JOURNAL OF BACTERIOLOGY, Apr. 1987, p. 1691-17010021-9193/87/041691-11$02.00/0Copyright © 1987, American Society for Microbiology

Vol. 169, No. 4

In Vivo Translation of a Region within the rrnB 16S rRNA Gene ofEscherichia coli

KAREN L. BERG, CATHERINE L. SQUIRES,* AND CRAIG SQUIRESDepartment of Biological Sciences, Columbia University, New York, New York 10027

Received 8 October 1986/Accepted 20 January 1987

In this study we show that a segment of the Escherichia coli rrnB 16S gene can be translated in vivo. Otherlaboratories have previously reported that there are internal transcription and translation signals and openreading frames within the E. coli rrnB rRNA operon. Their studies revealed a translation start signal followedby a 252-base-pair open reading frame (ORF16) within the 16S gene and detected a promoter (P16) in the samegeneral region by using in vitro RNA polymerase binding and transcription initiation assays. By using plasmidgene fusions of ORF16 to lacZ we showed that an ORF16'-'2-galactosidase fusion protein was made in vivo.Transcripts encoding the fusion protein were expressed either from the rrnB PIP2 control region or from ahybrid trp-lac promoter (tacP), but the amount of expression was considerably less than for a lacZ controlplasmid. We used fusions to the cat gene to show that P16 is one-half as active as lacP. Deletions were used toshow that P16 is located within ORF16 and thus cannot promote a transcript encoding the ORF16 peptide. Acomparison of sequences from different organisms shows that ORF16 and P16 lie in a highly conserved regionof the procaryotic 16S RNA structure. The first 20 amino acids of 0RF16 are conserved in most eubacterial andplant organellar sequences, and promoter activity has been detected in this region of the Caulobacter crescentussequence by other workers.

The possibility that rRNA codes for an amino acid se-quence has been considered by many workers. Both tran-scriptional and translational start signals and open readingframes within rRNA genes have been described previously.However, evidence for the translation of rRNA has neverbeen reported, and it is generally believed that the extensivesecondary structure and protein interactions of rRNA mol-ecules render them inaccessible to the translational machin-ery. In this study we show that a prominent open readingframe near the end of the Escherichia coli rrnB 16S genecould be translated in vivo.The E. coli genome contains seven rRNA operons, each

with genes coding for 16S, 23S, and 5S rRNA subunits, aswell as a variable number of tRNAs. The rrnB (Fig. 1)operon is located at 89 min on the E. coli genetic map.Transcription of rrn operons initiates from a control regionthat contains tandem promoters (PP2) (11, 44) and anantitermination (AT) system, presumably to protect theextensive untranslated transcript from premature termina-tion by the Rho-specific termination system of the cell (22).The polycistronic transcript is subsequently processed intomature 16S, 23S, and 5S rRNAs and tRNAs. The rrnBoperon has been sequenced in its entirety (7, 8); rRNAsequencing (9) as well as partial DNA sequences from otheroperons (11, 15, 33, 35, 42-44; C. Squires, unpublished data)suggests that the seven rrn sequences of E. coli are highlyconserved, especially in their structural genes.

Brosius and co-workers (8) noted the presence of a ribo-some-binding site (Shine-Dalgarno [SD] sequence [36] andan ATG start codon separated by nine bases) and a 252-base-pair (bp) (84 codon) open reading frame (designated ORF16)starting at position 1187 in the rrnB 16S sequence (Fig. 2). Invitro transcription initiation has been noted from the samegeneral region of the rrnB 16S gene of E. coli (39) and the

* Corresponding author.

homologous region within the 16S gene of Caulobactercrescentus (2).

In this paper we used ORF16'-'lacZ gene fusion plasmidsto show that ORF16 could be translated in vivo. However,the ORF16'-'lacZ gene fusion plasmid was expressed muchless efficiently than a control lacZ plasmid. We also usedfusions to the chloramphenicol acetyltransferase gene (cat)to examine E. coli rrnB internal promoters. We found thatP16 was the strongest of these promoters, about one-half asactive as lacP. Deletions showed that P16 lies within theORF16 sequence and, therefore, does not promote the openreading frame. Examination of small rRNA subunit se-quences of other organisms showed that the ORF16 and P16regions are highly conserved in diverse genera. The first 20amino acids of ORF16 (the polypeptide specified by ORF16)are conserved in most eubacterial and plant organellarsequences.

MATERIALS AND METHODS

Abbreviations. Several abbreviations and conventions areused here. The nucleotide sequence of the open readingframe between nucleotides 1187 and 1448 of the mature 16Ssequence is designated ORF16. The polypeptide specified byORF16 is designated ORF16. In gene fusions between trun-cated genes and open reading frame sequences, primes (')are used to indicate that some of the coding sequences aremissing (e.g., ORFJ6'-'lacZ). The hybrid trp-lac promoter isdesignated tacP. lacP is the lac UV5 promoter.

Bacterial strains, plasmids, and bacteriophage. StrainMC1009 [A(lacIPOZY) galU galK A(ara-leu) rpsL srl: :TnJOrecA56 spoT relA; (M. Casadaban, personal communication)and plasmid pMC874 ('lacZ Kmi) (10) were provided by M.Casadaban. Strain SE5000 and plasmid pMLB1034 (41) wereboth obtained from M. Berman. SE5000 [recA/F'laclqA(lacZ)M15] is derived from MC4100 (4; M. Berman, per-

1691

on February 20, 2021 by guest

http://jb.asm.org/

Dow

nloaded from

1692 BERG ET AL.

T 16S 16tRNA

AT 16

23S

P23

T2

PORFII

FIG. 1. Diagram of the rrnB operon showing the arrangement ofthe genes coding for 16S, 23S, 5S, and tRNA-glu-2, as well as themajor transcriptionl control sites, i.e., the tandem promoters PWP2,the rrn AT region, and tandem terminators t1t2. Also depicted are

ORF16 and the relative placement of P16, P23, and PORFII- Symbols:r-i, genes; -, surrounding or spacer regions; _, ORF16.

sonal communication). Strain KK588 [F- trpE9851 leu-277A(lacZY co4)] is a derivative of W3110 and was a gift from 0.

Karlstrom. Strain GM33 (F- dam- X-) (25) was obtainedfrom B. Bachman. The maxicell strain CSR603 (recAl uvrA6phr-) (32) was obtained from D. Rupp. Plasmids pNF1344(13) and pBD2720 (F. W. Bech, personal communication)were obtained from F. W. Bech. Plasmids pKK232-8 andpKK223-3 were obtained from J. Brosius (6). PlasmidspSL100, pSL130, and pSL140 were made in this laboratoryand are described elsewhere (22). Lambda drifi18 (18, 39)DNA was obtained from H.-L. Yang, and plasmid pBK17 (5)was obtained from P. Veneti4ner. Plasmid pLacZl wasobtained from T. Eckhardt (personal communication).Bacteriophage Ml3mp7 and its host strain 71.18 [A(lac-proAB) supE thi / F' lacIqZ A(lacZ)M15 proA+B+] were

obtained from J. Messing (26).Materials. Radioactive nucleotides for DNA sequencing,

[35S]methionine, and 1251, were purchased from AmershamCorp. S-Acetyl coenzyme A, 5,5'-dithiobis-(2-nitrobenzoicacid), cephaloridine, chloramphenicol, ampicillin, o-nitro-phenyl-a-D-galactopyranoside, and isopropyl-p-D-thiogalac-topyranoside (IPTG) were obtained from Sigma ChemicalCo. 5-Bromo-4-chloro-3-indolyl-p-D-galactopyranoside (X-Gal) was purchased from Boehringer Mannheim Biochemi-cals.

Methods. Plasmid DNAs were prepared by standard pro-cedures (24). DNA fragments were purified by using NA-45DEAE membranes (Schleicher & Schuell, Inc.). Southernhybridizations were performed by the standard procedure(24) or by the Gene Screen Plus instructions (New EnglandNuclear Corp.).Chloramphenicol acetyltransferase (Cat) and ,-lactamase

(Bla) assays were performed as described by Li et al. (22),with slight modifications. The cells were treated withlysozyme rather than sonicated. Duplicate assays were

performed on each sample. For Cat activity, 1 U is 1 ,umol ofchloramphenicol acetylated in 1 min at 37°C and 1 U of Blaactivity is 1 ,umol of cephaloridine hydrolyzed in 1 min at37°C. We expressed Cat enzyme activity of the plasmids asthe ratio of Cat to Bla units in cell extracts to correct forpossible differences in plasmid copy number and volumetricdifferences in the enzyme extracts. The Cat activities repre-sent averages of measurements determined from two to fourindependent experiments.

