Upload
hoangthien
View
223
Download
6
Embed Size (px)
Citation preview
Inferring biogeography from the evolutionary history of the giant freshwater prawn (Macrobrachium rosenbergii)
Mark de Bruyn B.App.Sc. (Hons), QUT
School of Natural Resource Sciences
Queensland University of Technology
Gardens Point Campus
Brisbane, Australia
This dissertation is submitted as a requirement of the
Doctor of Philosophy Degree
December 2005
2
Table of Contents
Table of Contents .....................................................................................................2
Statement of Original Authorship ...........................................................................3
Acknowledgments....................................................................................................4
Abstract.....................................................................................................................5
List of Publications ..................................................................................................7
CHAPTER 1. General Introduction and Literature Review ...................................8
Statement of Joint Authorship ..............................................................................26
CHAPTER 2. Huxley’s Line demarcates extensive genetic divergence between
eastern and western forms of the giant freshwater prawn, Macrobrachium
rosenbergii. .............................................................................................................27
Statement of Joint Authorship ..............................................................................43
CHAPTER 3. Reconciling geography and genealogy: phylogeography of giant
freshwater prawns from the Lake Carpentaria region. .......................................44
Statement of Joint Authorship ..............................................................................74
CHAPTER 4. Phylogeographic evidence for the existence of an ancient
biogeographic barrier: the Isthmus of Kra Seaway. ...........................................75
Statement of Joint Authorship ............................................................................100
CHAPTER 5. Past climate change has mediated evolution in giant freshwater
prawns...................................................................................................................101
CHAPTER 6. Final Discussion and Conclusion.................................................128
Statement of Joint Authorship ............................................................................138
APPENDIX 1. Microsatellite loci in the eastern form of the giant freshwater
prawn (Macrobrachium rosenbergii) ..................................................................139
3
Statement of Original Authorship This work has not previously been submitted for a degree or diploma at any
other educational institution. To the best of my knowledge, this thesis
contains no material from any other source, except where due reference is
made.
Mark de Bruyn
1 December, 2005
4
Acknowledgments
This thesis is dedicated to my father, Jack de Bruyn, who passed away
during the course of my Ph.D.
Thank you to my supervisors, John Wilson and Peter Mather, for all
their help and support over the years. In particular, thanks Peter for a
fantastic project concept and for your excellent mentoring and support. I
would like to thank my mother and father for all their love and support over
the years, and for instilling in me a love of nature at an early age - those
camping trips in Namibia were fantastic Mom. I would also like to thank the
rest of my family and my friends for all their support and understanding,
particularly during those times (of which there have been many of late) when
I have been too absorbed in my studies to fully appreciate them - thanks and
sorry guys. Finally, I would like to thank my partner, best friend, and the love
of my life, Kriket, for all her help, support, generosity and love over the past
10 years (how many?!!), a large proportion of which has been taken up by my
studies. Thanks babe - you’re a legend!
I would like to acknowledge Steve Caldwell, a good friend and
colleague who died tragically in a 4WD accident while conducting fieldwork in
northern Australia in 2003. I thank Kriket Broadhurst, Steve Caldwell, Natalie
Baker, Daisy Wowor, Peter Ng, David Milton, John Short, Peter Davie, David
Harvey, Estu Nugroho, Md. Mokarrom Hossain, Melchor Tayamen,
Nuanmanee Pongthana and colleagues, Nguyen Van Hao, Tran Ngoc Hai,
Pek Yee Tang, Selvaraj Oyyan, Abol Munafi Ambok Bolong and anyone else
who may have helped in acquiring specimens for this study. Jane Hughes,
David Hurwood, Andrew Baker, Peter Prentis, and several anonymous
manuscript reviewers provided helpful suggestions that improved this thesis
considerably. Thanks to all in the QUT Ecological Genetics Lab and
Ecological Genetics Group (EGG) for suggestions, advice and assistance. I
received financial support from an Australian Postgraduate Award and a QUT
write-up grant, and my fieldwork was supported partly by research grants
from the Australian Geographic Society, the Ecological Society of Australia
and the Linnean Society of New South Wales, all of which are gratefully
acknowledged.
5
Abstract
The discipline of historical biogeography seeks to understand the contribution
of earth history to the generation of biodiversity. Traditionally, the study of
historical biogeography has been approached by examining the distribution
of a biota at or above the species level. While this approach has provided
important insights into the relationship between biological diversity and earth
history, a significant amount of information recorded below the species level
(intraspecific variation), regarding the biogeographical history of a region,
may be lost. The application of phylogeography - which considers information
recorded below the species level - goes some way to addressing this
problem. Patterns of intraspecific molecular variation in wide-ranging taxa
can be useful for inferring biogeography, and can also be used to test
competing biogeographical hypotheses (often based on the dispersal-
vicariance debate). Moreover, it is argued here that phylogeographical
studies have recently begun to unite these two disparate views, in the
recognition that both dispersal and vicariance have played fundamental roles
in the generation of biodiversity.
Freshwater dependent taxa are ideal model organisms for the current
field of research, as they reflect well the underlying biogeographical history of
a given region, due to limited dispersal abilities - their requirement for
freshwater restricts them. To this end, this study documented the
phylogeographical history of the giant freshwater prawn (Macrobrachium
rosenbergii) utilising both mitochondrial (COI & 16S) and nuclear
(microsatellite) markers. Samples (n = ~1000) were obtained from across
most of the natural distribution of M. rosenbergii [Southern and South East
(SE) Asia, New Guinea, northern Australia]. Initial phylogenetic analyses
identified two highly divergent forms of this species restricted to either side of
Huxley’s extension of Wallace’s Line; a pattern consistent with ancient
vicariance across the Makassar Strait. Subsequent analyses of molecular
variation within the two major clades specifically tested a number of
biogeographical hypotheses, including that: 1.) a major biogeographical
transition zone between the Sundaic and Indochinese biotas, located just
north of the Isthmus of Kra in SE Asia, results from Neogene marine
6
transgressions that breached the Isthmus in two locations for prolonged
periods of time; 2.) Australia’s Lake Carpentaria [circa 80 000 - 8 500 before
present (BP)] facilitated genetic interchange among freshwater organisms
during the Late Pleistocene; 3.) sea-level fluctuations during the Pleistocene
constrained evolutionary diversification of M. rosenbergii within the Indo-
Australian Archipelago (IAA); and 4.) New Guinea’s Fly River changed
course from its current easterly outflow to flow westwards into Lake
Carpentaria during the Late Pleistocene. The results support hypotheses 1-3,
but not 4. The potential for phylogeography to contribute significantly to the
study of historical biogeography is also discussed.
Key words: historical biogeography, phylogeography, freshwater prawn, SE
Asia, Australia, population genetic, demography, Lake Carpentaria, Isthmus
of Kra, Indo-Australian Archipelago
7
List of Publications
de Bruyn M, Wilson JC, Mather PB (2004) Huxley’s Line demarcates
extensive genetic divergence between eastern and western forms of the
giant freshwater prawn, Macrobrachium rosenbergii. Molecular Phylogenetics
and Evolution, 30, 251-257 (Short Communication).
de Bruyn M, Wilson JC, Mather PB (2004) Reconciling geography and
genealogy: phylogeography of giant freshwater prawns from the Lake
Carpentaria region. Molecular Ecology, 13, 3515-3526.
de Bruyn M, Nugroho E, Hossain MM, Wilson JC, Mather PB (2005)
Phylogeographic evidence for the existence of an ancient biogeographic
barrier: the Isthmus of Kra Seaway. Heredity, 94, 370-378.
de Bruyn M, Mather PB (2005) Past climate change has mediated evolution
in giant freshwater prawns. Proceedings of the Royal Society of London B
(Submitted, In Review).
Chand V, de Bruyn M, Mather PB (2005) Microsatellite loci in the eastern
form of the giant freshwater prawn (Macrobrachium rosenbergii). Molecular
Ecology Notes, 5, 308-310 (Technical Note).
8
Inferring Biogeography from the Evolutionary History of the Giant Freshwater Prawn (Macrobrachium rosenbergii)
CHAPTER 1. General Introduction and Literature Review
Description of research program investigated: Historical biogeography as
a discipline is concerned with documenting the influences of past events and
processes on the geographical distributions of taxa. Species are therefore
the fundamental units of analyses in historical biogeographical studies, and a
phylogenetic ‘tree’ can be used to describe the observed genealogical
pattern among related taxa. Alternatively, a general area cladogram can be
generated based on the distributional limits of multiple taxa, which may
illustrate a shared geographical history. These approaches, while providing
considerable insights into the historical effects of earth history events on the
distribution of biological diversity, have an obvious limitation. Biological
diversity is structured hierarchically at all levels, from the community level to
the intraspecific level and below, that is, variation within a single
species/individual. Intraspecific variation can also be strongly influenced by
earth history events and/or ecological processes within a given region, and
thus can provide information on the historical biogeography of that region;
however, this history may go undiscovered if research is focussed only at or
above the species level. This will be most problematical when species have
broad distributions, as an historical biogeographical approach will by default
infer a dispersalist scenario to explain these wide-ranging distributions. In
such a situation, considerable information about the biogeographical history
of a region, which may be recorded at the intraspecific level, may be lost.
To address this issue, biogeographical questions have in recent times
been examined using analyses of intraspecific variation, a discipline known
as Phylogeography, and defined as “…the study of the principles and
processes governing the geographical distributions of genealogical lineages,
including those at the intraspecific level” (Avise 1994, p. 233). The origins of
this discipline can be traced back to the advent of genetic techniques that
enabled rapid and fairly inexpensive screening of variation within and among
species, thus largely eliminating a reliance on morphological traits as
9
character states for analyses. An early classical example of the use of
genetic data in reconstructing genealogical relationships to infer
biogeographical history was that of Hampton Carson (1970, 1983), who
established a phylogeny and a network of derived Drosophila species on the
Hawaiian Archipelago based on polytene chromosome rearrangements. He
used this information to infer routes of colonisation and mechanisms for
speciation arising from the volcanic nature of the relatively young (in
geological terms) Hawaiian island-chain.
Early influential phylogeographical studies utilised mitochondrial
restriction fragment length polymorphisms (mtRFLPs) to reconstruct
intraspecific haplotype trees (e.g. Avise et al. 1979). Many of these early
studies focussed on genetic variation within small mammals and marine
fishes in the southeastern USA (reviewed in Avise 1994). With the advent of
polymerase chain reaction (PCR) in the early 1980’s, DNA sequence
variation could be used directly to determine genealogical relations within
and among species. For the first time, DNA-based studies incorporated both
a spatial and temporal perspective, as mutational sequence changes
accumulate over time (Arbogast et al. 2002). This was important, as earth-
history events leave two distinct imprints on biological diversity - that of
geography and time. A robust phylogeographical analysis of a species’
biogeographical history would thus incorporate inferences about the
geographical relationships among terminal taxa (i.e. individuals), and the
chronology of causal events resulting in such a pattern.
When traditional historical biogeographical and/or phylogeographical
patterns are congruent in indicating disjunctions across multiple taxa (e.g.
comparative phylogeography; Bermingham & Avise 1986), the distinction
between the two methods is minimised. The explanation for the observed
pattern can be relatively straightforward, that is, a widespread ancestral biota
was fragmented by some vicariant event. However, the two approaches differ
widely in their ability to explain incongruent patterns. Incongruent historical
biogeographical patterns (i.e. an unresolved area cladogram or phylogenetic
tree) are difficult to reconcile because of the age of the events under
investigation; the true biogeographical history may be obscured by dispersal,
extinctions of taxa, and/or overlapping earth history events (Cracraft 1988) -
10
in other words “the trace grows colder with time” (Zink 2002). Nonetheless,
traditional historical biogeographical studies may be more appropriate for
investigating relatively ancient earth history events when a good resolution of
genealogical relationships and/or area cladograms is achieved. In contrast,
phylogeographical studies often deal with relatively recent events, and
genealogical relationships may reveal species’ histories whether the
phylogeny is resolved or not.
A resolved or structured gene tree will exhibit a pattern of reciprocal
monophyly among geographical lineages. Reciprocal monophyly has been
described as the “currency” of phylogeography (Zink 2002), and permits the
rejection of the hypothesis that (reciprocally monophyletic) groups are
exchanging genes. Moreover, it is possible to determine how long the groups
have been isolated from each other, either in a relative sense, or by applying
a molecular clock to the data (Arbogast et al. 2002; but see Marko 2002). In
contrast to the view put forward by some cladistic biogeographers (e.g.
Nelson & Platnick 1981; Ebach & Humphries 2002), many recent studies (e.g.
Donoghue & Moore 2003; de Queiroz 2005) report that the history of a
species is equally likely to be shaped by gene flow and range expansion
events as they are by a static history of isolation resulting from vicariance.
Such processes can result in an unstructured, or even a star-like gene tree
(Slatkin & Hudson 1991). This apparent lack of resolution is often mistakenly
believed to be caused by conflicting synapomorphies (i.e. characters that are
shared by a group of sequences due to recentness of common ancestry).
This is a major problem for historical biogeographical inference and for
analyses based on morphological characters in general; although in fact it
usually results from autapomorphies (i.e. a character state that is seen in a
single sequence and no other) (Zink 2002). No matter the amount of
sequence information available, the shape of the phylogeny will remain
unstructured as it illustrates a dynamic history of non-isolation.
