lable at ScienceDirect

Theriogenology 90 (2017) 120e128

Contents lists avai

Theriogenology

journal homepage: www.ther iojournal .com

In vitro production of functional haploid sperm cells from male germcells of Saanen dairy goat

Shoulong Deng a, Xiuxia Wang a, Zhipeng Wang a, Suren Chen a, Yuqian Wang a,Xiaoxia Hao a, Tiecheng Sun a, Yi Zhang b, c, Zhengxing Lian b, *, Yixun Liu a, **

a State Key Laboratory of Stem Cell and Reproductive Biology, Institute of Zoology, Chinese Academy of Sciences, Beijing, 100101, Chinab Laboratory of Animal Genetics and Breeding, College of Animal Science and Technology, China Agricultural University, Beijing, 100193, Chinac Department of Animal Sciences, Georg-August-Universit€at G€ottingen, G€ottingen, 37075, Germany

a r t i c l e i n f o

Article history:Received 22 June 2016Received in revised form20 October 2016Accepted 1 December 2016Available online 2 December 2016

Keywords:Spermatogonial stem cellDifferentiationSpermatid injectionActivatedGoat

* Corresponding author.** Corresponding author.

E-mail address: popo84350746@126.com (Z. Lian)

http://dx.doi.org/10.1016/j.theriogenology.2016.12.0020093-691X/© 2016 Elsevier Inc. All rights reserved.

a b s t r a c t

The dairy goat is an important economic animal. Studies on in vitro differentiation of dairy goat sper-matogonial stem cells (SSCs) could understand the molecular mechanisms for detecting mammaliansperm generation and innovative transgenetics. This study established an in vitro differentiation systemfor Saanen dairy goat SSCs. After 35 days incubation, single flagellum sperm-like cells with late roundspermatid (Sa2) morphologically and the ability to express sperm-specific protein acrosin is detected.DNA ploid analysis showed that addition of testosterone to the culture system significantly improved thedifferentiation efficiency (P < 0.05) of haploid cells, and stimulated the post-meiotic gene (Tnp1, Tnp2and Prm1) expression. A green fluorescent protein expressed in the morula was observed after trans-fection of the green fluorescent protein (GFP) vector with a round spermatid microinjection into theoocyte at metaphase II-stage. This study optimized activated method of the goat oocytes injected withround spermatids in vitro. This method increases the reconstructed embryonic development rate. Theseresults suggest that testosterone boosts the efficiency of haploid cell differentiation in Saanen dairy goattesticular cells in the in vitro differentiation system. After optimization of activated and injectionmethods, fertility and embryonic were improved.

© 2016 Elsevier Inc. All rights reserved.

1. Introduction

To generate functional sperm, male germline stem cells (mGCs)involved in a complicated and unique cell proliferation and differ-entiation process. Spermatogenesis, which includes self-renewaland mitotic cell division in spermatogonia, meiotic cell division inspermatocytes, and spermiogenesis in spermatids act sequentiallyto produce spermatozoa. Interaction of spermatogonial stem cells(SSCs) with the somatic testicular cell types, Sertoli cells, peri-tubular myoid cells in vitro is especial important for the SSCs pro-liferation and differentiation [1]. The somatic cells (e.g. Sertoli cellsand Leydig cells) provide essential nutrients (e.g. amino acids, vi-tamins), reproductive hormones (testosterone), cytokine synergy,and through the somatic cells to recieve follicle stimulating hor-mone (FSH) and luteinizing hormone (LH) regulation [2].

.

Functional disorders of Sertoli cells and Leydig cells, along withother abnormalities, such as local micro-environment imbalance,could result in arrest of spermatogenesis. Recently, various in vitroculture systems for germ cell differentiation research have beenestablished, including organ culture, seminiferous tubule fragmentculture, and mixed cell co-culture [3e6]. The spermatogenesisin vitro testis cell culture model is different from in vivo that themeiotic division and spermiogenesis are completed inside of theblood-testis barrier (BTB) of the testicular tubles, a “micro-envi-ronment”. The established in vitro culture system may also estab-lish a similar microenvironment to in vivo spermatogenesis, but themolecular mechanism and the signaling pathway are unclear. Thepresent results extend the previous reported in vitro survival timeof spermatogenic cells and improves sperm differentiation rate[7,8]. Spermatogenic cell in vitro differentiation is hormone-dependent. FSH can improve mRNA levels of the stem cell factor(SCF) [9]. Increasing SCF in the culture could stimulate spermato-gonial DNA synthesis, thus promoting spermatogonial proliferationand differentiation [10]. Testosterone impacts the whole process

S. Deng et al. / Theriogenology 90 (2017) 120e128 121

from meiosis of spermatocytes to sperm maturation [11].Round spermatids contain a complete haploid chromosome set

and possess the ability to fertilize metaphase II-stage oocytes [12].However, the fertilization and birth rates following round sper-matid injection (ROSI) are quite low. Sousa et al. [13] used an in vitromixed culture of spermatogonia and Sertoli cells from non-obstructive azoospermia patients to collect sperm cells. Aftermicroinjection, blastocysts were formed, but with low embryonicdevelopment. Abnormal elongating and elongated spermatidsenabled 8.3% and 27.3% fertilization rates respectively, but none ofthem reached to blastocyst stage. The main reason might be lack ofoocyte activation factor, leading to ineffective oocyte stimulation.However, before or after ROSI, assisted oocyte activation (e.g.electrical activation, chemical activation) significantly improvedround spermatid fertilization rate [14].

Researchers have completed the process of spermatogenesisin vitro by using spermatogenic cells [15,16]. The obtained sper-matids with tails are able to produce normal offspring after ROSI[17,18]. In addition, human spermatogenic cells can differentiateand mature in an in vitro culture system [19,20]. Addition of FSHand testosterone into culture systems can promote SSC differenti-ation [21]. In this study, testis cells and small fragments of semi-niferous tubules of 2-month-old Saanen dairy goats were incubatedto induce SSC differentiation in the in vitro culture system.Furthermore we investigated the effect of testosterone on in vitrodifferentiation of SSCs and found that the steroid increases thein vitro generation efficiency of the haploid sperm-like cells, andoptimizes the activation of ROSI to improve embryonic develop-ment after injection of in vitro cultured spermatids into oocytes.

