Upload
others
View
1
Download
0
Embed Size (px)
Citation preview
INDEPENDENT TRANSCRIPTION OF A FUNCTIONAL
LUCERNE TRANSIENT STREAK VIRUS SATELLITE RNA
AND ITS PACKAGING REQUIREMENT(S)
By
Feiyuan Liu
A thesis submitted in conformity with the requirements
for the Degree of Master of Science
Graduate Department of Cell and Systems Biology
University of Toronto
© Copyright by Feiyuan Liu 2014
II
Independent Transcription of A Functional
Lucerne Transient Streak Virus Satellite
RNA and Its Packaging Requirement(s)
Feiyuan Liu
Degree of Master of Science
Department of Cell and Systems Biology
University of Toronto
2014
The satellite RNA of Lucerne Transient Streak Virus (LTSV) is a 322-nucleotide,
single-stranded circular RNA. To investigate whether interactions between genomic
and satellite RNA are important for satellite packaging into the helper virus capsid
protein, transgenic plants were generated which contained turnip rosette virus
capsid protein gene and LTSV satellite dimer sequence in tandem. Results of the
RT-PCR and western blotting revealed that the ribozyme was functional in vivo and
generated the unit length of monomeric LTSV circular RNA. This was confirmed by an
infectivity assay results showing that the LTSV circular RNA was infectious when
inoculated into plants with the turnip rosette helper virus. However, the TRoV capsid
protein (CP) failed to be expressed in transgenic plants. Lack of TRoV mRNA for
capsid protein in transgenic plants is probably due to the presence of the ribozyme
which resulted in the destabilization and consequent degradation of CP TRoV mRNA.
III
Acknowledgements
I would like to sincerely thank Dr. Mounir AbouHaidar for all of his expertise,
guidance, and support throughout this project. Thank you for the valuable
opportunity to conduct research in your laboratory and learn from the best.
Many thanks go to Dr. Maurice Ringuette and Dr. Eiji Nambara who have supported
me as members of my supervisory committee.
I am very grateful to Tauqeer Ahmad, a wonderful colleague, for all of his helpful
advice and unreserved assistance. I have learned a great deal from him and I wish
him the very best of luck in all of his endeavors. Thanks also go to my colleagues:
Alex Mosa and Reem Merwas.
Finally, I am especially thankful to my family, for all of their love, support, and
confidence. To them, I owe all of my accomplishments.
IV
Table of Contents
ABSTRACT ······················································································································· i
ACKNOWLEDGEMENTS ································································································· ii
TABLE OF CONTENTS ···································································································· iii
LIST OF FIGURES ··········································································································· vi
LIST OF TABLES ··········································································································· viii
LIST OF ABBREVIATIONS ······························································································· ix
1 LITERATURE REVIEW ··································································································1
1.1 Overview ··········································································································1
1.2 Sobemoviruses ·································································································2
1.2.1 General Features ····················································································2
1.2.2 Genome Organization ············································································4
1.3 Lucerne Transient Streak Virus ········································································5
1.3.1 Biological Properties ··············································································5
1.3.2 Main Diseases ······················································································6
1.4 Viroids and Plant Virus Satellites ································································6
1.4.1 Viroids ····································································································6
1.4.2 Viroid-like Satellite RNAs ····································································7
1.4.3 Satellite RNA of Lucerne Transient Streak Virus ····································7
1.4.4 Sequence and Structure of LTSV Satellite RNA ······························8
1.4.5 Replication of the viroids and satellite RNAs ·································9
V
1.4.6 Ribozyme Activity ··············································································13
2 INTRODUCTION ········································································································16
3 MATERIALS AND METHODS ·····················································································18
3.1 Molecular Techniques ····················································································18
3.1.1 Plasmid DNA Isolation from E. coli ················································18
3.1.2 Gel Electrophoresis ············································································19
3.1.3 Phenol-Chloroform DNA/RNA Purification ·······································19
3.1.4 Polymerase Chain Reaction ······························································20
3.1.5 Reverse Transcription (RT) – Polymerase Chain Reaction ············21
3.1.6 Preparation of Competent Cells and Transformation of
A. tumefaciens ····················································································22
3.2 Confirmation of Transgenic Plant ······························································23
3.2.1 Chromosomal DNA Extraction from Plant Tissue··························23
3.2.2 Total RNA Extraction from Plant Tissue ·········································24
3.2.3 DNase Treatment ···············································································25
3.3 Generation of Antibodies and Immunoblotting ·······································25
3.3.1 Electroelution of Protein From SDS-PAGE Gels ·····························25
3.3.2 Polyclonal Antibody Production ·······················································26
3.3.3 Total Protein Extraction ····································································27
3.3.4 Protein Quantitation ··········································································27
3.3.5 SDS-PAGE Gel ·····················································································29
3.3.6 Western Blotting ················································································30
VI
3.4 Infectivity Assay of TRoV and LTSV sat RNA ··········································31
3.5 Transient Infectivity Assay ··········································································31
4 RESULTS ····················································································································32
4.1 Production of Transgenic N. Benthamiana Plants ···································32
4.2 Confirmation of Transgenic Plants ·····························································33
4.2.1 Detection of Transgene DNA in Chromosomal DNA of
Transgenic N. Benthamiana Plants ······················································34
4.2.2 Analysis of Transcription Products in
Transgenic Plants ·················································································39
4.3 Antibody Generation and Immunoblotting ···············································45
4.3.1 Protein Purification ············································································45
4.3.2 Western Blotting ················································································46
4.4 Agrobacterium Mediated Transient Infectivity Assay ······························50
4.5 Infectivity Assay of TRoV and LTSV sat RNA ··········································51
5 DISCUSSION ··············································································································56
6 CONCLUSIONS ·········································································································61
7 FUTURE DIRECTIONS ······························································································62
8 REFERENCES ·············································································································63
VII
List of Figures
Figure 1: Sobemovirus genome organization ·······························································5
Figure 2: Rolling-circle model for the replication of circular RNAs ·····························10
Figure 3: Rolling-circle mechanism for viroid replication ···········································11
Figure 4: The probable cleavage mechanism of the hammerhead ribozyme,
and potential catalytic strategies ································································15
Figure 5: Proposed secondary structure of the positive (plus) and negative
(minus) sense hammerhead domains for LTSV sat RNA ·····························15
Figure 6: Schematic representation of TROVCP_LTSVsat constructs ··························33
Figure 7: Transgenic seeds screening ··········································································34
Figure 8: PCR confirmation of capsid protein transgene in
TROVCP_LTSVsat transgenic N. benthamiana ·············································36
Figure 9: PCR confirmation of LTSV satRNA transgene in
TROVCP_LTSVsat transgenic N. benthamiana ·············································37
Figure 10: PCR confirmation of Green fluorescent protein transgene in
TROVCP_LTSVsat transgenic N. benthamiana ·············································38
Figure 11: Quality check of total RNA from transgenic N. benthamiana ···················39
Figure 12: Quality of RNA samples before and after DNase treatment ·····················41
Figure 13: PCR and RT-PCR results of genomic and transcripts of
TRoV capsid protein, LTSV sat RNA and GFP construct in
transgenic N. benthamiana plants ······························································43
VIII
Figure 14: SDS-PAGE of purified TRoV capsid protein·················································45
Figure 15: Bradford assay showing concentrations of protein
samples (in μg/ml) ······················································································47
Figure 16: Western blotting using anti-TRoV antisera across dilution of
purified virus and total protein extracts to detect the
presence of the TRoV capsid protein ··························································49
Figure 17: Schematic representation of TROVCP constructs ······································50
Figure 18: Confirmation of the expression of the TRoV capsid
protein in N. benthamiana plant using western blotting ···························51
Figure 19: Quality of total RNA extraction from turnip plant ·····································52
Figure 20: RT-PCR results of transcripts of TRoV capsid protein in
turnip plants after infectivity assay ·····························································54
Figure 21: RT-PCR results of transcripts of LTSV satellite RNA in
turnip plants after infectivity assay ·····························································55
Figure 22: Diagram showing how the CP mRNA could be degraded ··························60
IX
List of Tables
Table 1: Viruses of genus Sobemovirus and their biological properties ·······················3
Table 2: Amount of reagent and spectrophotometer Reading of
different concentration of BSA protein ·························································28
Table 3: Spectrophotometer reading of RNA ···························································· 40
Table 4: Bradford Assay to quantitate the amount of proteins used for
western blotting ····························································································46
Table 5: Protein concentration for western blotting ···················································48
Table 6: Nucleotide sequences of forward (F) and reverse (R) primers
used for confirmation of transgene presence ··············································70
X
List of Abbreviations
aa amino acid
AMV Alfalfa mosaic virus
A. tumefaciens Agrobacterium tumefaciens
ASBVd avocado sunblotch viroid
APS Ammonium persulfate
ATP adenosine triphosphate
bp base pair
BSA bovine serum albumin
CCC RNA covalently closed circular ribonucleic acid
cDNA complementary DNA
CfMV cocksfoot mottle virus
CTAB hexadecyltrimethylammonium bromide
CP capsid protein
DNA Deoxyribonucleic acid
dNTP 2’-deoxyribonucleotide triphosphate
DEPC diethylpyrocarbonate
DNase deoxyribonuclease
E. coli Escherichia coli
EDTA ethylenediaminetetra-acetate
g gram
XI
g gravitational constant (9.8m/s2)
HCl hydrochloric acid
HDV hepatitis delta virus
HHR hammerhead ribozyme
kb kilo base pair
kDA kilodalton
LB Luria-Bertani (media)
LTSV lucerne transient streak virus
M molar
mA milliampere
min minute
mg milligram
MgCl2 magnesium chloride
mM millimolar
mRNA messenger ribonucleic acid
mRNP messenger ribonucleoprotein particles
MS Murashige and Skoog (media)
N. benthamiana Nicotiana benthamiana
NaCl sodium chloride
ng nanogram
nm nanometer
nc RNA non-coding ribonucleic acid
XII
nt nucleotide
OD optical density
ORF open reading frame
PAGE polyacrylamide gel electrophoresis
pCambia Cambia plasmid strain 1300
PCR polymerase chain reaction
pol polymerase
PSTVd potato spindle tuber viroid
RdRp RNA-dependet RNA polymerase
RNA ribonucleic acid
RNase ribonuclease
rpm revolutions per minute
rRNA ribosomal ribonucleic acid
RT-PCR reverse transcription – polymerase chain reaction
RYMV rice yellow mottle virus
sat RNA satellite ribonucleic acid
SBMV Southern bean mosaic virus
SCMoV subterranean clover mottle virus
SDS sodium dodecyl sulfate
sgRNA subgenomic RNA
SNMoV solanum nodiflorum mottle virus
SoMV sowbane mosaic virus
XIII
ssRNA single-stranded RNA
TE-1 1:10 dilution of 10mM Tris-HCl (pH 8), and 1Mm
EDTA
TLS tRNA-like structure
TMV Tobacco mosaic virus
Tnos nopaline synthase terminator
TRAMP complex Trf4/Air2/Mtr4p Polyadenylation complex
Tris tris(hydroxymethyl) aminomethane
tRNA transfer ribonucleic acid
TRoV turnip rosette virus
UTR untranslated region
µg microgram
µl microliter
V volt
VPg viral protein genome-linked
VS Varkud satellite
VTMoV Velvet tobacco mottle virus
1
1 Literature Review
1.1 OVERVIEW
Viruses are replicative particles composed of nucleic acids and proteins. Lacking
the cellular organelles required for translation, viruses parasitize host cells to
propagate. The cellular pathologies induced by viral infection are contingent on
both innate replicative requirements, as well as host cell responses. Constituting
an evolutionary ancient vehicle for nucleic acid replication, viruses have been
identified to parasitize all domains of living organisms (Koonin et al., 2006).
Plant viral pathogen potentiated disease is responsible for major global losses in
crop yield and quality, estimated $60 billion loss each year (Wei et al., 2010). The
majority of plant viruses have positive single-stranded RNA (ss RNA) genome
which is encapsidated in either rod-like or icosahedral capsid protein. Plants
cannot move, so plant-to-plant transmission necessitates vectors, which are
commonly insects. Within plant hosts, the impermissivity of cell walls requires
intercellular transport of virions to occur via plasmodesmata. However, physical
modification of plasmodesmata is required for virion transport. Plant viruses thus
commonly possess various movement proteins involved in expanding the
plasmodesmata pore (Oparka et al., 2001).
2
1.2 SOBEMOVIRUSES
1.2.1 GENERAL FEATURES
Sobemoviruses are plant viruses named after their type species, Southern
bean mosaic virus (SBMV). This virus group was established according to
similarities in protein subunit molecular weight, capsid protein stabilization,
sedimentation coefficient and distribution in the cell (Hull, 1977). Viruses in
the genus Sobemovirus are icosahedral particles of about 30 nm in diameter
(Hull, 1995). Virions contain capsid protein (approximately 30 kDa), genomic
RNA, and one subgenomic RNA (sg RNA) molecule (Hull, 1995). The capsid
protein is made of 180 subunits patterned in T=3 symmetry (Hull, 1995). The
genome of the virus is a single-stranded positive-sense RNA molecule
between 4 to 4.5 kb in size, with a viral protein genome-linked protein (VPg)
at the 5’ terminus and a non-polyadenylated 3’ end (Hull, 1995).