To circumvent this lack of resolution, new population genetic methods
were developed, based on coalescent theory (Kingman 1982 a, b), that do
not rely on a traditional structured phylogenetic tree to describe relationships
among genotypes (Excoffier et al. 1992; Crandall & Templeton 1993;
Excoffier & Smouse 1994; and others). Today these methods are collectively
11
known as minimum-spanning trees/networks (see Smouse 1998 for
discussion, and review by Posada & Crandall 2001). An unstructured
phylogeographical tree still allows for further inferences to be made about
biogeographical history. Population genetic analyses based on coalescent
theory can be applied to the spatial distribution of genotypes to provide
information about the relative roles of gene flow (effective dispersal) (Slatkin
1989; Hudson et al. 1992), and vicariance. Similarly, genetic variation within
and among populations can provide information about the demographic
history of a species that is relevant to the biogeographical history of a region.
For example, these data can be used to estimate effective population size
(Fu 1994), and to determine historical changes in population size (e.g. past
bottlenecks, range expansions; Rogers & Harpending 1992), among many
other applications (see Emerson et al. 2001 for review).
These developments have been accompanied by a move away from
earlier descriptive phylogeographical studies that simply overlaid
genealogical relationships upon geography, to a more formal framework that
has allowed the testing of specific biogeographical hypotheses. When the
geological history of a region is well documented, biogeographical
hypotheses can be erected a priori, and tested using phylogeographical
methodology. Moreover, a phylogeographical approach may allow one to
distinguish between competing hypotheses when such hypotheses exist (e.g.
Wallis & Trewick 2001). Alternatively, when the geological history of a region
is poorly understood, phylogeographical analyses may reveal unexpected
patterns (e.g. da Silva & Patton 1998) that can be used as testable
hypotheses by earth scientists. The development of Nested Clade Analysis
(NCA; Templeton et al. 1995) allows such an approach. The first step in NCA
is to test statistically whether there is an actual association between
geography and genealogy. NCA then provides an explicit a posteriori
framework for determining possible causes for the observed pattern of
intraspecific variation, based on predictions from population genetic and
coalescent theory. ‘Statistical phylogeography’ (sensu Knowles & Maddison
2002) is another method that has recently been advocated that allows one to
distinguish between competing hypotheses. This method uses a simulation
approach to measure the discord between alternative tree topologies based
12
on specific a priori hypotheses regarding population history. Similarly, the
application of likelihood frameworks (Goldman et al. 2000) to molecular data
allows an explicit test of competing biogeographical hypotheses based on
independently derived data (e.g. climatological, geological, palaeontological).
Although most of the early phylogeographical studies focussed on
small mammals and marine fishes (reviewed in Avise 1994, 2000), Avise and
co-workers recognised that phylogeographical patterns in freshwater aquatic
taxa could provide good resolution for many biogeographical questions. One
of their early influential papers found that intraspecific genetic breaks were
congruent across four freshwater fish species, and were concordant with
previously described historical biogeographical boundaries; that is, the
distributional limits of species (Bermingham & Avise 1986). This good
resolution results from the fact that historical connections among discrete
drainages (and therefore gene flow) relies directly on the underlying earth
history of the region, which is not always the case in more mobile terrestrial
or avian taxa. Thus, patterns observed in freshwater fauna permit strong
inferences to be made about the biogeographical history of a given region
(Lundberg 1993). Nonetheless, this fact is often overlooked, and
phylogeographical studies of freshwater aquatic taxa are limited, compared
with those, for example, on terrestrial mammals or birds.
Employing phylogeographical approaches to the study of
biogeography in the Indo-Australian Archipelago (IAA) may prove particularly
useful, owing to this regions’ dynamic earth history. Pleistocene sea-level
changes (eustasy) are believed to have played an important role in the
dispersal of both aquatic and terrestrial taxa within this region (Dodson et al.
1995; Voris 2000), which may have somewhat obscured historical
biogeographical relationships. Eustatic changes are also likely to have
influenced the intraspecific genetic structuring of many freshwater taxa,
although the application of phylogeographical techniques should prove useful
in elucidating the regions’ true biogeographical history. The Torres Strait
land-bridge, which connected Australia and New Guinea periodically during
the Pleistocene, is one such example of a major eustatic influence on the
Australian/New Guinean biota. This land bridge was exposed for much of the
Pleistocene, due to lowered sea levels resulting from climatic fluctuations and
13
associated glacial maxima (Voris 2000). The Torres Strait land bridge played
not only a significant role in the vicariance of marine taxa restricted to either
side of this land bridge, but also allowed an interchange of elements of the
terrestrial and freshwater biota between Australia and New Guinea. For
example, some riverine drainage basins that are today restricted to Australia
or New Guinea, respectively, drained into Lake Carpentaria (Torgersen et al.
1985; Voris 2000) during the Pleistocene. This may have provided ample
opportunity for effective dispersal (gene-flow) of freshwater organisms among
river drainages that are today isolated by a marine barrier. Indeed, the
inundation of Lake Carpentaria by rising sea-levels is believed to have
occurred only 8500 years BP (Chivas et al. 2001). Similarly, what is today the
SE Asian mainland was connected in recent geological time (circa 1 million
years BP - 10 000 years BP) to a number of SE Asian islands, including
Sumatra, Borneo, Java, Bali and parts of the Philippine Archipelago (e.g.
Palawan) (Voris 2000; see Fig.1). Thus, the phylogeographical structure of
freshwater taxa within this region is likely to reflect a dynamic history of both
vicariance and dispersal influenced by ancient earth-history events, and more
recent (Pleistocene epoch) sea-level fluctuations; however, such studies are
rare (but see Dodson et al. 1995; Usmani et al. 2003; McConnell 2004).
Contrary to land connections in the region that may have facilitated
dispersal of terrestrial and freshwater taxa in the recent past, long-standing
barriers to dispersal such as the deep-sea trench of the Makassar Strait
(Indonesian Archipelago; Fig. 1) would presumably have impeded dispersal
for these same taxa. The Makassar Strait acts as the western boundary for
the Australian and Asian biotic transition zone (Wallacea). Indeed, of all
vertebrate groups, the distributions of primary freshwater fish fauna most
clearly demarcate this boundary (Moss & Wilson 1998). This ancient deep-
water barrier was formed in the early Tertiary (Moss & Wilson 1998), and was
first recognised by Wallace in the nineteenth century (Wallace 1859). Today,
this biogeographical boundary is known as ‘Wallace’s Line’. Later, Huxley
(1868) modified the path of this line, based on zoological data, and extended
it north into the Philippines. Huxley placed his line to the east of Palawan (the
most westerly of the Philippine islands), effectively linking Palawan
14
biogeographically to Borneo and mainland Asia, and separating it from the
rest of the Philippine Archipelago (Fig. 1).
Major zoogeographic boundaries such as these often result from far
more ancient earth-history events, rather than recent climatic fluctuations and
associated eustatic change - namely plate-tectonic movements. Ancient plate
tectonics may have played a fundamental role in the evolutionary history of
many IAA taxa. The islands of SE Asia form one of the most geologically
complex regions in the world. This is due to their position at the meeting point
of the two former supercontinents of Laurasia and Gondwanaland (Hall 1996).
The islands to the west of this region, including part of Borneo and the whole
of Palawan are on the Sunda continental shelf and are Laurasian in origin.
The islands to the east of this region, including New Guinea, are on the Sahul
shelf and are essentially Gondwanan in origin (Hall 1996). The islands in the
middle, including Sulawesi, the Moluccas and most of the islands in the
Philippine Archipelago, lie in deep sea between the two shelves, which may
have posed a formidable barrier to the dispersal of many freshwater and
terrestrial taxa.
The tectonic history of the Philippine Archipelago, in particular, is
extremely complex. Reconstructions by Hall (1996) suggest that the main
landmass of the Philippines originated as a series of island arcs far out in the
Pacific Ocean more than 50 million years ago (MYA). As the Australian
continent moved northward towards the Asian continent, the plate tectonic
movement formed undersea volcanoes, which gradually emerged from the
sea and underwent considerable tectonic movement and rotation. As recently
as the Miocene (~15 MYA), Mindanao, for example, was widely separated
from Luzon and situated east of the Sulawesi landmass and only a short
distance north of the New Guinean part of the Australian plate. The Philippine
Archipelago may have only taken on its’ current shape over the last 5-10
million years, but the geological history of the region is still poorly understood.
Similarly, Sulawesi (Fig. 1) has a complex history, and is believed to be a
composite landmass of different geological origins. Geologists (Hall 1998;
Moss & Wilson 1998) suggest that: (1.) the SE arm of the island and possibly
parts of the northern arm may have been emergent approximately 20 MYA;
(2.) central Sulawesi was emergent during at least part of the Miocene; (3.)
15
the microcontinental blocks of Banggai-Sula and Buton-Tukang Besi, which
rifted from the Australian-New Guinea continent during the late Mesozoic,
were accreted onto eastern Sulawesi during the Miocene or Pliocene; and
(4.) Sulawesi finally took on its present shape between the Pliocene and the
present. For Wallacea as a whole, Hall (2001) postulated that most of the
smaller islands only emerged within the last 5 million years, and therefore the
biota can only have populated much of Wallacea during this period. Thus,
phylogeographical data on widely-distributed species that occur in the SE
Asian/Australian region may be useful not only for determining mechanisms
that may have shaped the distribution of biodiversity in the region, but also
for unraveling the region’s geological history. This is particularly relevant for
landmasses as geologically complex as Sulawesi and the Philippine
Archipelago.
The decapod crustacean Macrobrachium rosenbergii (giant freshwater
prawn) is an ideal candidate species to investigate the biogeography of this
region using phylogeographical approaches because it: (1.) occurs in
freshwater, (2.) is widespread, and (3.) is locally abundant across its’ natural
range. M. rosenbergii is distributed from Pakistan in the west to southern
Vietnam in the east, and south across SE Asia to New Guinea and northern
Australia. M. rosenbergii is most often associated with coastal river systems,
as it is freshwater dependent as an adult, but requires brackishwater for
breeding and larval development (New & Singholka 1985); however, M.
rosenbergii has also occasionally been found in full marine conditions
(Johnson 1973; Short 2000). Indeed, this species occurs on some isolated de
novo oceanic islands (e.g. Christmas Island & Palau; Short 2000), although
introductions by humans, while unlikely, cannot be discounted. Laboratory
studies suggest, however, that adults are incapable of surviving full marine
conditions for prolonged periods (> 1 week), although a very small
percentage of postlarvae may survive for up to 20 days (Smith et al. 1976;
Sandifer & Smith 1979). Gravid females migrate from freshwater into
estuarine areas to spawn, where free-swimming larvae hatch from eggs
attached to the females’ abdomen. Fully mature M. rosenbergii females are
capable of producing up to 100 000 eggs in a single spawning event (New &
Singholka 1985). Larval duration in M. rosenbergii varies from 3-6 weeks,
16
after which juveniles migrate upstream to freshwater habitat, with massive
migrations of juveniles, estimated at 500 to 1000 million individuals, recorded
for some northern Australian rivers (e.g. Daly, Roper, Fitzroy & Ord Rivers;
Anonymous 1997).
Two sub-species of M. rosenbergii have been recognised by a number
of researchers, and stocks divided into ‘eastern’ and ‘western’ forms,
although the species is still considered a single taxon, i.e. M. rosenbergii. De
Man (1879) and Johnson (1973) based their sub-divisions on traditional
systematic characters (morphology). Lindenfelser (1984) analysed
morphometric and allozyme data and concluded that M. rosenbergii should
be considered a species complex with species boundaries corresponding
approximately with Wallace’s Line. Malecha (1977, 1987) and co-workers
(Hedgecock et al. 1979) also examined stock structure in M. rosenbergii and
identified 3 ‘geographical races’; an Eastern, a Western and an Australian
‘race’, based on allozyme and morphological data. Significant intraspecific
variation was also evident between the only two Australian sites they
sampled (Derby, Western Australia & Darwin, Northern Territory; Malecha
1977). Thus, there are strong, but somewhat contradictory, indications that M.
rosenbergii could be polytypic both regionally and perhaps even within
regions. Early systematic studies are likely to be limited in scope, however,
for two reasons; first, allozymes are highly conserved in many decapod
crustaceans (Nelson & Hedgecock 1980); and second, morphological data
can be ambiguous in freshwater prawns, because morphological traits can be
modified by exposure to different environmental conditions during larval
development (see Dimmock et al. 2004 for work on a related Australian
Macrobrachium species).
Thus, the overall objectives of this study were to: relate the roles
of earth history events and ecological processes to the observed population
genetic structure of wild populations of Macrobrachium rosenbergii, via a
phylogeographical approach. A number of molecular ‘markers’ are available
that may be employed in such phylogeographical studies, although
mitochondrial DNA’s (mtDNA) apparent lack of recombination, rapid rate of
molecular evolution, and uniparental (maternal) inheritance has made this the
marker of choice in such studies on animal species (Riddle 1996). The
17
effective population size of the mtDNA genome is approximately one-fourth
that of the nuclear genome (Avise et al. 1987). These features result in rapid
geographical sorting of lineages through the stages of polyphyly and
paraphyly, to eventual reciprocal monophyly in the absence of gene flow - in
other words, good resolution of geographical patterns of variation may be
achieved. Moreover, discrete regions of the mitochondrial genome evolve at
different rates, allowing one to choose a region that may best address the
time frame under investigation. Two mtDNA markers were utilised in this
study from mtDNA regions that exhibit different evolutionary rates - the
slower evolving 16S ribosomal RNA (16S) gene and the more rapidly
evolving cytochrome c oxidase subunit I (COI) gene. Microsatellites are bi-
parentally inherited nuclear markers that exhibit high mutation rates and often
show considerable population variation, and while the potential for
homoplasy exists, they can provide good insights into both phylogeny and
population history when applied with care (e.g. Angers & Bernatchez 1998;
Grant et al. 2000). A number of microsatellite markers were developed to
complement mtDNA analyses for this study, and were used to address
specific questions about the extent of recent gene flow among subsets of the
populations studied here.
