Infection, Genetics and Evolution 13 (2013) 317–330

Contents lists available at SciVerse ScienceDirect

Infection, Genetics and Evolution

journal homepage: www.elsevier .com/locate /meegid

Infections with Wolbachia, Spiroplasma, and Rickettsia in the Dolichopodidaeand other Empidoidea

Oliver Y. Martin a,⇑, Nalini Puniamoorthy b,c, Andrea Gubler b, Corinne Wimmer b, Marco V. Bernasconi b,d

a ETH Zürich, Experimental Ecology, Institute for Integrative Biology, CHN J 11, Universitätsstrasse 16, CH-8092 Zürich, Switzerlandb Institute of Evolutionary Biology and Environmental Studies, University of Zurich, Winterthurerstrasse 190, CH-8057 Zürich, Switzerlandc Department of Biological Sciences, National University of Singapore, 14 Science Drive 4, Singapore 117543, Singapored Natur-Museum Luzern, Kasernenplatz 6, CH-6003 Luzern, Switzerland

a r t i c l e i n f o a b s t r a c t

Article history:Received 7 March 2012Received in revised form 29 October 2012Accepted 8 November 2012Available online 24 November 2012

Keywords:Reproductive parasiteEndosymbiontReproductionSpeciationDiptera

1567-1348/$ - see front matter � 2012 Elsevier B.V. Ahttp://dx.doi.org/10.1016/j.meegid.2012.11.005

⇑ Corresponding author.E-mail address: oliver.martin@env.ethz.ch (O.Y. M

Vertically transmitted reproductive parasites are both extraordinarily widespread and diverse in theireffects on their invertebrate hosts. In addition to causing skewed population sex ratios via male-killingor feminization, such bacteria can further cause cytoplasmic incompatibility or parthenogenesis. Previoussurveys show that the microbes Wolbachia and Spiroplasma are common in some dipteran families, e.g.Drosophilidae or Scathophagidae, and are known to be heritable symbionts and affect reproduction inthe Diptera. However, little is known of Rickettsia infections and detailed surveys targeting other Dipteranfamilies are lacking. Here 329 samples of 247 species of Diptera belonging to the Dolichopodidae, Empid-idae, and Hybotidae (superfamily Empidoidea) are surveyed for the presence of the endosymbionts Wol-bachia, Spiroplasma, and Rickettsia. The superfamily Empidoidea contains numerous species, which havebeen the targets of intense research concerning reproductive traits involved in sexual selection. 151 ofthe species (i.e. ca. 61%) screened here, including species from key genera such as Dolichopus, Poeciloboth-rus or Empis, harboured one or more symbionts. Reproductive parasites are thus also common in theEmpidoidae, yet effects on hosts remain unclear. Potential endosymbiont-host interactions in this groupwould hence be worthy of further investigation.

� 2012 Elsevier B.V. All rights reserved.

1. Introduction

Reproductive parasites such as Wolbachia pipientis are notoriousfor their dramatic effects on the biology of their hosts (Stouthameret al., 1999; Engelstädter and Hurst, 2009; Goodacre and Martin,2012). Wolbachia represents an extremely common parasite, possi-bly infecting ca. two thirds of insect species worldwide(Hilgenboecker et al., 2008). Moreover, this symbiont is also foundin arachnids (Breeuwer, 1997; Noda et al., 1997; Goodacre et al.,2006), crustaceans (Cordaux et al., 2001) and nematodes (Taylorand Hoerauf, 1999). In addition to Wolbachia there are a range ofother symbionts, which have been demonstrated to have similareffects on their hosts (reviewed in Duron et al., 2008), e.g. Rickettsia(Werren et al., 1994) and Spiroplasma sp. (Hackett et al., 1986).These microbes, alongside Wolbachia, infect a very large numberof arthropods overall.

Surveys for infections with reproductive parasites have beenperformed for many arthropods (Martin and Goodacre, 2009). Forinstance, ca. 40% of spiders are infected with Wolbachia, Spiroplas-ma and/or Rickettsia (Goodacre et al., 2006). Within the Dipera,

ll rights reserved.

artin).

extensive surveys have assessed infections with the two commonsymbionts, Wolbachia and Spiroplasma, in particular in the familyDrosophilidae (Clark et al., 2005; Mateos et al., 2006) and thesuperfamily Muscoidea (Martin et al., 2012). Both symbionts areknown to manipulate reproduction of dipteran hosts. Wolbachiacauses CI in Culex pipiens (Yen and Barr, 1971) and Spiroplasmacauses male-killing in Drosophila willistoni (Hackett et al., 1986).Additionally, Wolbachia can affect particular reproductive traits in-volved in pre- and postcopulatory sexual selection in Drosophila(increased male mating rate: Champion de Crespigny and Wedell,2006; decreased sperm competitive ability: Champion deCrespigny et al., 2006). In contrast, knowledge of the possible con-sequences of infections with Rickettsia in Diptera lags far behind,although the microbe is known to infect flies (Weinert et al.,2009). So far, though, to our knowledge, there are no records ofRickettsia-caused effects in dipterans, although it is known fromwork on other arthropods that this microbe can cause male-killingin Coleoptera (e.g. Werren et al., 1994; Lawson et al., 2001;Majerus and Majerus, 2012), as well as parthenogenesis inHymenoptera (Neochrysocharis formosa: Hagimori et al., 2006).

Many dipteran species, especially the Drosophilidae, have beeninstrumental in furthering our understanding of host-symbiontinteractions. Within this order, the Dolichopodidae represent one

318 O.Y. Martin et al. / Infection, Genetics and Evolution 13 (2013) 317–330

of the most speciose families. Over 7100 species have been de-scribed worldwide (Pape et al., 2009), and new taxa are discoveredregularly, especially in the tropics (e.g. Bickel, 2009). Dolichopodiddiversities and abundance is greatest in humid sites, and due totheir habitat preferences have considerable potential as bio-indica-tors for natural quality assessments of biotopes (Pollet, 2009).Larval and adult stages of numerous dolichopodids feed on smallsoft-bodied arthropods (Ulrich, 2004), and have hence been con-sidered beneficial for pest control. For example, Medetera speciesare predators of bark beetles, and adult Dolichopodidae feed onmosquito and black fly larvae (Werner and Pont, 2003).

Furthermore, Empidoidea contain numerous species, whichhave attracted intense research interest in the context of sexualselection, focusing especially on elaborate courtship behaviours,nuptial gifts, deceptive signals, or sex role reversal (e.g. Zimmeret al., 2003; Bussière et al., 2008). This research focus is of directrelevance, as reproductive parasites are known to profoundly affectdiverse reproductive traits (Stouthamer et al., 1999; Goodacre andMartin, 2012). Also, symbionts have been argued to have the po-tential to drive reproductive isolation (Wade and Stevens, 1985;Hurst and Schilthuizen, 1998; Goodacre and Martin, 2012), againlinking back to the study of sexual selection and associated diver-sification (discussed in Martin et al., 2012), and the considerablepotential of empidoid systems (Cumming, 1994; Germann et al.,2010).

As a group, the Empidoidea contain species that are character-ised by elaborate courtship behaviour and conspicuous secondarysexual characters. These taxa thus provide valid targets for study-ing processes involved in sexual selection and speciation (Germannet al., 2010). Considering their importance as models of sexualselection studies, and as argued for species such as Scathophagastercoraria, another important model system (Martin et al., 2012),knowledge concerning potentially infected empidoid host taxawould be valuable. Here 247 species of Empidoidea from 67 generabelonging to the families Dolichopodidae, Empididae, and Hyboti-dae (all belonging to the superfamily Empidoidea) are surveyed forinfections with the common reproductive parasites Wolbachia,Rickettsia and Spiroplasma. The taxa assessed include the well-studied genera Dolichopus (Lunau, 1996; Zimmer, 2000), Poecilo-bothrus (Lunau, 1992; Land, 1993a,b) and Empis (Preston-Mafham,1999; Sadowski et al., 1999; Svensson and Petersson, 1987, 1988,1992, 1995, 2000).

2. Methods

2.1. Samples, DNA extraction, amplification, sequencing

Here we assess a range of representatives of the Dolichopodi-dae, Empididae, and Hybotidae for infection with the symbiontsWolbachia, Spiroplasma, and Rickettsia via PCR and direct sequenc-ing. We were able to access an extensive collection of DNA samplesfrom previous studies (Bernasconi et al., 2007a,b; Germann et al.,2010; Germann et al., 2011a,b; Pollet et al., 2010, 2011) supple-mented with a few additional samples. DNA was extracted usingDNeasy Tissue kits (Qiagen AG, Hombrechtikon, Switzerland)according to the manufacturer’s instructions. Whole fly specimenswere triturated mechanically in microtubes using a TissueLyser(Mixer Mill MM 300, Qiagen AG). Following digestion with Protein-ase K (20 lg/ml), samples were applied to the columns for DNAabsorption and washing. Finally, DNA was eluted in 200 ll of thebuffer from the kit and stored at �20 �C. All extracted fly speci-mens are deposited at the Zoological Museum, Institute of Evolu-tionary Biology and Environmental Studies, University of Zurich.PCR reactions were performed with 2 ll of the extracted DNA astemplate, 1 ll of each primer (10 lM), 12.5 ll Master Mix

(250 units, HotStarTaq Master Mix Kit, Qiagen AG), 8.5 ll distilledH2O, for a total volume of 25 ll (manufacturer’s buffer). We usedthe following primers for PCR (Microsynth GmbH, Balgach, Swit-zerland): (i) Wolbachia (wsp gene) Wsp-F: TGGTCCAATAAGTGAT-GAAGAAACTAGCTA and Wsp-R: AAAAATTAAACGCTACTCCAGCTTCTGCAC (Braig et al., 1998; Zhou et al., 1998; Jeyaprakash andHoy, 2000); (ii) Spiroplasma (intergenic ribosomal spacer and adja-cent regions between the 30-end of 16S and the 50-end of the 23S),SP-ITS-J04: GCCAGAAGTCAGTGTCCTAACCG and SP-ITS-N55: ATT-CCAAGGCATCCACCATACG (see Majerus et al., 1999). (iii) Rickettsia(citrate synthase gene) Rics741F: CATCCGGAGCTAATCCTTTTGCand Rcit1197R: CATTTCTTTCCATTGTGCCATC (Davis et al., 1998).