Cells for P-galactosidase (LacZ) and Bla assays weregrown in M9 minimal salts medium-0.5% Casamino Acids(Difco Laboratories)-0.2% glucose at 37°C with vigorousshaking. Cultures were diluted 1 to 100 from an overnightculture and grown for three to four doublings to establish astate of balanced growth. Cultures were diluted 10-fold andallowed to continue exponential growth. Cells (10 ml) weresampled at an optical density at 450 nm of 0.5, lysed asdescribed above for Cat and Bla assays, then assayed forLacZ (27) and Bla activities. For LacZ activity, 1 U is 1 nmol

of o-nitrophenyl-a-D-galactopyranoside hydrolyzed in 1 minat 28°C. We expressed LacZ activity of the plasmids 4s theratio of LacZ to Bla units to correct for possible differencesin plasmid copy number, etc. The LacZ activities presentedrepresent averages of at least two separate measurements foreach plasmid.

Strains to be analyzed by sodium dodecyl sulfate (SDS)-polyacrylamide gel electrophoresis of their proteins were

grown at 37°C in minimal medium plus glycerol (0.4%),either in the absence or presence of the inducer IPTG (1mM). An overnight culture was diluted 100-fold and grownto an optical density at 450 nm of 0.3. A 1-ml sample of theculture was then pulse-labeled for 1 min with 3 ,uCi of[35S]methionine, and the pulse was terminated by adding 50pg of cold methionine. The labeled cells were chilled on ice,centrifuged for 1 min, washed with 10 mM Tris hydrochlo-ride (pH 8), suspended in 50 p1 of resuspension buffer (21),and boiled for 5 min. Half of the 'sample was run on an

SDS-polyacrylamide gel (7.5%). The gel was then dried andplaced on X-ray film for 3 days.

Maxicell strains were grown to exponential phase, UVirradiated, and then labeled with [35S]methionine (32). La-beled cell extracts were then examined on SDS-polyacryl-amide gels.ORF16'-'lacZ gene fusion plasmids. Plasmids pC6,

pMLB1034, pKB1-3, and pKB5-6 are shown in 'Fig, 3.Plasmid pC6 was constructed by inserting the BamHI frag-ment from lambd,a drif'18 which contains the entire rrnBoperon into the BamHI site of pBR322. Plasmid pC6 wasused as one source of rrnB DNA during the course of thisstudy. Plasmid pMLB1034 was the parent plasmid used togenerate the lacZ gene fusions. pMLB1034 contains the blagene and a truncated lacZ gene (ClacZ), with cloning sites(EcoRI, SmiaI, and Bam'HI) in a synthetic linker replacingthe first eight codons of lacZ (40). Derivatives of pMLB1034that made LacZ fusion proteins were transformed intoMC1009 and selected on Penassay medi,um (Difco) contain-ing ampicillin (100 ,g/ml). X-Gal (120 ,ug/ml) was alsoincluded in the medium so that colonies that made 'LacZfusion proteins could be identified by their blue color.Diagrams of the fusion plasmids derived from pMLB1034and pC6 are shown in Fig. 3.pKBl. The initial ORFJ6'-'lacZ fusion was constructed by

-2 +1I-SD-- Met Thr Ser Ser His His Gly ProGCCAGTGATAAACTGGAGGAAGGTGGGGATG ACG TCA AGT CAT CAT GGC OCT'-3.5- "-1 oZ 20Tyr Asp Gln Gly Tyr Thr Arg Ala Thr Met Ala His Thr Lys ArgTAC GAC CAG OO TAC ACA COGT GCTACA ATG GCOG CAT ACA MG AGA

30Ser Asp Leu Ala Arg Ala Ser Gly Pro His Lys Val Arg Ar SerAGC GAC CTC GCG AGA GCA AGC G4 CCT CAT AAA GTG CGT CGT AGT

Pro As T Ser Leu Gln Leu As Ser Met Lys Ser Glu Ser LeuCCG GAT TGG AGT CTG CAA CTC GAC TCC ATG AAG TMG GAA TM CTA

Val lie Val Asp Gin Asn A?a Thr Val Asn Thr Phe Pro Gly LeuGTA ATC GTG GAT CAG MAT GCC ACG GTG MAT ACG TTC CCG GGC CTT

70 50Val Hig Thr Ala Arg His Thr Met Gly Val Gly C s Lys Arg SerGTA CAC A G0CC COGT CAC ACC ATG GGA GTG GGT T A AG4 AGT

84ArqgAGO TAG

FIG. 2. DNA and amino acid sequence of ORF16. The translatedmolecular weight is 10,174. The SD sequence is underlined and inboldface. Two possible translation initiation codons, GTG -2 andATG +1, are marked and in boldface. Possible -10 and -35features of P16 are underlined. Italicized codons indicate those thatare infrequently used in E. coli genes.

J. BACTERIOL.

on February 20, 2021 by guest

http://jb.asm.org/

Dow

nloaded from

IN VIVO TRANSLATION OF AN rRNA SEQUENCE 1693

ligating a 651-bp ORF16'-containing Cpfl fragment from pC6into pMLB1034 DNA cleaved with BamHI. In pKB1, thefirst 57 codons of ORF16 are fused in frame to codon 8 oflacZ. This junction was confirmed by DNA sequence anal-ysis of a fragment spanning the fusion point by using M13and dideoxy sequencing (37).pKJI. pKB2 was made by inserting the hybrid trp-lac

promoter (tacP) into the EcoRI site before the 16S se-quences in pKB1. The approximately 250-bp tacP EcoRIfragment was obtained from pSL130 (22). This fragment alsocontains the lac ribosomal-binding site but no ATG startcodon (3). Since there are stop codons in all reading framesof the 16S sequence between tacP and ORFJ6, translation ofthe ORF16'-'lacZ fusion can only be initiated from theribosome-binding site associated with the start codon ofORF16.pKB3. pKB3, a control lacP-'lacZ fusion, was constructed

in pMC874 (10), because, for unknown reasons, the equiva-lent fusion in pMLB1034 was unstable. pMC874 contains atruncated 'lacZ gene starting with a BamHI site at codon 8.The lacP (14) segment was isolated from pSL140 (22) on aBglII fragment and ligated into BamHI-cleaved pMC874DNA. In addition to lacZ, pKB3 also contains the lacYAgenes.pKB4. pKB4 was made by cleaving pKB2 DNA with ApaI

and AatII, removing the 3' protruding ends with T4 DNApolymerase, and religating the blunted ends. This procedureremoved 263 bp of 16S sequence; 164 bases of ORF16(nucleotides 1195 to 1359 of the 16S sequence) and theORFJ6'-'lacZ fusion point remained intact..pKB5. Since the PLP2 promoters cannot be cloned into

plasmids unless they are followed by strong terminators (6),the ORFJ6'-'lacZ fusion from pKB1 was inserted into the

pCOR6 23S bla

AbC6A

pMLB1034

pKB1

pKB2

pKB4

pKBS =

Ai ¢ g dB

lacz iacr F

blaORF16'-'acZ

RFi C CibAla

tacP |OR BS6'-'lacZ

A/atac~P I/del RBS)'ORF16'-'lacZ

lacr bla

lacr bia

latc bla

PllP 16S ORF16'-'la. Z

smCP' l567W168 ORF16'-/acZ

pKB6 _=

'23S T1i.2 boa

'23S T1fi2 boa=_-c=FIG. 3. Plasmids used in the study of ORF16. Lines indicate

plasmid, chromosomal, or spacer DNA regions. Boxes indicategenes; large open boxes indicate ribosomal operon genes, withORF16 filled in; small open boxes indicate the bla gene; shadedboxes denote lactose operon segments. Asterisks mark endpoints ofpBR322 sequences in pC6 and its derivatives, pKB5 and pKB6. (Thesequences between asterisks are not drawn to scale.) A prime (')

indicates an incomplete gene; the gene is missing sequences fromthe 5' end if the prime precedes the gene designation and from the 3'end if it follows the designation. tacP is a hybrid trp-lac promoter.Del, Deletion; RBS, ribosome-binding site. The wavy lines witharrows show the direction of transcription of the bla gene. A, ApaI;a, AatII; B, BamnHI; b, BcII; C, CpjI; H, HindIII; h, HpaI; R,EcoRI; S, StuI. BIC, CIB, Ala, and Slh mark fusions of the twoindicated restriction sites.