2. Materials and methods

2.1. Ethics statement

Surgical biopsy in goats was performed at the experimentalstation of the China Agricultural University, and the whole pro-cedure was carried out in strict accordance with the protocolapproved by the Animal Welfare Committee of China AgriculturalUniversity.

2.2. Isolation of male testicular cells

Testis tissue was obtained from three 2-month-old Saanen dairygoats. Some of the tissue was fixed in 4% paraformaldehyde,embedded in paraffin wax, sectioned, and stained in hematoxylinand eosin (H&E) to observe the morphology of the seminiferoustubules. Another part of the testis was transported to the laboratoryin normal saline where it was washed thrice with phosphatebuffered solution (PBS) supplemented with 100 IU/mL penicillinand 100 mg/mL streptomycin. After decapsulation, isolated cellsand small fragments of seminiferous tubules were dissociated bythe modified enzymatic digestion [22]. Briefly, the short seminif-erous tubules were incubated with a tenfold (w/v) enzyme cocktailcontaining 1 mg/mL collagenase type IV, hyaluronidase (Sigma)1 mg/mL and 500 mg/mL DNaseI (Sigma) at 37 �C for 15 min, fol-lowed by neutralisation with Dulbecco's modified Eagle medium(DMEM) containing 10% foetal bovine serum (FBS) (Gibco, GrandIsland, NY, USA). The cell suspension was filtered using a 40 meshsieve. The dissociated cells and small fragments of seminiferoustubules were washed twice with DMEM by 500�g centrifugation.

2.3. In vitro differentiation of SSCs

Thetestis somatic cells and the small fragments of seminiferoustubules in suspension (containing SSCs, Sertoli cells, Leydig cells

and myoid cells) were seeded in 60-mm culture dishes and incu-bated at 37.8 �C for 3 d. Then the temperature was maintained at34 �C in 5% CO2/air. The cells were suspended in medium (M)containing DMEM, 5% FBS, 1% non-essential amino acids, 10 ng/mLSCF, 10 ng/mL fibroblast growth factor, 25 ng/mL epidermal growthfactor, l0 ng/mL insulin-like growth factor, 20 ng/mL glial derivedneurotrophic factor, 10 mg/mL transferrin, 10�4 M Vc, 4 M L-gluta-mine, 0.05 IU/mL FSH, 0.05 IU/mL LH (Sigma) and 1% pen-icillinestreptomycin (Gibico) [23,24]. Then, 10�6 M testosteronewas added to the experimental group (M1). In the culture systems,half the medium was changed every 3 d. Cell growth was timingobserved. After 30-d culture, cells were transfected. The pIRES2-GFP vector was transfected into culture cells using lipofectamineTM2000 (Invitrogen, Carlsbad, CA, USA). Expression of green fluo-rescent protein was observed by microscopy.

2.4. Immunofluorescence

The cells in the culture system were examined after 5 days forvasa (Santacruz, sc-67185) and PGP9.5 (Bioss, bs-3806R), a markerfor the SSCs [25]. At 30 days they were examined for acrosin (Bioss,bs-5151R), a marker for differentiated spermatozoa, by immuno-fluorescence staining. Briefly, cells were fixed in 70% alcohol for 2 h,and then washed twice in PBS. Slides were blocked with 1% bovineserum albumin (BSA) for 1 h at room temperature, and the antibody(final concentration 1:200) was added to the solution for 4 h. Slideswere rinsed twice and washed three times with PBS, for 5 min. Thesecondary antibody (1:500) was used for 1 h at room temperature,followed by the same washes, and nuclei were stained with DAPI.

2.5. Flow cytometric analyses

The DNA content of the mixed goat testes cells was examined byflow cytometry. For flow cytometry, cultured cells were dissociatedwith trypsin. In vitro cell suspensions adjusted to 1 � 106/mL werecollected at 5 d, 15 d and 35 d, and sperm from a mature goat wasused as a control. The cells and spermwere fixed in 70% ethanol for4 h. After three washes in PBS, the cells were incubated at 37 �C for10 min in PBS plus 200 mg/mL RNase I and 20 mg/mL propidiumiodide (PI). Finally, the DNA content of the cells was detected byflow cytometry.

The 7-day-old cells in the culture system were examined forPGP9.5 and vasa. Briefly, cells were fixed in 70% alcohol for 2 h,washed twice in PBS, and then re-suspended in PBS with BSA for anhour. Anti-PGP9.5 antibody (final concentration 1:200) and anti-vasa antibody (final concentration 1:200) was added to the solu-tion for an hour. After three washes in PBS by centrifugation at500�g for 5 min, the secondary antibody was added and incubatedfor 45 min. Finally, after three washes with PBS, the cells were re-suspended in 0.5 mL PBS and analyzed by flow cytometry.

2.6. Reverse transcription-PCR

Five- and 30-day-old cells (including Sertoli cells, Leydig cells,peritubular myoid cells and various spermatogenic cells) werecollected from the culture system. Total RNA of the mixed cells wasextracted (Invitrogen, Carlsbad, CA, USA) to produce complemen-tary DNA (cDNA) via reverse transcription (Promega, Madison, WI,USA). RNA from adult goat testis was used as a positive control.Post-meiotic gene expression of sperm (Transition proteins 1(Tnp1), Tnp2, protamine 1 (Prm1)) was detected by RT-PCR. The b-actin was used as an internal control (for primer sequences seeTable 1). The PCR products were separated by 1% agarose gelelectrophoresis, and analyzed by gel imaging systems after stainingthe gel with 0.01% ethidium bromide.

Table 1Primer sequences.