For all three symbionts under study, PCR reaction mixtureswere subjected to 10 min DNA denaturation at 95 �C, 50 cyclesof denaturation at 94 �C for 30 s, annealing at 50 �C for 20 s,and elongation at 72 �C for 30 s. Elongation was completed bya further 7 min step at 72 �C. We used 50 cycles because preli-minary tests on our specimens demonstrated that PCR basedon 36 cycles produced weak signals for our positive samples.Increasing the number of PCR cycles allowed us to obtain ampli-cons of better quality so that these could be sequenced to con-firm the identity of the endosymbionts investigated.Importantly, the weak positive signals recorded via the morecommonly used 36 cycle PCRs were of the same length as theclearer positive signals resulting from our PCRs using 50 cycles,so were very likely to be the same amplicons. The PCR reactionswere performed in a DNA Thermal Cycler (Perkin-Elmer AppliedBiosystems, Rotkreuz, Switzerland). Purification of PCR productsfor direct sequencing was performed by adding 0.5 ll (1 U/ll)Shrimp Alkaline Phosphatase (Promega AG, Wallisellen, Switzer-land), 0.25 ll (20 U/ll) Exonculease I (New England Biolabs (Bio-concept), Allschwil, Switzerland), and 24.25 ll distilled H2O(ratio of PCR product and ExoSap-mix 1:1) to each PCR product.The ExoSAP protocol consisted of 45 min incubation at 37 �C and15 min deactivation at 80 �C. Cycle sequencing reactions wereperformed in total volumes of 10 ll using an ABI Prism BigDye Terminator Cycle Sequencing Kit (Perkin-Elmer Applied Bio-systems) on an ABI 3730 DNA Analyser (Perkin-Elmer AppliedBiosystems), again following the manufacturer’s instructions.Negative controls were used at each step of the amplificationand sequence procedures. These negative controls consisted ofmicro-tubes/positions in the reaction plates containing all thenecessary reagents except that the extracted genomic DNA orthe purified PCR product to be amplified or sequenced wassubstituted with distilled H2O. Positive controls, consisting of ex-tracted genomic DNA of samples infected with the three micro-bial symbionts (for the PCR) and in purified PCR products (fordirect sequencing in one direction) were also used at each stepof the procedures.

2.2. DNA sequence analyses

Gene sequences for all microbes were handled and storedusing the Lasergene program Editseq (DNAstar Inc., Madison,WI USA). Alignment of all sequences was performed using theClustal W method as implemented in Megalign (DNAstar Inc.)with default multiple alignment parameters (‘‘gap penalty = 15’’;‘‘gap length penalty = 6.66’’; ‘‘delay divergent sqs(%)=30’’; ‘‘DNAtransition weight = 0.50’’). Phenetic reconstruction was per-formed using MEGA (Molecular Evolutionary Genetics Analysis)version 4.0.2 (Tamura et al., 2007). Phenograms were obtainedby applying the neighbour-joining tree reconstruction methodwith Kimura 2-parameters as nucleotide substitution model.The sequences of the genes analysed here have been depositedin GenBank (Table 1).

Table 1The microbial endosymbionts Wolbachia, Spiroplasma and Rickettsia identified via PCR and direct sequencing in a range of Dipteran species belonging to the Dolichopodidae and other Empidoidea. GenBank accession numbers areprovided wherever good quality sequences of the microorganisms assessed were available. Further explanations: 4 sequences were <200 bp and were hence not given ACC nos; (⁄) indicates putative positives (i.e. where PCR was positivebut no sequence was available due to poor quality), and ‘unknown’ indicates a sequence of an unidentified microorganism (after BLAST in GenBank).

Species Locality Country Sample ID Wolbachia Spiroplasma RickettsiaPositive PCR ACC No. Positive PCR ACC No. Positive PCR ACC No.

Fam. DolichopodidaeAchalcinae

Achalcus cinereus Denderleeuw Belgium 86 X JQ925503 X JQ925562Achalcus flavicollis Denderleeuw Belgium 171 X JQ925436Achalcus phragmitidis Virelles, Etang de Virelles Belgium 229 X JQ925530 X JQ925467Achalcus vaillanti Meilegem, Kaaimeersen Belgium 182 X JQ925444 X JQ925595

DiaphorinaeArgyra argentina Aalst, Het Osbroek Belgium 119Argyra argyria Denderhoutem Belgium 11 X (⁄) X (⁄) X (⁄)Argyra atriceps Denderhoutem Belgium 19 X Unknown X JQ925548Argyra atriceps Aalst, Het Osbroek Belgium 122 X (⁄) X JQ925569Argyra diaphana Denderhoutem Belgium 6 X JQ925375Argyra elongata Virelles, Etang de Virelles Belgium 214 X JQ925460Argyra grata Sint-Pieters-Voeren, Alserbos Belgium 140 X Unknown X JQ925576Argyra ilonae Aalst, Het Osbroek Belgium 121 X JQ925568Argyra leucocephala Denderhoutem Belgium 5 X (⁄)Argyra perplexa Aalst, Het Osbroek Belgium 120 X JQ925507 X (⁄) X JQ925567Argyra vestita Baasrode Belgium 160 X JQ925432 X JQ925587Argyra vestita Denderleeuw Belgium 173 X JQ925437 X JQ925590Asyndetus latifrons Nijlen Belgium 219 X JQ925527 X (⁄)Chrysotus blepharosceles Froidfontaine Belgium 77 X JQ925501 X (⁄) X JQ925558Chrysotus blepharosceles Sint-Martens-Voeren, Altenbroek Belgium 137 X JQ925514 X JQ925417 X JQ925575Chrysotus cilipes Zonhoven Belgium 39 X JQ925492 X (⁄)Chrysotus femoratus Zonhoven Belgium 57 X JQ925498 X (⁄)Chrysotus gramineus Zonhoven Belgium 54 X JQ925496 X JQ925391 X JQ925554Chrysotus gramineus Nijlen Belgium 215 X JQ925461 X JQ925604Chrysotus gramineus var. varians Sint-Martens-Voeren, Altenbroek Belgium 136 X JQ925513 X JQ925416 X JQ925574Chrysotus laesus Zonhoven Belgium 40 X JQ925493Chrysotus laesus Prugiasco, Ticino Switzerland D1 X (⁄)Chrysotus laesus Prugiasco, Ticino Switzerland D2 X (⁄) X JQ925625Chrysotus miripalpis Guanacaste: Costa Rica 313 X JQ925541Chrysotus neglectus Zonhoven Belgium 28 X JQ925488 X (⁄)Chrysotus neglectus Nijlen Belgium 217 X JQ925526 X (⁄) X JQ925605Chrysotus palustris Baasrode Belgium 155 X JQ925430 X JQ925582Chrysotus palustris Denderhoutem Belgium 282 X JQ925535Chrysotus pulchellus Zonhoven Belgium 33 X JQ925489 X Unknown X JQ925550Chrysotus sp. CR-2003–002 Heredia Costa Rica 302 X JQ925537Chrysotus sp. CR-2003–010 Puntarenas Costa Rica 305 X (⁄)Chrysotus sp. CR-2003–015 – Costa Rica 320Chrysotus sp. CR-2003–017 – Costa Rica 307 X JQ925538 X UnknownChrysotus suavis Zonhoven Belgium 37 X JQ925491 X JQ925552Diaphorus nigricans Zonhoven Belgium 31 X (⁄) X UnknownDiaphorus nigricans Zonhoven Belgium 38Diaphorus oculatus Denderleeuw Belgium 79 X JQ925502 X JQ925400 X JQ925559Diaphorus oculatus Ligneuville Belgium 284 X (⁄)Diaphorus oculatus Baasrode Belgium 285Diaphorus sp. CR-2003–006 Heredia Costa Rica 311 X JQ925540 X JQ925483Diaphorus sp. CR-2003–013 Heredia Costa Rica 310 X JQ925539Symbolia costaricensis Heredia Costa Rica 300

(continued on next page)

O.Y.M

artinet

al./Infection,Genetics

andEvolution

13(2013)

317–330

319

Table 1 (continued)

Species Locality Country Sample ID Wolbachia Spiroplasma RickettsiaPositive PCR ACC No. Positive PCR ACC No. Positive PCR ACC No.

DolichopodinaeDolichopus acuticornis Nijlen Belgium 222 X (⁄)Dolichopus arbustorum Heure-en-Famenne Belgium 108Dolichopus argyrotarsis Grandhan Belgium 111Dolichopus atripes Zonhoven Belgium 60 X JQ925393Dolichopus brevipennis Denderhoutem Belgium 14Dolichopus campestris Froidfontaine Belgium 71 X (⁄)Dolichopus cilifemoratus Meilegem, Kaaimeersen Belgium 177 X JQ925440Dolichopus claviger Denderhoutem Belgium 15 X JQ925376 X JQ925546Dolichopus claviger Zonhoven Belgium 53 X JQ925390Dolichopus clavipes Knokke Belgium 113 X JQ925407Dolichopus clavipes Knokke Belgium 194 X JQ925451 X JQ925601Dolichopus diadema Knokke Belgium 197Dolichopus excisus Meilegem, Kaaimeersen Belgium 181 X JQ925443 X JQ925594Dolichopus festivus Sint-Martens-Voeren, Altenbroek Belgium 142 X JQ925419Dolichopus genicupallidus Tirol, Kaunertal Austria 100Dolichopus griseipennis Sint-Martens-Voeren, Altenbroek Belgium 150 X JQ925425Dolichopus griseipennis La Gué de la Chaine France 186Dolichopus griseipennis Knokke Belgium 195 X JQ925602Dolichopus laticola Chimay, Lac de Virelles Belgium 109Dolichopus latilimbatus Zonhoven Belgium 45 X (⁄)Dolichopus lepidus Zonhoven Belgium 48Dolichopus linearis Veldegem Belgium 115Dolichopus linearis Baasrode Belgium 157 X (⁄) X JQ925584Dolichopus longicornis Veldegem Belgium 112Dolichopus longicornis Baasrode Belgium 158 X (⁄) X JQ925585Dolichopus longitarsis Tirol, Kaunertal Austria 95Dolichopus migrans De Haan Belgium 114Dolichopus nigricornis Neigem Belgium 23Dolichopus nigricornis Froidfontaine Belgium 61 X JQ925394Dolichopus nitidus Nijlen Belgium 218Dolichopus nubilus Meilegem, Kaaimeersen Belgium 180 X (⁄) X JQ925593Dolichopus pennatus Denderhoutem Belgium 13 X UnknownDolichopus pennatus Froidfontaine Belgium 62 X JQ925395Dolichopus picipes Froidfontaine Belgium 65Dolichopus planitarsis Chimay, Lac de Virelles Belgium 110Dolichopus plumipes Lompret Belgium 209 X JQ925459Dolichopus plumipes Virelles, Etang de Virelles Belgium 212 X (⁄)Dolichopus plumipes Nijlen Belgium 223 X JQ925465Dolichopus plumipes Baasrode Belgium 257 X JQ925476 X JQ925619Dolichopus plumipes Ligneuville Belgium 262 X JQ925478Dolichopus plumipes Veldegem Belgium 264Dolichopus plumipes Denderhoutem Belgium 267 X UnknownDolichopus plumipes Mürringen Belgium 269Dolichopus plumipes Denderhoutem Belgium 271 X JQ925480Dolichopus plumipes Virelles, Etang de Virelles Belgium 272Dolichopus plumipes Denderhoutem Belgium 3A X (⁄)Dolichopus plumipes Denderhoutem Belgium 3B X JQ925372 X (⁄)Dolichopus plumipes Denderhoutem Belgium 3C X JQ925373Dolichopus polleti Virelles, Etang de Virelles Belgium 213Dolichopus popularis Denderhoutem Belgium 2 X UnknownDolichopus rupestris Rekem, Vallei van de Zijpbeek Belgium 116 X JQ925506 X JQ925408Dolichopus sabinus Knokke Belgium 117 X JQ925409Dolichopus signatus Zonhoven Belgium 46 X JQ925386