Sobemoviruses currently contain 11 species whose natural host range is quite
narrow, but include both monocotyledonous and dicotyledonous, (Zaumeyer
& Hareter, 1943) and are transmitted by vectors or by seeds (Table 1).
In addition to their genomic RNA, some Sobemovirus also encapsidate a
viroid-like satellite RNA (sat RNA) that relys on helper virus for replication and
packaging. The presence of sat RNA has been reported for lucerne transient
streak virus (LTSV), rice yellow mottle virus (RYMV), subterranean clover
mottle virus (SCMoV), solanum nodiflorum mottle virus (SNMoV), and velvet
tobacco mottle virus (VTMoV) (Sehgal et al., 1993; Collins et al., 1998; Francki
3
et al., 1983; Gould & Hatta, 1981). The length of these circular sat RNA range
from 220 to 390 nucleotides (nt). RYMV sat RNA (220 nt) which known as the
smallest naturally occurring viroid-like RNA known today (Collins et al., 1998).
Interactions between sat RNA, helper virus, and host plants significantly
influence the infectivity of the satellite.
Table1. Viruses of genus Sobemovirus and their biological
properties. Adapted from Tamm & Truve, 2000a.
4
1.2.2 GENOME ORGANIZATION
The genome of the Sobemovirus shows similarity amongst members of the
genus. Their genome isacompact and majority of the openareading frames
(ORFs) overlap. The genome contains four protein-coding ORFs. A small ORF 1
at the 5’ end, and a large polyprotein ORF 2 are translatedafrom genomic
RNA, while ORF 3, which encodes for the viral coat protein, is translated from
a subgenomic RNA. ORF 1 encodes for P1, which is responsibleafor virus
movement (Sivakumaran et al., 1998; Chowdhury & Savakumaran, 2011), and
also seems to be participated in gene silencing (Voinnet et al., 1999; Lacombe
et al., 2010). The sequences of the P1 amino acid are significantly different
from different species and the encoded protein is around 12 to 24 kilo Dalton
(KD) (Tamm & Truve, 2000). ORF 2 is comprised of ORF 2a and ORF 2b, which
encode the polyprotein consisting of a serine protease,
RNA-dependent-RNA-polymerase (RdRp), a VPg protein and other products
called P10 and P8 (Mäkinen et al., 2000; Nair & Savithri, 2010).
For many years, sobemoviruses were thought to have two different genome
organizations. Some were thought to have the organization like Figure 1,
while, in other sobemoviruses, ORF2a and ORF2b were fused intoaone long
ORF, with theaORF3aoverlapathe region between ORF2a and ORF2b.
However Meier and Truve (2007) demonstrated that all sobemoviruses have
genomes organized in accordance with the model presented in Figure 1.
Previous inconsistencies are dueato sequencing error. The presence of two
5
short 5’ ORFs (1a and 1b) in LTSV and TRoV was shown to be sequence error
(Sõmera & Truve, 2013).
Another functionalaORF (ORFx) wasaidentified in the sobemoviruses (Ling et
al., 2013). ORFx, whichaoverlaps the 5’ terminal of ORF2a in the +2 reading
frame and extends to upstream of ORF2a, (shown in Figure 1) isaconserved in
all sobemoviruses. Mutations that disrupt the expression of ORFxaeliminate
viral infectiousness (Ling et al., 2013).
Figure 1: Sobemovirus genome organization. Map of the∼4.45 kb RYMV genome. ORF1 (P1),
ORF2a (Pro-VPg-P10-P8 polyprotein) and ORF2b (RdRp) are translated from the genomic
RNAthrough both leaky scanning and ribosomal frameshifting. ORF3 which is encoded for the
viral capsid protein is translated from a subgenomic RNA. The newly identified ORFx (X, pink) is
thought to be translated using leaky scanning, a Adapted from Ling et al., 2013.
1.3 LUCERNE TRANSIENT STREAK VIRUS
1.3.1 BIOLOGICAL PROPERTIES
Lucerne Transient Streak Virus belongs to Sobemovirus. The genome of the
LTSV is a single-stranded messenger-sense RNA molecule approximately 4.5
kb in size with a VPg at the 5’ end (Hull, 1988). Similar to other
sobemoviruses, the capsid of LTSV is composed of 180 protein subunits
according to T=3 symmetry with a molecular weight of 32 KDa (Forster &
Jones, 1979).
6
1.3.2 MAIN DISEASES
LTSV naturally cause disease in lucerne and can be a great economic burden
on commercial lucerne crops. To date, three isolates have been identified:
Australian (Blackstock, 1978), Canadian (Paliwal, 1983), and New Zealand
(Forster & Jones, 1979). These three isolates are distinguished based on their
host range and symptom. The natural method of transmission of LTSV is
unknown, however, chewing insects are suspected as the most likely vector
(Blackstock, 1978; Paliwal, 1983; Forster & Jones, 1979).
LTSV infected lucerne plants generally develop chlorotic streaks centered on
the main lateral vein of leaflets. Leaf distortion around the streak appears
mostly on newly expended leaves and the symptoms weaken when plants are
grown in temperate condition (Blackstock, 1978; Paliwal, 1983; Forster &
Jones, 1979). LTSV cause 18% loss in dry matter of plant growth in one year of
growth in the field (Blackstock, 1978).
1.4 VIROIDS AND PLANT VIRUS SATELLITES
1.4.1 VIROIDS
Viroids are chracterized by the following characteristics: they are circular
single-strand RNAs between 246-401 nt long. They show a high degree of
secondary structure which results in a distinct rod-like double-stranded
structure with small single-stranded loop-out region (Sänger et al., 1976). No
ORFs exist in their sequences and no viroid specific product has been
detected. As lack of coding product, viroids are extensively dependent on
7
host encoded protein for replication (Diener, 2001).
1.4.2 VIROID-LIKE SATELLITE RNAs
Satellites are RNA molecules unable to replicate without the assistance of a
specific helper virus. They are not needed for the replication of their helper
virus and their sequence was not homology with the helper virus genome
(Roossinck et al., 1992). It is believed that RNA polymerase encoded by helper
virus as well as host encoded factors is responsible for the satellite replication.
The satellite usually interferes with helper virus synthesis and therefore either
ameliorating or exacerbating effect on the diseases symptoms caused by their
helper virus (Collmer & Howell, 1992; Roossinck et al., 1992).
Satellite RNAs associated with four Sobemoviruses: VTMoV, SNMoV, SCMoV
and LTSV, have certain properties similar to viroids (Gould, 1981; Gould &
Hatta, 1981; Tien et al., 1981). For they are all small circular single-stranded
RNA but they form the double strand like structure. However the main
difference between these satellites and viroids is that satellite RNAs are
replicated with the help of the helper virus and they are also packaged into
the helper virus coat protein. While viroids replicate totally with plant host
enzymes and they don’t need the capsid protein for their packaging.
1.4.3 SATELLITE RNA OF LUCERNE TRANSIENT STREAK VIRUS
The 322-nt RNA which is encapsidated with LTSV particles has been
characterized as satellite RNA (satRNA) due to it needs of the helper virus for
replication. Paliwal (1984) confirmed that LTSV sat RNA was unable to
8
replicate without the suitable helper virus on Trigonella foenum-graecum and
Trifolium incarnatum.
Several interesting interactions between LTSV sat RNA, host plant and helper
virus have been illustrated. The replication of the SNMoV sat RNA can be
supported by LTSV (Jones & Mayo, 1984). However, SNMoV cannot support
the replication of the LTSV sat RNA (Jones & Mayo, 1984). Furthermore, the
replication of the LTSV sat RNA is also supported by sobemoviruses which are
naturally don’t have the sat RNAs, including Cocksfoot mottle virus (CfMV),
SBMV, Sowbane mosaic virus (SoMV), and Turnip rosette virus (TRoV)
(AbouHaidar & Paliwal, 1988; Paliwal, 1984; Sehgal et al., 1993). Replication
of LTSV sat RNA also shows host specificity. For instance, TRoV can support
the replication of the LTSV sat RNA in Brassica rapa, Raphanus raphanistrum
and Sinapsis arvensis, but not in Thlapsi arvense or Nicotiana bigelovii (Sehgal
et al., 1993a).
1.4.4 SEQUENCE AND STRUCTURE OF LTSV SATELLITE RNA
Sequence analyses showed that the three known isolates of LTSV sat RNA
share the high scale similarity. Both the New Zealand and Australian isolates
are 324-nt in size and share 98% sequence similarity (Keese et al., 1983),
while the Canadian isolate is a 322-nt RNA with only 80% sequence
homology to the other 2 types of sat RNA (AbouHaidar & Paliwal,
1988). The primary sequences of the three sat RNA isolates can be predicted
up to seven ORFs, there is very little amino acid (aa) conservation within
9
the ORFs and no in vitro translation products have been
identified (Morris-Krsinich & Forster, 1983). Therefore, LTSV sat RNAs
are considered to lack of translation products in vivo (AbouHaidar & Paliwal,
1988).
Secondary structure three LTSV sat RNA isolates predict wide-ranging internal
base-pairing of the circular RNAs (up to 70%) and suggest a double stranded
structure which is similar to the viroids. In both the positive- and
negative-sense strands of LTSV, the right one-third of the molecule can fold
into alternative hammerhead structures which have the self-splicing function
(Forster &Symons, 1987a; Sheldon & Symons, 1989) (Figure 6).
1.4.5 REPLICATION OF THE VIROIDS AND SATELLITE RNAs
The replication of viroids and viroid-like satellite RNAs from plants occurs in
different cell components (nucleus, chloroplast and cytoplasm) using
rolling-circle mechanism (Figure 2). The replication has three steps including
RNA polymerization (replication), cleavage and ligation (Flores et al., 2011).
Viroids rely on the DNA-dependent RNA polymerase of the host plant for
replication, so this process occurs in the same place where these subcellular
enzymes are located. Early study showed that both positive and negative
polarities of potato spindle tuber viroid (PSTVd) circular RNAs were detected
in nuclear fractions, which indicates nuclear RNA polymerase was functional
in the replication of PSTVd (Flores et al., 2005). Similar results were also
confirmed to the other members of the family Pospiviroidae which usually
10
refer to as nuclear viroid (Qi & Ding, 2003). Similar experiments have been
conducted to avocado sunblotch viroid (ASBVd) and other members of the
family Avsunviroidae, revealed that both positive and negative sense strands
accumulated in plastids, indicating Avsunviroidae family which refer to as
chloroplastic viroids which dependent on chlroplastic RNA polymerase for
replication (Figure 3)(Flores et al., 2005; Navarro et al., 1999). On the other
hand, viroid-like satellite RNAs depend on their helper virus encoded
RNA-dependent RNA polymerase for replication, so their replications most
probably co-occur with their helper viruses which replicate in membranous
vesicles connected with cytoplasm (Kopek et al., 2007). However, due to lack
of evidence, it is possible that helper virus may contribute proteins
redirecting host RNA polymerase to synthesis satellite RNAs.
11
12
As for RNA polymerization, multimeric RNAs were produced through
transcription of the circular templates of one or both polarities, catalyzed by
either RNA-dependent RNA polymerase of the helper virus or
DNA-dependent RNA polymerase of the host plant (Flores et al., 2011). The
cleavage or (self-cleavage) of the multmeric RNA intermediates into their
monomeric counterpart may occur in positive sense as well as both polarities
due to two mechanisms of rolling-circle replication, and this procedure is
catalyzed by either host encoded enzymes or by its own ribozyme (Flores et
al., 2011). The family Pospiviroidae most probably using asymmetric
rolling-circle mechanism for replication. Evidence showed that the cleavage of
the multimeric positive sense RNAs is determined by a specific RNA
conformation (Gas et al., 2007; Gas et al., 2008). Recent data supported a
double-stranded structure makes specific phosphodiester bonds easy to be
cut by RNase III-like enzyme, typically generating 5’-P and 3’-OH terminal(Gas
et al., 2007; Gas et al., 2008). Meanwhile, replication of the family
Avsunviroidae is supposed to follow symmetric rolling-circle mechanism.
Furthermore, the self-cleavage of the multimeric positive sense and negative
sense RNAs to its monomeric form is catalyzed by cis-acting hammerhead
ribozyme (Huthins et al., 1986; Prody et al., 1986). Circularization of the
unit-length linear RNA appears to be catalyzed by enzymes of the host or by
its own ribozyme activity (splicing/ligation). In the family Pospiviroidae,
recent data revealed that the cleavage of the multimeric positive sense RNA
13
into the monermeric sense and the self-ligation to form the circular monomer
most probably catalyzed by RNase III like enzyme (Gas et al., 2007). While in
the family Avsunviroidae, monomeric RNA resulting from self-cleavage
ribozyme activity result in the product which contains 5’-OH and 2’,
3’-phosphodiester end which require tRNA ligase for self-circularization
(Englert et al., 2007; Martinez et al., 2009).