Gene (accession no.) Primer sequence Product size (bp)

Tnp1 (XM_005676523.3) 50 ATCGGAAGAGCAGCCTGAAGA 30 17250 CTGGCTTTGGTCTAACTTCAGGTC 30

Tnp2 (XM_005709693.1) 50 TTGCTGACTGCCCACCCAT 30 18250 CTGCTTGCTCCTCTTGACCTG 30

Prm1 (HM773246.1) 50 AAGATGTCGCAGACGAAGGAG 30 11250 GGTCTTGCTACTGTGCGGTTA 30

b-actin (AF481159.1) 50 CACGGTGCCCATCTACGAG 30 15850 CCTTGATGTCACGGACGATTT 30

S. Deng et al. / Theriogenology 90 (2017) 120e128122

2.7. Pre-microinjection preparations

Superovulation of the donor was induced by insertion of aprogesterone-releasing intravaginal controlled internal drugreleasing device (CIDR) and FSH (Pharmacia and Upjohn Company,Rydalmere, Australia). Ovulated oocytes were collected 60 h postsponge withdrawal. In vivo-matured goat oocytes were collectedsurgically using a fallopian tube flushing method, and then placedin the in vitro maturation (IVM) medium that included 10% FBSTCM-199 (Gibco, Grand Island, NewYork, USA), 0.05 IU/mL FSH,0.05 IU/mL LH, 1 mg/mL 17b-estradiol, 10 ng/mL EGF, and 2 mMglutamine (Sigma). Oocytes extruding the first polar body wereselected for haploid cell injection. The early spermatid is roundwithout a flagellum. Later sperm cells have a single flagellum [26].Spermatids obtained from adult goat testis by microdissectionmethod. Nuclear can be observed in the center of cell and sub-stances are aggregated. Cultured spermatids with single flagellaused in microinjection were less than 10 mm in diameter. Micro-manipulation was in TCM-199 that included 5 mg/mL cytochalasinB, 3 mg/mL BSA, and 0.5 mM HEPES (Sigma).

2.8. Intracytoplasmic injections

The cell membrane of spermatids with a single flagellum weredestroyed by repeated blowing by an injection needle, and theninjected into the cytoplasm of oocytes. Two strategies for oocyteactivation were used. One was activation of the spermatid afterintracytoplasmic injection. Another was activation before and afterintracytoplasmic injection. The development of reconstructedembryos was observed. The steps of activation after intra-cytoplasmic injection were as follows. These ROSI zygotes weretransferred into IVC (in vitro culture (IVC), medium that includedmodified synthetic oviduct fluid with amino acids, 0.2 mM gluta-mine, 6 mg/mL BSA, 3% essential amino acids, 1% non-essentialamino acids, and 0.5 mg/mL inositol [Sigma]) for recovery at38 �C and 5% CO2 for 30 min, subsequently activated with 5 mMionomycin for 5min, followed by 2mM6-dimethylaminopurine (6-DMAP) for 4 h. After activation, reconstructed embryos werecultured at 38 �C, in 5% CO2 for development, and cleavages ofreconstructed embryos were observed at 48 h. Oocytes withoutinjection for parthenogenetic were used as control. The steps ofactivation before and after intracytoplasmic injection were as fol-lows. Oocyteswere activatedwith 5-mM ionomycin for 5min beforeinjection. Intracytoplasmic injection was finished within 1 h afteractivation. The remaining steps were the same as the steps ofactivation after intracytoplasmic injection. The blastocysts wereobserved on day 7.

2.9. Perivitelline spermatid injections

Goat metaphase II-stage oocytes were activated with 5 mMionomycin for 5 min before injection, and then spermatids weremicroinjected into the zona pellucida. These recovered couplets

were transferred into IVC for recovery at 38 �C with 5% CO2 for30 min. Recovered couplets were transferred to a fusion groove(electrode weight, 1 mm), which covered the electric fusion liquid(0.3 M mannitol, 0.05 mM Ca2þ, 0.1 mM Mg2þ, 0.5 mM HEPES, and0.01% polyvinyl alcohol [Sigma]), and electrofused. Couplets werefused with two direct current pulses (1.5 kV/cm for 60 ms) using afusion apparatus (BLS, CF-150/B, Budapest, Hungary). After elec-trical fusion, recovered couplets were transferred to an IVC solutionat 38 �C with 5% CO2 for 30 min. Then the effectiveness of fusionwas checked. Recovered couplets were then activated with 5 mMionomycin for 5 min, followed by 2 mM 6-DMAP for 4 h. Afteractivation, reconstructed embryos were cultured at 38 �C and 5%CO2 for development, and cleavages of reconstructed embryos wereobserved at 48 h. The blastocysts were observed on day 7.

2.10. Blastocysts quality analyzed

To analysis blastocysts quality, 7-day blastocysts were trans-ferred into staining mediumwhich contating 1% (v/v) Triton X-100and 100 mg/mL PI for approximately 20 s, Then blastocysts wereincubated in 25 mg/mL bisbenzimide (Hoechst 33342) overnight at4 �C in dark chamber. To cell counting, place stained blastocystsontomicroscope slide, and put a cover slide on it. Total cell number,Trophectoderm cells (TE) and Inner cell mass (ICM) were countedunder fluorescence microscope.

2.11. Statistical analyses

The experiment was repeated three times. All data were sub-jected to analysis of variance using the GLM procedures of theStatistical Analysis System (SAS Institute, Cary, NC, USA). All datawere expressed as mean ± SEM. Differences were considered to besignificant when P < 0.05.

3. Results

3.1. Dairy goat SSC proliferation in in vitro culture system

In histological sections of testes only spermatogonia and Sertolicells were present within the seminiferous tubules of 2-month-oldgoats (Fig. 1A). The testicular tubule digested mixed cells and theseminiferous tubule fragments were seeded into petri dishes.During early stage of incubation, Sertoli cells, germ cells and othersomatic cells grew in adherent culture. After 48 h, the Sertoli cellswere star-shaped, fusiform or triangular in form. Leydig cells werepolygonal with a round vesicular nucleus and lipid droplets. Peri-tubular myoid cells grew in a single layer of flattened cells andsurrounded the Sertoli cells. The germline stem cells were scat-tered, single and uniformally round. Seventy-two hours later, thenumber of two conjoined cells increased, followed by triplet andquadruplet cells. Chain clones with intercellular bridge connectionswere visible (Fig. 1B). Immunofluorescence of 5-day-old culturedcells showed conjoined cells expressing SSC vasa and PGP9.5

Fig. 1. Goat male germ-line stem cell culture. A) Goat testis tissue of 2-month-old goats stained with H&E. B) after 72-h culture, the SSCs are adhering to the testicular somaticfeeder cell layer, and chain clones with an intercellular bridge connection are visible. C) Immunofluorescence of cultured cells showing conjoined cells expressing SSC antibody vasaand PGP9.5. D) SSCs growing in small colonies. E) Flow cytometry result of vasa and PGP9.5 proteins from goat SSCs.