Hence, the specific aims of this study were to: (1.) document the
distribution of genetic diversity and levels of genetic differentiation within and
among wild populations of M. rosenbergii; (2.) relate these findings to causal
mechanisms that may have generated and maintained the observed
population genetic structure of wild M. rosenbergii populations; and (3.) utilise
a molecular approach (phylogeography) to test a number of specific
hypotheses regarding the biogeographical history of the SE Asian/Australian
region.
18
Account of research progress linking the research papers:
The initial research paper (Chapter 2) was essentially a pilot study that
examined the distribution of the eastern and western forms of M. rosenbergii
using a molecular marker (16S mtDNA). The second research paper
(Chapter 3) examined the phylogeographic history of M. rosenbergii sampled
from Australia and New Guinea (eastern form of M. rosenbergii), to identify
the role that Lake Carpentaria played in the evolutionary history of
freshwater-dependent organisms from this region. The third research paper
(Chapter 4) examined the phylogeographic history of the western (Asian)
form of M. rosenbergii, and specifically tested for the influence of an ancient
postulated seaway on population genetic structuring in M. rosenbergii. The
fourth research paper (Chapter 5) extended the sampling design of Chapter 3
to incorporate samples from two de novo oceanic islands, and also extended
the molecular analyses to incorporate nuclear markers (microsatellites). The
specific aim of this study was to assess the influence of Pleistocene climatic
change on the evolutionary history of M. rosenbergii from the eastern Indo-
Australian Archipelago. The fifth and final research paper (Appendix 1) is a
technical note that describes the isolation and characterisation of the six
microsatellite loci (in the eastern form of M. rosenbergii) utilised in Chapter 5.
Please note: Figures and Tables are re-initialised in each chapter to maintain
the independence of each published research paper.
Figure 1. Study region indicating landmasses referred to in Chapter 1. Major river systems are shown.
Huxley’s Line
Wallace’s Line Makassar Strait
Philippine Archipelago Palawan
Sulawesi Sumatra
Borneo (Kalimantan)
New Guinea
Australia
Java Bali
SE Asian Mainland
Mindanao
20
REFERENCES Angers B, Bernatchez L (1998) Combined use of SMM and non-SMM
methods to infer fine structure and evolutionary history of closely related
Brook Charr (Salvelinus fontinalis, Salmonidae) populations from
microsatellites. Molecular Biology and Evolution, 15, 143-159.
Anonymous (1997) Aborigine prawn hopes. Fish Farming International, 24(9), 9.
Arbogast BS, Edwards SV, Wakeley J, Beerli P, Slowinski JB (2002)
Estimating divergence times from molecular data on phylogenetic and
population genetic timescales. Annual Review of Ecology and
Systematics, 33, 707-740.
Avise J (1994) Molecular Markers, Natural History and Evolution. Chapman &
Hall, New York.
Avise (2000) Phylogeography: The History and Formation of Species.
Harvard University Press, Cambridge, MA.
Avise J, Giblin-Davidson C, Laerm J, Patton J, Lansman R (1979)
Mitochondrial DNA clones and matriarchal phylogeny within and among
geographic populations of the pocket gopher, Geomys pinetis.
Proceedings of the National Academy of Sciences of the USA, 76, 6694-6698.
Avise JC, Arnold J, Ball RM, Bermingham E, Lamb T, Neigel JE, Reeb CA,
Saunders NC (1987) Intraspecific phylogeography: the mitochondrial
DNA bridge between population genetics and systematics. Annual
Review of Ecology and Systematics, 18, 489-522.
Bermingham E, Avise JC (1986) Molecular zoogeography of freshwater
fishes in the southeastern United States. Genetics, 113(4), 939-965.
Carson HL (1970) Chromosome tracers of the origin of species. Science, 168, 1414-1418.
Carson HL (1983) Chromosomal sequences and the interisland colonisation
in Hawaiian Drosophila. Genetics, 103, 465-482.
Chivas AR, Garcia A, van der Kaars S et al. (2001) Sea-level and
environmental changes since the last interglacial in the Gulf of
Carpentaria, Australia: an overview. Quartenary International, 83-85, 19-46.
21
Cracraft (1988) Deep-history biogeography: retrieving the historical pattern of
evolving continental biotas. Systematic Zoology, 37, 221-236.
Crandall KA, Templeton AR (1993) Empirical tests and some predictions
from coalescent theory with applications to intraspecific phylogeny
reconstruction. Genetics, 134, 959-969.
da Silva MNF, Patton JL (1998) Molecular phylogeography and the evolution
and conservation of Amazonian mammals. Molecular Ecology, 7, 475-
486.
De Man JG (1879) On some species of the genus Palaemon Fabr. with
descriptions of two new forms. Notes Leyden Museum, 1, 165-184.
de Queiroz A (2005) The resurrection of oceanic dispersal in historical
biogeography. Trends in Ecology and Evolution, 20, 68-73.
Dimmock A, Williamson I, Mather PB (2004) The influence of environment on
the morphology of Macrobrachium australiense (Decapoda:
Palaemonidae). Aquaculture International, 12, 435-456.
Dodson JJ, Colombani F, Ng PKL (1995) Phylogeographic structure in
mitochondrial DNA of a South-east Asian freshwater fish, Hemibagrus
nemurus (Siluroidei; Bagridae) and Pleistocene sea-level changes on
the Sunda shelf. Molecular Ecology, 4, 331-346.
Donoghue MJ, Moore BR (2003) Toward an integrative historical
biogeography. Integrative and Comparative Biology, 43, 261-270.
Ebach MC, Humphries CJ (2002) Cladistic biogeography and the art of
discovery. Journal of Biogeography, 29, 427-444.
Emerson BC, Paradis E, Thébaud C (2001) Revealing the demographic
histories of species using DNA sequences. Trends in Ecology and
Evolution, 16, 707-716.
Excoffier L, Smouse PE (1994) Using allele frequencies and geographic
subdivision to reconstruct gene trees within a species: Molecular
variance parsimony. Genetics, 136, 343-359.
Excoffier L, Smouse PE, Quattro JM (1992) Analysis of molecular variance
inferred from metric distances among DNA haplotypes: Application to
human mitochondrial DNA restriction sites. Genetics, 131, 479-491.
22
Fu Y-X (1994) Estimating effective population size or mutation rate using the
frequencies of mutations of various classes in a sample of DNA
sequences. Genetics, 138, 1375-1386.
Grant PR, Grant BR, Petren K (2000) The allopatric phase of speciation: the
sharp-beaked ground finch (Geospiza difficilis) on the Galapagos
islands. Biological Journal of the Linnean Society, 69, 287-317.
Goldman N, Anderson JP, Rodrigo AG (2000) Likelihood-based tests of
topologies in phylogenetics. Systematic Biology, 49, 652-670.
Hall R (1996) Reconstructing Cenozoic Asia. In ‘Tectonic Evolution of
Southeast Asia.’ (Eds. R. Hall & D.J. Blundell), pp. 153-184. The
Geological Society Publishing House, Bath, UK.
Hall R (1998) The plate tectonics of Cenozoic SE Asia and the distribution of
land and sea. In ‘Biogeography and Geological Evolution of SE Asia.’
(Eds. R. Hall & J.D. Holloway), pp. 99-131. Backhuys Publishers,
Leiden, The Netherlands.
Hall R (2001) Cenozoic reconstructions of SE Asian and the SW Pacific:
changing patterns of land and sea. In ‘Faunal and Floral migrations and
Evolution in SE Asia-Australasia.’ (Eds. I. Metcalfe, J.M.B. Smith, M.
Morwood, I. Davidson), pp. 35-56. A.A. Balkema Publishers, Lisse.
Hedgecock D, Stelmach DJ, Nelson K, Lindenfelser ME, Malecha SR (1979)
Genetic divergence and biogeography of natural populations of
Macrobrachium rosenbergii. Proceedings of the World Mariculture
Society, 10, 873-879.
Hudson RR, Slatkin M, Maddison WP (1992) Estimation of levels of gene
flow from DNA sequence data. Genetics, 132, 583-589.
Huxley TH (1868) On the classification and distribution of the
Alectoromorphae and Heteromorphae. Proceedings of the Zoological
Society of London, 294-319.
Johnson DS (1973) Notes on some species of the genus Macrobrachium
(Crustacea: Decapoda: Caridea: Palaemonidae). Journal of the
Singapore National Academy of Sciences, 3(3), 273-291.
Kingman J (1982 a) The coalescent. Stochastic Processes and their
Applications, 13, 235-248.
23
Kingman J (1982 b) On the genealogy of large populations. In ‘Essays in
Statistical Science.’ (Eds. J. Gani & E. Hannan), pp. 27-43. Applied
Probability Trust, London, UK.
Knowles LL, Maddison WP (2002) Statistical phylogeography. Molecular
Ecology, 11, 2623-2635.
Lindenfelser ME (1984) Morphometric and allozymic congruence: evolution in
the prawn Macrobrachium rosenbergii (Decapoda: Palaemonidae).
Systematic Zoology, 33(2), 195-204.
Lundberg JG (1993) African-South American freshwater fish clades and
continental drift, problems with a paradigm. In ‘Biotic Relationships
Between Africa and South America.’ (Ed. P. Goldblatt), pp. 156-198.
Yale University Press, New Haven, Connecticut, USA.
Malecha SR (1977) Genetics and selective breeding of Macrobrachium
rosenbergii. In ‘Shrimp and Prawn Farming in the Western
Hemisphere.’ (Eds. J.A. Hanson & H.L. Goodwin), pp. 328-355.
Dowden, Hutchinson and Ross, Stroudsberg, Pa, USA.
Malecha SR (1987) Selective breeding and intraspecific hybridization of
crustaceans. In ‘Proceedings of the World Symposium on Selection,
Hybridization, and Genetic Engineering in Aquaculture.’ pp. 323-336.
Vol. 1, Berlin, Germany.
Marko PB (2002) Fossil calibration of molecular clocks and the divergence
times of geminate species pairs separated by the Isthmus of Panama.
Molecular Biology and Evolution, 19, 2005-2021.
McConnell SKJ (2004) Mapping aquatic faunal exchanges across the Sunda
shelf, South-East Asia, using distributional and genetic data sets from
the cyprinid fish Barbodes gonionotus (Bleeker, 1850). Journal of
Natural History, 38, 651-670.
Moss SJ, Wilson MEJ (1998) Biogeographic implications of the Tertiary
palaeogeographic evolution of Sulawesi and Borneo. In ‘Biogeography
and Geological Evolution of SE Asia.’ (Eds. R. Hall & J.D. Holloway), pp.
133-163. Backhuys Publishers, Leiden, The Netherlands.
Nelson K, Hedgecock D (1980) Enzyme polymorphism and adaptive strategy
in the decapod Crustacea. American Naturalist, 116, 238-280.
24
Nelson G, Platnick NI (1981) Systematics and Biogeography; Cladistics and
Vicariance. Columbia University Press, New York.
New MB, Singholka S (1985) Freshwater prawn farming: a manual for the
culture of Macrobrachium rosenbergii. FAO Fisheries Technical Paper
225.
Posada D, Crandall KA (2001) Intraspecific gene genealogies: trees grafting
into networks. Trends in Ecology and Evolution, 16, 37-45.
Riddle BR (1996) The molecular phylogeographic bridge between deep and
shallow history in continental biotas. Trends in Ecology and Evolution,
11, 207-211.
Rogers AR, Harpending H (1992) Population growth makes waves in the
distribution of pairwise genetic differences. Molecular Biology and
Evolution, 9, 552-569.
Sandifer PA, Smith TIJ (1979) Possible significance of variation in the larval
development of Palaemonid shrimp. Journal of Experimental Marine
Biology and Ecology, 39, 55-64.
Short J (2000) Systematics and biogeography of Australian Macrobrachium
(Crustacea: Decapoda: Palaemonidae) – with descriptions of other new
freshwater Decapoda. Ph.D. Thesis, The University of Queensland,
Brisbane, Australia.
Slatkin M (1989) Detecting small amounts of gene flow from phylogenies of
alleles. Genetics, 121, 609-612.
Slatkin M, Hudson RR (1991) Pairwise comparisons of mitochondrial DNA
sequences in stable and exponentially growing populations. Genetics,
129, 555-562.
Smith TIJ, Sandifer PA, Trimble WC (1976) Progress in developing a
recirculating synthetic seawater hatchery for rearing larvae of
Macrobrachium rosenbergii. In ‘Food-drugs from the Sea, Proceedings
1974.’ (Eds. H.H. Webber & G.D. Ruggieri.) pp. 167-181. Marine
Technology Society, Washington DC, USA.
Smouse PE (1998) To tree or not to tree. Molecular Ecology, 7, 399-412.
Templeton AR, Routman E, Phillips C (1995) Separating population structure
from population history: a cladistic analysis of the geographical
25
distribution of mitochondrial DNA haplotypes in the tiger salamander,
Ambystoma tigrinum. Genetics, 140, 767-782.
Torgersen T, Jones MR, Stephens AW, Searle DE, Ullman WJ (1985) Late
Quartenary hydrological changes in the Gulf of Carpentaria. Nature,
313, 785-787.
Usmani S, Tan SG, Siraj SS, Yusoff K (2003) Population structure of the
Southeast Asian river catfish Mystus nemurus. Animal Genetics, 34, 462-464.
Voris HK (2000) Maps of Pleistocene sea levels in Southeast Asia:
shorelines, river systems and time durations. Journal of Biogeography,
27, 1153-1167.
Wallace AR (1859) Letter from Mr Wallace concerning the geographical
distribution of birds. Ibis, 1, 449-454.
Wallis GP, Trewick SA (2001) Finding fault with vicariance: A critique of
Heads (1998). Systematic Biology, 50(4), 602-609.