1.4.6 RIBOZYME ACTIVITY
Ribozymes are RNA molecules which are able to catalyzing specific chemical
reaction. The ribozymes are a group of relatively small RNA (50-150 nt)
species (Lilley, 2005) that, dependent on presence of the metal ions, perform
a site-specific cleavage via a trans-esterification reaction to their own
phosphodiester backbone (Wilson & Lilley, 2009). Mainly there are four
members of ribozymes: hammerhead, hairpin, hepatitis delta virus (HDV),
and Varkud satellite (VS). Though each type have different sequence and
structure, they can conduct the same reaction. The general mechanism of the
ribozymes is 2’ oxygen nucleophile attacks the nearby phosphate in the RNA
backbone, resulting in cleavage product one with 2’, 3’-cyclic phosphate and
the other have 5’ hydroxyl end, which is similar to some of the protein
ribonucleases (Figure 4). Unlike protein ribonucleases, ribozymes only cleave
at a specific location, using base-pairing and tertiary interaction to help align
the cleavage site within the catalytic core (Doherty & Doudna, 2001).
The hammerhead ribozyme (HHR) is a small catalytic RNA motif capable of
14
endonucleolytic (self-) cleavage. It is composed of a catalytic core of
conserved nucleotides flanked by three helices, two of which form essential
tertiary interaction for fast self-scission under physiological conditions. The
hammerhead ribozyme was discovered in satellite RNA of plant virus, where
it works as site-specific self-cleaving unit in the processing of single-stranded
RNA transcripts result from rolling-circle replication (Forster & Symons, 1987;
Hazeloff & Gerlach, 1988). The active ribozyme is transiently formed during
replication to promote monomeric cleavage, while a later alternate folding
promotes ligation during monomer circularization (Flores et al., 2004).
Satellite RNA of LTSV also contains hammerhead ribozyme motif (Figure 5).
For both polarities of the sat RNAs, the sequence near the cleavage site can
be folded into a hammerhead secondary structure. The activity of the
hammerhead ribozyme was shown to be also functional in vitro. Though such
activity is quite low (Collins et al, 1998).
15
16
2 Introduction
A majority of plant viruses are single-stranded RNA viruses. Some RNA viruses
also contain divided genome. Generally the genomes of those viruses are
packaged into a capsid protein. Additionally, certain plant viruses have been
described to be associated with replication-dependent satellite nucleic acids.
Satellites can be divided into two groups: 1) satellite viruses may encode for their
own protein (satellite viruses) but they rely on the helper virus for replication. 2)
Satellite RNAs which rely on their helper viruses for encapsidation and replication.
Satellites normally share little or no sequence homology to their helper viruses,
which distinguish them from subgenomic RNA (Murant & Mayo, 1982). To the
extent they utilize viral replication machinery; satellites can be characterized as
parasitic. Satellite co-infection does not predict severity of host symptoms. In
most plants, sat RNA’s reduce helper virus replication, thereby attenuating
disease symptoms. However, certain hosts do present increased symptom
severity in satellite virus co-infection.
One class of satellite circular RNAs which exist as circular, single-stranded, highly
self-complementary viroid-like RNAs was baptized as Virusoids. They rely on
the helper virus for replication and encapsidation (Symons, 1991). The secondary
structure of virusoids is similar to the structure of the viroids, which are also
small circular highly complementary plant pathogens that rely on host RNA
polymerase for replication (Flores et al., 2005). The satellite of LTSV relies on the
17
helper virus for both replication and encapsidation, and hitherto no translational
products have been reported for LTSV sat RNA. The replication of LTSV sat RNA is
catalyzed by the RNA-dependent RNA polymerase of the helper virus (LTSV and
TRoV) through rolling–circle mechanism. During the process of rolling-circle
mechanism, the hammerhead secondary motif embedded in LTSV sat RNA
putatively catalyzed self-cleavage to generate unit length RNA from a multimeric
precursor. The hammerhead ribozyme is a single-folded strand of RNA which
undergoes autocatalytic self-cleavage (and ligation). Elucidation of the
self-cleavage of the ribozyme activity of LTSV satellite would be important in
understanding the replication mechanism.
The small circular LTSV sat RNA is naturally found packaged together with the
viral genomic RNA into the icosahedral viral capsid (Forster & Jones, 1979).
However, viral packaging is exclusive for these RNA molecules; no cellular RNAs
(mRNA, tRNA, etc.) have been found in nucleic acid extracts of virions. The aim of
the thesis is to determine whether or not a functional satellite RNA can be
produced in plants without the helper virus. Furthermore, we determine whether
a satellite/capsid protein system is functional without any other helper virus
sequence. Data obtained will help to understand the interaction between
genomic and satellite RNAs in LTSV satellite packaging and capsid protein
assembly, and whether sense-directionality (positive and negative-sense LTSV
satellite RNAs) influences satellite RNA packaging ability. The stability of mRNA
lacking either the cap or poly (A) tail was also explored.
18
3 Materials and Methods
3.1 MOLECULAR TECHNIQUES
3.1.1 PLASMID DNA ISOLATION FROM E.COLI (MINI-PREP)
A 50% glycerol stock of Escherichia coli (strain DH5α) was used to inoculate 4
ml of LB media (1% tryptone, 0.5% bacto yeast extract and 1% sodium
chloride [pH 7.5]) supplemented with the appropriate antibiotic and the cells
were cultured in a 37℃ shaker overnight. Then the culture was divided into
1.5 ml and plasmid DNA was extracted.
E. coli cells were centrifuged at 12,000 g for 5 minutes. The supernatant was
decanted and pellet was resuspended in 100μl of Solution I (50mM glucose,
10mM EDTA [pH 8.0], 25mM Tris-HCl [pH 8.0]) stored at 4℃. After 10 minutes
incubation at room temperature, 200μl of freshly prepared SolutionⅡ (0.2N
sodium hydroxide and 1% sodium dodecyl sulphate) was added to each
sample to promote lysis of bacterial cell, degradation of cellular RNA. The
solution was thoroughly mixed by inverting the tubes. Then the samples were
chilled on ice for 20 minutes. 150μl of SolutionⅢ (3M sodium acetate [pH
4.8]) was added to each sample and thoroughly mixed before incubating for
45 minutes on ice. Then the samples were centrifuged at 12,000 g for 10
minutes at 4℃, the supernatant was then transferred to a new tube.
0.6 volume of isopropanol was added to each sample to precipitate plasmid
DNA. The samples were mixed by Vortex and incubated at room temperature
19
for 1 hour. Plasmid DNA was pelleted by centrifugation at 12,000 g for 5
minutes and then washed with 70% ethanol followed by 95% ethanol and air
dry to allow the evaporation of the remaining ethanol. The pellets were
resuspended in 50μl of TE-1 buffer and stored at -20℃.
3.1.2 GEL ELECTROPHORESIS
DNA and RNA samples were analyzed using electrophoresis. 1X TBE buffer
(0.1M Tris base, 0.5 M Boric acid, and 2mM EDTA [pH 8.0]) was used for
running buffer and agarose gel (1-2%) preparation. DNA or RNA samples were
dissolved or diluted in TE-1 buffer (1mM Tris-HCl [pH 8.0] and 0.1mM EDTA
[pH 8.0]) to a final volume of 8μl, mixed with 2μl of loading dye (0.25%
bromophenol blue, 20% glycerol). The whole volume of the sample was
loaded into the well and then subjected to electrophoresis at a constant
current 50mA and voltage 120V. Electrophoresis was stopped when the
bromophenol had migrated 3/5 down the agarose gel, then the gel was
stained with 1% ethidium bromide and observed under ultraviolet light
(300nm) with a trans-illuminator.
3.1.3 PHENOL-CHLOROFORM DNA/RNA PURIFICATION
Phenol-chloroform extraction was performed to purify the nucleic acid.
DNA/RNA was dissolved in 50μl of TE-1; an equal volume of water saturated
phenol was added to the sample. The sample was thoroughly mixed by vortex
and then centrifuged at 10,000g for 2 minutes. 40μl of the top phase was
transferred to a new tube and meanwhile 50μl of TE-1 was added to the
20
original tube. The tube was “vortexed” to mix and centrifuged for 2 minutes.
Again the 50μl of top phase was transferred to the new tube. The original
tube was then discarded.
Two volume of water saturated chloroform (stored at 4℃) was added to the
new tube which contain the transferred top phase to remove phenol. The
tube was inverted several times to thoroughly mix and centrifuged for 2
minutes. The bottom phase (chloroform) was removed and then this step was
repeated. After the second time the chloroform was removed, the aqueous
phase which contains DNA/RNA was transferred to a new tube. Sodium
acetate was added to 0.1M final concentration. Two and a half volume of 95%
ethanol (store at -20℃) was added to improve DNA/RNA precipitation. The
sample was thoroughly mixed and stored at -20℃ overnight or 3 hours at
-80 . The DNA/RNA was centrif℃ uged at 10,000g for 10 minutes at -4 . The ℃
supernatant was discarded and the pellet was first washed with 70% ethanol
then 95% ethanol. The sample was allowed to air dry until all ethanol had
evaporated.
3.1.4 POLYMERASE CHAIN REACTION
Polymerase Chain Reaction (PCR) was used for confirmation of gene presence
in the chromosomal DNA of transgenic plant. A 25μl was prepared using
12.5μl of PCR Master Mix, 2X (Promega) (50 unites/ml Taq polymerase
supplied in a proprietary reaction buffer [pH 8.5], 400μM dATP, 400μM dGTP,
400μM dCTP, 400μM dTTP, 3mM MgCl2), 1μl each of 10μM forward and
21
reverse primers, 1-3μl of DNA template (plasmid, chromosomal DNA or
cDNA), add autoclaved water to final volume 25μl. The mixture was mixed
and 30μl of mineral oil was added to the surface of the mixture to prevent
the evaporation during PCR. PCR conditions are as followed:
Temperature Time(min:sec) Number of cycles
94℃ 3:00 1X
94℃ 0:30 35X
Primer specific annealing temperature 0:30 35X
72℃ 1:00 35X
72℃ 10:00 1X
4℃ forever
3.1.5 REVERSE TRANSCRIPTION (RT)-POLYMERASE CHAIN REACTION
The confirmation of viral presence in plant tissues and transgene
transcription in transgenic plant was achieved by RT-PCR following RNA
extraction. RNA was first reverse transcribed into cDNA: 1000ng of total RNA
was dissolved in 11μl of DEPC-treated water, mixed with 1μl of 10μM gene
specific reverse primer. The sample was boiled for 3 minutes and then
quickly chilled on ice for 5 minutes. The following reagents were added: 5μl
M-MLV RT 5X Reaction buffer (250mM Tris-HCl [pH 8.3 at 25℃], 375mM KCl,
15mM MgCl2, and 50mM DTT), 1.25μl 10μM dATP, 1.25μl 10μM dCTP, 1.25μl
10μM dCTP, 1.25μl 10μM dTTP and 1μl M-MLV RT (H-) Point Mutant
(100units). Add DEPC-treated water to a 25μl final volume. The sample was
22
then mixed and incubated at 40℃ for 60 minutes. Then the reaction was
inactivated by heating at 80℃ for 15 minutes. Once the first-strand synthesis
was completed, 2μl of prepared cDNA sample was used as template for PCR.
3.1.6 PREPARATION OF COMPETENT CELLS AND TRANSFORMATION OF A.
TUMEFACIENS
A glycerol stock of Agrobacteria tumefaciens (strain GV3101), was used to
inoculate 4 mL of LB media and supplemented with 30 µg/ml Gentamycin.
The culture was grow overnight on a 28°C shaker. Next day, 1 ml of the
culture was added to 25 ml fresh LB media supplemented with Gentamycin
(30µg/ml). The cells were set on a 28°C shaker for an additional 4 hours, until
OD595 reached 0.4-0.6. The culture was then chilled on ice for 20 minutes and
split into two tubes of 10 ml before centrifuging at 3,000 g for 15 minutes at
4°C. The supernatant was then discarded and the pellet was resuspended in 1
ml of ice-cold 20mM calcium chloride solution. 100µl aliquots of this
suspension were distributed into pre-chilled tubes and left on ice for 15
minutes. 50ng of plasmid phenol-chloroform extracted DNA from E.coli mini
prep of confirmed clone was then added to cells.
Next, cells were frozen by immersing tubes containing competent A.
tumefaciens and desired plasmid into liquid nitrogen for 5 minutes, followed
by a thawing period of 5 minutes at 37°C. After the addition of 1 ml LB media
to each sample, tubes were incubated for 3 hours at 28°C with gentle shaking.