S. Deng et al. / Theriogenology 90 (2017) 120e128 123

antibodies (Fig. 1C). Adherent Sertoli cells were woven into a singlelayer. Seven days later, SSCs mainly grew in small colonies (Fig. 1D).Flow cytometry revealed goat SSC antibody in the culture system(Fig. 1E).

3.2. Testosterone promotes haploid spermatozoa in in vitro culture

Goat SSCs were differentiated into developmentally competentsperm-like cells during culture at day 35 (Fig. 2A). Late roundspermatids (Sa2) or early elongating spermatids (Sb) with a singleflagellum and a diameter less than 10 mmwere observed [27]. In theculture system, round spermatids in the free surface of adherentcells only produced short or >1 flagella and apoptosis eventuallyoccurred, leaving the surface of adherent cells [28,29]. Spermatidsadhered to or embedded in Sertoli cells generated spermatozoawith a single flagellum, which is similar to those formed duringin vivo spermatogenesis (to prevent centrosome duplication, onlyone flagellum develops). Long fusiform spermatids were rare in thissystem. Spermatids expressed the mature sperm protein acrosin(Fig. 2B). Reverse transcription-PCR results showed no expressionof the meiosis-specific genes Prm1, Tnp1 and Tnp2 during the earlyphase of cell culture. This lasted until the 35th day of in vitro dif-ferentiation culture. Groups with additional testosterone had high-expression levels of Prm1, Tnp1 and Tnp2 (Fig. 2C).

To investigate whether SSCs undergo differentiation in vitro, wedetermined the DNA content of the cells by flow cytometry. Asshown in Fig. 2D, the DNA content of suspended cells showed threepeaks (including a haploid (1C), prominent diploid, and tetraploidpeaks). About 5.54% of the cells produced a haploid cell populationafter 35 days induction. Haploid efficiency in the group withadditional testosterone was 9.18% and significantly higher than thecontrol group (P < 0.05) (Table 2). Therefore, adding testosteroneeffectively promoted goat SSC differentiation in vitro. Forty dayslater, the number of germ cells began to decrease.

3.3. Obtaining functional haploid spermatozoa by injection ofmetaphase II-stage oocytes

Single-tailed spermatids were injected into goat metaphase II-stage oocytes (Fig. 3A). Two methods of microinjection,

intracytoplasmic injection and perivitelline space injection, wereapplied to improve developmental ability of spermatids (Fig. 3Band C). After strategy optimization, the reconstructed embryos hadtwo pronulei (Fig. 3D) and the ability to further develop by cleavageinto a blastocyst (Fig. 3E and F). Thus, in vitro cultured spermatidswith a single tail had the potential for development in vitro.

3.3.1. Activation of oocytes before and after intracytoplasmicinjection promotes embryonic cleavage rate

Single flagellum spermatids obtained by in vitro differentiationwere injected into the cytoplasm of oocytes. In the case of a twiceactivation strategy, before injection, oocytes were treated withionomycin. Once injection was finished, the activation procedurewas repeated. This method stimulated oocytes and improved theembryonic cleavage rate (reached 68.73 ± 4.88%) when comparedwith only one activation operation (P < 0.05) (Table 3).

3.3.2. Perivitelline spermatid injection boosts embryonic blastocystrate

After application of the optimized activation procedure, singleflagellum spermatids were injected into the perivitelline region andfused reconstructed embryos were produced by an electric fusioninstrument. Round spermatids derived from mature testis pro-cedure with Perivitelline spermatid injection. The reconstructedembryo fused by electric fusion instrument was used as control. Agroup with intracytoplasmic injection was used as a control, acti-vation with optimized activation procedure. The embryonic cleav-age rate and blastocyst ratewere calculated based on the number ofobtained reconstructed embryos. There was no difference in em-bryonic cleavage rate (P > 0.05), even though it was slightly higherwith intracytoplasmic injection (Table 4). However, the blastocystrate in the perivitelline injection group (17.65 ± 2.17%) was signif-icantly higher than the intracytoplasmic injection group(11.56 ± 1.83%) (P < 0.05). But significantly lower than roundspermatids derived from mature testis groups (P < 0.05). Amonggroups, Total cell number and ICM/TE ratio of goat reconstructedblastocysts using different spermatid injection methods were notstatistical difference (Table 5). Therefore, perivitelline injectioncombined with electrical fusion improved blastocyst rate in sper-matid reconstructed embryos.

Fig. 2. Goat haploid spermatozoa obtained by in vitro culture. A) Observation of spermatid with a single flagellum after 35 days, adult goat sperm as control. B) The haploid cellexpressed the mature sperm protein acrosin (green), nuclei of the cells were stained by DAPI, adult goat sperm as control. C) Post-meiotic gene expression of sperm (Tnp1, Tnp2 andPrm1) was detected by RT-PCR. 1) The mixed cells were cultured for 5 days. 2) (M) and 3) (M þ Testosterone), the mixed cells in vitro differentiated and cultured for 35 days. 4) Adulttesticular cells as a control. D) DNA contents of the suspended culture cells were analyzed by flow cytometry. 5-, 15- and 35-day-old cultured cells, respectively. M is basic induceddifferentiation medium group, M1 is M medium group with added testosterone. Adult sperm cells were positive control. 1C is the peaks of haploids. (For interpretation of thereferences to colour in this figure legend, the reader is referred to the web version of this article.)

Table 2Ratio of haploid spermatozoa in suspended cells 5, 15, and 35 days after SSCdifferentiation.

