¬