Zink RM (2002) Methods in comparative phylogeography, and their
application to studying evolution in the North American aridlands.
Integrative and Comparative Biology, 42(5), 953-959.
26
Statement of Joint Authorship
de Bruyn M, Wilson JC, Mather PB (2004) Huxley’s Line demarcates
extensive genetic divergence between eastern and western forms of the
giant freshwater prawn, Macrobrachium rosenbergii. Molecular Phylogenetics
and Evolution, 30, 251-257 (Short Communication).
de Bruyn M (candidate) Designed and developed experimental protocol. Carried out field and
laboratory work, and analysed data. Wrote manuscript and acted as
corresponding author.
Wilson JC Co-supervised the study design and experimental protocols. Assisted in the
interpretation of data. Contributed to the structure and editing of the
manuscript.
Mather PB Principal supervisor of the study design and experimental protocols. Assisted
in the interpretation of data. Contributed to the structure and editing of the
manuscript.
27
CHAPTER 2. Huxley’s Line demarcates extensive genetic divergence between eastern and western forms of the giant freshwater prawn,
Macrobrachium rosenbergii.
de Bruyn M, Wilson JC, Mather PB
School of Natural Resource Sciences, Queensland University of Technology,
GPO Box 2434, Brisbane, Qld 4001, Australia
ABSTRACT Phylogenetic analysis of representatives from 18 wild populations of the giant
freshwater prawn, Macrobrachium rosenbergii, utilising a fragment of the 16S
rRNA mitochondrial gene, identified two major reciprocally monophyletic
clades either side of a well known biogeographic barrier, Huxley’s line. The
level of divergence between the two clades (maximum 6.2%) far exceeds
divergence levels within either clade (maximum 0.9%), and does not concord
with geographical distance among sites. Eastern and western M. rosenbergii
clades have probably been separated since Miocene times. Within-clade
diversity appears to have been shaped by dispersal events influenced by
eustatic change.
Keywords: Macrobrachium rosenbergii; Decapod crustacean; 16S; mtDNA;
Huxley’s line; Wallace’s line; Phylogenetics; Biogeography
28
INTRODUCTION Prawns of the genus Macrobrachium Bate, 1868 (Crustacea: Palaemonidae)
are a highly diverse group of decapod crustaceans found in circumtropical
marine-, estuarine- and fresh-waters. Much debate has surrounded the
systematic relationships of many species within this group (e.g. Holthuis,
1950; Johnson, 1973; Holthuis, 1995; Pereira, 1997), which has until recently
been based exclusively on comparisons of external morphological
characteristics. Molecular genetic approaches to resolving systematic
questions in Macrobrachium have only been applied recently, when Murphy
and Austin (2002) recognised that species and genus level designations did
not correspond to traditional morphology-based classification schemes.
M. rosenbergii, the giant freshwater prawn, is found in coastal river
systems from Pakistan in the west to Vietnam in the east, across SE Asia,
and south to Papua New Guinea and northern Australia. Gravid females
migrate from freshwater to estuarine areas, satisfying larval requirements for
brackish water for survival and early development, where free-swimming
larvae hatch and metamorphose into post-larvae, before migrating to
freshwater after 3-6 weeks (New and Singholka, 1985). Several studies have
reared M. rosenbergii larvae to post-larvae stage in artificial seawater (Smith
et al., 1976; Sandifer and Smith, 1979), and considering this in light of a
relatively prolonged larval duration, suggests that marine dispersal may play
a previously unrecognised role in the life-history of this species.
Two forms of M. rosenbergii (‘eastern’ and ‘western’) have been
described independently (De Man, 1879; Johnson, 1973), although the
species is currently considered to be monophyletic. Lindenfelser (1984)
analysed morphometric and allozyme data, and concluded that the boundary
for eastern and western M. rosenbergii forms corresponds approximately with
Wallace’s Line (although Philippine samples were assigned to the eastern
form, thus Huxley’s Line would seem a more appropriate boundary than
Wallace’s Line; see Fig. 1). Malecha (1977; 1987) and co-workers
(Hedgecock et al., 1979) recognised 3 ‘geographical races’; an eastern, a
western and an Australian ‘race’, based on allozyme and morphological data.
Wowor and Ng (2001) regard the eastern and western forms of M.
rosenbergii as two distinct species, based on adult morphological characters.
29
Thus, M. rosenbergii as currently recognised taxonomically may be polytypic
both regionally and perhaps even within biogeographic regions. Hence, the
goal of the present study was to examine the evolutionary relationships
among wild M. rosenbergii stocks at a regional scale, using 16S ribosomal
RNA mitochondrial DNA (mtDNA) sequences, and relate the findings to the
biogeographical history of the region.
Figure 1. Locations sampled for Macrobrachium rosenbergii. Light grey
shading indicates -120m sea-level contour. Pleistocene drainage basins
indicated on map (Voris 2000). Haplotype labels correspond to Appendix A.
(Map adapted with kind permission Harold K. Voris and the Field Museum of
Natural History, Chicago, USA; Voris 2000.)
30
MATERIALS AND METHODS Specimens, DNA Extraction, Amplification and Sequencing
Prawns used in this study were collected from localities indicated in Appendix
1 and Fig. 1. Macrobrachium australiense and M. lar were used as outgroup
taxa. Tissue samples were incubated overnight at 55ºC in 500µl extraction
buffer (100mM NaCL, 50mM Tris, 10mM EDTA, 0.5% SDS) containing 20µl
of 10µg/µl Proteinase K (Sigma Co.). Total genomic DNA was extracted
using standard phenol: chloroform extraction methods. A 472-bp region of
the mitochondrial 16S ribosomal gene was amplified using primers 16SAR
and 16SBR (Palumbi et al., 1991). DNA sequencing was conducted at the
Australian Genome Research Facility, Brisbane, Australia; using an ABI 377
automated DNA sequencer. Both strands of the PCR product were
sequenced. Because mtDNA sequences were invariant among five
individuals from each of four sampling sites (Mekong and Dongnai, Vietnam;
Wenlock, Australia; Plandez/Pulilan, Philippines; de Bruyn et al., unpublished
data), a single sequence from each sampling site was considered to be
representative for phylogenetic analyses.
Phylogenetic Analyses
Consensus sequences were aligned using ClustalX (Thompson et al., 1997).
A total of 472 bp were aligned for analysis (see Appendix 1 for GenBank
accession numbers). Saturation of nucleotide substitutions in the data set
was tested. A bootstrapped (1000 pseudoreplicates) maximum parsimony
(MP) and neighbour-joining (NJ) phylogeny was constructed using MEGA
version 2.1 (Kumar et al., 2001), based on Kimura 2-parameter distances
(Kimura, 1980). A quartet-puzzling maximum-likelihood tree using the
Hasegawa-Kishino-Yano (HKY) sequence evolution model (Hasegawa et al.,
1985) was constructed in TREE-PUZZLE (Strimmer and von Haesler, 1996),
using 1000 iterations of the puzzling process. Finally, a log-likelihood ratio
test was carried out in TREE-PUZZLE that compared trees generated under
the assumption of a molecular clock, to trees unconstrained by any such
assumption (Felsenstein, 1988).
31
RESULTS A total of 472 base pairs of the 16S mitochondrial gene were amplified
successfully for 18 M. rosenbergii individuals and two outgroup species. Of
these, 90 variable sites were detected, of which 59 were phylogenetically
informative. All sequences were found to be AT-rich (62.9%). Nucleotide
substitutions (excluding outgroups) favoured transitions over transversions,
yielding a transition/transversion ratio of 3.3. No evidence of saturation was
evident. Kimura 2-parameter sequence divergences ranged from 5.1% to
6.2% between haplotypes from eastern and western M. rosenbergii samples,
0.0% to 0.6% among western samples, and 0.0% to 0.9% among eastern
samples. A single deletion was observed in the dataset, for the M.
australiense outgroup sequence. The log-likelihood ratio test rejected the
assumption of clock-like behaviour. Two major reciprocally monophyletic M.
rosenbergii clades (Fig. 2) were identified; corresponding geographically with
the east/west disjunction reported previously (Lindenfelser, 1984). Bootstrap
support for these clades was high in all cases. Relationships within the two
clades were resolved to varying degrees.
32
Figure 2. Neighbour-joining distance tree of the relationships between
Macrobrachium rosenbergii 16S rRNA haplotypes. Haplotype labels
correspond to Appendix A. Bootstrap values (percentages) are shown for
nodes with support >50%. Values correspond to neighbour-joining firstly,
maximum parsimony secondly, and maximum-likelihood thirdly. The trees
produced by all three methods of analyses were not significantly different in
topology.
IJ
PH
PN
1A
6A
5A
2A
3A
4A
1V
4M
JA
1M
2V
2M
3M
1T
2T
M.australiense
M.lar
64/67/82
63/-/54
63/-/-
71/-/97
100/100/99
100/100/100
66/64/92 99/99/99
54/63/53
0.01
WESTERN
EASTERN
33
DISCUSSION Variation in 16S rRNA sequences for M. rosenbergii support Lindenfelser’s
(1984) recognition that wild stocks comprise two major clades, restricted to
either side of Huxley’s Line (Fig. 1). The level of sequence divergence
observed between the two clades exceeds interspecific 16S rRNA
divergence levels reported for diverse crustacean taxa, including penaeid
prawns (Tong et al., 2000) and freshwater crayfish (Grandjean et al., 2002).
The significant phylogenetic break between eastern and western haplotypes
observed indicates the coalescence for these two clades was probably of mid
to late Miocene origin, and approximates 5.3 to 11.7 million years before
present (BP), based on 16S rRNA molecular clocks calibrated for porcelain
crabs (0.53%/MY; Stillman and Reeb, 2001) and fiddler crabs (0.96%/MY;
Sturmbauer et al., 1996; these values represent upper- and lower-bound
extremes for crustacean 16S rRNA molecular clocks identified in a literature
search). This estimate should be approached with caution, however, due to
the rejection of clock-like behaviour of the data set.
Wallace’s Line has long been recognised as a major biogeographical
barrier. Huxley (1868) modified Wallace’s Line by extending it into the
Philippines, based on zoological data, linking the island of Palawan to the
western (Oriental) group, and the rest of the Philippine Archipelago to the
eastern (Australasian) group. Data presented here clearly links a region of
the Philippines (Luzon) to the eastern group. Tree topology indicates that the
Australian OTUs (Operational Taxonomic Units) are basal to the remaining
eastern OTUs examined. The unexpectedly low degree of divergence (1-2
bp) between the Philippine OTU and the rest of the eastern OTUs suggests
recent gene flow has occurred. This has presumably been facilitated by larval
marine dispersal, as the Philippine and Australian/New Guinea landmasses
have been geographically distant since at least Miocene times (Hall, 1996).
Tree topology indicates that gene flow has occurred from a southerly
(Australian) to northerly (Philippines) direction, which appears consistent with
major ocean current movements in the region (South Equatorial Current;
Gordon and Fine, 1996), although this remains to be rigorously tested with a
more comprehensive dataset. Similar genetic signatures of Australian-
34
Philippine dispersal events have been observed in a number of marine
species (reviewed by Benzie, 1998).
The Mekong OTU appears ancestral to all other western OTUs. Sabah
(Borneo) and Java cluster together, while all other western OTUs (Mainland
Malaysia, Thailand, and Vietnam) apart from SW Thailand share identical
16S rRNA haplotypes. Reconstructions of Pleistocene drainage basins on
the Sunda Shelf (Voris, 2000) suggest that the ancient Mekong drainage
system has long been isolated from all other Pleistocene drainages identified.
The Sabah drainage remained isolated throughout the Pleistocene, while the
East Sunda River system, which encompassed the locality of the Javan OTU,
drained eastward to exit near Bali, possibly restricting westward dispersal of
M. rosenbergii. The SW Thai OTU would also have remained isolated during
this time, while all other western OTUs would have been incorporated into
either the Siam or Malacca Straits River Systems (Voris, 2000) that may
have coalesced at some stage in the past. Ongoing gene-flow amongst these
localities, however, cannot be ruled out at present. The possibility that some
form of selective sweep has produced the patterns observed in this study
would appear unlikely, given the concordance of mtDNA (this study),
allozymes (Malecha, 1977, 1987; Hedgecock et al., 1979; Lindenfelser,
1984) and morphological characters (De Man, 1879; Johnson, 1973;
Malecha, 1977, 1987; Lindenfelser, 1984; Wowor and Ng, 2001).
35
CONCLUSION
Significant mtDNA divergence between eastern and western M. rosenbergii
clades supports previous conclusions (De Man, 1879; Johnson, 1973;
Malecha, 1977, 1987; Lindenfelser, 1984; Wowor and Ng, 2001) that M.
rosenbergii may actually represent two distinct phylogenetic ‘species’.
Regardless of whether specific status is accorded to the eastern and western
forms, the divergence levels presented here are highly relevant for
conservation of wild stocks. A number of intriguing questions regarding the
evolutionary history of M. rosenbergii have been raised by this study. If
marine larval dispersal has occurred between New Guinea/Australia and the
Philippine Archipelago, why does that not appear to be the case between
sites separated by lesser geographic distances (e.g. between Sabah and the
Philippines) either side of Huxley’s Line? Can ancient vicariant events explain
the divergence between eastern and western clades? Could the ancestral
(Australian and Vietnamese) haplotypes represent lineages that persisted in
Pleistocene refugia (sensu Hewitt, 1996) during periods of glacial maxima?
Future directions for our research on M. rosenbergii will address these
questions utilising mitochondrial COI markers in conjunction with nuclear
markers.