In vitro differentiation medium Haploid ratio (%)

5 days 15 days 35 days

M 1.02 ± 0.48 3.66 ± 0.89 5.54 ± 0.55b

M þ Testosterone 1.31 ± 0.78 3.89 ± 1.22 9.18 ± 1.03a

Note: a, b Difference between M and M þ Testosterone (P < 0.05).

S. Deng et al. / Theriogenology 90 (2017) 120e128124

3.4. Oocytes injected with GFP-transfected spermatids developfurther

Plasmid containing GFP was transfected into 30-day-old culturecells. The haploid spermatids expressed green fluorescent protein(Fig. 4A). Round spermatids with GFP expression were thenmicroinjected into the zona pellucida of oocytes (Fig. 4B). Embryosin the morulae stage expressed GFP protein through microinjectedpositive haploid cells (Fig. 4C). Therefore oocytes injectedwith GFP-transfected spermatids could develop further.

4. Discussion

Testicular somatic cells play an important role in the

proliferation and differentiation of SSCs [30e33]. Previous studieshave shown in vitro production of functional sperm was obtainedfrom cultured neonatal mouse testes via organ culture method.These methods could successfully generate haploid germ cells,through microinjection, these haploid sperm cells were functionaland able to fertilize oocytes and generate offspring [34]. And ratspermatogonia differentiated into round spermatids in vitro in tis-sue culture [35]. In our study, a mixed culture with dissociated cellsand small fragments of seminiferous tubules was applied for thegoat in vitro culture. Necessary hormones and cytokines during theSSC proliferation and differentiation were added to the culturesystem [36e38]. After 35 days culture, spermatids with a singleflagellum were formed, indicating that a much shorter time spanin vitro compared with the in vivo spermatogenesis (goat sper-matogenesis period is 49e50 days) [39]. In the in vitro differenti-ation system, addition of FSH and LH to the media could promotethe SSC differentiation into sperm [40,41]. Androgen-androgenreceptor signaling is crucial to regulate spermatogenesis. Testos-terone, the main resource of androgens in the testis, is produced byLeydig cells but regulated by Sertoli cells and germ cells vianumerous testicular factors. Testosterone is crucial for in vivospermatogenesis and can inhibit LH release and stimulate FSHsecretion. Adding an appropriate amount of testosterone can pro-mote spermatogenic cell differentiation in vitro [42]. The present

Fig. 3. Goat functional haploid spermatozoa obtained. A) In vitro differentiation spermatid with single tail. B) and C) Intracytoplasmic injection and perivitelline injection of in-vitroformed spermatid. D) Nucleus of reconstructed embryos. E) Reconstructed embryos developed to two-cell stage embryos. F) Reconstructed embryos developed to the blastocyststage.

Table 3Cleavage rate of goat ROSI reconstructed embryos using different activation methods.*

Activation method Metaphase II-stage oocyte (N) Reconstructed embryos (N) Cleavage rate (%)

ROSI/Ionomycinþ6-DMAP 46 40 52.80 ± 2.45b

Ion/ROSI/Ionomycinþ6-DMAP 50 39 68.73 ± 4.88a

Ionomycinþ6-DMAP 72 e 75.51 ± 4.23a

Note: a, b Difference between ROSI after activation and ROSI before and after activation (P < 0.05). *Spermatid for ROSI were derived from in vitro culture.

Table 4Development of goat reconstructed embryos using different spermatid injection methods.

Spermatid injection method Metaphase II-stage oocyte (N) Fusion rate (%) Reconstructed embryos (N) Cleavage rate (%) Blastocyst rate (%)

Intracytoplasmic injection (in vitro cultured) 91 e 77 61.57 ± 3.83 11.56 ± 1.83c

Perivitelline injection (in vitro cultured) 118 59.81 ± 1.83 70 52.95 ± 6.51 17.65 ± 2.17b

Perivitelline injection (in vivo separated) 98 66.33 ± 4.25 65 64.62 ± 7.37 23.08 ± 1.58a

Note: Different letters in the same column indicate a significant difference (P < 0.05).

Table 5Total cell number and ICM/TE ratio of goat reconstructed blastocysts using different spermatid injection methods.

Spermatid injection method Blastocysts (N) Total cell number ICM cell number TE cell number Cell ratio of ICM/TE

Intracytoplasmic injection (in vitro cultured) 5 81.60 ± 3.58 20.20 ± 2.39 59.80 ± 3.19 0.34Perivitelline injection (in vitro cultured) 6 85.17 ± 3.25 21.83 ± 2.48 60.83 ± 2.32 0.36Perivitelline injection (in vivo separated) 6 88.83 ± 3.82 24.50 ± 2.59 65.59 ± 3.39 0.37

Note: Different letters in the same column indicate a significant difference (P < 0.05).

S. Deng et al. / Theriogenology 90 (2017) 120e128 125

study also proved that addition of the steroid to the culture systemsignificantly enhances the differentiation rate of haploid sperm-likecells and expression of specific genes during meiotic anaphase.

During the mitotic phase of spermatogenesis, when the nuclearmembrane is broken, exogenous DNA can easily enter the nucleus[43]. During meiosis, homologous chromosomes process DNArecombination, thus the nuclear membrane temporarily

disappears. This not only increases the probability of genetic vari-ation in offspring, but also the transfection efficiency of exogenousgenes [44]. Spermatogenesis is a process that spermatids differ-entiation into sperm. After a complex morphological evolutionprocedure, haploid-round-head spermatids turn into sperm withhead, neck and tail. By now, sperm cells are involved in chromo-some assembly by Tnp. Arginine-rich protamine substitutes

Fig. 4. Oocyte that was injected with in-vitro formed spermatid expressing GFP has developmental ability. A) Green fluorescent protein expressed in goat haploid cell. B) Afterperivitelline injection. C) GFP-haploid reconstructed embryos developed to the morula stage. (For interpretation of the references to colour in this figure legend, the reader isreferred to the web version of this article.)