center of the rrnB operon in plasmid pC6. In pC6, the P1P2transcript is stopped by the t1t2 terminators. pKB5 was madein two steps. First, the ORF16'-'lacZ fusion was obtained ona shorter fragment, which ends just after the lacZ gene. TheNdeI fragment which spans the 3' end of lacZ in pKB1, wasreplaced with the analogous NdeI fragment from plasmidpLacZl, which contains a multilinker with a StuI site in-serted into the lacZY intercistronic region (T. Eckhardt,personal communication). This intermediate, pKB1', wascleaved with ApaI and StuI, generating a 3,495-bp fragmentthat contains the ORFJ6'-'lacZ fusion. Second, this shorterfragment was ipserted into pC6 DNA which had beencleaved with ApaI and HpaI. The resulting plasmid, pKB5,carries the intact rrnB operon from the PWP2 control region tothe ORFJ6'-'lacZ fusion point. Sequences between position1356 of 16S and position 605 of 23S are replaced by the 'lacZsequence. The ORFJ6'-'lacZ Cpfl-BamHI fusion pQint ofpKB1 is preserved in pKB5.pKB6. pKB6 is a derivative of pKB5 in which the distance

between the rrnB P1P2 control region and the beginning ofORF16 is shortened by 567 bp. The sequence betweenpositions 81 and 648 of 16S was deleted by cleaving pKB5DNA with HindIll, religating, and selecting plasmids lackingthis fragment.ORFj6-cat operon fusion plasmids. Plasmid pKK232-8 (6)

is the parent plasmid of all cat fusion constructiQns in thisstudy. pKK232-8 contains the cat and bla genes and amultilinker site at the proximal end of the cat gene. Themulticloning site and cat gene are bracketed by the strongrrnB transcription terminators t1 and t1t2 to prevent otherplasmid genes from influencing cat expression (6). In addi-tion, translational stop codons are present in the leadersequence of the cat gene in all three reading frames. Theamount of Cat enzyme activity is therefore proportional tothe amount of transcription and does not reflect secondaryeffects such as translational starts that may have beenintroduced on the inserted sequences (6). Plasmid pSL100was used as a promoter probe vector in this study. pSL100 isa derivative of pKK232-8 in which the SmaI site has beenreplaced by both a BglII and ClaI site (22).pKB7. We cloned the rrnB tandem promoters into

pKK232-8 to create an rrnB pIP2-cat fusion to be used as apromoter control plasmid. As a source of rrnB sequence, weused pBK17, a de novo isolate containing the rrnB operon inthe BamHI site of pBR322 (5). A 2,700-bp Sall and SmaIfragment from pBK17 contains the rrnB control region andthe first 613 nucleotides of the 16S gene plus approximately1,900 bp before Pl. This fragment was isolated, the Sallsticky end was filled in by using Klenow fragment anddeoxynucleoside triphosphates, and the fragment was li-gated into pKK232-8 DNA digested with SmaI. Transform-ants were selected on plates containing 25 Rg of chloram-phenicol per ml, and the construction was verified by restric-tion mapping and Southern hybridization.pKB8-13. We searched for rrnB internal promoters on a

5,400-bp Bcll fragment isolated from pC6. This fragmentcontains most of the rrnB operon, from position 14 in 16S toposition 38 of ORFII, the open reading frame following therrnB terminator region (7). Cpfl and HpaII digests of the 1BclIfragment were shotgun cloned into pSL100 DNA digestedwith BamHI or ClaI. Promoter-containing fragments wereselected for resistance to a low chloramphenicol concentra-tion (5 pug/ml), followed by restriction mapping and Southernblotting analysis. Two isolates were subsequently identifiedas containing sequences from the 16S gene, i.e., a 651-bpCpfI fragment (pKB8) and a 162-bp HpaII fragment (pKB9).

1-1I1hr" 777V-...III

,I 4ft-e5 t-.a

=

VOL. 169, 1987

on February 20, 2021 by guest

http://jb.asm.org/

Dow

nloaded from

1694 BERG ET AL.

-8 -SD- - 2 WMet Thr Ser Ser His His GI ProGCCAGTGATAAACTGCGAGGAAGGTGGGATG ACG TCA AGT CAT CAT OCCCT

Tyr Asp Gln Gl Tyr Thr Arg Ala Thr ige Ala His Thr Lys ArTAC GAC CAG GG TAC ACA OGT GCT ACA ATG GOG CAT ACA MG AUSer Asp Leu Ala Arg Ala Ser Gly Pro His Lys Val Arg Arg SerAGC GAC CTC GCG AGA GCA AGC GGA CCT CAT AAA GTG OGT OCGT AGT

ProAsp T Ser Leu Gin Leu Asp Ser et Lys Ser Glu Ser LeuCOG GAT TGG AGT CTG CAA CTC GAC TOC ATG MG TOG GAA TOG CTA

ORF16' 1 'IacZ~~~~~~~~~~~~18

Val Ile d? Asp PLo Val Val Lou Gin Ar Ar As Trp Glu AsnGTA ATC GTG GAT CCC GTC GTT TTA CAA CGT CGT GAC TM G4A AAC

FIG. 4. Sequence of the ORFJ6'-'lacZ around the fusion. TheSD sequence is in boldface and underlined. Possible initiationcodons for the fusion protein are numbered and in boldface (GTG-8, GTG -2, ATG +1, ATG +18, ATG +48, and GTG +56). TheORF16'-'lacZ fusion point is indicated by a vertical line above thesequence, and the lacZ DNA sequence and amino acids are inboldface. The numbers 8 and 18 above the 'lacZ sequence denotethe amino acid number in wild-type LacZ.

Further localization of the promoter in 16S was accom-

plished by digesting the 651-bp Cpfl with AatII or HinPI indifferent experiments. The 156-bp AatII-CpJl subfragmentwas cloned and tested in plasmid pKK232-8 cleaved withSmaI and BamHI (pKB10). The 136-bp HinPI subfragmentwas cloned in pSL100 DNA cleaved with ClaI (pKB11).Promoter activity was also detected on a 786-bp Cpfl

fragment (pKB12) and on a 303-bp HpaII fragment (pKB13)that were subsequently identified as coming from the 23Sgene and on a 1,063-bp Cpfl fragment which, we found,spans the 3'-end of the 23S gene and the 5'-end of ORFII(pKB14).pKB20. pKB20 is a tacP-ORFJ6-cat operon fusion plas-

mid that was constructed to test ORF16 expression in themaxicell system. In this plasmid, both ORF16 and cat havetheir own ribosome-binding sites, ATG start codons, andtranslation termination codons. A 350-bp HinPI partial-digestion fragment containing the entire ORF16 sequence

was isolated from pC6 DNA. This fragment was ligated intopSL130 (22) that had been cleaved with ClaI. (pSL130 ispSL100 with tacP in its BglII site.) The resulting transform-ants were screened by restriction analysis, and one was

identified that contains the two contiguous HinPI fragmentswhich span ORFJ6 in the forward orientation (pKB20).

Strains. Strain KK588 was made recA56 by cotransduc-tion of recA with srl::TnJO from strain MC1009. A Plcmllysogen ofMC1009 was selected at 32°C on plates containing5 ,ug of chloramphenicol per ml. A lysate was prepared and

used to transduce KK588 (27). The transductants were

selected on plates containing 5 ,ug of tetracycline per ml, andrecA56 colonies were identified by their increased sensitivityto UV light.

RESULTS

In vivo translation of ORF16'-'lacZ gene fusions. We used a

lacZ fusion vector to determine whether ORF16 is trans-lated. Expression of LacZ activity in the plasmid pMLB1034depends on the in-frame fusion of a target gene fragment,with its accompanying ribosome-binding sequence and an

upstream promoter, to the truncated 'lacZ gene of thevector. We noted that a Cpf[ fragment from rrnB DNA couldbe ligated into the BamHI site in pMLB1034 to give an

in-frame ORFJ6'-'lacZ fusion. The recombinant plasmidpKB1 was isolated, and the ORFJ6'-'lacZ junction was

sequenced to verify the reading frame at the fusion point(Fig. 4). The fusion joins the first 57 codons of ORF16 withcodon 8 of lacZ. Cells containing pKB1 produced very paleblue colonies on X-Gal indicator plates, suggesting that thesequence preceding ORFJ6 does not contain a promoter forthe open reading frame. (The low level of LacZ activitymade by pKB1 probably reflects readthrough from plasmidpromoters (38). Alternatively, promotion from P16 that ispresent within the proximal ORF16 sequence (see below)plus initiation at secondary ATG codons in ORF16 or lacZsequences could account for the low LacZ activity observedwith pKB1.) Next, we placed a hybrid trp-lac promoter(tacP) before the ORF16 SD sequence and ATG start codonof pKB1. The resulting plasmid, pKB2, gave blue colonieson X-Gal indicator plates. The LacZ activities of thesefusions are shown in Table 1. pKB1 had very little activityon its own but with the addition of the tacP fragment, fusionLacZ activity was increased 25-fold (pKB2). Comparison ofpKB2 with a lacP-'lacZ control plasmid (pKB3) showed thatexpression of the tacP-ORF16'-'lacZ fusion was much lessefficient (Table 1); pKB3 had almost 500 times more LacZactivity than pKB2. We concluded from these experimentsthat ORF16 can be translated in vivo if a good promoter isadded upstream but that expression of the tacP-ORFJ6'-'lacZ fusion is inefficient. We also noted that the promoterassociated with ORF16 (P16) did not result in significantexpression of fusion LacZ. This is consistent with theobservation (see below) that P16 is located after the ORF16start codon.