Cells were then pelleted by centrifugation at 12 000 g for 1 minute at room
23
temperature, and 1 mL of supernatant was discarded. Cells were
resuspended in the remaining 100 µL supernatant and evenly plated on LBA
plates supplemented with 50µl/ml Kanamycin and 30 µg/ml Gentamycin (for
selection). Plates were inverted and incubated at 28°C for 2-3 days (until
appearance of colonies), then stored at 4°C. Single colonies were selected
and grown in 4 mL LB media supplemented with 50 µl/ml Kanamycin and 30
µg/ml Gentamycin in a 28°C shaker. Cells were pelleted by centrifuge at
10,000g for 5 minutes, resuspended the pellet in 10mM MES
[2-(N-morpholino) ethanesulfonic acid] pH 5.7, 10mM MgCl2 (pH 5.7) and
100µM Acetosyringone. The cells were incubated at room temperature for 5
hours at a shaker (100 rpm). The cells were then pelleted by centrifuge at
10,000g for 3 minutes. The pellet was then resuspended in 1ml 10mM MES
buffer and ready for infiltration.
3.2 CONFIRMATION OF THE TRANSGENIC PLANT
3.2.1 CHROMOSOMAL DNA EXTRACTION FROM PLANT TISSUE
CTAB buffer (2% CTAB [hexadecyltrimethylammonium bromide], 20mM EDTA,
100mM Tris-HCl [pH 8.0], 1.4M NaCl) was pre-heat at 65 water bath. 0.1g ℃
fresh young leaf was ground with 400μl CTAB buffer as well as 20μl
β-mercaptoethanol (added just before grinding). The CTAB/plant tissue
mixture was transferred to a new 1.5ml tube with 1ml tip. The tube was
incubated at 65℃ for 30 minutes (invert tube gently every 10 minutes). After
30 minutes incubation, 400μl chloroform: Iso amyl alcohol was added to the
24
tube, and mixed by inverting several times until the color of chloroform
become green. The sample was centrifuged at 14,000g for 10 minutes. The
supernatant was carefully transferred to a new tube without disturbing the
interference protein. 1 volume of Isopropanol (store at 4℃) was added and
mixed by inverting several times. The tube was centrifuged at 10,000g for 5
minutes and the supernatant was discarded. The pellet was washed 2 times
with 70% ethanol and then air dry to allow ethanol evaporated. The pellet
was then dissolved in 50μl TE-1 for future use.
3.2.2 TOTAL RNA EXTRACTION FROM PLANT TISSUE
To confirm transgenic plant as well as viral presence in infected plant tissues,
total RNA was extracted. Mortar and pestle were treated with bleach and
then cooled with liquid nitrogen. Subsequently the leaf sample was added to
the mortar and frozen with liquid nitrogen before homogenized as fine
powder. The frozen powder was quickly transferred to a sterile DEPC-treated
1.5ml tube which contain 500μl of 25:24:1 phenol: chloroform: isoamyl
alcohol solution, vortex to mix, another 500μl of 0.1M Tris-HCl (pH 7.4) was
added to the mixture and again vortex to mix (all solutions were treated with
DEPC). The mixture was centrifuged at 10,000g for 5 minutes. Supernatant
(450μl) was transferred to new DEPC-treated tube and washed twice with 2
volumes (900μl) of water saturated chloroform. After the second time
remove chloroform, the tube which only contains the top phase was
centrifuged at 10,000g for 2 minutes to further remove chloroform residual.
25
The supernatant was transferred to a new 1.5ml DEPC-treated tube. 3M
sodium acetate (pH 5.2) was added to the sample to a 0.1M final
concentration along with 2-2.5 volumes of ice-cold 95% ethanol. The sample
was thoroughly mixed by inverting several times and incubated at -20 ℃
overnight or 3 hours at -80 . RNA sample was then pelleted ℃ by centrifuge at
4 for 20 minutes. ℃ The pellet was first washed with 70% ethanol then 95%
ethanol. The sample was allowed to air dry until all ethanol had evaporated.
Then the pellet was dissolved in TE-1 buffer for further use.
3.2.3 DNASE TREATMENT
To ensure the accuracy of RT-PCR analysis, RNA sample was treated with
DNase I prior to cDNA synthesis. RNA pellet was dissolved in 21.5μl of sterile
DEPC-treated water; 2.5μl of 10X reaction buffer was added (100mM Tris-Hcl,
25mM MgCl2, 5mM CaCl2, pH 7.6 at 25℃). 1μl of DNase I (2000units/ml) was
added to the mixture, mix thoroughly and then incubated at 37 for 30 ℃
minutes. All protein including DNase I was removed by phenol-chloroform
extraction before RT-PCR.
3.3 GENERATION OF ANTIBODYS AND IMMUNOBLOTTING
3.3.1 ELECTROELUTION OF PROTEIN FROM SDS-PAGE GELS
Electroelution have been extensively used to purify protein. In this method,
protein zones are localized after electrophoresis by staining with Coomassie
brilliant blue. The gel pieces which contain protein of interest were then
excised and placed in an electroelution chamber where the proteins are
26
transferred in an electric field from the gel into the solution and concentrated
over a dialysis membrane. The SDS-PAGE gel was run according to a standard
method until a maximum separation of protein of interest was obtained. One
vertical strip on the side of the gel was cut and stained in Coomassie blue, the
rest of the gel still sitting in the running buffer. The stained piece of gel was
realigning to the rest of the gel, a long horizontal slice at the level of the band
of interest was cut. The long strip was cut into about 1cm pieces and put into
electroelution chamber. The electroelution was performed at 100V overnight.
Once the elution was completed, the eluate was removed from the
electroelution chamber. The purified protein was then concentrated and
stored at -80℃ for polyclonal antibody production.
3.3.2 POLYCLONAL ANTIBODY PRODUCTION
Two-month old female rabbit was used for the polyclonal antibody
production. 5-10ml of pre-immune blood was collected from the marginal ear
vein in rabbit just a few days before the injection. Clipper blade was used to
cut a large rectangle on rabbit back covering the proposed injection sites. The
injection site was disinfected with 70% ethyl alcohol. 0.5ml of purified TRoV
(2.3mg/ml) was combined with 0.5ml Freund’s Incomplete Adjuvant (FIA) and
mixed thoroughly by pipetting. The mixed sample was then injected
subcutaneously to a volume of 0.2ml per site into 5 shaved sites. Another
booster injection was given at two weeks intervals following the same
procedure. Exsanguination was performed after 2 weeks following the second
27
booster injection, with approximate 100ml of blood was harvested using
cardiac puncture. Blood was divided into two 50ml tubes and left undisturbed
overnight at 4 to allow clotting. Tubes were centrif℃ uged at 10,000g for 10
minutes the next day; the serum was transferred to a new tube and stored at
-80 .℃
3.3.3 TOTAL PROTEIN EXTRACTION
Leaf samples were added to autoclaved mortars with liquid nitrogen and
ground to a fine powder. The powder was transferred to a new 1.5ml tube
which contains 100μl Protein Extraction Buffer (50mM Tris-HCl [pH 7.5],
15mM MgCl2, 0.1mM Phenylmethanesulfonyl fluoride [PMSF] (added just
before use), 18% glycerol, 2% Triton X-100, 0.5% NP40, and 0.7%
β-mercaptoethanol [added just before use]) with a flame-sterilized scapula.
The sample was thoroughly mixed by vortex, and then centrifuged at 10,000g
for 5 minutes. The supernatant was transferred to a new tube and stored at
-20 .℃
3.3.4 PROTEIN QUANTITATION
The standard protein curve which is a plot of the protein concentration of
known amounts of BSA protein versus their OD595 values was made before
determine the concentration of crude extraction sample. 7 known protein
concentration showed in Table 2 was used to generate the standard curve
and each concentration was made up in duplicate to generate the standard
curve. The standard curve reagents ware prepared according to the Table 2.
28
All samples were incubated 5 minutes at room temperature before measure
the OD595. Set up the UV spectrophotometer to 595 nm, blank with 1 ml of
ddH2O. The reading of the spectrophotometer was recorded in the Table 2 to
create the standard curve. The protein extraction sample was prepared,
mixed and incubated for 5 minutes and then measure the OD595. Then
concentration of the crude sample can be determined using standard curve.
Table 2: Amount of reagent and spectrophotometer
Reading of different concentration of BSA protein
Sample
name
Amount of
BSA
Volume of
1mg/ml
BSA
Volume of
ddH2O
Volume of
Bradford
Reagent
OD595 Average
OD595 from
2 replicates
0 0μg 0μl 200μl 800μl 0.434 0.446
0 0μg 0μl 200μl 800μl 0.458
1 1μg 1μl 199μl 800μl 0.476 0.4915
1 1μg 1μl 199μl 800μl 0.507
2.5 2.5μg 2.5μl 197.5μl 800μl 0.700 0.6675
2.5 2.5μg 2.5μl 197.5μl 800μl 0.635
5 5μg 5μl 195μl 800μl 0.754 0.7425
5 5μg 5μl 195μl 800μl 0.731
7.5 7.5μg 7.5μl 192.5μl 800μl 0.975 0.9725
7.5 7.5μg 7.5μl 192.5μl 800μl 0.970
10 10μg 10μl 190μl 800μl 1.097 1.094
10 10μg 10μl 190μl 800μl 1.091
20 20μg 20μl 180μl 800μl 1.421 1.3905
20 20μg 20μl 180μl 800μl 1.360
30 30μg 30μl 170μl 800μl 2.003 1.995
30 30μg 30μl 170μl 800μl 1,987
29
3.3.5 SDS-PAGE GEL
The gel cassette was first set up in the casting stand, the comb was placed in
between the two plates and the place where is about 1 centimeter down
from the teeth of the comb was marked a short line as the position of the
height of the resoling gel.
12% resolving gel was made by combining 3.3ml of ddH2O, 2.5ml 1.5M
Tris-HCl (pH 8.8), 100μl of 10% SDS, and 4ml of 30%
Acrylamide/Bisacrylamide (29:1). These reagents were mixed gently without
introducing any air bubbles. 100μl of 10% Ammonium persulfate (APS) and
5μl of T.E.M.E.D. were added just right before casting. Wait for 30 minutes
until the gel was polymerized. After the resolving gel was fully polymerized, 5%
stacking gel was made by combining 1.7ml of ddH2O, 315μl of 1 M Tris-HCl
(pH 6.8), 25μl 10% SDS, and 415μl 30% acrylamide/bisacrylamide (29:1). 25μl
of 10% APS and 5μl of T.E.M.E.D. were added to the stacking gel solution and
mixed gently right before casting. Then the comb was slowly inserted wait for
30 minutes until the stacking gel was polymerized.
The crude protein extracts samples were retrieved from -20℃. 40μl of the
each sample and 10μl of 5X SDS loading dye (250mM Tris-HCl [pH 6.8], 10%
SDS, 1.42M β-mercaptoethanol, 50% glycerol) was mixed in a new tube and
then boiled for 5 minutes in the boiled water. After centrifuged at 10,000g for
5 minutes, 40μl of each sample was loaded into the well. Gel electrophoresis
was performed at 100 V for 20 minutes, and then increase the voltage to 150
30
V until the blue dye reached the bottom with 1X SDS-PAGE electrophoresis
buffer (5mM Tris-HCl [pH 8.3], 50mM glycine, 0.5% SDS).
3.3.6 WESTERN BLOTTING
Transfer sandwich was set up using nitrocellulose membrane, pre-wet in 1X
transfer buffer (38.7mM glycine, 0.5M Tris, 20% methanol); the SDS-PAGE gel
was on the side of the black portion of transfer cassette while the
nitrocellulose membrane was on the top of gel towards the transparent side.
Both the transfer cassette and the loaded transfer sandwich were placed into
the transfer chamber, such that the black side of cassette faced the black side
of transfer sandwich. Transfer was performed at 100V for one hour. After
transferring, the membrane was blocked in 50ml of TBS buffer (50mM
Tris-HCl [pH 7.5], 150mM NaCl) with 5% skimmed milk for five hours. Then
100μl of primary antibody was added to a new tube which contains 50ml of
TBS with 0.5% skimmed milk. The membrane was incubated in this solution
overnight at 4 in a shaker.℃
Next day, membrane was washed 4 times with 50ml TBS containing 0.05%
Tween-20, 10 minutes for each washing. Then the membrane was incubated
two hours with 10μl of alkaline phosphatase conjugated affinity with 15ml of
TBS with 0.5% skimmed milk. The treated membrane was then washed with 3
times TBS-tween-20, each washing 10 minutes then a final washing with TBS
only for 10 minutes. Alkaline phosphatase substrate was added to the treated
membrane to let the result come out.
31
3.4 INFECTIVITY ASSAYS OF TRoV AND LTSV sat RNA
Turnip plants, grow under standard conditions in a greenhouse, were used for
infectivity assay. Turnip leaf samples which already infected with TRoV was
retrieved from -20℃, and grinding well in a sterilized mortar with Phosphate
buffer to obtain TRoV virion. For test, two week-old healthy leaves were
mechanically inoculated, two leaves per plant, lightly dust with
Carborundum, then brushed with TRoV virion, LTSV sat RNA, or both by
cotton gently. Inoculated plants were then returned to the greenhouse and
maintained until newly-grown, naïve leaves were collect.