S. Deng et al. / Theriogenology 90 (2017) 120e128126

histones in the sperm nucleus chromatin and eventually formsmature sperm. Protamine contains a large amount of positivecharges, which attract negatively charged DNA; hence, an exoge-nous gene is easily combined with the nuclear genome in thisperiod. However, some studies have shown that protamine for-mation facilitated compactness between DNA and protamines,which increases the difficulty of exogenous DNA insertion intosperm DNA. By contrast, in round spermatids before protamineformation, integration of exogenous DNA is easier [45]. Our resultsindicated showed after 30 days culture, GFP observed in transfectedcells. Spermatogenic cells were at meiosis anaphase and the roundsperm phase. In differentiation culture system, Tnp1, Tnp2 andPrm1 expressions were detected from cells which were culture for35 days. This indicates round spermatid could integrate exogenousDNA before protamine produced. Furthermore, GFP expressed inround spermatids after injected into oocytes resulted in morulastage embryos expressing the GFP protein.

Spermatid cell injection time and oocyte activation is essentialfor nuclear development of reconstructed oocytes. Studies haveshown that round spermatids of mice could not activate oocytes;instead, intracytoplasmic ROSI should activate oocytes first. Then,when oocytes reach the end of phase II, injecting the sperm cellnucleus with a supplement of Ca2þ significantly improves the ROSIoocyte fertilization rate [46,47]. Currently the best procedure formouse ROSI is: oocyte treatment with 10 mM Sr2þ for 1.5 h; thenconduct ROSI and repeat oocyte treatment. The obtained ROSIblastocyst rate and birth rate by this method is similar to that of ICSI[48]. Ionomycin triggers Ca2þ influx and results in oocyte activa-tion. 6-DMAP is a protein phosphorylation inhibitor with the abilityto inhibit maturation promoting factor (MPF) activity, so thatoocyte recovery and completion of the second round meiotic di-vision is achieved [49]. Treating cattle oocytes with ionomycinbefore and after ROSI injection resulted in a 13% blastocyst rate [50].A similar method, but with additional cycloheximide (CHX) and 6-DMAP treatment, used in rabbit ROSI injections improved theembryonic development and birth rate [51]. However, combinationtreatment with ionomycin and 6-DMAP enhanced cloned goatembryonic development in vitro [52]. The combined activation of7% ethanol for 6 min and 2 mmol/L 6-DMAP for 2 h are the optimalprotocols for chemical activation of mouse oocytes following ROSI[53]. Previous studies have showed goat round spermatids was notable to trigger intracellular Ca2þ rises, but artificial activation couldimproved fertilization and development of ROSI goat oocytes. Mostoocytes formed pronuclei after ROSI which oocytes were treatedwith ionomycin [54]. We used ionomycin and 6-DMAP to treat goat

oocytes, and optimized oocyte activation and significantlyimproved the cleavage rate of reconstructed ooytes.

Direct intracytoplasmic injection of sperm cells into ooctyescauses them physical damage. An indirect injection strategywhereby the spermatid is injected into the subzonal region of theoocyte, followed by electrofusion could reduce oocyte physicaldamage [55]. Reconstructed embryos involving fused round spermstill need a process of manual activation [56]. Our study injectedcultured single flagellum spermatids into the subzonal region ofoocytes, and obtained fertilized embryos by electric fusion andoocyte activation, improving the reconstructed embryonic blasto-cyst rate.

4.1. Conclusions

In this study, we obtained functional spermatids by in vitroculture. This optimizes in vitro activated methods for goat oocytesinjected with round spermatids. Activation before and after ROSIand electrofusion has the advantage of increasing the rate ofreconstructed embryonic development. Embryos in the morulaestage expressed GFP protein throughmicroinjection of GFP-positivehaploid cells. This provides a new way for the production oftransgenic animals.

Competing interests

The authors declare that they have no competing interests.

Author contributions

Conceived and designed the experiments: Shoulong Deng andYixun Liu. Performed the experiments: Shoulong Deng, ZhipengWang and Suren Chen. Analyzed the data: Shoulong Deng, YuqianWang, Yi Zhang, Zhengxing Lian and Xiaoxia Hao. Contributed re-agents/materials/analysis tools: Xiuxia Wang and Tiecheng Sun.Wrote the paper: Yi Zhang and Shoulong Deng.

Acknowledgments

This work was supported by grants from Major Research Plan“973” Project (2011CB944302 and 2012CB944702), NationalTransgenic Creature Breeding Grand Project (2013ZX08008-005and 2014ZX08008-002B), National Technology Support Project(2012DAI131B08), and Natural Science Foundation of China(31501953, 31471352, 31471400 and 31171380).

S. Deng et al. / Theriogenology 90 (2017) 120e128 127

Appendix A. Supplementary data

Supplementary data related to this article can be found at http://dx.doi.org/10.1016/j.theriogenology.2016.12.002.

References

[1] Chen LY, Willis WD, Eddy EM. Targeting the Gdnf Gene in peritubular myoidcells disrupts undifferentiated spermatogonial cell development. Proc NatlAcad Sci U. S. A 2016;113(7):1829e34.

[2] Hai Y, Sun M, Niu M, Yuan Q, Guo Y, Li Z, et al. BMP4 promotes human Sertolicell proliferation via Smad1/5 and ID2/3 pathway and its abnormality isassociated with azoospermia. Discov Med 2015;19(105):311e25.

[3] Tesarik J. Overcoming maturation arrest by in vitro spermatogenesis: searchfor the optimal culture system. Fertil Steril 2004;81(5):1417e9.

[4] Cremades N, Sousa M, Bernabeu R, Barros A. Developmental potential ofelongating and elongated spermatids obtained after in-vitro maturation ofisolated round spermatids. Hum Reprod 2001;16(9):1938e44.

[5] Xie B, Qin Z, Huang B, Xie T, Yao H, Wei Y, et al. In vitro culture and differ-entiation of buffalo (Bubalus bubalis) spermatogonia. Reprod Domest Anim2010;45(2):275e82.

[6] Stukenborg JB, Wistuba J, Luetjens CM, Elhija MA, Huleihel M, Lunenfeld E,et al. Coculture of spermatogonia with somatic cells in a novel three-dimensional soft-agar-culture-system. J Androl 2008;29(3):312e29.