Size of the ORF16'-'LacZ fusion protein. Evidence thattranslation begins at the AUG + 1 start codon of ORF16 was

obtained from the size of the ORF16'-'LacZ fusion protein.pKB2 was transformed into strain SE5000. This strain con-

TABLE 1. Activity of ORFJ6'-'lacZ fusionsa

Plasmid Promoter Gene fusion RBSb Units of Units of Lac/Bla ratio

pMLB1034 0.00 0.04pKB1 ORF16' 0.19 0.03 6.3pKB2 tacP ORF16' 6.42 0.04 149.3pKB3 lacP lacZ' 3037.9cpKB4 tacP (ARBS)d 'ORF16' 0.98 0.04 22.4pKB5 rrnB P1P2 ORF16' 0.71 0.03 22.7pKB6 rrnB PLP2 (A567 bp)e ORF16' 1.65 0.03 55.3

a Plasmids are all in strain KK588 recA. In all cases, the fusion indicator is 'lacZ. For LacZ activity, 1 U is 1 nmol of o-nitrophenyl-a-D-galactopyranosidehydrolyzed in 1 min at 28°C. For Bla activity, 1 U is 1 ,umol of cephaloridine hydrolyzed in 1 min at 37°C.

b RBS, Ribosome-binding sequence (SD sequence and ATG start codon).c LacZ activity for equivalent cell mass.d 5' deletion of SD sequence and ATG + 1 codon of ORF16.' Internal deletion of 567 bp of 16S sequence between promoter and ORF16.

J. BACTERIOL.

on February 20, 2021 by guest

http://jb.asm.org/

Dow

nloaded from

IN VIVO TRANSLATION OF AN rRNA SEQUENCE 1695

tains an F' lac episome that carries lacIq and A(lacZ)MJ5 (adeletion that removes codons 11 to 41 of lacZ and results inproduction of a 112-kilodalton (kDa) LacZ omega fragment).In this strain, tacP is controlled by the lacI gene product andthe addition of an inducer (IPTG) is necessary for itsexpression. Cellular proteins were labeled with [35S]methio-nine and examined on SDS-polyacrylamide gels. An autora-diogram of the labeled proteins is shown in Fig. 5; lanes 5and 6 show the proteins from the wild-type lac strain GM33.Examining the controls first, we found that LacZ (116 kDa)was absent in the noninduced extract and present in theinduced extract (lanes 5 and 6). Wild-type LacZ was absentin the host strain SE5000, but the 112-kDa tacZ omegafragment was produced by this strain on induction withIPTG (lanes 1 and 2). We found that the experimentalplasmid pKB2 made a new 121-kDa protein in response toadded inducer (lanes 3 and 4). (Lane 4 also shows the112-kDa omega fragment, specified by the host strainSE5000.)There are seven codons in the 16S gene open reading

frame sequence that could initiate fusion peptide translation.Except for GTG -37, which is not shown, these codons areindicated in Fig. 4. The calculated sizes of the fusionpeptides that would be made if translation started from thesecodons are GTG -37 (128.4 kDa); GTG -8 (123.0 kDa);GTG -2 (122.2 kDa); ATG +1 (122.0 kDa); ATG +18 (120.1kDa); ATG +48 (116.7 kDa); and GTG +56 (115.8 kDa). Theexperimental result of 121 kDa (Fig. 5) is probably notsufficiently accurate to distinguish among peptides that startat the four codons from GTG -8 to ATG +18. To decide:

..L

FIG. 5. SDS-polyacrylamide gel analysis of the ORF16'-'LacZhybrid protein. Whole E. coli cells were pulse-labeled with 3 p.Ci of[35S]methionine per ml, boiled in lysis solution, and loaded on a7.5% polyacrylamide gel. After electrophoresis, the gel was driedand the film was exposed for 3 days. Lanes 1 and 2: labeled cellextracts of the host strain SE5000 in the absence or presence ofIPTG, respectively; the 112-kDa omega fragment is marked by a dotin lane 2. Lanes 3 and 4: cell extracts of the strain containing thetacP-ORFJ6'-'1acZ fusion, pKB2, in the absence or presence ofIPTG. The omega fragment and the fusion are marked by a dot inlane 4. Lanes 5 and 6: cell extracts of the wild-type lac strain GM33in the absence and presence of IPTG. Wild-type LacZ (116 kDa) ismarked by a dot in lane 6. Equal amounts of cell extract wereapplied to all lanes, except for lane 6 in which the cell extract wasdiluted fourfold.

I.'

1 2 3 4FIG. 6. Autoradiogram of labeled proteins from maxicells. Lane

1 is a control of the maxicell strain CSR603 without a plasmid. Inlane 2, a control plasmid, pBD2720, is present in CSR603. pBD2720encodes Bla (31.4 kDa) and the RelB protein (8.7 kDa). Lane 3shows the protein bands produced by pKB20, the plasmid encodingBla, Cat (24.2 kDa), and ORF16 (10.7 kDa). Lane 4 is a controlshowing the production of ribosomal proteins Li (25.7 kDa), L10(18.1 kDa), Lii (15.6 kDa), and L7/12 (13.3 kDa) from the plasmidpNF1344.

whether the ATG + 1 codon (and the GTG codons before it)or ATG +18 is the major start codon, we deleted a 217-bpApaI-AatII segment from pKB2. (AatII cuts within the +2codon of ORF16 as represented in Fig. 4.) The deletionpKB4 had sevenfold less LacZ activity than pKB2 had(Table 1). Therefore, the preferred start codon must be oneof the three, i.e., GTG -8, GTG -2, or ATG +1. We choseto represent the principal start as ATG + 1 rather than aseither of the GTG codons for the following reasons. (i) ATGis a more efficient start codon than GTG (29). (ii) The SDsequence for GTG -2 and ATG + 1 (GGAGG) is better thanthe SD sequence for GTG -8 (GGAG) (sequence not shownin Fig. 4). (iii) The spacing between the SD sequence and thestart codon is the most favorable for ATG +1 (9 bases versus3 bases for GTG -2 and 7 bases for GTG -8). We concludedfrom these experiments that pKB2 specifies a peptide that islarger than wild-type LacZ. The size of this new peptide,together with the observation that activity is decreased whenATG +1 is deleted, suggests that translation originates nearthe ATG + 1 codon of ORF16 (Fig. 4). The lower butsignificant level of LacZ activity of pKB4 probably resultsfrom weak translation initiation at downstream start codons,such as ATG +18, ATG +48, or GTG +56 in ORF16, oreven at start codons within the lacZ sequence.

Effect of additional ribosomal sequences on expression ofORF16. The plasmids used in the previous experimentscontain only part of the 16S sequence before the ORFJ6'-'lacZ fusion point. Possibly, some rrn control region func-tion, such as AT or some other rrn-specific mechanism isnecessary for good expression of ORF16. We tested theeffect of the ribosomal control region and additional 16Ssequences by reconstructing the ORF16'-'lacZ fusion in themiddle of the rrnB operon. This was accomplished byreplacing a segment spanning the rrnB spacer region inplasmid pC6 with a shortened ORF16'-'lacZ fusion fragment(see Materials and Methods). The resulting plasmid pKB5

VOL. 169, 1987

on February 20, 2021 by guest

http://jb.asm.org/

Dow

nloaded from

1696 BERG ET AL.

TABLE 2. Activity of promoter-cat fusions

Plasmid Promoter Fragment Size (bp) Cat/Bla ratio

pSL140 lacP Bg/II 221 1.0pKB7 rrnB PP2 Sal I-XmaI 2,700 30.6pKB8 P16 CpO 651 0.6pKB9 P16 HpaII 162 0.5pKB13 P23 HpaII 303 0.o4apKB14 PORFII Cpfl 1,065 0.04

a The Cat/Bla ratio of a control plasmid lacking a promoter for the cat geneis <0.005.

carries the entire sequence from the promoter region to theORFJ6'-'lacZ fusion point, including sequences for the P1P2promoters, the AT region (22), the 5' half of the 16S rRNAprocessing stalk (43), and 16S rRNA (Fig. 3). The 3' end ofthe 'lacZ gene in pKB5 is fused to a sequence within the 23Sgene. pKB5 contains no lacY sequences. Cells containingpKB5 formed blue colonies on X-Gal plates, and the LacZactivity is shown in Table 1. We found that the ORF16'-'lacZfusion in pKB5 was translated in vivo but that the activitywas lower than expected. The rrnB PIP2 promoters areapproximately five times as strong as tacP (K. Berg andC. L. Squires, unpublished results), yet the LacZ activity ofpKB5 was about 1/10 the activity of pKB2. Several possibleexplanations for this discrepancy will be considered in theDiscussion section. We examined one possibility experimen-tally (that 16S sequences inhibit ORF16 translation) bydeleting the 567-bp HindIII fragment from the 16S genesegment in pKB5 (removing nucleotides 81 to 648 of the 16Ssequence) (Fig. 3, pKB6). This increased expression offusion LacZ twofold, suggesting that the extra 567 nucleo-tides in pKB5 somewhat inhibit expression of ORF16. Thefusion LacZ activity made by pKB6 was still only one-thirdas much as that obtained with tacP in pKB2. We concludedfrom these experiments that the ORFJ6'-'lacZ fusion can betranslated when it is reconstructed in the middle of the rrnBoperon but that the activity was even lower than wasobtained with the tacP-ORF16'-'lacZ fusion plasmid. Nei-ther the rrnB AT mechanism nor the presence of other rrnsequences increased expression of ORF16.Attempted demonstration of the ORF16 peptide in

maxicells. We examined a tacP-ORF16-cat operon fusionplasmid (pKB20) in the maxicell strain CSR603 for theproduction of the 84-amino-acid ORF16 peptide (Fig. 6). Wewere unable to detect the predicted 10.17-kDa peptide (lane3), but we could identify Bla (31.4 kDa, lanes 2 and 3), Cat(24.2 kDa, lane 3), RelB protein (8.7 kDa, lane 2), andribosomal proteins (lane 4) Li (25.7 kDa), L10 (18.1 kDa),Lli (15.6 kDa), and L7/12 (13.3 kDa). The faint radioactivebands present in the 9-to-11-kDa region of lane 3 were alsoobserved in controls labeling the parent plasmid of pKB20and therefore are not specified by ORF16 on the plasmid(data not shown). We- concluded that it is possible todemonstrate the synthesis of other peptides which are aboutthe same size as the ORF16 peptide but that no ORF16peptide was detected.