36
ACKNOWLEDGMENTS
We thank Kriket Broadhurst, Steve Caldwell, Natalie Baker, Marilyn Wyatt,
Daisy Wowor, Peter Ng, David Milton, John Short, Peter Davie, Melchor
Tayamen, Nuanmanee Pongthana and colleagues, Nguyen Van Hao, Tran
Ngoc Hai, Pek Yee Tang, Selvaraj Oyyan and Abol Munafi Ambok Bolong for
their help in acquiring specimens for this study. David Hurwood and two
anonymous reviewers provided comments that greatly improved the
manuscript. Thanks to all in the QUT Ecological Genetics Lab for technical
assistance, and to those who took part in the Ecological Genetics Group
(EGG) discussions. MdB received financial support from an Australian
Postgraduate Award. MdB’s SE Asian and Australian fieldwork was
supported in part by grants from the Australian Geographic Society and the
Ecological Society of Australia.
37
Appendix 1. Samples used in this study for mitochondrial DNA extraction
Collection site location Site
abbr.
Eastern or
western type
GenBank
accession
no.
Bahand R, NW Peninsula Malaysia 1M Western AY203912
Semenyih R, SW Peninsula
Malaysia
2M Western AY203915
Setiu R, NE Peninsula Malaysia 3M Western AY203904
Sandakan R, Sabah, Malaysia 4M Western AY203905
Mekong R, Vietnam 1V Western AY203914
Dongnai R, Sth Vietnam 2V Western AY203907
Kraburi R, SW Thailand 1T Western AY203908
Tapi R, SE Thailand 2T Western AY203911
Bengawan R, Java, Indonesia JA Western AY203913
Plandez/Pulilan R, Luzon,
Philippines
PH Eastern AY203910
Fly R, Papua New Guinea PN Eastern AY203906
Ajkwa R, Irian Jaya, Indonesia IJ Eastern AY203909
Wenlock R, Qld, Australia 1A Eastern AY203918
Leichardt R, Qld, Australia 2A Eastern AY203919
Roper R, NT, Australia 3A Eastern AY203920
McArthur R, NT, Australia 4A Eastern AY203921
Katherine R, NT, Australia 5A Eastern AY203917
Ord R, WA, Australia 6A Eastern AY203916
Macrobrachium australiense AY203922
Macrobrachium lar AY203923
Appendix 2. Variable nucleotide sites among Macrobrachium rosenbergii haplotypes for 472 base pairs of the mtDNA 16s
rRNA gene. Haplotypes compared to sequence Sabah, Malaysia. Synonymous sites denoted by a dot, variable sites
denoted by type of nucleotide substitution.
096
101
112
113
114
117
125
156
158
186
196
197
199
211
215
229
233
234
270
281
283
284
288
295
299
318
322
330
334
436
442
4M G A A G C C T T A G A G C T G T C T A A A A C C G C G G A C G 1M . . . . . . . . . A . . . . . . . . . . . . T . . . . . . . . 2M . . . . . . . . . A . . . . . . . . . . . . T . . . . . . . . 3M . . . . . . . . . A . . . . . . . . . . . . T . . . . . . . . 1V . . . . . T . . . A . . . . . . . . . . . . T . . . . . . . . 2V . . . . . . . . . A . . . . . . . . . . . . T . . . . . . . . 1T . . . . . . . . . A . . . . . . . . . . . . T . . . . . . T . 2T . . . . . . . . . A . . . . . . . . . . . . T . . . . . . . . JA . . . . . . . . . . . . . . . . . . . . . . T . . . . . . . . PH A G T A . T . C G . G A T C A C T C T G T T T A A T A A T . . IJ A G T A . T C C G . G A T C A C T C T G T T T A A T A A T . . PN A G T A T T . C G . G A T C A C T C T G T T T A A T A A T . . 1A A G T A . T . C G . G A T G A C T C T G T T T A A T A A T . . 2A A G T A . T . C G . G A T . A C T C T G T T T A A T A A T . . 3A A G T A . T . C G . G A T . A C T C T G T T T A A T A A T . . 4A A G T A . T . C G . G A T . A C T C T G T T T A A T . A T . . 5A A G T A . T . C G . G A T . A C T C T G T T T A A T A A T . A 6A A G T A . T . C G . G A T . A C T C T G T T T A A T A A T . A
39
REFERENCES Benzie, J.A.H. (1998). Genetic structure of marine organisms and SE Asian
biogeography. In ‘Biogeography and Geological Evolution of SE Asia.’
(Eds. R. Hall and J.D. Holloway.), pp. 197-209. Backhuys Publishers,
Leiden, The Netherlands.
De Man, J.G. (1879). On some species of the genus Palaemon Fabr. with
descriptions of two new forms. Notes Leyden Museum 1, 165-184.
Felsenstein, J. (1988). Phylogenies from molecular sequences: inference and
reliability. Ann. Rev. Genetics 22, 521-565.
Gordon, A.L., and Fine, R.A. (1996). Pathways of water between the Pacific
and Indian Oceans in the Indonesian seas. Nature 379, 146-149.
Grandjean, F., Bouchon, D., and Souty-Grosset, C. (2002). Systematics of
the European endangered crayfish species Austropotamobius pallipes
(Decapoda: Astacidae) with a re-examination of the status of
Austropotamobius berndhauseri. J. Crust. Biol. 22, 677-681.
Hall, R. (1996). Reconstructing Cenozoic Asia. In ‘Tectonic Evolution of
Southeast Asia.’ (Eds. R. Hall and D.J. Blundell.), pp. 153-184. The
Geological Society Publishing House, Bath, UK.
Hasegawa, M., Kishino, H., and Yano, K. (1985). Dating of the human-ape
splitting by a molecular clock of mitochondrial DNA. J. Mol. Evol. 22, 160-174.
Hedgecock, D., Stelmach, D.J., Nelson, K., Lindenfelser, N.E., and Malecha,
S.R. (1979). Genetic divergence and biogeography of natural
populations of Macrobrachium rosenbergii. Proc. World Maricult. Soc.
10, 873-879.
Hewitt, G.M. (1996). Some genetic consequences of ice ages, and their role
in divergence and speciation. Biol. J. Linn. Soc. 58, 247-276.
Holthuis, L.B. (1950). The Palaemonidae collected by the Siboga and
Snellius Expeditions, with remarks on other species. The Decapoda of
the Siboga Expedition. Part X. The Palaemonidae. I Subfamily
Palaemoninae. Siboga Expeditie 39(a), Leiden, Netherlands.
Holthuis, L. B. (1995). Notes on Indo-West Pacific Crustacea Decapoda III to
IX. Zoologische Mededelingen 69 (13), 139-151. Leiden, The
Netherlands.
40
Huxley, T.H. (1868). On the classification and distribution of the
Alectoromorphae and Heteromorphae. Proc. Zool. Soc. Lond., 294-319.
Johnson, D.S. (1973). Notes on some species of the genus Macrobrachium
(Crustacea: Decapoda: Caridea: Palaemonidae). J. Sing. Nat. Acad. Sci.
3(3), 273-291.
Kimura, M. (1980). A simple method for estimating evolutionary rate of base
substitutions through comparative studies of nucleotide sequences. J.
Mol. Evol. 16, 111-120.
Kumar, S., Tamura, K., Jakobsen, I.B., and Nei, M. (2001). ‘MEGA2:
Molecular Evolutionary Genetics Analysis software.’ Arizona State
University: Tempe, Arizona, USA.
Lindenfelser, M.E. (1984). Morphometric and allozymic congruence:
evolution in the prawn Macrobrachium rosenbergii (Decapoda:
Palaemonidae). Syst. Zool. 33(2), 195-204.
Malecha, S.R. (1977). Genetics and selective breeding of Macrobrachium
rosenbergii. In ‘Shrimp and Prawn Farming in the Western
Hemisphere.’ (Eds. J.A. Hanson and H.L. Goodwin.), pp 328-355.
Dowden, Hutchinson and Ross, Stroudsberg, Pa, USA.
Malecha, S.R. (1987). Selective breeding and intraspecific hybridization of
crustaceans. In ‘Proceedings of the World Symposium on Selection,
Hybridization, and Genetic Engineering in Aquaculture.’ pp 323-336. Vol.
1, Berlin, Germany.
Murphy, N.P., and Austin, C.M. (2002). A preliminary study of 16S rRNA
sequence variation in Australian Macrobrachium shrimps
(Palaemonidae: Decapoda) reveals inconsistencies in their current
classification. Invert. Syst. 16(5), 697-701.
New, M.B., and Singholka, S. (1985). Freshwater prawn farming. A manual
for the culture of Macrobrachium rosenbergii. FAO Fish. Tech. Paper
(225) Rev.1. 118 pp, FAO, Rome, Italy.
Palumbi, S.R., Martin, A., Romano, S., McMillan, W.O., Stice, L., and
Grabowski, G. (1991). A simple fool’s guide to PCR, v2.0. Special
Publication of the University of Hawaii Department of Zoology and
Kewalo Marine Laboratory, pp. 1-23.
41
Pereira, G. (1997). A cladistic analysis of the freshwater shrimps of the family
Palaemonidae (Crustacea, Decapoda, Caridea). Acta Biol. Venez. 17, 1-69.
Sandifer, P.A., and Smith, T.I.J. (1979). Possible significance of variation in
the larval development of Palaemonid shrimp. J. Exp. Mar. Biol. Ecol.
39, 55-64.
Smith, T.I.J., Sandifer, P.A., and Trimble, W.C. (1976). Progress in
developing a recirculating synthetic seawater hatchery for rearing larvae
of Macrobrachium rosenbergii. In ‘Food-drugs from the Sea,
Proceedings 1974.’ (Eds. H.H. Webber and G.D. Ruggieri.) pp. 167-181.
Marine Technology Society, Washington DC, USA.
Stillman, J.H., and Reeb, C.A. (2001). Molecular phylogeny of eastern Pacific
porcelain crabs, genera Petrolisthes and Pachyceles, based on the
mtDNA 16S rDNA sequence: phylogeographic and systematic
implications. Mol. Phylogenet. Evol. 19(2), 236-245.
Strimmer, K., and von Haesler, A. (1996). Quartet-puzzling: a quartet
maximum-likelihood method for reconstructing tree topologies. Mol. Biol.
Evol. 13, 964-969.
Sturmbauer, C., Levinton, J.S., and Christy, J. (1996). Molecular phylogeny
analysis of fiddler crabs: test of the hypothesis of increasing behavioral
complexity in evolution. Proc. Natl. Acad. Sci. USA 93, 10855-10857.
Thompson, J.D., Gibson, T.J., Plewniak, F., Jeanmougin, F., and Higgens,
D.G. (1997). The ClustalX windows interface: flexible strategies for
multiple sequence alignment aided by quality analysis tools. Nucleic
Acids Res. 24, 4876-4882.
Tong, J.G., Chan, T.-Y, and Chu, K.H. (2000). A preliminary phylogenetic
analysis of Metapenaeopsis (Decapoda: Penaeidae) based on
mitochondrial DNA sequences of selected species from the Indo-West
Pacific. J. Crust. Biol. 20(3), 541-549.
Voris, H. K. (2000). Maps of Pleistocene sea levels in Southeast Asia:
shorelines, river systems and time durations. J. Biogeog. 27, 1153-1167.
Wowor, D. and Ng, P.K.L. (2001). Identity of the Giant Prawn,
Macrobrachium rosenbergii (De Man, 1879) (Crustacea: Decapoda:
42
Caridea: Palaemonidae). In ‘Proceedings of the Fifth International
Crustacean Congress’. Melbourne, Australia, July 9-13, 2001.
43
Statement of Joint Authorship
de Bruyn M, Wilson JC, Mather PB (2004) Reconciling geography and
genealogy: phylogeography of giant freshwater prawns from the Lake
Carpentaria region. Molecular Ecology, 13, 3515-3526.
de Bruyn M (candidate) Designed and developed experimental protocol. Carried out field and
laboratory work, and analysed data. Wrote manuscript and acted as
corresponding author.
Wilson JC Co-supervised the study design and experimental protocols. Assisted in the
interpretation of data. Contributed to the structure and editing of the
manuscript.
Mather PB Principal supervisor of the study design and experimental protocols. Assisted
in the interpretation of data. Contributed to the structure and editing of the
manuscript.
44
CHAPTER 3. Reconciling geography and genealogy: phylogeography of giant freshwater prawns from the Lake Carpentaria region.
de Bruyn M, Wilson JC, Mather PB
School of Natural Resource Sciences, Queensland University of Technology,
GPO Box 2434, Brisbane, Qld 4001, Australia
ABSTRACT There is convincing geological evidence for the historical existence of an
ancient lake on the Australian-New Guinea continental shelf during the late
Pleistocene. Lake Carpentaria was a vast fresh- to brackishwater lake that
would presumably have provided habitat for, and facilitated gene flow among,
aquatic taxa that tolerate low to moderate salinities in this region. Moreover, it
has been argued that the outflow of Papua New Guinea’s Fly River was
diverted westward into Lake Carpentaria during this period, although this
hypothesis is controversial. We predicted that these events, if a true history,
would have promoted gene flow and population growth via range-expansion
events in the giant freshwater prawn (Macrobrachium rosenbergii), and
restricted gene flow subsequently by way of a vicariant event as sea levels
rose during the late Pleistocene, and a marine environment replaced Lake
Carpentaria. We tested these hypotheses using phylogeographic and
phylogenetic analyses of mitochondrial DNA variation in M. rosenbergii
populations sampled from the Lake Carpentaria region. Our results support
the hypothesis that Lake Carpentaria facilitated gene flow among populations
of M. rosenbergii that are today isolated, but contest claims of a westward
diversion of the Fly River. We inferred the timing of initial expansion in the
‘Lake Carpentaria lineage’ and found the timing of this event to be broadly
concordant with geological dating of the formation of Lake Carpentaria.