[7] Tres LL, Kierszenbaum AL. Viability of rat spermatogenic cells in vitro isfacilitated by their coculture with Sertoli cells inserum-free hormone-sup-plemented medium. Proc Natl Acad Sci U. S. A 1983;80(11):3377e81.

[8] Hadley MA, Byers SW, Su�arez-Quian CA, Kleinman HK, Dym M. Extracellularmatrix regulates Sertoli cell differentiation, testicular cord formation, andgermcell development in vitro. J Cell Biol 1985;101(4):1511e22.

[9] Meehan T, Schlatt S, O'Bryan MK, de Kretser DM, Loveland KL. Regulation ofgerm cell and Sertoli cell development by activin, follistatin, and FSH. Dev Biol2000;220(2):225e37.

[10] Feng LX, Chen Y, Dettin L, Pera RA, Herr JC, Goldberg E, et al. Generation andin vitro differentiation of a spermatogonial cell line. Science 2002;297(5580):392e5.

[11] Wenker EP, Dupree JM, Langille GM, Kovac J, Ramasamy R, Lamb D, et al. Theuse of HCG-based combination therapy for recovery of spermatogenesis aftertestosterone use. J Sex Med 2015;12(6):1334e7.

[12] Yazawa H, Yanagida K, Hayashi S, Sato A. The oocyte activation and Ca2þoscillation-inducing abilities of mouse and human dead (sonicated) sperma-tozoa. Zygote 2009;17(2):175e84.

[13] Sousa M, Cremades N, Alves C, Silva J, Barros A. Developmental potential ofhuman spermatogenic cells co-cultured with Sertoli cells. Hum Reprod2002;17(1):161e72.

[14] Ogonuki N, Inoue K, Ogura A. Birth of normal mice following round spermatidinjection without artificial oocyte activation. J Reprod Dev 2011;57(4):534e8.

[15] Hasegawa H, Terada Y, Ugajin T, Yaegashi N, Sato K. A novel culture system formouse spermatid maturation which produces elongating spermatids capableof inducing calcium oscillation during fertilization and embryonic develop-ment. J Assist Reprod Genet 2010;27(9e10):565e70.

[16] Iwanami Y, Kobayashi T, Kato M, Hirabayashi M, Hochi S. Characteristics of ratround spermatids differentiated from spermatogonial cells during co-culturewith Sertoli cells, assessed by flow cytometry, microinsemination and RT-PCR.Theriogenology 2006;65(2):288e98.

[17] Sato T, Katagiri K, Yokonishi T, Kubota Y, Inoue K, Ogonuki N, et al. In vitroproduction of fertile sperm from murine spermatogonial stem celllines. NatCommun 2011;2:472.

[18] Vloeberghs V, Verheyen G, Tournaye H. Intracytoplasmic spermatid injectionand in vitro maturation: fact or fiction? Clin (Sao Paulo) 2013;68(Suppl 1):151e6.

[19] Tanaka A, Nagayoshi M, Awata S, Mawatari Y, Tanaka I, Kusunoki H.Completion of meiosis in human primary spermatocytes through in vitrococulture with Vero cells. Fertil Steril 2003;79(Suppl 1):795e801.

[20] Tesarik J, Cruz-Navarro N, Moreno E, Ca~nete MT, Mendoza C. Birth of healthytwins after fertilization with in vitro cultured spermatids from a patient withmassive in vivo apoptosis of postmeiotic germ cells. Fertil Steril 2000;74(5):1044e6.

[21] Tesarik J, Greco E, Mendoza C. Assisted reproduction with in-vitro-culturedtesticular spermatozoa in cases of severe germcell apoptosis: a pilot study.Hum Reprod 2001;16(12):2640e5.

[22] Izadyar F, Spierenberg GT, Creemers LB, den Ouden K, de Rooij DG. Isolationand purification of type A spermatogonia from the bovine testis. Reproduction2002;124(1):85e94.

[23] Staub C, Hue D, Nicolle JC, Perrard-Sapori MH, Segretain D, Durand P. Thewhole meiotic process can occur in vitro in untransformed rat spermatogeniccells. Exp Cell Res 2000;260(1):85e95.

[24] Vigier M, Weiss M, Perrard MH, Godet M, Durand P. The effects of FSH and oftestosterone on the completion of meiosis and the very earlysteps of sper-miogenesis of the rat: an in vitro study. J Mol Endocrinol 2004;33(3):729e42.

[25] Heidari B, Rahmati-Ahmadabadi M, Akhondi MM, Zarnani AH, Jeddi-Tehrani M, Shirazi A, et al. Isolation, identification, and culture of goat sper-matogonial stem cells using c-kit and PGP9.5 markers. J Assist Reprod Genet

2012;29(10):1029e38.[26] Kimura Y, Yanagimachi R. Mouse oocytes injected with testicular spermatozoa

or round spermatids can develop intonormal offspring. Development1995;121(8):2397e405.

[27] S�a R, Neves R, Fernandes S, Alves C, Carvalho F, Silva J, et al. Cytological andexpression studies and quantitative analysis of the temporal and stage-specific effects of follicle-stimulating hormone and testosterone during co-cultures of the normal human seminiferous epithelium. Biol Reprod2008;79(5):962e75.

[28] Gerton GL, Millette CF. Generation of flagella by cultured mouse spermatids.J Cell Biol 1984;98(2):619e28.

[29] Cremades N, Bernabeu R, Barros A, Sousa M. In-vitro maturation of roundspermatids using co-culture on Vero cells. Hum Reprod 1999;14(5):1287e93.

[30] França LR, Silva Jr VA, Chiarini-Garcia H, Garcia SK, Debeljuk L. Cell prolifer-ation and hormonal changes during postnatal development of the testis in thepig. Biol Reprod 2000;63(6):1629e36.

[31] Tesarik J, Greco E, Rienzi L, Ubaldi F, Guido M, Cohen-Bacrie P, et al. Differ-entiation of spermatogenic cells during in-vitro culture of testicular biopsysamples from patients with obstructive azoospermia: effect of recombinantfollicle stimulating hormone. Hum Reprod 1998;13(1O):2772e81.