In vivo identification of promoters within the rrnB operon.In vitro binding ofRNA polymerase to rrnB DNA results ininitiation of transcription from several sites within the rrnBoperon (39). We examined these putative internal promotersin vivo by subcloning small restriction fragments from therrnB operon into a promoter-testing plasmid. HpaII and Cpflrestriction fragments derived from a BclI fragment that spansmost of the rrnB operon (Fig. 1) were cloned into pSL100, a

vector that carries the cat gene but no promoter (22).Promoter-containing fragments were selected by their abilityto confer resistance to chloramphenicol. We found threedifferent regions that conferred chloramphenicol resistance,one each within the 16S and 23S genes (P16 and P23) and oneafter the rrnB terminators (PORFII). The activity of thesepromoters relative to lacP and rrnB PWV2 is shown in Table 2.P16 was about 1/2 as active as lacP, and P23 and PORFII were1/15 as active as P16. By contrast, rrnB P1P2 was 30 times asactive as lacP.The presence of promoter activity on the Cpfl 651-bp

fragment (nucleotides 705 to 1356 of 16S) and a small(approximately 150 bp) HpaII fragment suggests that P16must lie between positions 1140 and 1302 of the 16S se-quence (the limits of an HpaII 162-bp fragment within theCpfl 651-bp fragment) (Fig. 7). A unique NruI site at position1264 was used to identify the HpaII 162-bp fragment. Thisfragment overlaps the beginning of ORF16; therefore, itseemed possible that P16 might be a promoter for ORF16.This idea was checked by cleaving the Cpfl fragment justafter the ORFJ6 ATG +1 codon, at an AatII site, and testingthe two parts for promoter activity by using growth onmedium containing chloramphenicol as the assay procedure(data not shown). Chloramphenicol-resistant transformantswere obtained only with plasmids containing the 156-bpAatII-Cpfl fragment which follows the ATG codon (nucleo-tides 1190 to 1356 of the 16S sequence) (pKB10). Thisexperiment placed P16 entirely within ORF16. P16 was lo-cated more precisely by the detection of promoter activityon a 136-bp HinPI fragment (nucleotides 1106 to 1242)(pKB11). This places the promoter in a 51-bp region betweenthe AatII and HinPI sites (Fig. 7).

P23 was located on a 786-bp Cpfl fragment (pKB12) and onan HpaII fragment (pKB13) of approximately 300 bp. TheCpft fragment contains a 303-bp HpaII fragment, which

T1 '16S-ORF16' cat T1T2 T1T2 bJa

CpfI

Hpall: Hpall

A

Aat 11 Cpf I

I .

HinP I HinP I

:"6:

pKB8

pKB9

pKBIO

pKB1I

FIG. 7. Location of promoter activity within the ORF16 se-quence. The top line is a diagram of the Cpfl 651-bp fragment ligatedinto the multicloning site of the pSL100 promoter-testing plasmid(pKB8). Subsequent lines show the insert that was ligated into themulticloning site of pSL100 and pertinent restriction sites. Thedotted vertical lines delimit the 51-bp region containing the P16promoter activity. ORF16 sequences are shown as large closedboxes, and other 16S rrn sequences are shown as large open boxes.The rrnB terminator sequences are depicted by the smaller shadedboxes. The bla gene is represented by a smaller open box. Cp, Cpfl;Ba, BamHI.

J. BACTERIOL.

on February 20, 2021 by guest

http://jb.asm.org/

Dow

nloaded from

IN VIVO TRANSLATION OF AN rRNA SEQUENCE 1697

suggests that P23 lies between nucleotides 184 to 487 of the23S sequence (the limits of the HpaII 303-bp fragment).PORFII, located on a 1,065-bp Cpfl fragment (pKB14), hasbeen described previously (7). It is likely that PORFII is thepromoter for the biotin repressor operon (16). The relativelocations of the P16, P23 and PORFII promoters are indicated inFig. 1.

DISCUSSION

In this study we used in vivo techniques to examinetranscription and translation from sequences within the E.coli rrnB operon. We showed that an open reading framenear the 3' end of the 16S gene (ORF16) could be translatedin vivo. The rrnB operon also includes two internal promot-ers (P16 and P23). We determined the locations and relativestrengths of these promoters, and we found that P16 lieswithin ORF16. These sequences specifying P16 and ORF16are highly conserved in the small subunit rRNA genes ofmost procaryotes and plant organelles (the sequence com-parisons are described below).

In vivo translation of ORF16. We used a fusion to the 5'end of the lacZ gene on a plasmid to determine whetherORF16 is translated in vivo. Protein-labeling experimentswere used to show that a fusion protein larger than wild-typeLacZ was made and to locate the probable start codon ofORF16. In these experiments, an upstream promoter had tobe added for optimal expression of the fusion LacZ; how-ever, even with the best promoter, the expression was veryinefficient.We used the size of the pKB2 fusion LacZ to help

distinguish among seven possible start codons for the openreading frame. (The full extent of the open coding region,from nucleotides 1020 to 1442, is not shown in Fig. 2.)Brosius and co-workers noted an excellent SD sequence(GGAGG) 10 bases before an ATG at position 1188 of their16S sequence (8). This codon (ATG +1 in Fig. 2 and 4) liesnear the middle (codon 58 of 141) of the open coding region.We concluded that this codon is the major start point ofORF16 translation, although GTG -2 may also contribute toinitiation. The 121-kDa fusion protein specified by pKB2 wasabout 5 kDa larger than wild-type LacZ. The pKB4 deletionruled out the ATG +18, ATG +48, and GTG +56 codons aspossible starts. GTG -8 had the slightly weaker SD se-quence (AGGAG; sequence not shown in Fig. 2 and 4) andwould make a fusion protein somewhat larger than the onewe found. GTG -2 and ATG +1 are both preceded by theGGAGG SD sequence; however, translation initiation ismore efficient at AUG than it is at GUG start codons, and thethree-base spacing between the SD sequence and GTG -2 issub-optimal (29).An upstream promoter must be added to express ORF16.

The initial experiments with pKB1 and pKB2 showed thatthe promoter associated with the ORF16 sequence, P16, didnot cause significant synthesis of a fusion peptide (Table 1).This was consistent with our finding that P16 activity was onthe 156-bp AatII-CpJl fragment and therefore lies within theORF16 sequence after the ATG + 1 codon (Fig. 7). To obtainsignificant expression of the ORF16'-'lacZ fusion, it wasnecessary to place the tacP (pKB2) or rrnB P1P2 (pKB5)promoters upstream from ORF16 translational start signals.Even then, expression of the gene fusion was orders ofmagnitude lower than expected from the strength of thesepromoters. The LacZ activity of pKB2 (in which the pro-moter was tacP and the translational start signals were from

ORF16) was about 500 times less than for the pKB3 control(in which the promoter was the weaker lacP and the trans-lational start signals were from lacZ).There are several possible explanations for the low levels

of ORF16-LacZ activity that we observed. Our tentativeconclusion is that the low activity is caused by one or moretranslational impediments. However, the possibility existsthat expression is limited at either transcription or transla-tion.ORF16 expression might be affected by premature tran-

scription termination. rRNA operons have an AT mecha-nism to protect their transcripts from premature termination(15, 22). It seemed plausible that a transcript containingORF16 and other 16S sequences might be susceptible topremature termination and thus would be protected by therrn AT system. Also, it is possible that other sequences in16S might have a stabilizing effect on the ORF16 transcript.However, the AT sequence did not improve ORF16 expres-sion. Neither pKB5 nor pKB6, which both contain the ATregion, increased fusion LacZ activity. In fact, the some-what poorer activity obtained with these plasmids remainsunexplained, and the twofold increase in activity of pKB6over pKB5 indicates, if anything, that early 16S structuralsequences had an inhibitory effect on expression.The low level of ORF16 expression might be caused by

RNA degradation. It has been shown that different mRNAshave widely differing stabilities in vivo (30). Although theintact 16S rRNA is a very stable molecule, it is possible thatthe transcript of a 16S gene segment is unstable. Thishypothetical instability of the ORF16 segment might, in turn,destabilize the ORFJ6'-'lacZ mRNA. Our experiments didnot address this possibility.