3.5 TRANSIENT INFECTIVITY ASSAY
Plants were removed from the growth chamber and placed under white
fluorescent lamp for 1 hour before infiltration. Two large leaves were then
labeled prior to infiltration. Resuspended Agrobacterium samples were then
siphoned in a 1ml syringe (no needle). The region of the leaf to be infiltrated
was prepared by gently rubbing a small region of the underside of the leaf
with a syringe (needle removed). The tip of the syringe was placed against
the underside of the marked region and the plunger was gently press down
with the finger supporting the upper side of the leaf. The infiltration was
repeated for the other area of the same leaf until the whole leaf was
infiltrated. Infiltrated plants were place back to the growth chamber under
normal growth conditions. After 72 hours, the plants were ready for the
subsequent experiment.
32
4 RESULTS:
4.1 PRODUCTION OF TRANSGENIC N. BENTHAMIANA PLANTS
To examine the independent packaging ability of LTSV sat RNA, a construct
had been previously constructed in the lab with the TRoV capsid protein gene
and LTSV satellite dimer sequence in tandem. The TRoV capsid gene was
cloned using a forward primer with an incorporated KpnI sequence and a
reverse primer containing an XbaI restriction site; the insert incorporated the
natural start and stop codons of the capsid protein gene. The confirmed
constructs were subsequently used for sub-cloning with the LTSV satellite
dimer insert. Prospective forward- and negative- sense clones were
confirmed by sequencing. The transgenic plant which has forward sense LTSV
sat dimer clone (Figure 6a) was named TROVCP_LTSVsatF while the plant
which contains reverse sense LTSV sat dimer clone (Figure 6b) was named
TROVCP_LTSVsatR. TROVCP_LTSVsatF and TROVCP_LTSVsatR are identical
except for the LTSV satellite (positive sense F and negative sense R).
33
Figure 6: Schematic representation of TROVCP_LTSVsat constructs. The TRoV capsid protein
gene (TROVCP) is cloned between the KpnI and XbaI restriction sites of modified pCambia 1300,
and the LTSV satellite dimer insert is cloned at the XbaI site; both forward (F) and reverse (R)
orientations are produced. SmaI restriction sites were used to determine orientation of LTSV
satellite dimer insert. All elements downstream of the cauliflower mosaic virus (CaMV) 35S
promoter are destined for transcription, ending at the nopaline synthase terminator (Tnos).
TROVCP possesses independent translational start and stop (TAG, indicated) codons. sGFP
denotes synthetic green fluorescent protein. Thick arrows indicate the nucleotide sequence of
LTSV dimer (clockwise orientation represents positive-sense sequence of LTSV and counter
clockwise represents the negative-sense). Thin arrows represent the locations of ribozyme splice
sites.
4.2 CONFIRMATION OF TRANSGENIC PLANTS
Seeds from one line of transgenic N. benthamiana were selected and
screened on 20μg/ml Hygromycin in 1/2 x Murashige & Skoog (MS) medium
(Figure 7). Germinating plants were considered putative transgenics and were
transferred to the soil. Resistance to the antibiotic Hygromycin was used as a
selection marker to distinguish between transgenic and non-transgenic plants
(Figure 7 (a) and (b)).
34
Figure 7: Transgenic seeds screening. (a) Seeds of transgenic N. benthamiana were screened on
20μg/ml Hygromycin in 1/2 x MS medium; (b) Seeds of wild type N. benthamiana were screened
on 20μg/ml Hygromycin in 1/2 x MS medium.
4.2.1 DETECTION OF TRANSGENE DNA IN CHROMOSOMAL DNA OF
TRANSGENIC N. BENTHAMIANA PLANTS
After four week of growth, transgenic N. benthamiana, leaf samples were
collected for chromosomal DNA extraction and PCR confirmation for the
presence of transgene. Three different sets of primers were used in these
experiments: a) primers to detect the CP protein (750 bp), b) primers to
detect the LTSV satellite RNA (200 bp and 522bp) and c) primers to detect the
GFP gene (760 bp).
Forward primer (TROVCP_F) and reverse primer (TROVCP_R) were used for
PCR amplification of the CP gene. A 750 base pair (bp) product was
obtained from the chromosomal DNA of the transgenic plants (Figure 8). In
lane B, RT-PCR product of TRoV infected turnip plant total RNA used as a
positive control. Lanes C and D both show bands at the expected size (750 bp),
indicating the presence of the transgene in the transgenic N. benthamiana
35
plants. As expected non transformed plants (used as a negative control) did
not show the presence of the 750 bp (Figure. 8, Lane E).
For the identification of the LTSV satellite RNA, another PCR was performed
using LTSVsat_F and LTSVsat_R as forward and reverse primers. A 200 bp DNA
fragment corresponding to LTSV sat RNA as well as a 522 bp product were
shown due to presence of the dimer (200 bp + 322 bp)(Figure 9). Both lanes B
and C showed specific bands of the correct size, while in lane D (DNA from
healthy untransformed plant used as a negative control) showed no specific
bands (only bands for unused primers), confirming that both transgenic N.
benthamiana plants have the transgenes.
To verify the presence of DNA corresponding to GFP gene, GFP_F and GFP_R
primers were used to detect the presence of the Green Florescent Protein
(GFP) gene. A 760 bp product was produced only from the transgenic N.
benthamiana plants (Figure 10). Both Lane B and C showed strong band at
the expected molecular weight, while the absence of a 760 bp band in wild
type plant (Lane D) confirmed the presence of GFP gene in both transgenic
plants.
36
Figure 8: PCR confirmation of capsid protein transgene in TROVCP_LTSVsat transgenic N.
benthamiana. Chromosomal DNA was extracted from TROVCP_LTSVsatF, TROVCP_LTSVsatR N.
benthamiana and wild type N. benthamiana. PCR was performed using primers for the capsid
protein (TROVCP_F, TROVCP_R) and PCR products were analyzed on a 2% agarose gel. Lane A:
100 bp DNA size markers. Lane B: TROVCP PCR product from RT-PCR on TRoV RNA (positive
control for primers) Lane C: TROVCP PCR product from TROVCP_LTSVsatF (+sense RNA) transgenic
N. benthamiana chromosomal DNA extraction. Lane D: TROVCP PCR product from
TROVCP_LTSVsatR (-sense complementary RNA) transgenic N. benthamiana chromosomal DNA
extraction. Lane E: TROVCP PCR product from wild type (non-transformed plant as a negative
control) N. benthamiana chromosomal DNA extraction. Bands which are less than 100 bp are
probably unused primers/nucleotides.
37
Figure 9: PCR confirmation of LTSV satRNA transgene in TROVCP_LTSVsat transgenic N.
benthamiana. Chromosomal DNA was extracted from TROVCP_LTSVsatF, TROVCP_LTSVsatR N.
benthamiana and wild type N. benthamiana. PCR was performed using internal primers for the
LTSV sat (LTSVsat_FLTSvsat_R) and PCR products were analyzed on a 2% agarose gel. Lane A:
100 bp DNA ladder. Lane B: LTSV sat PCR product from TROVCP_LTSVsatF transgenic N.
benthamiana chromosomal DNA extraction. Lane C: LTSV sat PCR product from TROVCP_LTSVsatR
transgenic N. benthamiana chromosomal DNA extraction. Lane D: LTSV sat PCR product from wild
type N. benthamiana chromosomal DNA extraction. Bands which are less than 100 bp are
probably unused primers.
38
Figure 10: PCR confirmation of Green fluorescent protein transgene in TROVCP_LTSVsat
transgenic N. benthamiana. Chromosomal DNA was extracted from TROVCP_LTSVsatF,
TROVCP_LTSVsatR N. benthamiana and wild type N.benthamiana. PCR was performed using
primers for the GFP (GFP_F and GFP_R) and PCR products were analyzed on a 2% agarose gel.
Lane A: 100 bp DNA ladder. Lane B: GFP PCR product from TROVCP_LTSVsatF transgenic N.
benthamiana chromosomal DNA extraction. Lane C: GFP PCR product from TROVCP_LTSVsatR
transgenic N. benthamiana chromosomal DNA extraction. Lane D: GFP PCR product from wild
type N. benthamiana chromosomal DNA extraction. Bands which are less than 100 bp are
probably unused primers.
39
4.2.2 ANALYSIS OF TRANSCRIPTION PRODUCTS IN TRANSGENIC PLANTS
To determine the proper transcription of the transgenes in transgenic plants,
total RNA was extracted from transgenic plants and used in the following
experiments:
a. Quality of total RNA was verified by gel electrophoresis as shown in
Figure 11. As seen in lanes A and B the quality of cellular ribosomal
RNA is quite good implying that mRNAs transcripts must also be
intact.
Figure 11: Quality check of total RNA from transgenic N. benthamiana. RNA was extracted from
TROVCP_LTSVsatF and TROVCP_LTSVsatR, and due to high susceptibility to degradation, was
40
verified RNA quality on 1% RNA gel. 25S rRNA, 23S rRNA, 18S rRNA, 16S rRNA and tRNA were
indicated. Lane A: Total RNA extraction from TROVCP_LTSVsatF transgenic plant. Lane B: Total
RNA from TROVCP_LTSVsatR transgenic plant.
b. To verify that RNA preparations were not contaminated by
chromosomal DNA, RNA samples were first treated with DNases, and
then extracted with phenol-chloroform and precipitation by ethanol.
RNA concentrations were measured using spectrophotometer (see
Table 3). Gel electrophoresis further indicated the quality of the of the
RNA sample (see Figure 12).
Table 3: Spectrophotometer reading of RNA
TROVCP_LTSVsatF RNA sample
after DNase treatment
TROVCP_LTSVsatR RNA sample
after DNase treatment
OD260/ OD280 1.923 1.889
Concentration (ng/μl) 272 255
41
Figure 12: Quality of RNA samples before and after DNase treatment. Both RNA samples of
transgenic plants were subjected to DNase treatment to ensure no genomic DNA was exist in the
RNA sample. Due to RNA susceptibility to degradation, the quality of the RNA was verified by gel
electrophoresis. Genomic DNA was indicated. Lane A and lane C: TROVCP_LTSVsatF and
TROVCP_LTSVsatR RNA samples before DNase treatment. Lane B and lane D: TROVCP_LTSVsatF
and TROVCP_LTSVsatR RNA samples post DNase treatment.
The result in Table 3 showed that the ratio of OD260/OD280 is approximately
1.9, indicating that the RNA sample is free from proteins. Gel electrophoresis
reveals that the RNA quality is good. Bands corresponding to ribosomal RNAs
seem to be intact indicating that the quality of RNA is good. Contaminating
chromosomal DNA bands (seen on top of the gel) were not visible after
DNase treatment and presumably the total RNA samples are free from
contaminating DNAs.
42
c) Analysis of RNA transcripts from transgenic plants:
DNA free RNA samples were used for RT-PCR experiments. Three different
experiments were conducted to determine the expression of each of the
three genes in the transgene construct: TRoVCP, LTSV satellite and GFP genes.
All different treatments were using the same amount RNA (1000ng). A
negative control to determine that the RNA was not contaminated with DNA
was used. For RT-PCR experiments, 1μl of DEPC water rather than reverse
transcriptase was added. As seen in Lane D, and Lane J (Figure 13) no bands
were visible confirming that both transgenic RNA samples from transgenic
plants (TROVCP_LTSVsatF and TROVCP_LTSVsatR) were DNA free (only bands
for unused primers were shown), and revealed that the product of RT-PCR
derived from the cDNA and was not a contamination from genomic DNA.
43
Figure 13: PCR and RT-PCR results of genomic and transcripts of TRoV capsid protein, LTSV sat
RNA and GFP construct in transgenic N. benthamiana plants. RNA samples were used after
DNase treatment were used for the cDNA synthesis, followed by the PCR, using LTSVsat_F and
LTSVsat_R, Actin_F and Actin_R, GFP_F and GFP_R, and TROVCP_iF and TROVCP_iR respectively.
PCR products were analyzed on 2% agarose gel to determine the transcription of transgene in
transgenic plants. Lanes A and H: 100 bp molecular weight DNA size markers. Lane B: 210 bp
product from genomic DNA of transgenic N. benthamiana, using Actin primers. Lane C and Lane I:
RT-PCR product from TROVCP_LTSVsatF and TROVCP_LTSVsatR transgenic plants, using Actin_F
and Actin_R primer (positive control for the cDNA synthesis for RT-PCR). Lane D and Lane J:
negative control for the RT-PCR, using TROVCP_LTSVsatF and TROVCP_LTSVsatR RNA samples
after DNase treatment without reverse transcriptase, to confirm there is no genomic DNA
remaining in the RNA samples. Lane E: PCR product of genomic DNA from transgenic plant using
LTSVsat_F and LTSVsat_R primers (positive control for the primers). Lane F: RT-PCR product from
TROVCP_LTSVsatF transgenic plant, using LTSVsat_F and LTSVsat_R primers. Lane G: RT-PCR
product from TROVCP_LTSVsatR transgenic plant, using LTSVsat_F and LTSVsat_R primers. Lane K:
PCR product of genomic DNA from transgenic plant using GFP_F and GFP_R primers (positive
control for the primers). Lane L and Lane M: RT-PCR product from TROVCP_LTSVsatF and
TROVCP_LTSVsatR transgenic plant respectively, using GFP _F and GFP_R primers. Lane N: RT-PCR
product from TRoV RNA using TROVCP_iF and TROVCP_iR internal primers (positive control for
primers). Lane O and Lane P: RT-PCR products from TROVCP_LTSVsatF and TROVCP_LTSVsatR
transgenic plant respectively, using TROVCP_iF and TROVCP_iR primers. Bands which are less
than 100 bp are probably unused primers.