320O

.Y.Martin

etal./Infection,G

eneticsand

Evolution13

(2013)317–

330

Dolichopus signatus Sint-Martens-Voeren, Altenbroek Belgium 135 X JQ925415 X JQ925573Dolichopus simplex Nijlen Belgium 216 X JQ925462Dolichopus simplex Zonhoven Belgium 50ADolichopus simplex Zonhoven Belgium 50B X JQ925388Dolichopus simplex Zonhoven Belgium 50C X JQ925389Dolichopus subpennatus Noiseux Belgium 118Dolichopus subpennatus Baasrode Belgium 153 X JQ925428 X JQ925581Dolichopus tanythrix Zonhoven Belgium 43Dolichopus trivialis Froidfontaine Belgium 64Dolichopus ungulatus Denderhoutem Belgium 17 X JQ925377Dolichopus ungulatus Zonhoven Belgium 24 X JQ925382Dolichopus ungulatus Denderhoutem Belgium 256Dolichopus ungulatus Oberglass Germany 260Dolichopus ungulatus Denderhoutem Belgium 261Dolichopus ungulatus Schwarzwald Germany 265 X UnknownDolichopus ungulatus Lié Mürringen Belgium 266 X (⁄)Dolichopus ungulatus Sonvico, Madonna d’Arla Switzerland 273Dolichopus ungulatus Lié Ligneuville Belgium 275 X JQ925481Dolichopus ungulatus Todtrau Germany 276 X Legionella sp.Dolichopus ungulatus Castro, Ticino Switzerland D3Dolichopus ungulatus Castro, Ticino Switzerland D4Dolichopus urbanus Denderhoutem Belgium 1 X JQ925371Dolichopus vitripennis Zonhoven Belgium 29 X JQ925384Dolichopus wahlbergi Froidfontaine Belgium 76 X JQ925398Dolichopus wahlbergi Virelles, Etang de Virelles Belgium 211 X (⁄)Dolichopus wahlbergi Zürich, Züriberg Switzerland 255Dolichopus wahlbergi Virelles, Etang de Virelles Belgium 258 X JQ925477Dolichopus wahlbergi Froidfontaine Belgium 76A X <200 bp X JQ925556Dolichopus wahlbergi Froidfontaine Belgium 76B X <200 bp X JQ925557Ethiromyia chalybea Denderleeuw Belgium 81A X JQ925401Ethiromyia chalybea Denderleeuw Belgium 81B X JQ925402Gymnopternus aerosus Zonhoven Belgium 25 X JQ925383Gymnopternus angustifrons Zonhoven Belgium 52 X JQ925495Gymnopternus assimilis Denderleeuw Belgium 88 X JQ925403Gymnopternus blankaartensis Denderleeuw Belgium 90Gymnopternus brevicornis Denderhoutem Belgium 20 X JQ925379Gymnopternus brevicornis Zonhoven Belgium 36Gymnopternus brevicornis La Gué de la Chaine, Forêt de Bellême France 174Gymnopternus brevicornis Vrigny, Etangs de Vrigny France 190 X JQ925449 X JQ925600Gymnopternus celer Denderhoutem Belgium 18 X JQ925378 X JQ925547Gymnopternus celer Zonhoven Belgium 51Gymnopternus celer Ninove Belgium 170Gymnopternus celer Denderleeuw Belgium 205 X Erwinia sp.Gymnopternus celer Lompret Belgium 207 X Unknown X Erwinia sp.Gymnopternus celer Baasrode Belgium 268 X JQ925620Gymnopternus celer Port, Ligneuville Belgium 270 X Unknown X Erwinia sp.Gymnopternus cupreus Neigem Belgium 21 X JQ925486 X JQ925380Gymnopternus helveticus Losone, Piano d’Arbigo Switzerland 290 X UnknownGymnopternus helveticus Losone, Piano d’Arbigo Switzerland 291Gymnopternus metallicus Zonhoven Belgium 30 X JQ925385 X JQ925549Gymnopternus silvestris Denderleeuw Belgium 82 X (⁄)Hercostomus chaerophylli Tirol, Kaunertal Austria 105Hercostomus chetifer Lompret Belgium 206 X UnknownHercostomus fugax Tirol, Kaunertal Austria 293Hercostomus fulvicaudis Baasrode Belgium 154 X JQ925429 X UnknownHercostomus germanus Tirol, Kaunertal Austria 94Hercostomus longiventris Münstertal Germany 274Hercostomus nanus Denderleeuw Belgium 87Hercostomus nigrilamellatus St. Martens-Latem Belgium 294

(continued on next page)

O.Y.M

artinet

al./Infection,Genetics

andEvolution

13(2013)

317–330

321

Table 1 (continued)

Species Locality Country Sample ID Wolbachia Spiroplasma RickettsiaPositive PCR ACC No. Positive PCR ACC No. Positive PCR ACC No.

Hercostomus nigripennis Zonhoven Belgium 59Hercostomus nigriplantis Lompret Belgium 210Hercostomus nigriplantis Lompret Belgium 259 X (⁄)Hercostomus parvilamellatus Denderhoutem Belgium 4 X JQ925374Hercostomus pilifer La Gué de la Chaine, Forêt de Bellême France 176 X JQ925439Hercostomus plagiatus La Gué de la Chaine France 185 X Coxiella sp.Hercostomus praeceps Sint-Martens-Voeren, Altenbroek Belgium 141 X JQ925515 X JQ925577Hercostomus rusticus Kerkini Mts. Greece 324Hercostomus sp. nov. Stilfser Joch, Gomagoi Italy 322Hercostomus verbekei Mallorca Spain 263 X JQ925479Hercostomus vivax Tirol, Kaunertal Austria 96 X JQ925405Hercostomus vockerothi Voralberg, Montafon Austria 295Ortochile nigricoerulea Kusadaci Turkey 323Pelastoneurus sp. CR-2003–003 Puntarenas Costa Rica 309Poecilobothrus chrysozygos La Gué de la Chaine France 184 X JQ925446Poecilobothrus nobilitatus Denderhoutem Belgium 130 X JQ925511 X (⁄) X <200 bpPoecilobothrus nobilitatus Sint-Martens-Voeren, Altenbroek Belgium 143 X JQ925420 X Coxiella sp.Poecilobothrus principalis Knokke Belgium 198 X JQ925453Poecilobothrus regalis Spasovo, Chirpan Bulgaria 292Sybistroma crinipes Ihringen Germany 278 X UnknownSybistroma discipes Tirol, Kaunertal Austria 97 X JQ925406 X JQ925563Sybistroma nodicornis Froidfontaine Belgium 72 X UnknownSybistroma obscurellum Denderleeuw Belgium 83Sybistroma obscurellum Tirol, Kaunertal Austria 103Tachytrechus notatus Mallorca Spain 279 X Unknown X Bartonella sp.Tachytrechus sp. CR-2003–002 – Costa Rica 318Tachytrechus sp. CR-2003–003 Heredia Costa Rica 299 X JQ925482Tachytrechus sp. CR-2003–005 – Costa Rica 319 X JQ925543Tachytrechus transitorius Tirol, Kaunertal Austria 101

EnliniinaeHarmstonia nr recta Heredia Costa Rica 312

HydrophorinaeAphrosylus celtiber Knokke Belgium 191 X JQ925524 X JQ925450Cymatopus sp. CR-2003–001 Puntarenas Costa Rica 321Eucoryphus brunneri Tödi-Gebiet, Ochsenplanggen Switzerland 326 X Unknown X JQ925624Eucoryphus coeruleus Bergün, Preda, Lai da Palpuogna Switzerland 327 X (⁄)Hydrophorinae sp. CR 2003–01 Braulo Carillo Costa Rica 203 X JQ925457 X <200 bpHydrophorinae sp. CR 2003–03 Braulo Carillo Costa Rica 204 X JQ925458 X JQ925603Hydrophorus borealis Tirol, Kaunertal Austria 107 X JQ925566Hydrophorus oceanus Zeeland Netherlands 134 X JQ925572Hydrophorus oceanus Knokke Belgium 199 X JQ925454Hydrophorus praecox Grandhan Belgium 164 X JQ925518Hydrophorus rogenhoferi Tirol, Kaunertal Austria 106 X JQ925565Liancalus virens Tirol, Kaunertal Austria 104 X (⁄)Machaerium maritimae Doel Belgium 200 X JQ925455nr Oedematopus sp. CR-2003–001 Heredia Costa Rica 315 X JQ925542Sphyrotarsus argyrostomus Tödi-Gebiet, Ochsenplanggen Switzerland 325 X JQ925485 X JQ925623

MedeterinaeDolichophorus kerteszi Sint-Martens-Voeren, Altenbroek Belgium 138Medetera abstrusa Baasrode Belgium 161 X JQ925433 X JQ925588Medetera ambigua Belchen Germany 289Medetera belgica Pollare Belgium 225Medetera dendrobaena Zedelgem Belgium 129 X JQ925510 X JQ925571