Translational mechanisms that might be responsible forthe reduced expression of ORF16 include the following: (i)the inhibition of translation initiation by secondary structurein the mRNA; (ii) autogenous regulation of translation; (iii)peptide instability; and (iv) a decreased rate of translationbecause of rare codons.

(i) It has been shown that secondary structure encompass-ing the AUG start codon of the lacZ gene decreases trans-lational activity (29). The secondary structure proposed formature 16S rRNA involves the region surrounding the ribo-somal-binding site and AUG start codon of ORFJ6 in exten-sive base pairing (41). It is quite possible that this secondarystructure inhibits the initiation of ORF16 translation. Othersecondary structures formed between more distant parts ofthe 16S rRNA molecule may also affect translation ofORF16. In the case of pKB5 and pKB6, expression ofORF16 was increased twofold when 567 bp between the 5'end of 16S and ORF16 were deleted. The role played bysecondary structure occlusion of the ORF16 translationinitiation region could be assessed by replacing the SD andATG region with an initiation sequence that reduces second-ary structure in this region.

(ii) Autogenous regulation of ORF16 translation mightkeep peptide levels low even if transcription levels varysignificantly. This type of regulation is found in some E. colioperons in which an increase in gene dosage does not resultin a commensurate increase in gene product (31). We foundthat fusion LacZ activity did not vary much when we

replaced the tacP promoter (pKB2) with the rrnB PJP2promoters (pKB5 and pKB6), even though other experi-ments have shown that the rrnB PJP2 is five times strongerthan tacP (K. Berg and C. L. Squires, unpublished results).If autogenous regulation is involved in setting the level ofORF16 expression, then a specific sequence associated with

VOL. 169, 1987

on February 20, 2021 by guest

http://jb.asm.org/

Dow

nloaded from

1698 BERG ET AL.

TABLE 3. ORF16 translational start sequences inother organismsa

Length ofORF16 (no.Organism Homologous region of amino

acids)

EubacteriaAgrobacterium

tumefaciensPseudomonas

testosteroniEscherichia coli

rrnBEscherichia coli

rrnAProteus vulgarisBacillus brevisBacillus subtilisHeliobacteriumchlorum

Mycoplasmacapricolum

Mycoplasma sp.Bacteroides

fragilisFlavobacteriumheparinum

Desulfovibriodesulfuricans

Myxococcusxanthus

Anacystis nidulans

ChloroplastsChlamydomonas

reinhardiiEuglena gracilisNicotianatabacum

Zea mays

Plant mitochondriaOenothera sp.Triticum aestivumZea mays

ArchaebacteriaHalobacterium

cutirubrumHalobacteriumhalobium

Halobacteriumvolcanii

Halococcusmorrhuae

Methanobacteriumformicicum

Methanococcusvannielii

Methanospirillumhungatii

Sulfolobussolfataricus

Thermoproteustenax

Nonplantmitochondria

13 species

Eucaryotes15 species

AGAGGAAGGTGGGGATG

GGAGGAAGGTGGGGATG

GGAGGAAGGTGGGGATG

GGAGGAAGGTGGGGATG

GGAGGAAGGTGGGGATGGGAGGAAGGCGGGGATGGGAGGAAGGTGGGGATGGGAGGAAGGCGGGGATG

GGAGGAAGGTGGGGATG

GGAGGAAGGTGGGGATGTGAGGAAGGTGGGGATG

AGAGGAAGGAGGGGACG

GGAGGAAGGTGGGGATG

GGAGGAAGGTGGGGATG

GGAGGAAGGTGGGGATG

GGAGGAAGGTGGAGATG

GGAGGAAGGTGGAGACGGGAGGAAGGTGGAGATG

GGAGGAAGGAGGAGATG

GGAGGAAGGAGGAGATGGGAGGAAGGAGGAGATGGGAGGAAGGAGGAGATG

GGAGGAAGGAACGGGCA

GGAGGAAGGAACGGGCA

GGAGGAAGGAACGGGCA

GGAGGAAGGAACGGGCA

GGAGGAAGGAGTGGACG

AGAGGAAGGAGCGGGCA

GGAGGAAGGAAUGGGCA

GGAGGAAGGAGGGGGCC

GGAGGAAGGAGGGGGCG

No homology

No homology

the translation initiation region is probably necessary for thiscontrol mechanism to work. Our proposed experiment toreplace the SD and ATG region with another translationinitiation sequence might alter or eliminate this proposedautogenous regulation site. In addition to this experiment,we are presently making antibodies to synthetic ORF16peptides to improve the sensitivity of the assay for ORF16peptide. They will be used to probe Western blots of E. coliproteins to determine under what conditions ORF16 is madefrom wild-type chromosomal rrn operons.

(iii) The ORF16 peptide might be unstable. If this were so,the fusion of ORF16 sequences to the lacZ gene might alterthe stability of the fusion LacZ. We performed the maxicellexperiments to see whether we could detect a 10.17-kDapeptide made from a tacP-ORF16-cat operon fusion plas-mid. Our inability to detect this peptide might reflect a lowlevel of ORF16 translation, or it might reflect rapid degrada-tion of the peptide. The long labeling times required inmaxicell experiments make them inappropriate for studyingunstable proteins. The controls in the experiment show thatsmall stable proteins such as the RelB protein (7.4 kDa) orthe several ribosomal proteins (13 to 26 kDa) could be easilyseen.

(iv) The use of codons that occur infrequently in E. coligenes has previously been linked to the translational controlof several genes (19). ORF16 contains more than 25% ofthese rare codons. Genes that are highly expressed typicallymake use of less than 12% of rare codons, whereas genesthat are expressed at a lower rate (e.g., regulatory genes)contain more rare codons (19). The rare codons located inthe ORF16' sequence of the fusion might contribute to thelow level of fusion LacZ activity, but it seems unlikely thatthis could be the sole cause of the large decrease in activitythat we observed.Promoter activity within the rrnB operon. Experiments

showing in vitro binding and transcription initiation in therrnB operon detected RNA polymerase binding to restrictionfragments from within the 16S and 23S genes (39). Similartranscription initiation sites in an rrn operon of C. crescentushave been identified in vitro with C. crescentus and E. coliRNA polymerases and in vivo in E. coli with plasmidscontaining the C. crescentus genes (2, 12). We used apromoter-detecting plasmid to locate and measure the activ-ities of promoters within the E. coli rrnB operon. We foundthat the P16 activity lies in a 51-bp region within the ORF16sequence, and P23 is on a 303-bp fragment near the 5' end of23S. These in vivo activities were located in the sameregions that were identified by the previous experimentswith E. coli (39) and C. crescentus (2). We found that P16 wasabout 1/2 as active as lacP, whereas the P23 promoter wasabout 1/30 as active. Examination of the E. coli rrnBsequence with a promoter-searching program (28) revealedthat the region containing P16 possesses -35 and -10 fea-tures characteristic of procaryotic promoters, although thescore for this promoter was not especially good (Fig. 2). Thefragment containing P23 also contains several potential pro-moter sequences.The function of P16 has not been determined. Our results

placed P16 within ORF16, and we found that this promoterdid not cause significant expression of the ORFJ6'-'lacZfusion. Therefore, P16 cannot be the promoter for the ORF16peptide described in this study. Other workers have specu-lated that the internal promoter (P16) in the C. crescentus 16Sgene might be involved in expression of an open readingframe 89 bases downstream of the promoter (2). The SDsequence and ATG codon in this region are highly conserved

a SD sequences and start codons are in boldface. Sequence data for E. colirrnA is from reference 34; for B. brevis, sequence data are from reference 19.For all other organisms, sequence data are from reference 17.