Reconciling geological and molecular data, as presented here, provides a
powerful framework for investigating the influence of historical earth history
events on the distribution of biological (i.e. molecular) diversity.
Keywords: biogeography, nested clade analysis, Lake Carpentaria,
phylogeography, Fly River, range expansion
45
INTRODUCTION The recent development of statistical phylogeographic methodologies (e.g.
Templeton et al. 1995; Knowles & Maddison 2002) has enabled researchers
to distinguish between competing biological (e.g. dispersal) or earth history
(e.g. vicariance) events that may have influenced patterns of genetic
variation. Intraspecific phylogeographic studies have specifically tested
biogeographical hypotheses and the role of earth history events on the
distribution of taxa and genetic variation (e.g. Bermingham & Martin 1998;
Avise 2000; Waters et al. 2001; Sponer & Roy 2002; Waters & Roy 2003).
The intraspecific approach has been implemented to great effect along the
northern Australian coastline in diverse marine taxa (Benzie et al. 1992;
Keenan 1994; Norman et al. 1994; Elliott 1996; Fitzsimmons et al. 1997;
Begg et al. 1998; Chenoweth et al. 1998; Gopurenko & Hughes 2002), and
has highlighted the important role that vicariance has played in structuring
populations that were effectively isolated by the closure of the Torres Strait,
that separates Papua New Guinea from Australia, during Pleistocene low
sea-level stands. Several of these studies (Benzie et al. 1992; Keenan 1994;
Chenoweth et al. 1998) also demonstrated that subsequent dispersal events
lead to admixture between divergent lineages, and influenced intraspecific
genetic diversity in the region after inundation of the Torres Strait land bridge
by rising sea levels.
In contrast, few molecular studies have addressed the effects of
eustasy on freshwater aquatic taxa in this region (Macaranas et al. 1995;
McGuigan et al. 2000). While gene flow was effectively disrupted for marine
taxa by the closure of the Torres Strait, the same event may actually have
had the opposite effect and facilitated gene flow among fresh- and
brackishwater tolerant taxa, due to the formation of a substantial lake on the
Australia-New Guinea continental shelf during this period (Smart 1977;
Torgersen et al. 1983; Torgersen et al. 1985; Jones & Torgersen 1988). Lake
Carpentaria was a vast (approximate maximum size = 600km x 300km;
Chivas et al. 2001) intermittently fresh- to brackishwater lake hypothesised to
have existed from approximately 80 000-8 500 years before present (BP),
before absolute marine conditions were once again restored by rising sea-
levels cresting the Arafura Sill (Torgersen et al. 1983; Torgersen et al. 1985;
Figure 1. Study region and phylogenetic relationships (neighbour joining tree) among M. rosenbergii COI mtDNA lineages.
Sampling sites indicated by black dots as per Fig. 2. Phylogenetic relationships among haplotypes indicated by location as per map.
Major lineages indicated by Roman numerals to the left of nodes (see text for details), while bootstrap support indicated by numbers
to the right of nodes (neighbour-joining analysis firstly, maximum-likelihood analysis secondly). Genbank accession numbers for
haplotypes: AY614545-AY61458.
47
Jones & Torgersen 1988; Chivas et al. 2001). Lake Carpentaria would
presumably have provided habitat for (Torgersen et al. 1983; McGuigan et al.
2000), and facilitated connectivity among many Australian and New Guinean
fresh- and brackishwater tolerant aquatic taxa that are today separated by a
marine barrier (Fig. 1 & 2). A second significant factor that may have
influenced gene flow among populations of these taxa in the region was the
historical pattern and direction of flow of New Guinea’s Fly River, which has
been hypothesised (Blake & Ollier 1969; Torgersen et al. 1983; Torgersen et
al. 1988) to have drained into Lake Carpentaria until it diverted to its present-
day easterly course into the Coral Sea (Fig. 2) some 40-35 000 years BP
(Blake & Ollier 1969; Torgersen et al. 1988). This hypothesis is controversial,
however, and has been disputed by Harris et al. (1996; and see Voris 2000)
who found no evidence for a past westward diversion of the Fly River, but
argued that the outflow of the river in ‘recent’ geological time has always
remained on an easterly course into the Coral Sea (Fig. 2).
To determine the roles that Lake Carpentaria and the Fly River have
played in the evolutionary history of freshwater organisms in this region, we
examined mitochondrial DNA variation in the giant freshwater prawn,
Macrobrachium rosenbergii (eastern form; sensu de Bruyn et al. 2004). We
collected samples from rivers that are believed to have drained into Lake
Carpentaria (Voris 2000), as well as from rivers within the region that
apparently remained isolated during this period, for comparative analyses
(Fig. 2). M. rosenbergii is a commercially important (FAO 2000) freshwater
crustacean that migrates to estuaries to spawn, as juveniles require
brackishwater for survival and development. Laboratory experiments indicate
that adults and juvenile M. rosenbergii can survive in brackishwater for
extended periods of time, but do not tolerate full marine conditions for more
than a week as adults and approximately 3 weeks as postlarvae (Sandifer et
al. 1975). M. rosenbergii would therefore appear to be an ideal model
organism for investigating the influence of an historical fresh- to
brackishwater lake on the biogeographical history of the region. Taxonomists
(Short 2000; D. Wowor, pers. comm.) recognise 2 distinct ‘races’ of
Figure 2. Minimum-spanning network and study region indicating Lake Carpentaria and sea levels for much of the Pleistocene. Circle size for each haplotype (1 - 43) indicates overall frequency. Small black circles indicate inferred missing haplotypes not observed in the dataset. Site location abbreviations as per Table 1. Light grey shading on map indicates -75 m sea-level contour. Pleistocene drainage basins indicated on map (Map adapted with kind permission Harold K. Voris and the Field Museum of Natural History, Chicago, USA; Voris 2000).
49
Australian M. rosenbergii; a northwestern Australian race distributed from the
Fitzroy (northern Western Australia) to the Keep Rivers, and a northeastern
Australian race distributed from the Roper to the Normanby (NE Cape York
Peninsula) Rivers, with an intermediate form found between these two
regions (Fig. 1 & 2). Thus, a further aim of the present study was to
determine whether relationships based on molecular data presented here
were consistent with previous studies based on morphological characters.
If Lake Carpentaria facilitated gene flow in M. rosenbergii in the
‘recent’ past, populations sampled from rivers that formerly drained into Lake
Carpentaria (Fig. 2) should display the molecular signatures of ‘recent’
genetic interchange, a ‘recent’ range expansion, and a corresponding
population expansion that followed the formation of the Lake. Additional
evidence may be expected for subsequent vicariance when a marine
environment replaced the Lake, presumably restricting gene flow as sea
levels crested the Arafura Sill. Similarly, a signature of ‘recent’ genetic
interchange and subsequent vicariance between Fly River and Gulf of
Carpentaria populations might be expected if the Fly River did indeed flow
into Lake Carpentaria in ‘recent’ times.
We therefore documented the phylogeography of the giant freshwater
prawn, Macrobrachium rosenbergii from the Lake Carpentaria region to
determine:
i.) if molecular evidence indicates that Lake Carpentaria acted as a conduit
for gene flow, and provided habitat for M. rosenbergii during the low sea level
stands of the late Pleistocene (the outcome of which might be cautiously
generalised to other fresh- and brackishwater tolerant taxa in the region)
ii.) if gene flow was subsequently restricted by rising sea levels that
inundated Lake Carpentaria
iii.) if molecular evidence supports the westward diversion of the Fly River
into Lake Carpentaria during the late Pleistocene
iv.) if relationships based on molecular data concord with those based on
morphological variation.
Table 1. Sampling sites and their abbreviations, distribution of mtDNA COI haplotypes, and sample sizes used in this study. Location and abbreviation Haploty
-pe Katheri- ne KA
Keep KE
Roper RO
McArth-ur MC
Wenloc-k
WE
NormanNO
Archer AR
LimmenBight LB
LennardLE
AjkwaAJ
Hann HA
Fly FL
1 4 2 1 3 28 21 4 7 5 2 6 1 7 22 7 8 1 9 31
10 1 11 2 12 1 13 21 14 17 15 1 16 14 3 17 1 18 1 19 1 20 40 6 3 24 21 3 22 1 23 1 24 5 25 10 26 2 27 1 28 4 29 1
Haploty-pe
(cont.)
Katheri- ne KA
Keep KE
Roper RO
McArth-ur MC
Wenloc-k
WE
NormanNO
Archer AR
LimmenBight LB
LennardLE
AjkwaAJ
Hann HA
Fly FL
30 1 31 1 32 29 33 11 34 8 35 1 36 2 37 1 38 3 39 1 40 1 41 28 42 1 43 1 n 33 31 22 49 40 44 25 27 18 42 8 39
52
MATERIALS AND METHODS Sample collection and molecular analyses
A total of 378 individuals collected from 12 sites in Australia, Papua New
Guinea and Irian Jaya were included in the analyses (Table 1; Fig. 1 & 2).
Tissue samples (muscle or pleopod) were stored in 70% ethanol until
required for molecular analyses. For DNA extraction, a small piece of tissue
was first rehydrated for 30 minutes in 1ml GTE buffer (100mM glycine, 10mM
Tris, 1mM EDTA). Tissue samples were then incubated overnight at 55ºC in
500µl extraction buffer (100mM NaCL, 50mM Tris, 10mM EDTA, 0.5% SDS)
containing 20µl of 10µg/µl Proteinase K (Sigma Co.). Total genomic DNA
was extracted using standard phenol: chloroform extraction methods, and
collected by ethanol precipitation. Amplification of a fragment of the mtDNA
cytochrome c oxidase subunit I (COI) gene was carried out using primers
LCO1490 and HCO2198 (Folmer et al. 1994). Each 50µl amplification
reaction consisted of 400 ng of template DNA, 5 µl of 10X buffer containing
MgCl2 (Roche), an additional 2µl of 25mM MgCl2 (Roche), 0.5 units of Taq
polymerase (Roche), 0.8 µl of each primer (10 µM final conc.), 0.2 mM of
each dNTP, and 38.95 µl autoclaved ddH2O. Samples that proved difficult to
PCR were amplified using READY-TO-GO®BEADS (Pharmacia Biotech).
Thermal cycling was performed on a PTC-100 thermocycler (MJ Research
Inc.) under the following conditions: 3 min denaturation at 94ºC, followed by
30 cycles of 30 sec at 94ºC, 30 sec at 55ºC, 30 sec at 72ºC, and a final 10
min extension at 72ºC, before cooling to 4ºC for 10 mins. Negative controls
were included in all PCR runs, and sterile procedures were adhered to
throughout. PCR amplifications were confirmed with agarose gel
electrophoresis on a 1% gel. Screening for intrapopulation variation was
carried out using Temperature Gradient Gel Electrophoresis (TGGE)
combined with Outgroup Heteroduplex Analysis (OHA) (Campbell et al.
1995). This method proved to be sensitive enough to consistently distinguish
among haplotypes that varied by a single base pair (bp). Multiple examples
(~2-3) of PCR products from haplotypes identified as unique using
TGGE/OHA were purified using a Qiagen QIAquick PCR purification kit and
sequenced. DNA sequencing of 602 bp of the COI gene was conducted on
an ABI 3730 automated sequencer at the Australian Genome Research
53
Facility at the University of Queensland, Brisbane, Australia. Both strands of
the PCR product were completely sequenced.
Data analyses
Sequences were aligned in ClustalX (Thompson et al. 1997). Initial data
exploration and standard diversity indices were calculated in ARLEQUIN
(Version 2.0; Schneider et al. 2000). To determine whether the mitochondrial
region employed in the present study was evolving according to neutral
expectations, we employed neutrality tests (Fu & Li 1993; Tajima 1989) in
DnaSP ver.4.00 (Rozas et al. 2003). We investigated whether sequences
had reached substitution saturation by plotting separately the number of
transitions or transversions between pairs of haplotypes vs. the Kimura 2-
parameter genetic distances that corrects for multiple hits. Population
structure was investigated in ARLEQUIN using ΦST statistics, analysis of
molecular variance (AMOVA) with statistical significance determined by
permutation analyses (Excoffier et al. 1992), and the construction of a
minimum-spanning network (MSN; Excoffier & Smouse 1994). We
determined that the TrN model of substitution (Tamura & Nei 1993) plus
invariable sites (I) and a gamma distribution (Γ) of rate heterogeneity across
variable sites provided the best fit to our data set with the program
MODELTEST 3.06 (Posada & Crandall 1998). The estimated parameters
under this model were Γ = 0.5930, I = 0.6928 and Ti/Tv = 4.69. We used the
neighbour-joining method of tree construction with bootstrap analysis (1000
replicates; Felsenstein 1985) to evaluate support for relationships,
implemented in PAUP* 4.0b10 (Swofford 2002). As a comparison to the
neighbour-joining method, we also constructed trees using maximum
likelihood methods. We adopted these methods in an attempt to minimise the
potential for error that may arise from the assumptions inherent in phylogeny
reconstruction methods. A single M. rosenbergii individual from Bali (western
form; de Bruyn et al. 2004) was used as an outgroup. We calculated
maximum-likelihood distances among haplotypes in PAUP*. To test for
adherence to a clock-like evolution of the mtDNA sequences, a log-likelihood
ratio test was carried out in PAUP* that compared trees generated under the
assumption of a molecular clock, to trees unconstrained by any such
assumption (Felsenstein 1988). The timing of cladogenesis identified in the
54
phylogeny was then inferred by way of molecular clock approximation.