322O

.Y.Martin

etal./Infection,G

eneticsand

Evolution13

(2013)317–

330

Medetera dendrobaena Sint-Martens-Voeren, Altenbroek Belgium 148 X JQ925579Medetera diadema Zedelgem Belgium 125 X JQ925410Medetera feminina Denderleeuw Belgium 227Medetera impigra Sint-Pieters-Voeren, Alserbos Belgium 146 X JQ925423Medetera infumata Grandmenil Belgium 165Medetera jacula Zedelgem Belgium 127 X JQ925412Medetera jacula Baasrode Belgium 162 X JQ925434 X JQ925589Medetera jugalis Grandhan Belgium 169Medetera lorea Nijlen Belgium 220 X JQ925463 X JQ925606Medetera micacea Sonvico, Fié Switzerland 288Medetera muralis La Gué de la Chaine, La Haute Grange France 187 X JQ925522 X JQ925447 X JQ925597Medetera pallipes Sint-Pieters-Voeren, Alserbos Belgium 139 X JQ925418Medetera pallipes Denderhoutem Belgium 287Medetera parenti Denderhoutem Belgium 226 X JQ925607Medetera petrophiloides Knokke Belgium 196 X JQ925452Medetera plumbella Nijlen Belgium 224 X JQ925466Medetera saxatilis Zedelgem Belgium 128 X JQ925509 X JQ925413Medetera saxatilis Baasrode Belgium 163 X JQ925517Medetera saxatilis La Gué de la Chaine, La Haute Grange France 189 X JQ925523 X JQ925599Medetera signaticornis Belchen Germany 286 X JQ925622Medetera sp. CR-2003–005 – Costa Rica 296Medetera sp. CR-2003–006 Heredia Costa Rica 317Medetera truncorum Zedelgem Belgium 126 X JQ925411Medetera truncorum Sint-Martens-Voeren, Altenbroek Belgium 149 X JQ925424Medetera truncorum La Gué de la Chaine, La Haute Grange France 188 X JQ925448 X JQ925598Systenus leucurus Veldegem (Zedelgem) Belgium 228 X JQ925529Thrypticus smaragdinus Virelles, Etang de Virelles Belgium 230Thrypticus tarsalis Meilegem, Kaaimeersen Belgium 179 X JQ925442

MicrophorinaeMicrophor holosericeus Virelles, Etang de Virelles Belgium 239 X JQ925470 X JQ925610Microphor holosericeus Denderhoutem Belgium 252 X JQ925617

NeurigoninaeNeurigona lineata Meilegem, Kaaimeersen Belgium 183 X JQ925521 X JQ925445 X JQ925596Neurigona pallida Ihringen Germany 281Neurigona quadrifasciata Zonhoven Belgium 32Neurigona quadrifasciata Froidfontaine Belgium 74 X UnknownOncopygius distans Münstertal Germany 277 X JQ925621

PeloropeodinaeAcropsilus niger Namur Lairot Rochehaut Belgium 280Anepsiomyia flaviventris Zonhoven Belgium 35Chrysotimus flaviventris Sint-Martens-Voeren, Altenbroek Belgium 144 X JQ925421 X JQ925578Chrysotimus molliculus Baasrode Belgium 159 X JQ925586Micromorphus albipes Baasrode Belgium 156 X JQ925516 X JQ925431 X JQ925583Peloropeodes sp. CR-2003–001 Heredia Costa Rica 306Peloropeodes sp. CR-2003–002 Heredia Costa Rica 301

RhaphiinaeNematoproctus distendens Denderleeuw Belgium 80Rhaphium appendiculatum Denderhoutem Belgium 8 X Unknown X JQ925544Rhaphium caliginosum Denderleeuw Belgium 78 X JQ925399Rhaphium commune Denderhoutem Belgium 16 X UnknownRhaphium consobrinum Doel Belgium 201 X JQ925456Rhaphium crassipes Denderhoutem Belgium 9 X Unknown X JQ925545Rhaphium ensicorne Froidfontaine Belgium 68 X UnknownRhaphium ensicorne Sint-Pieters-Voeren, Alserbos Belgium 147Rhaphium fasciatum Denderleeuw Belgium 92Rhaphium fractum Durbuy Belgium 168Rhaphium laticorne Denderleeuw Belgium 85 X Unknown X Unknown X JQ925561

(continued on next page)

O.Y.M

artinet

al./Infection,Genetics

andEvolution

13(2013)

317–330

323

Table 1 (continued)

Species Locality Country Sample ID Wolbachia Spiroplasma RickettsiaPositive PCR ACC No. Positive PCR ACC No. Positive PCR ACC No.

Rhaphium longicorne Zonhoven Belgium 47 X JQ925553Rhaphium micans Meilegem, Kaaimeersen Belgium 124 X JQ925508 X unknown X JQ925570Rhaphium micans Nijlen Belgium 221 X JQ925528 X JQ925464Rhaphium monotrichum Virelles, Etang de Virelles Belgium 231Rhaphium penicillatum Durbuy Belgium 167 X JQ925520Rhaphium quadrispinosum Meilegem, Kaaimeersen Belgium 123

SciapodinaeAmblypsilopus sp. CR-2003–003 – Costa Rica 304Condylostylus sp. CR-2003–002 Guanacaste Costa Rica 316 X JQ925484Sciapus platypterus Neigem Belgium 22 X JQ925381Sciapus platypterus Zonhoven Belgium 58 X JQ925499Sciapus wiedemanni Le Mont St-Michel France 193Sciapus zonatulus Veldegem Belgium 283 X JQ925536 X Unknown

StolidosomatinaePseudosympycnus sp. CR-2003–001 Heredia Costa Rica 297Pseudosympycnus sp. CR-2003–003 Heredia Costa Rica 298Stolidosoma sp. CR-2003–001 Heredia Costa Rica 314

SympycninaeCampsicnemus alpinus Zonhoven Belgium 42Campsicnemus curvipes Zonhoven Belgium 27 X JQ925487 X Unknown X UnknownCampsicnemus loripes Zonhoven Belgium 34 X JQ925490 X JQ925551Campsicnemus loripes Odeigne Belgium 166 X JQ925519 X JQ925435Campsicnemus marginatus Lompret Belgium 208Campsicnemus picticornis Zonhoven Belgium 56 X JQ925392 X JQ925555Campsicnemus pumilio Zonhoven Belgium 55 X JQ925497 X UnknownCampsicnemus pusillus Vrigny, Etangs de Vrigny France 192 X JQ925525Campsicnemus scambus Zonhoven Belgium 49 X JQ925494 X JQ925387Campsicnemus umbripennis Tirol, Kaunertal Austria 98Lamprochromus bifasciatus Denderleeuw Belgium 91 X JQ925504 X (⁄)Lamprochromus strobli Baasrode Belgium 152 X JQ925427 X JQ925580nr Neoparentia s sp. CR-2003–002 Heredia Costa Rica 308nr Neoparentia sp. CR-2003–001 Heredia Costa Rica 303Sympycnus aeneicoxa Froidfontaine Belgium 67 X JQ925397Sympycnus cirripes Tirol, Kaunertal Austria 99 X JQ925505 X JQ925564Sympycnus desoutteri Denderhoutem Belgium 7 X UnknownSympycnus desoutteri Denderhoutem Belgium 131 X JQ925512 X JQ925414 X Coxiella sp.Syntormon bicolorellum Meilegem, Kaaimeersen Belgium 178 X JQ925441 X JQ925592Syntormon denticulatum Froidfontaine Belgium 70 X (⁄)Syntormon denticulatum Tirol, Kaunertal Austria 93 X JQ925404Syntormon pallipes Denderleeuw Belgium 172 X UnknownSyntormon pumilum Froidfontaine Belgium 73 X JQ925500Syntormon sulcipes Froidfontaine Belgium 63 X JQ925396Syntormon zelleri Tirol, Kaunertal Austria 102Teuchophorus calcaratus Denderleeuw Belgium 84 X JQ925560Teuchophorus calcaratus Denderhoutem Belgium 132Teuchophorus clavigerellus Rigaud, Quebec Canada 232Teuchophorus monacanthus La Gué de la Chaine, Forêt de Bellême France 175 X JQ925438 X JQ925591Teuchophorus nigricosta Denderhoutem Belgium 133Teuchophorus simplex Sint-Martens-Voeren, Altenbroek Belgium 145 X JQ925422Teuchophorus spinigerellus Baasrode Belgium 151 X JQ925426

XanthochlorinaeXanthochlorus ornatus Zonhoven Belgium 26 X Unknown

324O

.Y.Martin

etal./Infection,G

eneticsand

Evolution13

(2013)317–

330

Fam. EmpididaeClinocerinae

Clinocera sp. Lompret Belgium 249 X JQ925473 X JQ925615Dolichocephala irrorata Virelles, Etang de Virelles Belgium 245 X JQ925532

EmpidinaeEmpis (Empis) bicuspidata Virelles, Etang de Virelles Belgium 250 X JQ925474 X JQ925616Empis (Empis) nigripes Denderhoutem Belgium 254 X JQ925618Empis (Kritempis) livida Virelles, Etang de Virelles Belgium 242Empis (Xanthempis) trigramma Denderhoutem Belgium 246Hilara interstincta Virelles, Etang de Virelles Belgium 248 X JQ925614

HemerodromiinaeHemerodromia baetica Lompret Belgium 233 X JQ925468Phyllodromia melanocephala Virelles, Etang de Virelles Belgium 238 X JQ925609

Fam. Hybotidae

TrichopezinaeTrichopeza longicornis Le Gué de la Chaine, La Forêt de Bêlleme France 243 X JQ925611

HybotinaeHybos femoratus Virelles, Etang de Virelles Belgium 247 X JQ925533 X JQ925472 X JQ925613

OcydromiinaeBicellaria vana Denderhoutem Belgium 244 X JQ925612Leptopeza flavipes Virelles, Etang de Virelles Belgium 236 X JQ925469Oedalea hybotina Virelles, Etang de Virelles Belgium 253 X JQ925475Oedalea tibialis Lompret Belgium 235 X Unknown

TachydromiinaeDrapetis (Elaphropeza) ephippiata Virelles, Etang de Virelles Belgium 240 X UnknownPlatypalpus pallidiventris Virelles, Etang de Virelles Belgium 241 X JQ925471Stilpon graminum Virelles, Etang de Virelles Belgium 237Tachydromia annulimana Denderhoutem Belgium 234 X JQ925531 X JQ925608Tachypeza nubila Virelles, Etang de Virelles Belgium 251 X JQ925534

O.Y.M

artinet

al./Infection,Genetics

andEvolution

13(2013)

317–330

325

326 O.Y. Martin et al. / Infection, Genetics and Evolution 13 (2013) 317–330

3. Results

Overall, infections with the three microbes under study werefound to be widespread in the Dolichopodidae and the other twoEmpidoidea families assessed. Out of the 247 species (227 speciesof Dolichopodidae and 20 species of Empididae and Hybotidae)screened, 151 of the sampled species tested positive for at leastone symbiont (151/247, ca. 61%; i.e. only counting those sampleswhere microbe identity could be confirmed and sequences ob-tained were of good quality; full PCR survey results and explana-tions are presented in Table 1). In summary, both single andmultiple symbiont infections were found in numerous species(Table 1, see Figs. 1–3 for each symbiont-specific tree). Infectionswere also found across the Dolichopodidae sensu lato + sensu stricto(see Pollet and Brooks, 2008) and other Empidoidea surveyed.Positive PCRs for each of the symbionts assessed may either indi-cate current infections, or instances where bacterial DNA has beenincorporated into the fly genome (i.e. via lateral gene transfer inthe past, e.g. Hotopp et al., 2007).