44
As shown in Figure 13 lanes B is positive control using Actin to indicate that
Actin primers were functional with genomic DNA. Lanes C and I are RT-PCR
results using Actin primers which showed a 210 bp product, indicating that
cDNA synthesis conditions are optimal and the quality of both RNA samples is
suitable for cDNA synthesis. Lane E is a positive control for the LTSV satellite
primers (using genomic DNA). RT-PCR results of LTSV sat RNA for both
transgenic plants showed that they can successfully transcribe sat RNA
monomer, as only one single 200 bp band appeared (Figure 13 Lane F and
Lane G). While RT-PCR results of TRoV capsid protein and GFP showed only
bands less than 100 bp which probably come from unused primers. These
results indicated that the transcripts of the TRoV capsid protein and GFP were
not detectable (Figure 13 Lanes L, M, O and P). Lanes K and N are positive
controls for GFP and TRoV capsid protein primers using genomic DNA. The
results of RT-PCR indicated that either the capsid protein and GFP mRNAs
were not transcribed or the transcripts were not stable. Since the satellite
RNA was clearly transcribed, it is likely that the CP and GFP transcripts
originated from the same RNA transcript (driven by the 35S promoter) were
also transcribed. However, the absence of any RT-PCR bands related to these
2 genes clearly proves that both CP and GFP RNAs were not stable.
45
4.3 ANTIBODY GENERATION AND IMMUNOBLOTTING
4.3.1 PROTEIN PURIFICATION
To determine if TRoV capsid protein translation was occurring in transgenic
plants, polyclonal antibodies were raised against TRoV capsid protein. TRoV
capsid protein was first cloned in pET-29 Escherichia coli (E. coli) and total
protein was isolated and electrophoresed on the SDS-PAGE. Electroelution
was used to purify the specific protein. SDS-PAGE gel was run to confirm the
purified TRoV capsid protein (Figure 14).
Figure 14: SDS-PAGE of purified TRoV capsid protein. Total protein was extracted from E. coli
harboring TRoV capsid protein gene clone (pET29c plasmid). Lane A: Protein molecular weight
Ladder (molecular weights 30 KDa, 40 KDa, 50 KDa, 60 KDa, 80 KDa, 100 KDa and 150 KDa
from bottom to top respectively). Lane B: SDS-PAGE result of naive E. coli total protein extraction
(after IPTG induction). Lane C: SDS-PAE results of total E. coli expressing TRoV capsid protein
cloned in pET-29 plasmid (after IPTG induction). Lane D: Purified TRoV protein sample after
electroelution prior to injection into a rabbit.
46
In figure 14, the thick band of 30 KDa protein in the transgenic lane
corresponds to TRoV capsid protein. Electroelution mediated purification was
performed to prepare capsid protein sample to be injected in a rabbit for
generation of polyclonal antibody.
4.3.2 WESTERN BLOTTING
Following total protein extraction from the leaf samples, the crude protein
samples were prepared, mixed according to Table 4, and incubated for 5
minutes before measuring their OD595 using spectrophotometer. Results are
listed in Table 4.
Table 4: Bradford Assay to quantitate the amount of proteins used for western blotting.
Sample Volume
of Protein
sample
Volume of
ddH2o
Volume of
Bradford mix
OD595 Average OD595
from 2 replicates
Wild type N.
benthamiana
5μl 195μl 800μl 1.803 1.726
5μl 195μl 800μl 1.649
TROVCP_LTSV
satF N.benth
5μl 195μl 800μl 1.758 1.762
5μl 195μl 800μl 1.766
TROVCP_LTSV
satR N. benth
5μl 195μl 800μl 1.698 1.704
5μl 195μl 800μl 1.710
Healthy turnip
plant
5μl 195μl 800μl 1.690 1.687
5μl 195μl 800μl 1.684
Turnip plant
infected by TRoV
5μl 195μl 800μl 1.702 1.687
5μl 195μl 800μl 1.672
The Bradford Assay standard protein curve was made according to Table 2,
the concentration of protein crude extraction sample was then determined by
plotting the O.D. reading onto the standard curve (shown in Figure 15).
47
Figure 15: Bradford assay showing concentrations of protein samples (in μg/ml). Each sample
was incubated at room temperature for 5 minutes before subjected to spectrophotometric
measurement. BSA: Bradford Assay standard protein curve. Wild type N. Benthamiana: Protein
extraction of wild type N. benthamiana. F sense transgenic: Protein extraction of
TROVCP_LTSVsatF transgenic plant. R sense transgenic: Protein extraction of TROVCP_LTSVsatR
transgenic plant. Healthy turnip: protein extraction of healthy turnip plant. Infected turnip:
Protein extraction of turnip plant infected by TRoV.
From Figure 15, the concentration of 5 protein samples can be determined by
plotting the spectrophotometer reading on to the standard curve. Using the
standard curve we can then determine the concentration of the sample
subjected to the spectrophotometric measurement. The original sample’s
concentration is 200 times greater than the sample subjected to
spectrophotometric measurement, thus allowing calculation of the crude
48
protein extraction sample concentration (Table 5).
Table 5: Protein concentration for western blotting
Sample Concentration (μg/ml)
Wild type N. benthamiana 5045
TROVCP_LTSVsatF N.benth 5194
TROVCP_LTSVsatR N. benth 4955
Healthy turnip plant 4882
Turnip plant infected by TRoV 4882
Protein samples were then used for western blotting. The western result was
shown in Figure 16. Purified TRoV sample work as positive control, showed a
specific band at 30 KDa (Figure 16, Lane A), indicating the polyclonal antibody
of TRoV is effective. TRoV infected turnip plant protein sample also showed
specific band indicating that protein extraction method and western blotting
condition is optimal (Figure 16, Lane G). Both TROVCP_LTSVsatF and
TROVCP_LTSVsatR transgenic N. benthamiana protein extract didn’t show
specific band, indicating there was no expression of TRoV capsid protein in
transgenic plants (Figure 16, Lane C and Lane D). While wild type N.
benthamiana and healthy turnip protein samples were used as negative
control and showed no specific band (Figure 16, Lane E and Lane F).
The result of the western blotting further confirms there was no TRoV capsid
protein expressed in the transgenic plant.
49
Figure 16: Western blotting using anti-TRoV antisera across dilution of purified virus and total
protein extracts to detect the presence of the TRoV capsid protein. Lane A: Purified TRoV
sample. Lane B: Protein molecular weight Ladder (molecular weights 20 KDa, 25 KDa (green), 35
KDa, 48 KDa, 63 KDa, 75 KDa (red) and 100 KDa, 135 KDa and 180 KDa from bottom to top
respectively). LaneC: Total protein extarction of TROVCP_LTSVsatF transgenic plant. Lane D:
Total protein extarction of TROVCP_LTSVsatR transgenic plant. Lane E: Total protein extarction of
wild type N. benthamiana. Lane F: Total protein extraction of healthy turnip plant. Lane G: Total
protein extraction of turnip plant which infected by TRoV.
50
4.4 AGROBACTERIUM MEDIATED TRANSIENT INFECTIVITY
ASSAY
To test whether TRoV capsid protein gene is expressed in the N. benthamiana
plant, a clone was constructed with TRoV capsid protein(Figure 17). TRoV
capsid gene was cloned using a forward primer with an incorporated KpnI
sequence and a reverse primer containing an XbaI restriction site; the insert
incorporated the natural start and stop codons of the capsid protein gene.
Figure 17: Schematic representation of TROVCP constructs. The TRoV capsid protein gene
(TROVCP) is cloned between the KpnI and XbaI restriction sites of modified pCambia 1300. All
elements downstream of the cauliflower mosaic virus (CaMV) 35S promoter are destined for
transcription, ending at the nopaline synthase terminator (Tnos). TROVCP possesses
independent translational start and stop (TAG, indicated) codons. sGFP denotes synthetic green
fluorescent protein.
The confirmed construct was then transformed to Agrobacterium to infiltrate
the healthy N. benthamiana plants. After 72 hours, the total protein of the
infiltrated leaf was extracted and used for the western blotting. The result is
shown in Figure 18. TRoV infected turnip plant protein sample (Lane A, Figure
18)acting as positive control, showed a specific band at 30 KDa indicating
western condition is optimal. Both TROVCP_LTSVsatF and TROVCP_LTSVsatR
transgenic N. benthamiana protein extract didn’t show specific band,
51
indicating there was no expression of TRoV capsid protein in transgenic plants
(Figure 18, Lane D and Lane E), which is the same result as shown in Figure 16.
The experiment plant showed specific band at 30 KDa (Figure 18, Lane F),
while wild type N. benthamiana, functioning as negative control, showed no
specific band. These findings confirm that TRoV capsid protein gene can be
successfully transcribed and translated in N. benthamiana plant. Furthermore,
poly (A) tail (generated from the Tnos-terminator) can replace the function of
the 3’ UTR in TRoV (which is naturally devoid of poly (A) tail but has a 3’ UTR).
Figure 18: Confirmation of the expression of the TRoV capsid protein in N. benthamiana plant
using western blotting. Lane A: Total protein extraction of turnip plant which infected by TRoV.
Lane B: Protein molecular weight Ladde. Lane C: Total protein extarction of wild type N.
benthamiana. Lane D: Total protein extarction of TROVCP_LTSVsatF transgenic plant. Lane E: Total
protein extarction of TROVCP_LTSVsatR transgenic plant. Lane F: Total protein extraction of
experiment N. benthamiana using Agrobacterium-mediated transient expression assay.
4.5 INFECTIVITY ASSAY OF TRoV AND LTSV sat RNA
Infectivity assays were performed on turnip plants to determine if LTSV sat
RNA transcribed in the transgenic N. benthamiana is in its natural, circularized
form. Healthy turnip leaves were used for infectivity assay with either TRoV
virion, total RNA extraction of transgenic plants, or both. Newly-grown leaf
was collected for the RNA extraction.
52
Quality of total RNA was verified by gel electrophoresis as shown in Figure 19.
As seen in lanes A, B, C, D, and E the quality of cellular ribosomal RNA is good
indicating that mRNAs transcripts must also be intact.
Figure 19: Quality of total RNA extraction from turnip plant. RNA was extracted from turnip
plants doing different infectivity assay, due to high susceptibility to degradation, was viewed on 1%
RNA gel to verify quality before RT-PCR. 28S rRNA, 18S rRNA and tRNA are indicated. Lane A: RNA
extraction of healthy turnip plant. Lane B: RNA extraction of turnip plant inoculated with TRoV
only. Lane C: RNA extraction of turnip plant inoculated with both TRoV and total RNA extraction
of TROVCP_LTSVsatF transgenic plant. Lane D: RNA extraction of turnip plant inoculated with
both TRoV and total RNA extraction of TROVCP_LTSVsatR transgenic plant. Lane E: RNA extraction
of turnip plant inoculated with both TRoV and LTSV sat RNA.
RT-PCR was performed to analyze RNA transcripts from different treatments.
Results are shown in Figure 20 and Figure 21. As shown in Figure 20, lane B,
RT-PCR result of healthy turnip plant, worked as negative control showed no
53
specific band, indicating prior to treatment, turnip plant didn’t contain TRoV
capsid protein. Lane C, turnip plant infected by TRoV only, used as positive
control which showed a specific 250 bp RT-PCR product, meaning the
infectivity assay method worked well. While both lane D and E showed
specific band indicating turnip plants infected by both TRoV virion and RNA
extraction of transgenic plant are successfully infected by TRoV. As shown in
Figure 21, no band was visible for RT-PCR of healthy turnip RNA and turnip
plant only inoculated with TRoV (Lane B and lane C), indicating prior to
inoculation with LTSV sat RNA (either RNA extraction of transgenic plant or
LTSV sat RNA), there was no LTSV sat RNA in either naïve turnip plant or TRoV
virion infected turnip plant (negative control). A 200 bp band was visible in
the RT-PCR result of turnip plant infected with both TRoV and LTSV sat RNA
(positive control), revealing TRoV supported replication of LTSV satellite
(Figure 21 Lane D). Meanwhile, both turnip plants inoculated with TRoV and
total RNA of transgenic plants (TROVCP_LTSVsatF and TROVCP_LTSVsatR)
possessed a specific band at correct place, indicating that transgenic N.
benthamiana produce the circular, natural form of the satellite.
54
Figure 20: RT-PCR results of transcripts of TRoV capsid protein in turnip plants after infectivity
assay. Turnip plants were subjected to different treatment, and newly grown leaves were
collected for RNA extraction, followed by RT-PCR using TROVCP_iF and TROVCP_iR internal
primers to detect the presence of TRoV capsid protein transcription product. PCR products were
run on the 2% agarose gel. Lane A: 100 bp DNA ladder. Lane B: RT-PCR result of healthy turnip
plant RNA extraction. Lane C: RT-PCR product of turnip plant inoculated with TRoV only. Lane D:
RT-PCR product of turnip plant inoculated with both TRoV and total RNA of TROVCP_LTSVsatF
transgenic plant. Lane E: RT-PCR product of turnip plant inoculated with both TRoV and total RNA
of TROVCP_LTSVsatR transgenic plant. Bands which are less than 100 bp are probably unused
primers.