Although the accuracy of dates of divergence based on a molecular clock are
debatable (Marko 2002), they do none the less provide a relative time frame
for investigating phylogeographical relationships. To determine relationships
among haplotypes, and factors that may have influenced these relationships,
we employed nested clade analysis (NCA; Templeton et al. 1995). A 95%
probability haplotype cladogram was constructed according to Templeton &
Sing (1993), Crandall (1996) and Templeton (1998) in TCS ver. 1.13
(Clement et al. 2000). This network was then converted into a nested design
and analysed in GeoDis ver. 2.0 (Posada et al. 2000), with the null
hypothesis of no geographic association among haplotypes. Templeton’s
latest inference key (2004) was used to infer processes involved in any
statistically significant association observed. To address the question of
changes in historical population (lineage) size, we employed mismatch
distribution analyses (Rogers & Harpending 1992; Rogers 1995) in DnaSP
and ARLEQUIN. If the distribution identified is unimodal and fits the sudden
expansion model, it is possible to estimate the time to the onset of population
expansion.
55
RESULTS Genetic diversity
A total of 602 bp of the COI mitochondrial gene were amplified successfully
for all samples analysed, for a total of 378 M. rosenbergii individuals,
resulting in 43 unique haplotypes defined by 59 variable sites. All unique
sequences have been deposited with GenBank (accession numbers:
AY614545-AY614587). The sequences were unambiguously aligned with no
insertions or deletions observed in the dataset. No significant deviations from
those expected under neutrality were identified when all haplotypes were
analysed together (Fu & Li 1993; D = -1.12, P = > 0.10; F = -1.08, P = > 0.10;
Tajima 1989; D = - 0.53, P = > 0.10), or when phylogenetic lineages (Fig. 1)
or individual populations were analysed separately (statistics not presented
here). Haplotype diversity ranged from 0.00 - 0.66 (mean 0.376). Maximum-
likelihood distances ranged from 0.002 - 0.05. No evidence was found for
saturation in transitions or transversions in our dataset (graphs not shown).
Conversion of the nucleotide sequences into amino acid sequence indicated
that nearly all polymorphisms were silent substitutions. Only three amino acid
changes were inferred, two from Irian Jayan sequences, and one from a
Western Australian sequence. Moreover, no stop codons were identified and
these data supported our view that pseudogenes were absent from the
dataset.
Phylogeny reconstruction
The neighbour-joining tree (Fig. 1) constructed using the complete dataset of
43 haplotypes resulted in a well-resolved phylogeny, defined by 37
phylogenetically informative sites. Four major clades were identified,
hereafter referred to as lineages I - IV, supported by high bootstrap values
(Fig. 1). These relationships were also strongly supported by the maximum-
likelihood analysis (Fig. 1), although within lineage relationships varied
depending on the method of tree construction. The geographical distributions
of all identified lineages were discrete. Lineage II had the broadest
geographical distribution, and was represented by specimens that were
collected from Australian rivers that discharge into the Gulf of Carpentaria
(Fig. 1 & 2) and from two more westerly Australian sites (Keep & Katherine
Rivers, Northern Territory). The Northern Territory populations formed a sub-
56
group nested within this clade, although bootstrap support for this
relationship was low (neighbour-joining bootstrap value = 44). Lineage I was
restricted to the Western Australian population, the Irian Jayan population
comprised lineage III, while the Papua New Guinean and the Hann River
(Australia) populations together comprised lineage IV (Fig. 1). Bootstrap
support was low for within lineage variation so we examined these
relationships further as described below.
Genetic structuring among and within lineages
AMOVA identified 75% of the variation to be present among phylogenetic
lineages, 16.5% of the variation to be among populations within lineages, and
only 8.5% of the variation to be within populations. This evidence for
restricted gene flow among populations representing discrete phylogenetic
lineages was supported by pairwise ΦST and exact test values (Table 2).
These data suggest that gene flow among populations representing discrete
lineages has not taken place for a significant period of evolutionary time.
Even within lineages, little or no ongoing gene flow among populations was
suggested by pairwise ΦST and exact test values, as all populations were
significantly differentiated from each other (Table 2). The Katherine and Keep
River populations (lineage II) were genetically most similar (ΦST = 0.161),
while the Roper and Hann River populations (lineages II & IV respectively)
were most dissimilar (ΦST = 1.000). Interestingly, these four populations were
all collected from Australian sites (Fig. 1 & 2).
Network estimation and nested clade analysis
Relationships among haplotypes in the MSN (Fig. 2) supported the presence
of the 4 discrete lineages identified in the phylogenetic reconstruction (Fig. 1).
Lineage II (Australian Gulf of Carpentaria & Northern Territory populations)
formed a central clade dominated by 4 haplotypes (haplotypes 3, 9, 16 & 20)
occurring at high frequencies at the centre of a star-like radiation, separated
from one another by 1 – 5 bp differences (Fig. 2). Of these 4 haplotypes, 3
were found in more than one geographical location (haplotype 3 = Keep &
Katherine Rivers; haplotype 16 = Wenlock & Norman Rivers; haplotype 20 =
Norman, McArthur, Archer & Limmen Bight Rivers), while the fourth was
restricted to the Norman River (haplotype 9; Table 1).
57
Table 2. Pairwise ΦST values and exact test of population differentiation
among sites. ΦST above diagonal based on nucleotide content and haplotype
frequencies (all values significant; P < 0.05). Exact test probabilities of non-
differentiation below the diagonal based on 10 000 Markov permutational
steps, significance values indicated by * = P < 0.05 and *** = P < 0.0005 (i.e.
all pairwise comparisons significant). See Table 1 for sampling site codes. KA KE RO MC WE NO AR LB LE AJ FL HA
KA - 0.16 0.94 0.76 0.55 0.56 0.76 0.95 0.94 0.94 0.93 0.97KE * - 0.90 0.74 0.54 0.57 0.72 0.92 0.93 0.93 0.92 0.96RO *** *** - 0.77 0.65 0.49 0.82 0.98 0.95 0.95 0.93 1.00MC *** *** *** - 0.45 0.53 0.54 0.10 0.89 0.89 0.89 0.89WE *** *** *** *** - 0.30 0.37 0.63 0.86 0.88 0.87 0.85NO *** *** *** *** *** - 0.49 0.72 0.88 0.89 0.89 0.88AR *** *** *** *** *** *** - 0.77 0.89 0.90 0.90 0.91LB *** *** *** * *** *** *** - 0.95 0.94 0.93 0.99LE *** *** *** *** *** *** *** *** - 0.92 0.91 0.93AJ *** *** *** *** *** *** *** *** *** - 0.91 0.92FL *** *** *** *** *** *** *** *** *** *** - 0.80HA *** *** *** *** *** *** *** *** *** *** *** -
Only one other haplotype from the total dataset (haplotype 7) was identified
at multiple geographic locations, namely in the Roper & McArthur River
populations. There were few intermediate missing haplotypes, and lineage II
was separated by 11 bp from lineage I, and 10 bp from both lineages III and
IV respectively. Lineages I and III formed two well-resolved clades with only a
single missing haplotype evident in lineage III. Relationships within lineage IV
were more complex, with a number of missing intermediate haplotypes. The
Fly River (Papua New Guinea) population had the greatest number of
haplotypes (9) compared with all other populations (Table 1). The Hann River
population from the eastern Cape York Peninsula (Australia) was only 5 bp
divergent from the Fly River population, but a minimum of 11 bp divergent
from any other Australian haplotype (Fig. 2). We adopted a conservative
approach, and only analysed lineage II by approximation of a 95% parsimony
network, followed by nested clade analysis (Templeton et al. 1995). This
decision was made based on the extensive intermediate (unsampled)
geographic areas between populations from each respective lineage, which
may result in an ambiguous outcome in NCA (Templeton 2004), and the
large number of inferred missing haplotypes among lineages identified in the
58
MSN (Fig. 2). In contrast, lineage II’s range was well sampled and there were
few inferred missing haplotypes (Fig. 3). NCA enabled us to reject the null
hypothesis of no association between the distribution of haplotypes and
geography for a number of clades, and we therefore inferred likely causes for
the observed patterns using Templeton’s (2004) latest inference key (see
Table 3 for nested clade distances and inferred processes). For clades 1-5,
2-1 and 2-3 the inference key did not allow us to distinguish between
contiguous range expansion, long distance colonisation or past fragmentation.
The inference key suggested contiguous range expansion for both clades 1-
10 and 2-2, while at the entire cladogram level either isolation by distance or
long distance dispersal was suggested.
Timing of cladogenesis and lineage expansions
A log-likelihood ratio test could not reject the hypothesis that lineages were
evolving according to a clock-like model of evolution (-ln L = 1576.76 with
molecular clock enforced vs. -ln L = 1553.55 without molecular clock
enforced, χ2 = 46.42, d.f. = 41, P > 0.10). Knowlton & Weigt (1998) calibrated
a caridean shrimp (caridea is the infraorder of Macrobrachium rosenbergii)
COI molecular clock at 1.4 X 10-8 based on the rise of the Isthmus of
Panama. Assuming a molecular clock and applying this divergence rate to:
firstly, the uncorrected genetic distances, and secondly, the corrected
maximum-likelihood distances (as per Knowlton & Weigt 1998) between
lineages, coalescence between the central lineage II and lineages I, III & IV
respectively dates back to the early Pleistocene (1 - 1.4 million years ago
(Mya) uncorrected; 1.2 - 1.7 Mya corrected). To determine whether lineages
fitted the predicted distribution under a sudden expansion model, we
employed mismatch distribution analyses. The validity of the model was
tested using the parametric bootstrap approach in ARLEQUIN, where P =
(number of SSDsim ≥ SSDobs)/B (Schneider & Excoffier 1999). Lineages II &
IV fitted well the predicted distribution under a sudden expansion model, but
the fit for lineages I & III were rejected. Mismatch distributions (Slatkin &
Hudson 1991; Rogers & Harpending 1992) and P values are presented in
Figure 4. To determine the approximate timing of the expansion of lineages II
& IV the equation for tau (τ = 2ut) was rearranged to solve for t (generations
since expansion).
59
Table 3. Results of nested clade analysis showing clade (Dc), nested (Dn)
and interior to tip clade (I-T) distances. Only clades with significant
permutational χ2 probabilities for geographic structure have been included. nesting
level haplotype/clade
no. location Dc Dn χ2 - P inference key
conclusion 1-2 1 tip 0 154.89 0.0730* RG-IBD 2 tip 0 211.11 3 interior 180.73L* 179.85L* I-T 180.73L* 13.71 1-5 9 interior 0S 453.44L 0.0000 CRE/LDC/PF? 7 tip 55.09S 306.57S 8 tip 0 658.26L 11 tip 0 453.44 10 tip 0 107..05 I-T -48.41S 133.35L 1-10 20 interior 165.02S 182.07S 0.0000 CRE 18 tip 0 155.39 23 tip 0 155.39 19 tip 0 155.39 21 tip 0 677.99L 22 tip 0 677.99 I-T 165.02 -271.95S 2-1 1-1 tip 0 183.23 0.0020 CRE/LDC/PF? 1-2 interior 178.65S 183.04L 1-3 tip 0S 182.77S I-T 178.65L 0.22L 2-2 1-4 interior 48.30S 385.25S 0.0000 CRE 1-5 tip 365.84S 463.70L 1-6 interior 0S 393.00S I-T -341.69S -74.58S 2-3 1-7 interior 0S 587.24L 0.0000 CRE/LDC/PF? 1-8 tip 0 477.40 1-9 tip 0 167.61 1-10 tip 201.29S 261.67S I-T -196.44S 324.11L 3-1 2-1 tip 183.00S 653.09L 0.0000 IBD/LDD? 2-2 interior 426.99 426.40S 2-3 tip 399.36S 391.67S I-T 102.49L -55.71 Footnote: Significantly small or large values for Dc, Dn and I-T (Dc and Dn) are indicated by
superscript ‘S’ and ‘L’ respectively, and ‘*’ indicates P < 0.08. Inference key conclusions
using Templeton’s updated key for NCA (Templeton 2004). Conclusions as follows: RG-IBD,
restricted gene flow with isolation by distance; CRE, contiguous range expansion; LDC, long
distance colonisation; PF, past fragmentation; IBD, isolation by distance; LDD, long distance
dispersal. ‘?’ indicates inconclusive outcome discriminating between the listed conclusions.
60
The product of μ and 602 nucleotide sites used in this study replaced the
parameter u in the equation. Substituting these values into the equation and
assuming a generation time of 6 months - 1 year, it is suggested that the
initial timing of these expansion events took place approximately 154 000-77
000 years BP for lineage II, and 370 000-185 000 years BP for lineage IV.
61
DISCUSSION Four discrete genealogical lineages of giant freshwater prawns were
identified in this study (Fig. 1): a Western Australian lineage (lineage I); a
Gulf of Carpentaria/Northern Territory lineage (II); an Irian Jayan lineage (III);
and a Papua New Guinean/NE Cape York lineage (IV). This relationship
coincides with the phylogeographic structuring of a number of marine
organisms sampled from Australian waters that have displayed genetic
breaks between i.) Western Australia ii.) NE Australia and/or iii.) Northern
Territory/Gulf of Carpentaria (Mulley & Latter 1981; Benzie et al. 1992;
Johnson & Joll 1993; Keenan 1994; Norman et al. 1994; Elliott 1996;
Fitzsimmons et al. 1997; Begg et al. 1998; Chenoweth et al. 1998; Brooker et
al. 2000; Benzie et al. 2002; Gopurenko & Hughes 2002; Ovenden et al.
2002). It also coincides with results from the only two molecular studies
undertaken on freshwater taxa in this region to date. The first identified low
levels of divergence between populations of redclaw crayfish from the Gulf of
Carpentaria and the Northern Territory (Macaranas et al. 1995), while the
second found a close phylogenetic relationship between rainbowfish from
southern Papua New Guinea and northern Australia indicative of recent
speciation and range expansion events (McGuigan et al. 2000).