Focussing on the Dolichopodidae and the individual bacteria inturn, the following patterns were observed: 136 out of 227 species(ca. 60%) tested positive for at least one microbe. Regarding singleinfections, overall 26 samples were infected with Wolbachia, com-pared with 62 solely harbouring Spiroplasma, and 26 Rickettsia (seeTable 1 for details). Concerning multiple infections (i.e. within thesame individual), we found 52 individuals harbouring doubleinfections and 7 with triple infections (Table 1). Focussing on thegenus Poecilobothrus, which has been the object of sexual selectionstudies (Lunau, 1992; Land, 1993a,b), among the 5 individualstested representing 4 species surveyed, we find evidence for infec-tions with Wolbachia (one sample, belonging to Poecilobothrusnobilitatus) and Spiroplasma (Poecilobothrus chrysozygos, P. nobilita-tus and Poecilobothrus principalis). In 82 samples of Dolichopus rep-resenting 41 species screened, 39 samples were infected with atleast one microbe. Of these samples, 25 were infected solely withSpiroplasma, 4 with Rickettsia only, and 9 samples harboured bothsymbionts. Interestingly, only a single sample (D. rupestris) har-boured Wolbachia (double infection with Spiroplasma).

In the other two Empidoidea families assessed (Empididae (9species) + Hybotidae (11 species)), 15 out of 20 species screenedwere infected with at least one symbiont. Specifically, we find Wol-bachia in 4 species (20%). In addition, out of the 20 species, 7 har-boured Spiroplasma (35%), and 9 were infected with Rickettsia (45%)(see Table 1 for full details). We found three double infections (twoindividuals were infected with both Spiroplasma + Rickettsia andone individual harboured Wolbachia + Rickettsia), as well as a singleHybos femoratus individual harbouring all three symbionts. In par-ticular, in the well-studied genus Empis (e.g. Preston-Mafham,1999; Sadowski et al., 1999; Svensson and Petersson, 2000), ofthe four species surveyed, the Empis (Empis) bicuspidata individualscreened harboured both Spiroplasma and Rickettsia, whereas Empis(Empis) nigripes was infected with Rickettsia.

We identified GenBank sequences previously reported in otherarthropods that were very similar or even almost identical to thosestrains found in our samples. Overall, we found no clear taxonomicrelationships between any of the three endosymbiont strains andtheir respective hosts. For instance, out of the 21 sequences of Wol-bachia with highest similarity, only 6 belonged to other dipterans(Fig. 1). Similarly for Rickettsia, we identified 18 close-matching se-quences, out of which only 1 belonged to that of a fly Glossina mors-itans submorsitans (GQ255903), whilst the rest were mostly fromspiders, beetles and ticks (Fig. 3). We found fewer identical se-quences for Spiroplasma, although the sequence of highest similar-ity to 49 of our sequences was that of a male-killing Spiroplasma sp.(AJ245996) in the butterfly Danus chrysippus (Jiggins et al., 2000b),

while 20 were similar to the male-killing Spiroplasma strain HARF-UKU2 (AB127933) found in Japanese ladybird beetles (Nakamuraet al., 2005) (Fig. 2). We also identified 28 that were most similarto the non-male killing Spiroplasma strain found in Drosophilamojavensis (FJ657350) (Haselkorn et al., 2009) (Fig. 2).

4. Discussion

Wolbachia infections were present across many of the Dolicho-podidae and other Empidoidea assessed (62 samples tested posi-tive, ca. 19%), but we found far more infections with Spiroplasma(175 samples, ca. 53%). Interestingly, this pattern does not mirrorresults from similar surveys for other taxa, including other Diptera,where Wolbachia was generally found to be more common thanSpiroplasma. For example, in 225 drosophilid species, Wolbachia(19 species) was found more commonly than Spiroplasma (only 3species) (Mateos et al., 2006). Similarly, in the Scathophagidae 33of the 130 samples tested harboured infections with Wolbachiaversus only 9 out of 130 with Spiroplasma (Martin et al., 2012).The third symbiont assessed, Rickettsia, was also more commonlyfound than Wolbachia (i.e. in 101 samples, ca. 31%). The species as-sessed here hence seem to show a high proportion of infectionswith symbionts other than Wolbachia. This interesting pattern,where Wolbachia is not as typically dominant and frequent (seeHilgenboecker et al., 2008), is worthy of further investigation.

Focussing in particular on species studied in the context of sex-ual selection, we find that representatives from the genera Empis,Dolichopus and Poecilobothrus can harbour infections with the threesymbionts assessed. The symbionts under study can profoundly af-fect their host’s biology, for example skewing sex ratio towards fe-males by causing male-killing in various insects (e.g. Werren et al.,1994; Hurst et al., 1999; Jiggins et al., 2000ab). Empis, Dolichopusand Poecilobothrus have been subjected to intense research in thepast (e.g. Lunau, 1992; Land, 1993a,b; Preston-Mafham, 1999;Sadowski et al., 1999; Svensson and Petersson, 2000), so it mightbe rewarding to use these species to investigate consequences ofinfection. This might make particular sense if samples from pub-lished experiments are still available and could be screened forinfections. Crucially, this would render it possible to match infec-tion status to a range of measures of interest that have been al-ready assessed experimentally for focal animals. Reproductiveparasites can have more subtle effects than dramatic phenotypessuch as male-killing, and have been shown to affect both pre-and postcopulatory processes in Drosophila (Champion de Cres-pigny and Wedell, 2006; Champion de Crespigny et al., 2006; Mar-kov et al., 2009). Considering the extensive knowledge ofreproduction in Empidoidea, it should be possible to find relevantcandidate traits likely to be affected by symbionts.

It is now clear that consequences of symbiont infections can beextraordinarily varied and may not only affect reproduction, butalso immunity or non-reproductive behaviours (Goodacre andMartin, 2012). Wolbachia infections can increase resistance toviruses in Aedes aegypti (Bian et al., 2010) and to the entomopath-ogenic fungus Beauveria bassiana in Drosophila melanogaster(Panteleev et al., 2007). This microbe has further been found to in-crease longevity in the dipterans Drosophila melanogaster (Fry andRand, 2002) and Aedes albopictus (Dobson et al., 2002). Spiroplasmais known to enhance survival of its host Drosophila hydei versus aparasitoid wasp (Xie et al., 2010). Infections with Rickettsia havebeen shown to increase thermotolerance in Bemisia tabaci (Bruminet al., 2011), and impede long-range dispersal in the spider Erigoneatra (Goodacre et al., 2009). Again, it would be interesting to gainknowledge on the effects the symbionts under study could haveon empidoid hosts. A further question worthy of investigation iseffects when hosts harbour multiple infections (see Engelstädter

128 Medetera saxatilis 163 Medetera saxatilis 131 Sympycnus desoutteri 189 Medetera saxatilis 164 Hydrophorus praecox

130 Poecilobothrus nobilitatus 129 Medetera dendrobaena 141 Hercostomus praeceps

Anagasta kuehniella (Lepidoptera: Pyralidae) AB469184 228 Systenus leucurus 33 Chrysotus pulchellus Sitotroga cerealella (Lepidoptera: Gelechiidae) AB469189

Chloropidae sp (Diptera) EU126473 120 Argyra perplexa

Xylosandrus germanus (Coleoptera: Curculionidae) AB359040 247 Hybos femoratus

234 Tachydromia annulimana 319 Tachytrechus sp. Aedes albopictus (Diptera: Culicidae) AF397411 54 Chrysotus gramineus

Pleistodontes imperialis (Hymenoptera: Agaonidae) AY567677 99 Sympycnus cirripes 192 Campsicnemus pusillus 57 Chrysotus femoratus 52 Gymnopternus angustifrons 137 Chrysotus blepharosceles

219 Asyndetus latifrons Dicranoncus femoralis (Coleoptera: Carabidae) GU236959

27 Campsicnemus curvipes 245 Dolichocephala irrorata Rhagoletis pomonella (Diptera: Tephritidae) HQ333157 315 Hydrophorinae sp. 124 Rhaphium micans 221 Rhaphium micans

167 Rhaphium penicillatum Ixodes ricinus (Acari: Ixodidae) EF219192

229 Achalcus phragmitidis 251 Tachypeza nubila 86 Achalcus cinereus Oedemeronia lucidicollis (Coleoptera: Oedermeridae) GU236968

283 Sciapus zonatulus Ceutorhynchus neglectus (Coleoptera: Curculionidae) HQ602874

Anthophora plumipes (Hymenoptera: Apidae) JN639222 183 Neurigona lineata 187 Medetera muralis

191 Aphrosylus celtiber Culex neomimulus (Diptera: Culicidae) AY462860 217 Chrysotus neglectus

Macrosteles fascifrons (Hemiptera: Cicadellidae) HQ404773 116 Dolichopus rupestris

Hylyphantes graminicola (Araneae: Linyphiidae) EU916184 34 Campsicnemus loripes 166 Campsicnemus loripes

55 Campsicnemus pumilio 49 Campsicnemus scambus Gimnomera cerea (Diptera: Scathophagidae) JN601185

21 Gymnopternus cupreus Phlebotomus perniciosus (Diptera: Psychodidae) AF237884

302 Chrysotus sp. 313 Chrysotus minipalpis 307 Chrysotus sp.

Bactericera cockerelli (Hemiptera: Triozidae) JN166717 310 Diaphorus sp. 311 Diaphorus sp.