J. BACTERIOL.

on February 20, 2021 by guest

http://jb.asm.org/

Dow

nloaded from

IN VIVO TRANSLATION OF AN rRNA SEQUENCE 1699

TABLE 4. Comparison of ORF16 N-terminal amino acid sequences% Homologyb

Organism Sequencea Amino Nucleicacid acid

EubacteriaE. coli rrnB VGMTS SHHGPYDQGYTRATMAHTKRSDLARA SGP HKVRRS PDWS LQLDSMKS E 100 100B. brevis ..MTS nHH a PYD I GYTRATMvg t t g c yLAR g r q s I k t n I s s d c r LQL a yMKS E 60 74H. chlorum MTSnHHaPYv 1GYTRATMgg t nRSeaerws ep e kavps sdc SLQLeSMKaE 56 71M. xanthus VGMTS S pHG I YDQGYTRATMAg t e r c qpAR g s o 63 73P. testosteroni VGMTS S pHGPYr wGYTRh TMAg TKg c qpAR g s o 63 70B. subtilis VGMTS nHHa PYD I GYTRATMdr TKg s e I p r g o 61 78Mycoplasma sp. VGMTS nHH a PYv I GYTRATMAg TKs c np vk g s o 57 67B. fragilis VGMTS n qHGPYv rGYTRvTMgg t eg s o 55 72A. tumefaciens VGMTS S pHGPYg I GYTRATMvv t vg s e t am s s o 51 72A. nidulans vw t TS SHHa PYi I GYTRt TMl r t ar r eaAP o 48 73M.capricolum VGMTlnyyalyvlGYTRATMAgTKscnpvkgso 42 56D. desulfuricans VG t TSSHHGPYao 76 85E. coli rrnA VGMTS SHH TGPI r pg r h t c y ng a yk e k t r t s reqadlikcvvvrigvcnstpo 19 98P. vulgaris VGMTI s t Tr i ma Its r at h v 1 qwq i q re at s r e q a e I i k s v v v r i gv c n s t p o 8 93

ChloroplastN. tabacum v r MTS SHH a PYa I gd TRATMAg TKg r dpAR v s o 54 72Z. mays . .mrpSHHaPYalgdTRATMggTKgrDLARvso 52 70E.gracilis vr tTSSHHIaPYi IGYTRATMvkt iscnfvkmso 42 60C.reinhardii vrMTSSqhaPYi IgfTRnTMvgt iRSelvrkso 36 73

MitochondriaT.aestivum VGMTSSpHGPYg I ghTRATMAmtmgskavr r sevs g k i asvr i v I cnsgt o 32 64Z.mays VGMTSSpHGPYg I ghTRATMAmtmgskavr r ses g k i asvr i v I cnsgt o 32 64Oenothera sp. VGMTS S p hI a I mg wa t h v I q wq I qw e a r I o 20 71

AConsensus sequence VGMTS SHHGPY- LGYTRATMAGTK

a The best alignment between the sequence from E. coli rrnB and each of the other sequences was obtained by requiring matches of two or more contiguous ami-no acids. Homologies with E. coli rrnB are indicated by an uppercase letter. Amino acids represented by lower case letters do not meet the requirement for two ormore contiguous matches. Arrows between amino acids in some sequences mark the approximate location of single base additions ( T ) and deletions ( I ) withrespect to E. coli rrnB. The amino acid sequences for E. coli rrnB, B. brevis, and H. chlorum are truncated 50 amino acids after the first methionine; the letter omarks the termnination codon in the remaining sequences.

b Amino acid homologies were calculated as described in footnote a. Nucleic acid homology required matches of five or mnore contiguous bases.

in other organisms and are present in the E. coli 16S gene inthe same open coding frame as ORF16 (this ATG is codon+48 in Fig. 4). However, we found that this translation startwas not very active in our fusion plasmid, pKB1, whichcontains P16, the SD sequence, and ATG +48 fused in frameto the 'lacZ gene (Fig. 4). It has also been suggested that thefunction of this promoter might be to initiate transcription ofthe rrn spacer region tRNA genes (2, 39). In other experi-ments that are not presented here, we found that P16 activityis not growth rate-dependent (K. Berg and C. L. Squires,unpublished results). It is possible that P16 supplementstranscription of spacer tRNAs when transcription from PLP2is limited during lower growth rates, amino acid starvation,or stationary phase. If this is true, it might be possible todemonstrate different ratios of transcripts from P16 versusP1P2 as a function of growth rate.The possibility should be examined that AT is involved in

the expression of rrn internal promoters. It has been shownthat an in vivo 1,800-base transcript is made from the C.crescentus 16S internal promoter by using an E. coli plasmidsystem (2). Since rrn operon sequences are polar (1) andrequire an AT system for efficient expression from the P1P2promoters (15, 22), it is possible that P16 also possesses somekind of mechanism for AT. The sequence following P16 doesnot contain structures similar to those found in the ATregion; therefore, ifAT activity can be demonstrated for thisregion, study of the sequence may help us to understandmore about the AT process in E. coli.

Conservation of the ORF16 sequence. Although the conser-vation of rRNA sequehce is a probable cause of the apparenthomology, examination of 60 small-subunit rRNA sequencesfrom diverse organisms indicates that sequences specifyingORF16 are highly conserved in the eubacteria and plantorganelles (2, 17, 20, 34) (Table 3). This is especially true ofthe region containing the SD sequence and the GTG -2 andATG +1 start codons. The SD sequence is present in all ofthe eubacterial, chloroplast, plant mitochondrial, andarchaebacterial sequences that have been reported. Thefive-nucleotide SD sequence (GGAGG) is complementary toa sequence near the 3' end of procaryotic 16S rRNA (3'-UCCUCCA-5') that has been implicated in procaryotictranslation initiation (36). (Although this procaryotic 3'-endsequence is present in eubacterial, archaebacterial, andchloroplast 16S sequences, it is absent from the plant mito-chondrial sequences and other eucaryotic small-subunit se-

quences.) The SD sequence is followed by at least one startcodon in the plant mitochondrial, chloroplast, and eubacte-rial sequences (with one exception). The spacing betweenthe SD sequence and the start codons is also highly con-

served. In each case, the start codon(s) follows the SDsequence by three (GTG -2) or nine (ATG +1) nucleotides.Eight of the nine archaebacterial sequences do not have startcodons following the SD sequence, but one has a GTGcodon five nucleotides after this sequence.The nucleotide sequences following the translational starts

indicated in Table 3 are also highly conserved (17), but the

VOL. 169, 1987

on February 20, 2021 by guest

http://jb.asm.org/

Dow

nloaded from

1700 BERG ET AL.

open reading frames specified by these nucleotide sequencesvary in length and in the amino acid sequences which theyencode. The'predicted ORF16 amino acid sequences werealigned, and the amino acid and nucleic acid homologies withthe E. coli rrnB sequence were tabulated (Table 4). Althoughthese amino apid sequences have considerable homologynear their N termini their similarity decreases after 20 aminoapids. Most of these differences were caused by basechanges, but in three cas'es they were caused by nucleotideinsertions or deletions. Some major differences were foundin the predicted amino acid sequences from closely relatedorganisms, or even from different operons in the sameorganism. For instance, within E. coli the rrnB and the rrnAQRF16 amino acid sequences differ in size and composition.Also, the Proteus vulgaris sequence is like the E. coli rrnAORF16 sequence. The nucleotide sequences of E. coli rrnBand rrnA and of P. vulgaris are highly homologous, and thedifferences in their amino acid sequences can be tracedprimarily to insertions in the rrnA and P. vulgaris ORF16sequences that cause reading frame shifts. The difference inthe length of the ORF16 sequences of Bacillus brevis andBacillus subtilis can also be traced to an insertion early in theB. subtilis sequence. A consensus sequence was derived forthe 24 N-terminal amino acids of the ORF16 sequencespresented in Table 4. This concensus sequence was used tosearch (23) the Dayhoff protein data base, but no significantmatches were found. This result was not unexpected, sinceour experiments have suggested that ORF16 is not anabundant peptide.

In this work we have reported that an open reading framenear the 3' end of the rrnB 16S gene of E. coli can betranslated in vivo. Although we were unable to directlydemonstrate the presence of the intact ORF16 peptide in E.coli, we demonstrated expression of 4n ORFJ6'-'lacZ fusionand we measured the size of the fusion peptide and knowwhere translation starts. The widespread occurrence of ahomologous open reading frame in the rRNA genes of otherorganisms adds substance to the hypothesis that ORF16 hasa function in E. coli that is conserved in eubacteria and plantorganelles.

ACKNOWLEDGMENTSWe thank the following people for providing us with strains: B.

Bachmann, F. W. Bech, M. Berman, J. Brosius, M. Casadaban, T.Eckhardt, 0. Karlstrom, J. Messing, D. Rupp, P. Venetianer, andH.-L. Yang. We also acknowledge the helpful discussions andcritical comments of Bjarne Albrechtsen, Jurgen Brosius, SeamusCondon, Steen Pedersen, and Morten Johnsen. We are grateful toSeamus Condon for performing some of the promoter confirmationexperiments. We thank C. Levinthal for the use of the ComputerGraphics Facility, Department of Biological Sciences, ColumbiaUniversity, for analysis of nucleotide sequence information.

LITERATURE CITED1. Aksoy, S., C. L. Squires, and C. Squires. 1985. Evidence for

antitermination in Escherichia coli rRNA transcription. J. Bac-teriol. 159:260-264.

2. Amemiya, K., V. Bellofatto, L. Shapiro, and J. Feingold. 1986.Transcription initiation in vitro and in vivo at a highly conservedpromoter within a 16S ribosomal RNA gene. J. Mol. Biol.187:1-14.

3. Amman, E., J. Brosius, and M. Ptashne. 1983. Vectors bearinga hybrid trp-lac promoter useful for regulated expression ofcloned genes in Escherichia coli. Gene 25:167-178.

4. Berman, M. L., and D. E. Jackson. 1984. Selection of lac genefusions in vivo: ompR-lacZ fusions that define a functionaldomain of the ompR gene product. J. Bacteriol. 159:750-756.