55
Figure 21: RT-PCR results of transcripts of LTSV satellite RNA in turnip plants after infectivity
assay. Turnip plants were subjected to different treatment, and newly grown leaves were
collected for RNA extraction, followed by RT-PCR using LTSVsat_F and LTSVsat_R internal primers
to detect LTSV sat RNA. PCR products were run on the 2% agarose gel. Lane A: 100 bp DNA ladder.
Lane B: RT-PCR result of healthy turnip plant RNA extraction. Lane C: RT-PCR result of turnip plant
inoculated with TRoV only. Lane D: RT-PCR product of turnip plant inoculated with TRoV and LTSV
sat RNA. Lane E: RT-PCR product of turnip plant inoculated with both TRoV and total RNA of
TROVCP_LTSVsatF transgenic plant. Lane F: RT-PCR product of turnip plant inoculated with both
TRoV and total RNA of TROVCP_LTSVsatR transgenic plant. Bands which are less than 100 bp are
probably unused primers.
56
5 Discussion
The main goal of this study was to investigate whether a functional (CCC RNA
which is identical to the native CCC RNA found in LTSV particles and capable
of replication with the helper TRoV) LTSV satellite RNA can be produced in
vivo without any other helper viral proteins. Furthermore whether LTSV
satellite RNA is capable of independent packaging, i.e., without the presence
of a helper virus, in TRoV capsid protein alone. The particles of LTSV, the
natural helper virus of the LTSV satellite, are always found to contain sat RNA
together with LTSV genomic RNA. Moreover, packaging is exclusive for these
RNA molecules (Forster & Jones, 1979). The TROVCP_LTSVsat transgenic lines
were developed to test whether TRoV particles can assemble and encapsidate
the LTSV satellite in the absence of TRoV.
From the results of the thesis, we confirm that TRoV capsid protein gene and
LTSV satellite dimer successfully inserted into chromosomal DNA of transgenic
plants (Figure 8, 9). However, the result of the RT-PCR showed that due to the
ribozyme activity of the LTSV satellite, the LTSV satellite dimer was
self-cleaved into a monomer, and conjunctively that the TRoV capsid protein
mRNA is not stable. From Figure 13, the RT-PCR result of the LTSV satellite for
the transgenic plants showed a single 200 bp product while the PCR result of
the transgenic chromosomal DNA showed 200 bp and 522 bp products (due
to the LTSV sat dimer) indicating that due to the hammerhead ribozyme
57
activity of the LTSV satellite generated in transgenic plants is circular
monomer. Additionally, there was no detectable transcription product for
TRoV capsid protein and GFP, which revealed that 3’ poly (A) (generated from
the polyadenylation signal in pCambia) and 5’ cap deficient mRNA of the TRoV
capsid protein and GFP are not stable in the transgenic plants. Western
blotting result showed no specific band at the correct place further confirmed
that TRoV capsid protein is not expressed in the transgenic plants (Figure 16).
Furthermore, Agrobacterium-mediated transient expression assay proved
TRoV capsid protein can be successfully expressed in the N. benthamiana
plant (Figure 18), indicating that the poly (A) tail (provided by Tnos terminator)
is a functional surrogate for the natural TRoV 3’ UTR. It is worth noting here
that the LTSV sat dimer is transcribed from the 35S promoter following the
transcription of the TRoV CP mRNA. Lack of the detection of any TRoV mRNA
in transgenic plants implies that the mRNA is rapidly degraded following the
self-splicing of the LTSV sat dimer into monomeric covalently closed circular
RNA (CCC RNA). This may be related to the instability of the transgene mRNA
for the capsid protein gene which is positioned in tandem with LTSV dimer.
Self-cleavage of the satellite following the transcription would leave the TRoV
capsid protein without the protection of the poly (A) tail and therefore prone
to degradation (Figure 22). This is despite the additional 168 nucleotides that
would remain from the LTSV satellite before the hammerhead ribozyme
following satellite self-cleavage. That the constitutive expression of the TRoV
58
capsid protein and LTSV by the 35S promoter did not result in a significant
amount of uncleaved transcripts further indicates that both the self-cleavage
of the satellite and degradation of the defective mRNA (TRoV capsid protein)
are at a very high efficiency. Since the self-splicing/ligation ribozyme is carried
out through a 2’-3’ cyclic phosphate diester bonding, leaving one 2’-3’ cyclic
phosphate end and a 5’ OH termini. The 5’ OH end which is a good substrate
for the exonucleases (see Figure 4). Consequently, the GFP gene located
downstream from the sat RNA was shown to be degraded (see Figure 14).
However the 2’-3’ cyclic phosphate which is found at the end of the CP gene
should in theory be more resistant to exonucleases. This is contradictory to
our results. Furthermore, the Sobemoviruses are known to be devoid of a
poly (A) tail. However, their mRNAs (particularly CP mRNA) must be stable in
vivo to generate the CP. The 5’ end in Sobemoviruses is also known to have a
covalently bound VPg protein which is certainly a good protection from
exonucleases. In our construct we do not have the VPg. However, the 35 S
promoter will generate a cap which is certainly a good protection from
exonuleases. The 3’ UTR of CP which naturally may contain a specific
structure (which is not a tRNA-like structure) may confer a stability of CP
mRNA. In our construct we relied on the 168 nucleotides (not the 3’ UTR) to
confer stability to CP mRNA. This proved not to be the case.
LTSV circular RNA was shown to be biologically active. According to the
inoculation of turnip plants with the total RNA extracted from transgenic
59
plants, transgenic plants produced infective monomeric LTSV satellite RNA
(Figure 21); further substantiating that the transgenic plants transcribed
functional and infectious LTSV satellite successfully without any other LTSV
genes. However, no mRNA of the TRoV capsid protein was detected through
RT-PCR, and no translation product of TRoV in western blotting, indicating
that the mRNA was degraded immediately after transcription. The most
notable feature of characterized eukaryotic RNA degradation pathways is
their striking efficiency. Therefore due to the lack of the poly (A) tail at the 3’
end, TRoV capsid protein RNA transcripts were degraded in no time. The
original construct was designed to produce both the TRoV capsid protein and
the LTSV satellite in the same transgenic plant. However, the unexpected
results obtained opened a new direction in the study of the stability of mRNA.
It would be interesting to determine whether a CP mRNA with an added poly
(A) tail at the 3’ end before the ribozyme would be able to protect the mRNA
from fast degradation by exonuleases. Or is it the 2’-3’ cyclic phosphate which
makes the mRNA an efficient target for degradation?
60
Figure 22: Diagram showing how the CP mRNA could be degraded. Scissors indicate the
ribozyme activity of the LTSV sat RNA. Pocket monsters represent exonucleases. Thick
arrows indicate the LTSV (+)-sense sequence. CaMV 35S = Cauliflower mosaic 35S
promoter. Tnos= NOS terminator. sGFP=synthetic green fluorescent protein. pCambia
1300. Binary plasmid used.
61
6 Conclusions
In this thesis we have shown that a dimer copy of the virusoid of LTSV
(satellite RNA) may be expressed in transgenic plants (from 35S promoter) to
produce a functional (infectious and circular) monomer identical to the
natural one. This implies that the hammerhead ribozyme is fully functional in
vivo in a non-host plant (LTSV does not replicate in tobacco plants). Satellite
RNA expressed in tobacco was fully infectious in the natural host plant with
TRoV as a helper virus. Furthermore this result indicated that the satellite
RNA does not require any viral genes to be functional in vivo.
Encapsidation experiments with the capsid protein of TRoV (helper virus) did
not produce positive results because the presence of hammerhead ribozyme
near the end of the TRoV-CP resulted in the instability of CP mRNA. This
unexpected result becomes a very useful tool to study the stability of viral
and non-viral mRNAs in vivo.
62
7 Future Directions
Due to the ribozyme activity of the LTSV satellite RNA, transgenic plants
failed to produce TRoV capsid protein. Therefore another vector (other than
pCambia) which has TRoV capsid protein will be used to transform transgenic
plants which were proven to generate monomeric LTSV satellite RNA. Once
the TRoV capsid protein is expressed in the transgenic plants, we may attain
our original aim to test whether LTSV satRNA can be packaged in viral
particles without the presence of a helper virus.
Additionally, using the same system as TROVCP_LTSVsat, a poly (A) tail
sequence can be added to the end of the TRoV capsid protein gene to test
whether poly (A) tail is enough for the stability of the mRNA. Furthermore,
the entire 3’ UTR of the CP gene will also be added to determine whether or
not this sequence will be resistant to exonucleases.
To determine whether sat RNA produced in the both transgenic plant are
circular or linear, the denature acrylamide gel can be used to verify the
circular sat RNA and linear sat RNA.
63
8 References
AbouHaidar, M.G., and Y.C. Paliwal. (1988). Comparison of the nucleotide sequences
of the viroid-like satellite RNA of the Canadian and Australasian strains of lucerne
transient streak virus. Journal of General Virology, 69: 2369–2373.
Babour, A., Dargemont, C., and Stutz, F. (2012). Ubiquitin and assembly of export
competent mRNP. Biochim. Biophys. Acta, 1819:521-530.
Blackstock, J.M. (1978). Lucerne transient streak and lucerne latent, two new viruses
of lucerne. Australian Journal of Agricultural Research, 29: 291-304.
Bousquet-Antonelli, C., Presutti, C., and Tollervey, D. (2000). Identification of a
regulated pathway for nuclear pre-mRNA turnover. Cell, 102: 765-775.
Chiu, W.W., Kinney, R.M., and Dreher T.W. (2005). Control of translation by the 5′- and
3′-terminal regions of the dengue virus genome. J Virol, 79:8303–8015.
Chowdhury, S.R., and Savithri, H.S. (2011). Interaction of Sesbania mosaic virus
movement protein with the coat protein—implications for viral spread. FEBS J, 278:
257–272.
Collmer, C.W., and Howell, S.H. (1992). Role of satellite RNA in the expression of
symptoms caused by plant viruses. Ann. Rev. Phytopathol, 30: 419-442.
Collins, R.F., Gellatly, D.L., Sehgal, O.P., and M.G. AbouHaidar. (1998). Self-cleaving
circular RNA associated with rice yellow mottle virus is the smallest viroid-like RNA.
Virology, 241: 269-275.
Côté, F., Lévesque, D., and Perreault, J.P. (2001). Natural 2’,5’-phosphodiester bonds
found at the ligation sites of peach latent mosaic viroid. J Virol, 75:19-25.
De la Sierra-Gallay, I.L., Zig, L., Jamalli, A., and Putzer, H. (2008). Structural insights
into the dual activity of RNase J. Nat. Struct. Mol. Biol. 15, 206–212.
Decker, C.J., and Parker, R. (1993). A turnover pathway for both stable and unstable
mRNAs in yeast: evidence for a requirement for deadenylation. Genes Dev, 7:
1632-1643.
Diener, T.O. (2001). The viroid: biological oddity or evolutionary fossil? Advances in
Virus Research, 57: 137–184.
64
Doherty, E.A., and Doudna L.A. (2001). Ribozyme structure and mechanisms. Annu.
Rev. Biophys. Biomol. Struct, 30: 457-475.
Englert, M., Latz, A., Becker, D., Gimple, O., Beier, H., and Akama, K. (2007). Plant
pre-tRNA splicing enzymes are targeted to multiple cellular compartments.
Biochimie , 89: 1351-1365.
Flores, R., Delgado, S., Gas, M.E., Carbonell, A., et al. (2004). Viroids: the minimal
noncoding RNAs with autonomous replication. FEBS Letters, 567: 42–48.
Flores, R., Grubb, D., Elleuch, A., Nohales, M.A., Delgado, S., and Gago, S.
(2011). Rolling-circle replication of viroids, viroid-like satellite RNAs and hepatitis
delta virus: variations on a theme. RNA Biol, 8: 200–206.
Flores, R., Hernández C., Martinez de Alba A.E., Daròs J.A., and F. Di Serio. (2005).
Viroids and viroid-host interactions. Annual Review of Phyopathology, 43: 117-139.
Forster, A.C. and Symons, R.H. (1987a). Self-cleavage of a virusoid RNA is performed
by the proposed 55-nucleotide active site. Cell, 50: 9-16.
Forster, A.C. and Symons, R.H. (1987b). Self-cleavage of plus and minus RNAs of a
virusoid and a structural model for the active sites. Cell, 49: 211-220.
Forester, R.L. S. and Jones, A.T. (1979). Properties of lucerne transient streak virus,
and evidence of its affinity to southern bean mosaic virus. Annals of
Applied Biology , 93: 181-189.
Francki, R.B., Randles, J.W., Hatta, T., Davies, C., et al. (1983). Subterranean clover
mottle virus: another virus from Australia with encapsidated viroid-like RNA. Plant
Pathogens, 32: 47-59.