58 Sciapus platypterus Dryinidae sp. (Hymenoptera) GU289823 91 Lamprochromus bifasciatus 156 Micromorphus albipes 79 Diaphorus oculatus Rhagoletis cerasi (Diptera: Tephritidae) EU344971 37 Chrysotus suavis 136 Chrysotus gramineus var. varians 28 Chrysotus neglectus 77 Chrysotus blepharosceles 40 Chrysotus laesus 282 Chrysotus palustris

39 Chrysotus cilipes 73 Syntormon pumilum

Diabrotica barberi (Coleoptera: Chrysomelidae) EU188683 Norellia (Norellisoma) liturata (Diptera: Scathophagidae) JN601164

96

100

100

92

100

100

100

100

100

68

83

87

57

99

98

100

87

50

100

99

89

94

100

83

62

90

70

70

86

94

96

87

8164

99

50

5881

58

0.02

Fig. 1. Neighbour joining tree (Kimura 2 parameter) illustrating the diversity of the Wolbachia strains recorded in the Dolichopodidae and other Empidoidea speciesexamined here. The letter and/or number before a species name is the code identifying the samples used in this study (in black). Also included are some sequences recoveredfrom GenBank and showing high similarity to the strains identified in our Diptera samples (in grey; with corresponding accession numbers). Wolbachia endosymbiont ofNorellia (Norellisoma) liturata was used to root the tree. Bootstrap support values (for 1000 pseudo-replicates) higher than 50% are indicated at the branches.

O.Y. Martin et al. / Infection, Genetics and Evolution 13 (2013) 317–330 327

Mycoplasma mycoides NC015407

53 Dolichopus claviger 233 Hemerodromia baetica 247 Hybos femoratus Cantharidae sp. (Coleoptera) DQ861916 239 Microphor holosericeus 299 Tachytrechus sp.

236 Leptopeza flavipes 253 Oedalea hybotina Syrphidae sp. (Diptera) DQ439673

24 Dolichopus ungulatus 196 Medetera petrophiloides 25 Gymnopternus aerosus 258 Dolichopus wahlbergi 199 Hydrophorus oceanus Drosophila aldrichi (Diptera: Drosophilidae) FJ657364 316 Condylostylus sp. Drosophila hydei (Diptera: Drosophilidae) FJ657368 198 Poecilobothrus principalis 29 Dolichopus vitripennis 78 Rhaphium caliginosum 223 Dolichopus plumipes 262 Dolichopus plumipes 209 Dolichopus plumipes Scathophaga socor (Diptera: Scathophagidae) JN601190 257 Dolichopus plumipes 263 Hercostomus verbekei 56 Campsicnemus picticornis 54 Chrysotus gramineus 62 Dolichopus pennatus 241 Platypalpus pallidiventris 271 Dolichopus plumipes 116 Dolichopus rupestris 20 Gymnopternus brevicornis 152 Lamprochromus strobli 17 Dolichopus ungulatus 1 Dolichopus urbanus 224 Medetera plumbella 215 Chrysotus gramineus 18 Gymnopternus celer 275 Dolichopus ungulatusDrosophila mojavensis (Diptera: Drosophilidae) FJ657350

21 Gymnopternus cupreus 311 Diaphorus sp.

64

96

51

51

98

91

94

50

88

0.1

88

Drosophila atripex (Diptera: Drosophilidae) FJ657370 Danaus chrysippus (Lepidoptera: Nymphalidae) AJ245996

166 Campsicnemus loripes 81B Ethiromyia chalybea 182 Achalcus vaillanti Harmonia axyridis (Coleoptera: Coccinellidae) AB127933 117 Dolichopus sabinus 61 Dolichopus nigricornis 204 Hydrophorinae sp. 63 Syntormon sulcipes 184 Hercostomus chrysozygos 76 Dolichopus wahlbergi Scathophaga soror (Diptera: Scathophagidae) JN601191 151 Teuchophorus spinigerellus 214 Argyra elongata 179 Thrypticus tarsalis 183 Neurigona lineata 81A Ethiromyia chalybea Drosophila ananassae (Diptera: Drosophilidae) FJ657372 Scathophaga stercoraria (Diptera: Scathophagidae) JN601188 88 Gymnopternus assimilis 250 Empis (Empis) bicuspidata 201 Rhaphium consobrinum 216 Dolichopus simplex 221 Rhaphium micans Ixodes pacificus (Acari: Ixodidae) DQ004911 229 Achalcus phragmitidis

150 Dolichopus griseipennis 162 Medetera jacula 155 Chrysotus palustris 153 Dolichopus subpennatus 46 Dolichopus signatus

249 Clinocera sp. 325 Sphyrotarsus argyrostomus 188 Medetera truncorum

22 Sciapus platypterus 15 Dolichopus claviger

143 Poecilobothrus nobilitatus 178 Syntormon bicolorellum 161 Medetera abstrusa 160 Argyra vestita 113 Dolichopus clavipes 93 Syntormon denticulatum 4 Hercostomus parvilamellatus 191 Campsicnemus pusillus 190 Gymnopternus brevicornis 146 Medetera impigra 156 Micromorphus albipes 149 Medetera truncorum 135 Dolichopus signatus 131 Sympycnus desoutteri Scathophaga stercoraria (Diptera: Scathophagidae) JN601189 142 Dolichopus festivus Scathophaga stercoraria (Diptera: Scathophagidae) JN601194 6 Argyra diaphana 50B Dolichopus simplex Scathophaga soror (Diptera: Scathophagidae) JN601193 60 Dolichopus atripes 145 Teuchophorus simplex 177 Dolichopus cilifemoratus 3B Dolichopus plumipes 187 Medetera muralis 49 Campsicnemus scambus 203 Hydrophorinae sp. 137 Chrysotus blepharosceles 200 Machaerium maritimae Scathophaga stercoraria (Diptera: Scathophagidae) JN601195 97 Sybistroma discipes 96 Hercostomus vivax 173 Argyra vestita 79 Diaphorus oculatus 176 Hercostomus pilifer 126 Medetera truncorum 175 Teuchophorus monacanthus 128 Medetera saxatilis 50C Dolichopus simplex 171 Achalcus flavicollis 30 Gymnopternus metallicus 181 Dolichopus excisus 127 Medetera jacula 144 Chrysotimus flaviventris 139 Medetera pallipes 220 Medetera lorea 125 Medetera diadema 154 Hercostomus fulvicaudis 194 Dolichopus griseipennisScathophaga soror (Diptera: Scathophagidae) JN601192

136 Chrysotus gramineus var. varians 67 Sympycnus aeneicoxa

3C Dolichopus plumipes

74

67

Fig. 2. Neighbour joining tree (Kimura 2 parameter) illustrating the diversity of the Spiroplasma strains recorded in the Dolichopodidae and other Empidoidea speciesexamined here. The letter and/or number before a species name is the code identifying the samples used in this study (in black). Also included are some sequences recoveredfrom GenBank and showing high similarity to the strains identified in our Diptera samples (in grey; with corresponding accession numbers). Crosses to the right of sequencesindicate Spiroplasma strains known to cause male-killing in their hosts, crosses covered with red exmarks indicate non male-killing strains. Mycoplasma mycoides was used toroot the tree. Bootstrap support values (for 1000 pseudo-replicates) higher than 50% are indicated at the branches.

328 O.Y. Martin et al. / Infection, Genetics and Evolution 13 (2013) 317–330

54 Chrysotus gramineus Adalia decempunctata (Coleoptera: Coccinellidae) AJ269522 106 Hydrophorus rogenhoferi 137 Chrysotus blepharosceles 234 Tachydromia annulimana 86 Achalcus cinereus 135 Dolichopus signatus Deronectes delarouzei (Coleoptera: Dytiscidae) FM955313 97 Sybistroma discipes 144 Chrysotimus flaviventris 178 Syntormon bicolorellum 8 Rhaphium appendiculatum 85 Rhaphium laticorne 134 Hydrophorus oceanus 76A Dolichopus wahlbergi 159 Chrysotimus molliculus 136 Chrysotus gramineus var. varians 203 Hydrophorinae sp. CR 2003-01 182 Achalcus vaillanti 188 Medetera truncorum 239 Microphor holosericeusOedothorax gibbosus (Araneae: Linyphiidae) HQ286289

187 Medetera muralis 238 Phyllodromia melanocephala 76B Dolichopus wahlbergi Oedothorax retusus (Araneae: Linyphiidae) JN889707 47 Rhaphium longicorne 244 Bicellaria vana Collin, 1926 148 Medetera dendrobaena 156 Micromorphus albipes 215 Chrysotus gramineus

249 Clinocera sp. 19 Argyra atriceps 124 Rhaphium micans 122 Argyra atriceps 30 Gymnopternus metallicus

248 Hilara interstincta Deronectes semirufus (Coleoptera: Dytiscidae) FM955314

252 Microphor holosericeus 15 Dolichopus claviger 250 Empis (Empis) bicuspidata 160 Argyra vestita 56 Campsicnemus picticornis 77 Chrysotus blepharosceles 173 Argyra vestita 79 Diaphorus oculatus 175 Teuchophorus monacanthus 189 Medetera saxatilis 190 Gymnopternus brevicornis

121 Argyra ilonae 325 Sphyrotarsus argyrostomus 254 Empis (Empis) nigripes 226 Medetera parenti 129 Medetera dendrobaena Troxochrus scabriculus (Araneae: Linyphiidae) DQ231485 183 Neurigona lineata 141 Hercostomus praeceps 243 Trichopeza longicornis

107 Hydrophorus borealis D2 Chrysotus laesus

99 Sympycnus cirripes 204 Hydrophorinae sp. CR 2003-03

277 Oncopygius distans 37 Chrysotus suavis Rhyzobius litura (Coleoptera: Coccinellidae) FJ666753

9 Rhaphium crassipes 33 Chrysotus pulchellus

153 Dolichopus subpennatus 158 Dolichopus longicornis 257 Dolichopus plumipes 152 Lamprochromus strobli 161 Medetera abstrusa 268 Gymnopternus celer 155 Chrysotus palustris 157 Dolichopus linearis 220 Medetera lorea