[32] Honaramooz A, Megee SO, Rathi R, Dobrinski I. Building a testis: formation offunctional testis tissue after transplantation of isolated porcine (Sus scrofa)testis cells. Biol Reprod 2007;76(1):43e7.

[33] Izadyar F, Den Ouden K, Creemers LB, Posthuma G, Parvinen M, De Rooij DG.Proliferation and differentiation of bovine type A spermatogonia during long-term culture. Biol Reprod 2003;68(1):272e81.

[34] Sato T, Katagiri K, Gohbara A, Inoue K, Ogonuki N, Ogura A, et al. In vitroproduction of functional sperm in cultured neonatal mouse testes. Nature2011;471(7339):504e7.

[35] Reda A, Hou M, Winton TR, Chapin RE, S€oder O, Stukenborg JB. In vitro dif-ferentiation of rat spermatogonia into round spermatids in tissue culture. MolHum Reprod 2016;22(9):601e12.

[36] Staub C. A century of research on mammalian male germ cell meiotic differ-entiation in vitro. J Androl 2001;22(6):911e26.

[37] Marh J, Tres LL, Yamazaki Y, Yanagimachi R, Kierszenbaum AL. Mouse roundspermatids developed in vitro from preexisting spermatocytes can producenormal offspring by nuclear injection into in vivo-developed mature oocytes.Biol Reprod 2003;69(1):169e76.

[38] Hue D, Staub C, Perrard-Sapori MH, Weiss M, Nicolle JC, Vigier M, et al. Meioticdifferentiation of germinal cells in three-week cultures of whole cell popu-lation fromrat seminiferous tubules. Biol Reprod 1998;59(2):379e87.

[39] Weiss M, Vigier M, Hue D, Perrard-Sapori MH, Marret C, Avallet O, et al. Pre-and postmeiotic expression of male germ cell-specific genes throughout 2-week cocultures of rat germinal and Sertoli cells. Biol Reprod 1997;57(1):68e76.

[40] Matthiesson KL, McLachlan RI, O'Donnell L, Frydenberg M, Robertson DM,Stanton PG, et al. The relative roles of follicle-stimulating hormone andluteinizing hormone in maintaining spermatogonial maturation and sper-miation in normal men. J Clin Endocrinol Metab 2006;91(10):3962e9.

[41] Sofikitis N, Pappas E, Kawatani A, Baltogiannis D, Loutradis D, Kanakas N, et al.Efforts to create an artificial testis: culture systems of male germ cells underbiochemical conditions resembling the seminiferous tubular biochemicalenvironment. Hum Reprod Update 2005;11(3):229e59.

[42] Tesarik J, Bahceci M, Ozcan C, Greco E, Mendoza C. Restoration of fertility byin-vitro spermatogenesis. Lancet 1999;353(9152):555e6.

[43] G€orlich D, Mattaj IW. Nucleocytoplasmic transport. Science 1996;271(5255):1513e8.

[44] Lu L, Lin M, Xu M, Zhou ZM, Sha JH. Gene functional research usingpolyethylenimine-mediated in vivo gene transfection into mouse spermato-genic cells. Asian J Androl 2006;8(1):53e9.

[45] Huang Z, Tamura M, Sakurai T, Chuma S, Saito T, Nakatsuji N. In vivo trans-fection of testicular germ cells and transgenesis by using the mitochon-driallylocalized jellyfish fluorescent protein gene. FEBS Lett 2000;487(2):248e51.

[46] Tejera A, Moll�a M, Muriel L, Remohí J, Pellicer A, De Pablo JL. Successfulpregnancy and childbirth after intracytoplasmic sperm injection with cal-ciumionophore oocyte activation in a globozoospermic patient. Fertil Steril2008;90(4). 1202.e1e5.

[47] Egashira A, Murakami M, Haigo K, Horiuchi T, Kuramoto T. A successfulpregnancy and live birth after intracytoplasmic sperm injection with globo-zoospermic sperm and electrical oocyte activation. Fertil Steril 2009;92(6).2037.e5e9.

[48] Loren J, Lacham-Kaplan O. The employment of strontium to activate mouseoocytes: effects on spermatid-injection outcome. Reproduction 2006;131(2):259e67.

[49] Deng S, Li G, Zhang J, Zhang X, Cui M, Guo Y, et al. Transgenic cloned sheepoverexpressing ovine toll-like receptor 4. Theriogenology 2013;80(1):50e7.

[50] Ock SA, Kwack DO, Lee SL, Cho SR, Jeon BG, Kumar BM, et al. In vitro devel-opment of bovine oocytes reconstructed with round spermatids. Ther-iogenology 2006;65(7):1242e53.

[51] Hirabayashi M, Kato M, Kitada K, Ohnami N, Hirao M, Hochi S. Activationregimens for full-term development of rabbit oocytes injected with roundspermatids. Mol Reprod Dev 2009;76(6):573e9.

[52] Lan GC, Chang ZL, Luo MJ, Jiang YL, Han D, Wu YG, et al. Production of clonedgoats by nuclear transfer of cumulus cells and long-term cultured fetal

S. Deng et al. / Theriogenology 90 (2017) 120e128128

fibroblast cells into abattoir-derived oocytes. Mol Reprod Dev 2006;73(7):834e40.

[53] Huang J, Jiang H, Wang CL, Song XM. Application of chemical activation toin vitro fertilization by round spermatid injection in mice. Zhonghua Nan KeXue 2014;20(2):111e6.

[54] Liu XY, Miao YL, Zhang J, Qiu JH, Cui XZ, Gao WQ, et al. Effects of activation onfunctional aster formation, microtubule assembly, and blastocyst

development of goat oocytes injected with round spermatids. Cell Reprogr2012;14(5):436e47.

[55] Liu L, Sun Q, Duan C, Liu H, Song X, Qian J, et al. Subzonal fertilization of mouseround spermatids. Sci China C Life Sci 1997;40(2):152e8.

[56] Ogura A, Matsuda J, Yanagimachi R. Birth of normal young after electrofusionof mouse oocytes with round spermatids. Proc Natl Acad Sci U. S. A1994;91(16):7460e2.