5. Boros, I., A. Kiss, and P. Venetianer. 1979. Physical map of the

seven ribosomal RNA genes of Escherichia coli. Nucleic AcidsRes. 6:1817-183Q.

6. Brosius, J. 1984. Plasmid vectors for the selection of promoters.Gene 27:151-160.

7. Brosius, J., T. Dull, D. Sleeter, and H. Noller. 1981. Geneorganization and primary structure of a ribosomal RNA operonfrom Escherichia coli. J. Mol. Biol. 148:107-127.

8. Brosius, J., M. L. Palmer, P. J. Kennedy, and H. Noller. 1978.Complete nucleotide sequence of a 16S ribosomal RtNA genefrom Escherichia coli. Proc. Natl. Acad. Sci. USA 75:4801-4805.

9. Carbon, P., C. Ehresmanp, B. Ehresmann, and J.-P. Ebel. 1979.The complete nucleotide sequence of the ribosomal 16S RNAfrom Escherichia coli: experimental details and cistron hetero-geneities. Eur. J. Biochem. 10Q:399-410.

10. Casadaban, M. J., J. Cbou, and S. N. Cohen. 1980. In vitro genefusions that join an enzymatically active P-galactosidase seg-ment to amino-terminal fragments of exogenous proteins: Esch-erichia coli plasmid vectors for the detection and cloning oftranslational initiation signals. J. Bacteriol. 143:971-980.

11. de Boer, H. A., S. F. Gilbert, and M. Nomura. 1979. DNAsequences of promoter regions for rRNA operons rrnE and rrnAin E. coli. Cell'17:201-209.

12. Feingold, J., V. Beliofatto, L. Shapiro, and K. Amemiya. 1985.Organization and nucleotide sequence analysis of an rRNA andtRNA gene cluster from Caulobacter crescentus. J. Bacteriol.163:155-166.

13. Fill, N., D. Bendiak, J. Collins, and J. Friesen. 1979. Expressionof Escherichia coli ribosomal protein and RNA polymerasegenes cloned on plasmids. Mol. Gen. Genet. 173:39-50.

14. FuUler, F. 1982. A family of cloning vectors containing thelacUV5 promoter. Gene 19:43-54.

15. Holben, W. E., S. M. Prasad, and E. A. Morgan. 1985.Antitermination by both the promoter and the leader regions ofan Escherichia coli ribosomal RNA operon. Proc. Natl. Acad.Sci. USA 82:5073-5077.

16. Howard, P., J. Shaw, and A. Otsuka. 1985. Nucleotide sequenceof the birA gene encoding the biotin operon repressor and biotinholoenzyme synthetase functions of Escherichia coli. Gene35:321-331.

17. Huysmgns, E., and R. De Wachter. 1986. Compilation of smallsubunit RNA sequences. Nucleic Acids Res. 14:r73-r118.

18. Kirschbaum, J., and E. B. Konrad. 1973. Isolation of a special-ized lambda transducing bacteriophage carrying the betasubunit gene for Escherichia coli ribonucleic acid polymerase.J. Bacteriol. 116:517-526.

19. Konigsberg, W., and G. N. Godson. 1983. Evidence for use ofrare codons in the dnaG gene and other regulatory genes ofEscherichia coli. Proc. Natl. Acad. Sci. USA 80:687-691.

20. Kop, J., A. M. Kopylov, L. Magrum, R. Siegel, R. Gupta, C. R.Woese, and H. F. Noller. 1984. Probing the structure of 16Sribosomal RNA from Bacillus brevis. J. 13iol. Chem. 259:15287-15293.

21. Laemmli, U. K. 1970. Cleavage of structural proteins during theassembly of the head of bacteriophage T4. Nature (London)227:680-685.

22. Li, S., C. L. Squires, and C. Squires. 1984. Antitermination ofE.coli rRNA transcription is caused by a control region segmentcontaining lambda nut-like sequences. Cell 38:851-860.

23. Lipman, D. J., and W. R. Pearson. 1985. Rapid and sensitiveprotein similarity searches. Science 22:1435-1441.

24. Maniatis, T., E. F. Fritsch, and J. Sambrook. 1982. Molecularcloning: a laboratory manual, p. 368-369. Cold Spring HarborLaboratory, Cold Spring Harbor, N.Y.

25. Marinus, M. 1973. Location of IDNA methylation genes on theEscherichia coli K-12 genetic map. Mol. Gen. Genet. 127:47-55.

26. Messing, J., B. Gronenborn, B. Muller-Hill, and P. Hof-schneider. 1977. Filamentous coliphage M13 as a cloning vehi-cle: insertion of a HindIll fragment of the lac regulatory regionin M13 replicative form in vitro. Proc. Natl. Acad. Sci. USA 74:3642-3646.

27. Miler, J. H. 1972. Experiments in molecular genetics. ColdSpring Harbor Laboratory, Cold Spring Harbor, N.Y.

J. BACTERIOL.

on February 20, 2021 by guest

http://jb.asm.org/

Dow

nloaded from

IN VIVO TRANSLATION OF AN rRNA SEQUENCE 1701

28. Mulligan, M. E., D. K. Hawley, R. Entriken, and W. R.McClure. 1984. Escherichia coli promoter sequences predict invitro RNA polymerase selectivity. Nucleic Acids Res.12:789-800.

29. Munson, L., G. Stormo, R. Niece, and W. S. Reznikoff. 1984.LacZ translation initiation mutations. J. Mol. Biol. 177:663-684.

30. Nilsson, G., J. Belasco, S. Cohen, and A. von Gabain. 1984.Growth-rate dependent regulation of mRNA stability in Esche-richia coli. Nature (London) 312:75-77.

31. Nomura, M., R. Gourse, and G. Baughmann. 1984. Regulationof the synthesis of ribosomes and ribosomal components. Annu.Rev. Biochem. 53:75-117.

32. Sancar, A., A. M. Hack, and W. D. Rupp. 1979. Simple methodfor identification of plasmid-coded proteins. J. Bacteriol.137:692-693.

33. Sarmientos, P., J. E. Sylvester, S. Contente, and M. Cashel.1983. Differential stringent control of the tandem E. coli ribo-somal RNA promnoters from the rrnA operon expressed in vivoin multicopy plasmids. Cell 32:1337-1346.

34. Sekiya, T., and S. Nishimura. 1979. Sequence of the gene forisoleucine tRNA-1 and the surrounding region in a ribosomalRNA operon of Escherichia coli. Nucleic Acids Res. 6:575-592.

35. Shen, W.-F., C. Squires, and C. L. Squires. 1982. Nucleotidesequence of the rrnG ribosomal RNA promoter region ofEscherichia coli. Nucleic Acids Res. 10:3303-3313.

36. Shine, J., and L. Dalgarno. 1974. The 3'-terminal sequence ofEscherichia coli 16S ribosomal RNA: complementarity to non-sense triplets and ribosome binding sites. Proc. Natl. Acad. Sci.

USA 71:1342-1346.37. Squires, C., A. Krainer, G. Barry, W.-F. Shen, and C. L.

Squires. 1981. Nucleotide sequence at the end of the gene for theRNA polymerase 3' subunit (rpoC). Nucleic Acids Res.9:6827-6839.

38. Stuber, D., and H. Bujard. 1981. Organization of transcriptionalsighals in plasmids pBR322 and pACYC184. Proc. Natl. Acad.Sci. tJSA 78:167-171.

39. Taylor, W., and R. Burgess. 1979. Escherichia coli polymerasebinding and initiation of transcription on fragments of Arij'18DNA containing promoters for X genes and for rrnB, tufB, rplK,A, rplJ, L, and rpoB, C genes. Gene 6'331-365.

40. Weinstock, G., M. Berman, and T. Silhavy. 1983. Chimericgenetics with 1-galactosidase, p. 44 47. In T. S. Papas, M.Rosenberg, and J. G. Chirikjian (ed.), Gene amplification andanalysis. Elsevier Science Publishing, Inc., New York.

41. Woese, C. k., R. Gutell, R. Gupta, and H. F. Noller. 1983.Detailed analysis of the higher-order structure of 16S-like ribo-somai ribonucleic acids. Microbiol. Rev. 47:621-669.

42. Young, R. A., R. Macklis, and J. A. Steitz. 1979. Sequence of the16S-23S spacer region in two ribosomal RNA operons of Esch-erichia coli. J. Biol. Chem. 254:3264-3271.

43. Young, R. A., and J. A. Steitz. 1978. Complementary sequences1700 nucleotides apart form a ribonuclease III cleavage site inEscherichia coli ribosomal precursor RNA. Proc. Natl. Acad.Sci. USA 75:3593-3597.

44. Young, R. A., and J. A. Steitz. 1979. Tandem promoters directE. coli ribosomal RNA synthesis. Cell 17:225-234.

V'OL. 169, 1987

on February 20, 2021 by guest

http://jb.asm.org/

Dow

nloaded from