120 Argyra perplexaAcyrthosiphon pisum (Hemiptera: Aphididae) AY744287

Macrolophus sp. (Hemiptera: Miridae) HE583221Empoasca papayae (Hemiptera: Cicadellidae) U76908

217 Chrysotus neglectus 84 Teuchophorus calcaratus

34 Campsicnemus loripes 140 Argyra grata

180 Dolichopus nubilus 181 Dolichopus excisus 195 Aphrosylus celtiber Ixodes ovatus AB297808

247 Hybos femoratus Amblyomma scalpturatum (Acari: Ixodidae) AY375161

Amblyomma incisum (Acari: Ixodidae) FJ269035 Homo sapien (R. typhi strain Wilmington) U59714

18 Gymnopternus celer 326 Eucoryphus brunneri

Haemaphysalis flava (Acari: Ixodidae) AB297809Glossina morsitans submorsitans (Diptera: Glossinidae) GQ255903 286 Medetera signaticornis

Pulex echidnophagoides (Siphonaptera: Pulicidae) GU447233 Ixodes ovatus ( Acari: Ixodidae) AB297808

162 Medetera jacula 194 Dolichopus griseipennis80

65

64

93

80

65

96

89

52

90

65

68

61

99

62

63

68

95

99

97

60

0.02

Fig. 3. Neighbour joining tree (Kimura 2 parameter) illustrating the diversity of theRickettsia strains recorded in the Dolichopodidae and other Empidoidea speciesexamined here. The letter and/or number before a species name is the codeidentifying the samples used in this study (in black). Also included are somesequences recovered from GenBank and showing high similarity to the strainsidentified in our Diptera samples (in grey; with corresponding accession numbers).Bootstrap support values (for 1000 pseudo-replicates) higher than 50% areindicated above branches.

O.Y. Martin et al. / Infection, Genetics and Evolution 13 (2013) 317–330 329

et al., 2008; Vautrin et al., 2008). Here 63 samples (so ca. 19%) wereinfected with more than one symbiont in total (i.e. at least 55 dou-ble and 8 triple infections). Co-infections with different symbiontsor different strains of the same microbe are not uncommon acrossarthropods (e.g. Goodacre et al., 2006; Duron et al., 2008; Skaljacet al., 2010), and may often represent transitional situations. Alter-natively, more stable coexistence within individual hosts might bepossible if the different microbes occupy different host tissues (e.g.intracellular versus extracellular; different host organs). For exam-ple, in Drosophila melanogaster, Spiroplasma was found principallyin the hemolymph (i.e. extracellular niche), whereas Wolbachiawas entirely lacking there (Goto et al., 2006).

To conclude, we find that the symbionts under study were pre-valent across the empidoid families studied (Dolichopodidae,Empididae, Hybotidae). Overall, 151 of the 247 species investigatedharboured infections with one to three of the microbes assessed,including several double and triple infections within individuals.Symbionts can have extraordinarily diverse and occasionally dras-tic effects on host biology and evolution (Hurst and Schilthuizen,1998; Engelstädter and Hurst, 2009; Goodacre and Martin, 2012).Understanding the precise consequences of single and multipleinfections in the Empidoidea hence seems a fruitful future areaof research. This could involve further survey and performing tar-geted research where symbionts are planned as an integral compo-nent of the study, e.g. via experimental infections. In addition, onecould make use of samples from past studies if available to seekout effects associated with symbiont infection.

Acknowledgments

The authors would like to thank the SNF for support(31003A_125144/1, PZ00P3_121777/1 and PZ00P3-137514 toOYM; 31003A_115981/47191402 to MVB), and Marc Pollet at INBOBrussels for kindly providing most of the fly samples. NP was sup-ported by the National University of Singapore Overseas GraduateScholarship (NUS-OGS).

References

Bernasconi, M.V., Pollet, M., Varini-Ooijen, M., Ward, P.I., 2007a. Phylogeny ofEuropean Dolichopus and Gymnopternus (Diptera, Dolichopodidae) and thesignificance of morphological characters inferred from molecular data. Eur. J.Entomol. 104, 601–617.

Bernasconi, M.V., Pollet, M., Ward, P.I., 2007b. Molecular systematics ofDolichopodidae (Diptera) inferred from COI and 12S rDNA gene sequencesbased on European exemplars. Invert.. Syst. 21, 453–470.

Bian, G., Xu, Y., Lu, P., Xie, Y., Xi, Z., 2010. The endosymbiotic bacterium Wolbachiainduces resistance to Dengue virus in Aedes aegypti. PLoS Pathog. 6, e1000833.

Bickel, D.J., 2009. Dolichopodidae (Long-Legged Flies). In: Brown, B.V., Borkent, A.,Cumming, J.M., Wood, D.M., Woodley, N.E., Zumbado, M. (Eds.), Manual ofCentral American Diptera, National Research Council Canada, Ottawa, pp. 671–694.

Braig, H.R., Zhou, W., Dobson, S.L., O’Neill, S.L., 1998. Cloning and characterization ofa gene encoding the major surface protein of the bacterial endosymbiontWolbachia pipientis. J. Bacteriol. 180, 2373–2378.

Breeuwer, J.A.J., 1997. Wolbachia and cytoplasmic incompatibility in the spidermites Tetranychus urticae and T. Turkestani. Heredity 79, 41–47.

Brumin, M., Kontsedalov, S., Ghanim, M., 2011. Rickettsia influencesthermotolerance in the whitefly Bemisia tabaci B biotype. Insect Sci. 18, 57–66.

Bussière, L.F., Gwynne, D.T., Brooks, R., 2008. Contrasting sexual selection on malesand females in a role-reversed swarming dance fly, Rhamphomyia longicaudaLoew (Diptera: Empididae). J. Evol. Biol. 21, 1683–1691.

Champion de Crespigny, F.E.C., Wedell, N., 2006. Wolbachia infection reduces spermcompetitive ability in an insect. Proc. R. Soc. London, B 273, 1455–1458.

Champion de Crespigny, F.E.C., Pitt, T.D., Wedell, N., 2006. Increased male matingrate in Drosophila is associated with Wolbachia infection. J. Evol. Biol. 19, 1964–1972.

Clark, M.E., Anderson, C.L., Cande, J., Karr, T.L., 2005. Widespread prevalence ofWolbachia in laboratory stocks and the implications for Drosophila research.Genetics 170, 1667–1675.

Cordaux, R., Michel-Salzat, A., Bouchon, D., 2001. Wolbachia infection incrustaceans: novel hosts and potential routes for horizontal transmission. J.Evol. Biol. 14, 237–243.

330 O.Y. Martin et al. / Infection, Genetics and Evolution 13 (2013) 317–330

Cumming, J.M., 1994. Sexual selection and the evolution of dance fly matingsystems (Diptera: Empididae; Empidinae). Can. Entomol. 126, 907–920.

Davis, M.J., Ying, Z., Brunner, B.R., Pantoja, A., Fer-Werda, F.H., 1998. Rickettsialrelative associated with Papaya bunchy top disease. Curr. Microbiol. 26, 80–84.

Dobson, S., Marsland, E., Rattanadechakul, W., 2002. Mutualistic Wolbachia infectionin Aedes albopictus: accelerating cytoplasmic drive. Genetics 160, 1087–1094.

Duron, O., Bouchon, D., Boutin, S., Bellamy, L., Zhou, L.Q., Engelstädter, J., Hurst,G.D.D., 2008. The diversity of reproductive parasites among arthropods:Wolbachia do not walk alone. BMC Biol. 6, 27.

Engelstädter, J., Hurst, G.D.D., 2009. The ecology and evolution of microbes thatmanipulate host reproduction. Ann. Rev. Ecol. Evol. Syst. 140, 127–149.

Engelstädter, J., Telschow, A., Yamamura, N., 2008. Coexistence of cytoplasmicincompatibility and male-killing-inducing endosymbionts, and their impact onhost gene flow. Theor. Popul. Biol. 73, 125–133.

Fry, A., Rand, D., 2002. Wolbachia interactions that determine Drosophilamelanogaster survival. Evolution 56, 1976–1981.

Germann, C., Pollet, M., Bernasconi, M.V., 2011a. Aspects of European Argyrasystematics: molecular insights and morphology (Diptera: Dolichopodidae).Entomol. Fenn. 22, 5–14.

Germann, C., Pollet, M., Tanner, S., Backeljau, T., Bernasconi, M.V., 2010. Legs ofdeception: disagreement between molecular markers and morphology of longlegged flies (Diptera, Dolichopodidae). J. Zool. Syst. Evol. Res. 48, 238–247.

Germann, C., Pollet, M., Wimmer, C., Bernasconi, M.V., 2011b. Molecularphylogenetic analyses shed new light on the traditional classification of long-legged flies (Diptera: Dolichopodidae). Invert. Syst. 25, 303–321.

Goodacre, S.L., Martin, O.Y., 2012. Modification of insect and arachnid behaviours byvertically acquired endosymbionts: infections as drivers of behavioural changeand evolutionary novelty. Insects 3, 246–261.

Goodacre, S.L., Martin, O.Y., Thomas, C.F.G., Hewitt, G.M., 2006. Wolbachia and otherendosymbiont infections in spiders. Mol. Ecol. 15, 517–527.

Goodacre, S.L., Martin, O.Y., Bonte, D., Hutchings, L., Woolley, C., Ibrahim, K.,Thomas, C.F.G., Hewitt, G.M., 2009. Microbial modification of host long-distancedispersal capacity. BMC Biol. 7, 32.

Goto, S., Anbutsu, H., Fukatsu, T., 2006. Asymmetrical interactions betweenWolbachia and Spiroplasma endosymbionts coexisting in the same insect host.Appl. Environ. Microbiol. 72, 4805–4810.

Hackett, K.J., Lynn, D.E., Williamson, D.L., Ginsberg, A.S., Whitcomb, R.F., 1986.Cultivation of the Drosophila sex-ratio Spiroplasma. Science 232, 1253–1255.

Hagimori, T., Abe, Y., Date, S., Miura, K., 2006. The first finding of a Rickettsiabacterium associated with parthenogenesis induction among insects. Curr.Microbiol. 52, 97–101.

Haselkorn, T.S., Markow, T.A., Moran, N.A., 2009. Multiple introductions of theSpiroplasma bacterial endosymbiont into Drosophila. Mol. Ecol. 18, 1294–1305.