Gallie, D.R., and Kobayashi, M. (1994). The role of the 3′-untranslated region of
non-polyadenylated plant viral mRNAs in regulating translational efficiency.
Gene,142:159–165.
Gallie, D.R., Lewis, N.J., and Marzluff, W.F. (1996). The histone 3′-terminal stem-loop
is necessary for translation in Chinese hamster ovary cells. Nucleic Acids Res,
24:1954–1962.
Gallie, D.R., and Walbot, V. (1990). RNA pseudoknot domain of tobacco mosaic virus
can functionally substitute for a poly(A) tail in plant and animal cells. Genes Dev,
4:1149–1157.
Gas, M.E., Hernández, C., Flores, R., and Daròs, J.A. (2007). Processing of nuclear
65
viroids in vivo: an interplay between RNA conformations. PLoS Pathog, 3: 1813-1826.
Gas, M.E., Molina-Serrano, D., Hernández, C., Flores, R., and Daròs, J.A. (2008).
Monomeric linear RNA of citrus exocortis viroid resulting from processing in vivo has
5’-phosphomonoester and 3’-hydroxyl termini: implications for the ribonuclease and
RNA ligase involved in replication. J Virol, 82:10321-10325.
Gorgoni, B., Andrews, S., Schaller, A., Schumperli, D., Gray, N.K., Muller, B. (2005).
The stem-loop binding protein stimulates histone translation at an early step in the
initiation pathway. RNA , 11:1030–1042.
Gould, A.R. (1981). Studies on encapsidated viroid-like RNA. II. Purification and
characterization of a viroid-like RNA associated with velvet tobacco mottle virus
(VTMoV). Virology, 108: 123-133.
Gould, A.R. and T. Hatta. (1981). Studies on encapsidated viroid-like RNA. III.
Comparative studies on RNAs isolated from velvet tobacco mottle
virus and solanum nodiflorum mottle virus. Virology, 109: 137-47.
Gutiérrez, R., MacIntosh, G., and Green, P. (1999). Current perspectives on mRNA
stability in plants: multiple levels and mechanisms of control. Trend in plant science,
4:No.11.
Hazeloff, J.P. and Gerlach, W.L. (1988). Simple RNA enzymes with new and highly
specific endoribonuclease activities. Nature, 334: 585-591.
Hilleren, P., McCarthy, T., Rosbash, M., Parker, R., and Jensen, T.H. (2001). Quality
control of mRNA 3′-end processing is linked to the nuclear exosome. Nature, 413:
538-542.
Holden, K.L., and Harris, E. (2004). Enhancement of dengue virus translation: role of
the 3′ untranslated region and the terminal 3′ stem-loop domain. Virology,
329:119–133.
Houseley, J., and Tollervey, D. (2009). The many pathways of RNA degradation. Cell,
136:763-776.
Hull, R. (1977). The grouping of small spherical plant viruses with single RNA
components. J. Gen. Virol, 36: 289–295.
Hull, R. (1988). The sobemovirus group. Polyhedral Virions with monopartite RNA
genomes. In The Plant Viruses, 3: 113-146.
Hull, R. (1995). Sobemovirus. Classification and Nomenclature of Viruses. Sixth
66
Report of the International Committee on Taxonomy of Viruses. Eds. Murphy F.A.,
Fauquet C.M., Bishop D.H.L., Ghabrial S.A., Jarvis A.W., Martelli G.P., Mayo M.A., and
M.D. Summers. Vienna: Springer Publishing, pp. 376-78.
Hutchins, C., Rathjen, P.D., Forster, A.C., and Symons, R.H. (1986). Self-cleavage of
plus and minus RNA transcripts of avocado sunblotch viroid. Nucleic Acids Res, 14:
3627-3640.
Jacobs Anderson, J.S., and Parker, R. (1998). The 3′ to 5′ degradation of yeast mRNAs
is a general mechanism for mRNA turnover that requires the SKI2 DEVH box protein
and 3′ to 5′exonucleases of the exosome complex. EMBO J, 17:1497-1506.
Jensen, T.H., Patricio, K., and Rosbash, M. (2001). A block to mRNA nuclear export
in S. cerevisiae leads to hyperadenylation of transcripts that accumulate at the site of
transcription. Mol. Cell, 7: 887-898.
Jones, A.T., and Mayo M.A. (1984). Satellite nature of the viroid-like RNA-2 of
Solanum nodiflorummottle virus and the ability of other plant viruses to support the
replication of viroid-like RNA molecules. J. Gen. Virol, 65:1713–1721.
Koonin E.V., Senkevich T.G., and Dolja V.V. (2006) The ancient Virus World and
evolution of cells. Biology Direct, 1: 29.
Kopek, B.G., Perkins, G., Miller, D.J., Ellisman, M.H., and Ahlquist, P. (2007).
Three-dimensional analysis of a viral RNA replication complex reveals a virus-induced
mini-organelle. PLoS Biol, 5: 2022-2034.
LaCava, J., Houseley, J., Saveanu, C., Petfalski, E., Thompson, E., Jacquier, A., and
Tollervey, D. (2005). RNA degradation by the exosome is promoted by a nuclear
polyadenylation complex. Cell, 121: 713-724.
LaGrandeur, T.E., and Parker, R. (1996). mRNA decapping activities and their
biological roles. Biochinie, 78:1049-1055.
Lacombe, S., Bangratz, M., Vignols, F., and Brugidou, C. (2010). The rice yellow mottle
virus P1 protein exhibits dual functions to suppress and activate gene silencing. Plant
J. 61: 371–382.
Larimer, F.W., and Stevens, A. (1990). Disruption of the gene XRN1, coding for a 5′–3′
exoribonuclease, restricts yeast cell growth. Gene, 95: 85-90.
Matsuda, D., and Dreher, T.W. (2004). The tRNA-like structure of Turnip yellow mosaic
virus RNA is a 3′-translational enhancer. Virology, 321:36–46.
67
Lilley, D.M. (2005). Structure, folding and mechanisms of ribozymes. Curr Opin Struct
Biol, 15: 313–323.
Ling, R., Pate, A.E., Carr, J.P., and Firth, A.E. (2013). An essential fifth coding ORF in
the sobemoviruses. Virology, 446: 397-408.
Mäkinen, K., Mäkeläinen, K., Arshava, N., Tamm, T., Merits, A., Truve, E., Zavriev, S.,
and Saarma, M. (2000). Characterization of VPg and the polyprotein processing of
cocksfoot mottle virus (genus Sobemovirus). J. Gen. Virol, 81:2783–2789.
Martínez, F., Marqués, J., Salvador, M.L., and Daròs, J.A. (2009). Mutational analysis
of eggplant latent viroid RNA processing in Chlamydomonas reinhardtii chloroplast. J
Gen Virol,90: 3057-3065.
Mathy, N., Benard, L., Pellegrini, O., Daou, R., Wen, T., and Condon, C. (2007). 5’-to-3’
exoribonuclease activity in bacteria: role of RNase J1 in rRNA maturation and 5’
stability of mRNA. Cell, 129: 681–692.
Meier, M., and Truve, E. (20070. Sobemoviruses possess a common CfMV-like
genomic organization. Arch Virol, 152: 635–640.
Muhlrad, D., and Parker R. (1994). Premature translational termination triggers
mRNA decapping. Nature, 370: 578-581.
Murant, A.F., and Mayo, M.A. (1982). Satellites of plant viruses. Annu Rev
Phytopathol, 20:49–70.
Nair, S., and Savithri, H.S. (2010). Processing of SeMV polyproteins revisited. Virology,
396: 106–117.
Navarro, J.A., Daròs, J.A., and Flores, R. (1999). Complexes containing both polarity
strands of avocado sunblotch viroid: Identification in chloroplasts and
characterization. Virology, 253: 77-85.
Neeleman, L., Olsthoorn, R.C., Linthorst, H.J., and Bol, J.F. (2001). Translation of a
nonpolyadenylated viral RNA is enhanced by binding of viral coat protein or
polyadenylation of the RNA. Proc Natl Acad Sci U S A, 98:14286–14291.
Oparka KJ and Alison GR,Plasmodesmata. (2001). A Not So Open-and-Shut Case.
Plant Physiology, Jan, 125: 123-126.
Paliwal, Y.C. (1983). Identification and distribution in eastern Canada of Lucerne
transient streak, a virus newly discovered in North America. Canadian Journal of
Plant Pathology, 5: 75-80.
68
Paliwal, Y.C. (1984). Interction of the viroid-like RNA-2 of lucerne transient streak
virus with southern bean mosaic virus. Canadian Journal of Plant Pathology, 6:
93-184.
Pérez-Ortín, J.Z., Alepuz, P., Chavez, S., and Choder, M. (2013). Eukaryotic mRNA
Decay: methodologies, pathways, and links to other stages of gene expression. J Mol.
Biol, 425: 3750-3775.
Presutti, C. et al. (1995). Identification of the cis-elements mediating the autogenous
control of ribosomal protein L2 mRNA stability in yeast. EMBO J, 14:4022-4030.
Prody, G.A., Bakos, J.T., Buzayan, J.M., Schneider, I.R., and Bruening, G. (1986).
Autolytic processing of dimeric plant virus satellite RNA. Science, 231: 1577-1580.
Qi, Y., and Ding, B. (2003). Differential subnuclear localization of RNA strands of
opposite polarity derived from an autonomously replicating viroid. Plant Cell, 15:
2566-2577.
Roossinck, M. J., Sleat, D. and Palukaitis, P. (1992). Satellite RNAs of plant viruses :
structures and biological effects.Microbiological Reviews, 56:265-279.
Sänger H.L., Klotz G., Riesner D., Gross H.J., and A. Kleinschmidt. (1976). Viroids are
single-stranded covalently closed circular RNA molecules existing as highly
basepaired rod-like structures. Proceedings of the National Academy of Sciences
United States of America, 73: 3852–3856.
Sehgal O.P., Sinha R.C., Gellatly D.L., Ivanov I., and M.G. AbouHaidar. (1993).
Replication and encapsidation of the viroid-like satellite RNA of lucerne transient
streak virus are supported in divergent hosts by cocksfoot mottle virus and turnip
rosette virus. Journal of General Virology, 74: 785-788.
Shen, R.Z and Miller, W.A. (2007). Structures required for poly(A) tail-independent
translation overlap with, but are distinct from, cap-independent translation and RNA
replication signals at the 3′end of Tobacco necrosis virusRNA. Virology, 358: 448-458.
Sivakumaran, K., Fowler, B.C., and Hacker, D.L., (1998). Identification of viral genes
required for cell-to-cell movement of southern bean mosaic virus. Virology, 252:
376–386.
Symons, R.H. (1991). The intriguing viroids and virusoids: what is their information
content and how did they evolve? Mol. Plant Microbe Interact, 4(2): 111-121.
Tamm, T., and Truve, E. (2000). Sobemoviruses. J. Virol, 74: 6231–6241.
69
Thomsen, R., Libri, D., Boulay, J., Rosbash, M., and Jensen, T.H. (2003). Localization of
nuclear retained mRNAs in Saccharomyces cerevisiae. RNA, 9:1049-1057.
Tien-Po., Davres, C., Hatta, T., and Francki, R.I.B. (1981). Viroid-like RNA
encapsidated in lucerne transient streak virus. FEBS Letters, 132: 353-356.
Voinnet, O., Pinto, Y.M., and Baulcombe, D.C. (1999). Suppression of gene silencing: a
general strategy used by diverse DNA and RNA viruses of plants. PNAS 96:
14147–14152.
Wei T., Zhang C., Hong J., Xiong R., et al. (2010) Formation of complexes at
plasmodesmata for potyvirus intercellular movement is mediated by viral protein 116
P3N-PIPO. Public Library of Science Pathogens, 6 (6): e1000962.
Willson, T.J., and Lilley, D.M. (2009). The evolution of ribozyme chemistry. Science,
323: 1436-1438.
Zaumeyer W.J. and L.L. Harter. (1943). Inheritance of symptom expression of bean
mosaic virus. Journal of Agricultural Research, 67: 295-300.
70
Appendix
Table 6: Nucleotide sequences of forward (F) and reverse (R) primers
used for confirmation of transgene presence
Primer
Name
Sequence 5’ to 3’ Tm( )℃ PCR Product
Size
TROVCP_F ATAGTCGGTACCATGGAGAAAGGAAACAAGAAGCT 68.2 750bp
TROVCP_R GGGAACTCTAGACCATTCTATACGTTTAAGGACGA 68.2
LTSVsat_F CCTACCATGGCCTCATCAGT 62.4 200bp
LTSVsat_R GCCGGTAGGATGATGGATTA 60.4
GFP_F GACCATTCTATACGTTAGG 62.4 760bp
GFP_R GAACTTCAGGGTCAGCTTGC 62.4
TROVCP_iF ACGAGTGTGTGGAAGGGAAG 62.4 250bp
TROVCP_iR GTGGATATCTCGCCGACAGT 62.4
Actin_F GCGTGGTCTAGATGTGGATTT 60.2 200bp
Actin_R GACTACTCTAGAATGAGTAGAG 60.2