Hilgenboecker, K., Hammerstein, P., Schlattmann, P., Telschow, A., Werren, J.H.,2008. How many species are infected with Wolbachia? A statistical analysis ofcurrent data. FEMS Microbiol. Lett. 281, 215–220.

Hotopp, J.C.D. et al., 2007. Widespread lateral gene transfer from intracellularbacteria to multicellular eukaryotes. Science 317, 1753–1756.

Hurst, G.D.D., Schilthuizen, M., 1998. Selfish genetic elements and speciation.Heredity 80, 2–8.

Hurst, G.D.D., Jiggins, F.M., Schulenburg, J.H.G.v.d., Bertrand, D., West, S.A.,Goriacheva, I.I., Zakharov, I.A., Werren, J.H., Richard Stouthamer, R., Majerus,M.E.N., 1999. Male-killing Wolbachia in two species of insect. Proc. R. Soc.London, B 266, 735–740.

Jeyaprakash, A., Hoy, M.A., 2000. Long PCR improves Wolbachia DNA amplification:wsp sequences found in 76% of sixty-three arthropod species. Insect Mol. Biol. 9,393–405.

Jiggins, F.M., Hurst, G.D.D., Majerus, M.E.N., 2000a. Sex-ratio-distorting Wolbachiacauses sex-role reversal in its butterfly host. Proc. R. Soc. London, B 267, 69–73.

Jiggins, F.M., Hurst, G.D.D., Jiggins, C.D., Schulenburg, J.H.G.v.d., Majerus, M.E.N.,2000b. The butterfly Danaus chrysippus is infected by a male-killingSpiroplasma bacterium. Parasitology 120, 439–446.

Land, M.F., 1993a. The visual control of courtship behaviour in the fly Poecilobothrusnobilitatus. J. Comp. Physiol. A. 173, 595–603.

Land, M.F., 1993b. Chasing and pursuit in the dolichopodid fly Poecilobothrusnobilitatus. J. Comp. Physiol. A. 173, 605–613.

Lawson, E.T., Mousseau, T.A., Klaper, R., Hunter, M.D., Werren, J.H., 2001. Rickettsiaassociated with male-killing in a buprestid beetle. Heredity 86, 497–505.

Lunau, K., 1992. Mating behaviour in the long-legged fly Poecilobothrus nobilitatus L.(Diptera, Dolichopodidae): courtship behaviour, male signalling and matingsuccess. Zool. Beitr. 34, 465–479.

Lunau, K., 1996. Das balzverhalten von langbeinfliegen (Diptera, Dolichopodidae).Acta Albert. Ratisb. 50, 49–73.

Majerus, T.M.O., Schulenburg, J.H.G.v.d., Majerus, M.E.N., Hurst, G.D.D., 1999.Molecular identification of a male-killing agent in the ladybird Harmoniaaxyridis (Pallas) (Coleoptera: Coccinellidae). Insect Mol. Biol. 8, 551–555.

Majerus, T.M.O., Majerus, M.E.N., 2012. Male-killing in the Coccinellidae: testing thepredictions. Evol. Ecol. 26, 207–225.

Markov, A.V., Lazebny, O.E., Goryacheva, I.I., Antipin, M.I., Kulikov, A.M., 2009.Symbiotic bacteria affect mating choice in Drosophila melanogaster. Anim.Behav. 77, 1011–1017.

Martin, O.Y., Goodacre, S.L., 2009. Widespread infections by the bacterialendosymbiont Cardinium in arachnids. J. Arachnol. 37, 106–108.

Martin, O.Y., Gubler, A., Wimmer, C., Germann, C., Bernasconi, M.V., 2012. Infectionswith Wolbachia and Spiroplasma in the Scathophagidae and other Muscoidea.Infect. Genet. Evol. 12, 315–323.

Mateos, M., Castrezana, S.J., Nankivell, B.J., Estes, A.M., Markow, T.A., Moran, N.A.,2006. Heritable endosymbionts of Drosophila. Genetics 174, 363–376.

Nakamura, K., Ueno, H., Miura, K., 2005. Prevalence of inherited male-killingmicroorganisms in Japanese population of ladybird beetle Harmonia axyridis(Coleoptera: Coccinellidae). Ann. Entomol. Soc. Am. 98, 96–99.

Noda, H., Munderloh, U.G., Kurtti, T.J., 1997. Endosymbionts of ticks and theirrelationship to Wolbachia spp. and tick-borne pathogens of humans andanimals. Appl. Environ. Microbiol. 63, 3926–3932.

Panteleev, D.Y., Goryacheva, I.I., Andrianov, B.V., Reznik, N.L., Lazebny, O.E., Kulikov,A.M., 2007. Endosymbiotic bacteria Wolbachia increase non-specific resistanceto entomopathogens and changes behavior in Drosophila melanogaster. Russ. J.Genet. 43, 1066–1069.

Pape, T., Bickel, D., Meier, R., 2009. Diptera Diversity: Status. Challenges and Tools,Koninklijke Brill NV, Leiden.

Pollet, M., 2009. Diptera as ecological indicators of habitat and habitat change. In:Pape, T., Bickel, D., Meier, R. (Eds.), Diptera Diversity: Status. Challenges andTools, Koninklijke Brill NV, Leiden, pp. 302–322.

Pollet, M., Brooks, S.E., 2008. Long-legged flies (Diptera: Dolichopodidae). In:Capinera, J.L. (Ed.), Encyclopedia of Entomology, vol. 2, second ed., Springer,Heidleberg, pp. 2232–2241.

Pollet, M., Germann, C., Tanner, S., Bernasconi, M.V., 2010. Hypotheses frommitochondrial DNA: congruence and conflicts with morphology inDolichopodinae systematics (Diptera: Dolichopodidae). Invert. Syst. 24, 32–50.

Pollet, M., Germann, C., Bernasconi, M.V., 2011. Phylogenetic analyses usingmolecular markers reveal ecological lineages in Medetera (Diptera:Dolichopodidae). Can. Entomol. 143, 662–673.

Preston-Mafham, K.G., 1999. Courtship and mating in Empis (Xanthempis)trigramma Meig., E. tessellata F., and E. (Polyblepharis) opaca F. (Diptera:Empididae) and the possible implications of ‘cheating’ behaviour. J. Zool.(Lond.) 247, 239–246.

Sadowski, J.A., Moore, A.J., Brodie, E.D., 1999. The evolution of empty nuptial gifts ina dance fly, Empis snoddyi (Diptera, Empididae): bigger isn’t always better.Behav. Ecol. Sociobiol. 45, 161–166.

Skaljac, M., Zanic, K., Ban, S.G., Kontsedalov, S., Ghanim, M., 2010. Co-infection andlocalization of secondary symbionts in two whitefly species. BMC Microbiol. 10,142.

Stouthamer, R., Breeuwer, J.A.J., Hurst, G.D.D., 1999. Wolbachia pipientis: microbialmanipulator of arthropod reproduction. Ann. Rev. Microbiol. 53, 71–102.

Svensson, B.G., Petersson, E., 1987. Sex-role reversed courtship behaviour, sexualdimorphism and nuptial gifts in the dance fly, Empis borealis (L.). Ann. Zool.Fenn. 24, 323–334.

Svensson, B.G., Petersson, E., 1988. Non-random mating in the dance fly Empisborealis: the importance of male choice. Ethology 79, 307–316.

Svensson, B.G., Petersson, E., 1992. Why insects swarm: testing the models for lekmating systems on swarming Empis borealis females. Behav. Ecol. Sociobiol. 31,253–261.

Svensson, B.G., Petersson, E., 1995. Diurnal and seasonal variations in swarming andmating behavior of the dance fly Empis borealis (Diptera; Empididae). Ann. Zool.Fenn. 32, 403–409.

Svensson, B.G., Petersson, E., 2000. Swarm site fidelity in the sex role-reverseddance fly Empis borealis. J. Insect Behav. 13, 785–796.

Tamura, K., Dudley, J., Nei, M., Kumar, S., 2007. MEGA4: molecular evolutionarygenetics analysis (MEGA) software version 4.0. Mol. Biol. Evol. 24, 1596–1599.

Taylor, M.J., Hoerauf, A., 1999. Wolbachia bacteria of filarial nematodes. Parasitol.Today 15, 437–442.

Ulrich, H., 2004. Predation by adult Dolichopodidae (Diptera): a review of literaturewith an annotated prey-predator list. Stud. Dipterol. 11, 369–403.

Vautrin, E., Genieys, S., Charles, S., Vavre, F., 2008. Do vertically-transmittedsymbionts co-existing in a single host compete or cooperate? A modellingapproach. J. Evol. Biol. 21, 145–161.

Wade, M.J., Stevens, L., 1985. Microorganism mediated reproductive isolation inflour beetles (genus Tribolium). Science 227, 527–528.

Weinert, L.A., Werren, J.H., Aebi, A., Stone, G.N., Jiggins, F.M., 2009. Evolution anddiversity of Rickettsia bacteria. BMC Biol. 7, 6.

Werner, D., Pont, A.C., 2003. Dipteran predators of simuliid blackflies: a worldwidereview. Med. Vet. Entomol. 17, 115–132.

Werren, J.H., Hurst, G.D.D., Zhang, W., Breeuwer, J.A., Stouthamer, R., Majerus,M.E.N., 1994. Rickettsial relative associated with male killing in the ladybirdbeetle (Adalia bipunctata). J. Bacteriol. 176, 388–394.

Xie, J., Vilchez, I., Mateos, M., 2010. Spiroplasma bacteria enhance survival ofDrosophila hydei attacked by the parasitic wasp Leptopilina heterotoma. PLoSOne 5, e12149.

Yen, J.H., Barr, A.R., 1971. New hypothesis of the cause of cytoplasmicincompatibility in Culex pipiens. Nature 232, 657–658.

Zhou, W., Rousset, F., O’Neill, S.L., 1998. Phylogeny and PCR based classification ofWolbachia strains using wsp gene sequences. Proc. R. Soc. London, B 265, 1–7.

Zimmer, M., 2000. Visuelle kommunikation bei der balz von langbeinfliegen(Diptera: Dolichopodidae). Verh. Westdt. Entomol. Ges. 12, 159–167.

Zimmer, M., Diestelhorst, O., Lunau, K., 2003. Courtship in long-legged flies(Diptera: Dolichopodidae): function and evolution of signals. Behav. Ecol. 14,526–530.