Morphological variation among Australian M. rosenbergii populations also
appears broadly concordant with genetic relationships presented here. While
the reciprocal monophyly of the northwestern and northeastern Australian
races (lineages I & II respectively) are supported in the phylogenetic and
phylogeographic reconstructions (Fig. 1 & 2), the intermediate form, while
comprising a distinct sub-grouping (Northern Territory haplotypes), remains
nested within the Eastern Australian lineage (lineage II; Fig. 1). Based on
molecular data, the Keep River specimens collected for the present study do
not represent the northwestern race, as suggested by the morphological data
(Short 2000), but rather the intermediate form. Alternatively, specimen
collections for these two studies may have been from two geographically
isolated locations from the Keep River drainage, thus the Keep River region
may be a zone of contact between the northwestern race and the
intermediate form. This hypothesis warrants further investigation, and we
propose to investigate this further using microsatellite markers in the near
62
Figure 3. Statistical parsimony cladogram (95%) for lineage II estimated from
the M. rosenbergii COI data. Small black circles indicate inferred missing
haplotypes not observed in the dataset. See Fig. 2 and Table 1 for haplotype
frequencies.
future. In direct contrast to the molecular data, no morphological divergence
was reported between NW and NE Cape York populations (Short 2000).
Analysis of molecular variance indicated that the regional structuring
of the four lineages explained much of the total genetic variance presented
here. Complete lineage sorting and the high ΦST values (Table 2) among
populations from discrete lineages suggest that these lineages are on
independent evolutionary pathways, and have been so for a considerable
time frame. Indeed, a molecular clock estimate of the time to coalescence
5
4 2
6
1
3
13
12
9
7
8
10
11
14
24
16 15
17
22 20 18
23
19
21
1-1
1-2
1-3
1-4
1-5
1-6
1-7
1-8
1-9
1-10
2-1 2-2
2-3
63
between these groups indicates that events during the early Pleistocene,
some 1-1.7 Mya, initiated the regional structuring of haplotypes. Any
inferences regarding the timing of colonisation based on a partial phylogeny
such as that presented here however, may not reveal a true history. Hence,
we did not attempt to elucidate the chronology of ancestry among these
lineages, as our sampling was limited to a fairly small part of M. rosenbergii’s
(eastern form) known distribution (de Bruyn et al. 2004). We propose to
investigate ancestral relations among lineages in more detail in the future.
Within-lineage variation was also highly structured, with all populations
significantly differentiated from each other in the two lineages that were
represented by more than a single population (lineages II & IV; Table 2). In
population genetic terms, these data suggest that gene flow among
populations within regions is not sufficient to counter the effects of random
genetic drift. Out of a total of 43 unique haplotypes, only 4 were distributed in
multiple populations, all of which represented lineage II. Sharing of
haplotypes among the Keep & Katherine Rivers; the Wenlock & Norman
Rivers; the Norman, McArthur, Archer & Limmen Bight Rivers; and the Roper
& McArthur Rivers respectively, could indicate either the retention of
ancestral polymorphisms or alternatively that low levels of gene flow
occur(ed) among these populations. That 3 of these 4 haplotypes were
interior (ancestral) haplotypes (Fig. 3) would suggest that the retention of
ancestral polymorphisms is a more likely scenario.
Within lineage IV, the close phylogenetic relationship between the
Hann River population (NE coast of Cape York Peninsula, Australia) and the
Fly River population (Papua New Guinea) was surprising, given the much
greater geographic distance between the Hann and Fly Rivers compared with
that between the Hann River and western Cape York sites (e.g. Wenlock and
Archer Rivers, see Fig. 2). Nonetheless, the Hann and Fly River populations
do not share haplotypes, and it would appear (Fig. 1 & 2; Table 3) that the
relationship between them is historical, and not a consequence of
contemporary processes. The lack of evidence for ‘recent’ genetic
interchange between the Fly River and the Gulf of Carpentaria populations
challenges the hypothesis (Blake & Ollier 1969; Torgersen et al. 1983;
Torgersen et al. 1988) that the Fly River drained into Lake Carpentaria for an
Figure 4. Distribution of pairwise differences among mtDNA COI haplotypes for lineages I-IV. F(i): relative frequency of haplotypes
with i differences. (a) lineage I, (b) lineage II, (c) lineage III, (d) lineage IV.
(a). (b).
(c). (d).
65
extensive period of time during the late Pleistocene. Rather, the data
supports the alternative view (Harris et al. 1996) that the Fly River remained
on an easterly course draining into the Coral Sea during this time. Indeed, an
estimate of the time to coalescence between populations from the Fly River
and the Gulf of Carpentaria dates back some 1.5 Mya. Additional molecular
studies of freshwater taxa sampled from southern New Guinea rivers (that
are believed to have drained into Lake Carpentaria; see Fig. 2) are warranted
to further elucidate historical connectivity between Australia and New Guinea.
Interestingly, the time frame estimated here for coalescence between
lineages restricted to western and eastern flowing rivers on the Cape York
Peninsula (lineages II & IV respectively) concords with that identified for
divergence between populations of the estuarine mud crab, Scylla serrata,
sampled from either side of the Cape York Peninsula (~1 Mya; Gopurenko et
al. 1999).
The hypothesis that Lake Carpentaria provided habitat for, and
facilitated gene flow among giant freshwater prawn populations during the
late Pleistocene is supported by our analyses. NCA of lineage II strongly
indicated a range expansion event at both 1-step and 2-step clade levels for
present day Gulf of Carpentaria populations (Table 3). This expansion is also
evident in the star-like structuring of lineage II haplotypes (Fig. 3; Slatkin &
Hudson 1991). Inferring the timing of this lineage expansion (154 000 - 77
000 years BP) indicated that the formation of Lake Carpentaria some 80 000
years BP (Jones & Torgersen 1988) may have initiated this event.
Subsequently, Lake Carpentaria was replaced by a marine environment
some 8 500 years BP as sea-levels rose (Torgersen et al. 1983; Torgersen et
al. 1985; Jones & Torgersen 1988; Chivas et al. 2001), which evidently
restricted gene flow among populations formerly connected by the Lake. This
subsequent restriction of gene flow is suggested by significant values for all
pairwise tests of non-differentiation among populations from the Gulf region
(Table 2), while the low number of nucleotide differences and the lack of
geographic structuring among these haplotypes indicates that divergence
was ‘recent’. This fragmentation event highlights one recognised limitation of
NCA, i.e. the fragmentation event was too recent to detect using NCA (see
Masta et al. 2003 & Templeton 2004 for discussion). This problem can be
66
circumvented, however, by incorporating frequency-based analyses (e.g.
FST’s; A.R. Templeton, pers. comm.) as illustrated here. It would appear that
Northern Territory sites included in this study were either colonised shortly
after the time of Lake Carpentaria’s formation, or in situ haplotypes were
replaced by ‘Lake Carpentaria type’ haplotypes that have diverged
subsequently in apparent isolation (Fig. 1 & 2).
In conclusion, Lake Carpentaria appears to have played an important
role in the evolutionary history of aquatic taxa during the late Pleistocene
(this study; Macaranas et al. 1995; McGuigan et al. 2000), and may also
prove to have been a significant influence on pre-historic human migrations
in the region. Moreover, our results do not support the hypothesis (Blake &
Ollier 1969; Torgersen et al. 1983; Torgersen et al. 1988) of a westward
diversion of the Fly River during this time. The combination of geological and
molecular data presented here provides a powerful framework for
investigating the influence of historical earth history events on the distribution
of biological (i.e. molecular) diversity.
67
ACKNOWLEDGMENTS This paper is dedicated to the memory of our friend and colleague, Steve
Caldwell. We thank Steve Caldwell, Natalie Baker, Daisy Wowor, Peter Ng,
David Milton, John Short, Peter Davie and David Harvey for help in collecting
samples for this study. David Hurwood and Andrew Baker provided helpful
suggestions that improved the manuscript. Thanks to all in the QUT
Ecological Genetics Lab and Ecological Genetics Group (EGG) for
suggestions and assistance. MdB received financial support from an
Australian Postgraduate Award. MdB’s SE Asian and Australian fieldwork
was supported partly by research grants from the Australian Geographic
Society, the Ecological Society of Australia and the Linnean Society of New
South Wales. PBM acknowledges support from an ACIAR small-project grant
FIS/2002/083 and assistance from Western Australian Fisheries.
AUTHOR INFORMATION BOX This research forms part of Mark de Bruyn’s PhD thesis on the evolutionary
history of giant freshwater prawns, and the application thereof in addressing
questions related to earth history events. John Wilson (Mark’s co-supervisor)
and members of his group focus mainly on the ecology and population
dynamics of small mammal populations, particularly in northern Queensland.
Peter Mather leads research in the QUT Ecological Genetics lab, which often
focuses on the management implications of molecular variation in fishes and
crustaceans, although studies on other animals, and occasionally plants, are
also tolerated.
68
REFERENCES Avise JC (2000) Phylogeography. The history and formation of species.
Harvard University Press, Cambridge, MA, USA.
Begg GA, Keenan CP, Salini MJ (1998) Genetic variation and stock structure
of school mackerel and spotted mackerel in northern Australian waters.
Journal of Fish Biology, 53, 543-559.
Benzie JAH, Frusher S, Ballment E (1992) Geographical variation in
allozyme frequencies of populations of Penaeus monodon (Crustacea:
Decapoda) in Australia. Australian Journal of Marine and Freshwater
Research, 43, 715-725.
Benzie JAH, Ballment E, Forbes AT et al. (2002) Mitochondrial DNA variation
in Indo-Pacific populations of the giant tiger prawn, Penaeus monodon.
Molecular Ecology, 11, 2553-2569.
Bermingham E, Martin AP (1998) Comparative phylogeography of
neotropical freshwater fish: testing shared history to infer the
evolutionary landscape of Central America. Molecular Ecology, 7, 499-
517.
Blake DH, Ollier CD (1969) Geomorphological evidence of Quartenary
tectonics in Southwestern Papua. Revue de Geomorphologie
Dynamique, 19, 28-32.
Brooker AL, Benzie JAH, Blair D, Versini J-J (2000) Population structure of
the giant tiger prawn Penaeus monodon in Australian waters,
determined using microsatellite markers. Marine Biology, 136, 149-157.
Campbell NJH, Harriss FC, Elphinstone MS, Baverstock PR (1995) Outgroup
heteroduplex analysis using temperature gradient gel electrophoresis:
high resolution, large scale, screening of DNA variation in the
mitochondrial control region. Molecular Ecology, 7, 407-418.
Chenoweth SF, Hughes JM, Keenan CP, Lavery S (1998) When oceans
meet: a teleost shows secondary intergradation at an Indian-Pacific
interface. Proceedings of the Royal Society of London B, 265, 415-420.
Chivas AR, Garcia A, van der Kaars S et al. (2001) Sea-level and
environmental changes since the last interglacial in the Gulf of
Carpentaria, Australia: an overview. Quartenary International, 83-85, 19-46.
69
Clement M, Posada D, Crandall KA (2000) TCS: a computer program to
estimate gene genealogies. Molecular Ecology, 9, 1657-1659.
Crandall KA (1996) Multiple interspecies transmissions of human and simian
T-cell leukemia/lymphoma virus type I sequences. Molecular Biology
and Evolution, 13, 115-131.
de Bruyn M, Wilson JC, Mather PB (2004) Huxley’s Line demarcates
extensive genetic divergence between eastern and western forms of the
giant freshwater prawn, Macrobrachium rosenbergii. Molecular
Phylogenetics and Evolution, 30, 251-257.
Elliott NG (1996) Allozyme and mitochondrial DNA analysis of the tropical
saddle-tail sea perch, Lutjanus malabaricus (Schneider), from
Australian waters. Marine and Freshwater Research, 47, 869-876.
Excoffier L, Smouse PE, Quattro JM (1992) Analysis of molecular variance
inferred from metric distances among DNA haplotypes: application to
human mitochondrial DNA restriction data. Genetics, 131, 479-491.
Excoffier L, Smouse PE (1994) Using allele frequencies and geographic
subdivision to reconstruct gene genealogies within a species. Molecular
variance parsimony. Genetics, 136, 343-359.
FAO (Food and Agriculture Organisation of the United Nations) (2000)
Aquaculture production statistics 1989-1998. FAO Fisheries Circular
815 (Rev 12). FAO, Rome.
Felsenstein J (1985) Confidence limits on phylogenies: an approach using
the bootstrap. Evolution, 39, 783-791.
Felsenstein J (1988) Phylogenies from molecular sequences: inference and
reliability. Annual Review of Genetics, 22, 521-565.
Fitzsimmons NN, Moritz C, Limpus CJ, Pope L, Prince R (1997) Geographic
structure of mitochondrial and nuclear gene polymorphisms in
Australian green turtle populations and male-biased gene flow.
Genetics, 147, 1843-1854.
Folmer O, Black M, Hoeh W, Lutz R, Vrijenhoek R (1994) DNA primers for
amplification of mitochondrial cytochrome c oxidase subunit I from
diverse metazoan invertebrates. Molecular Marine Biology and
Biotechnology, 3, 294-299.
70
Fu Y-X, Li WH (1993) Statistical tests of neutrality of mutations. Genetics,
133, 693-709.
Gopurenko D, Hughes JM, Keenan CP (1999) Mitochondrial DNA evidence
for rapid colonisation of the Indo-West Pacific by the mudcrab Scylla
serrata. Marine Biology, 134, 227-233.
Gopurenko D, Hughes JM (2002) Regional patterns of genetic structure
among Australian populations of the mud crab, Scylla Serrata
(Crustacea: Decapoda): evidence from mitochondrial DNA. Marine and
Freshwater Research, 53, 849-857.
Harris PT, Pattiaratchi CB, Keene JB, et al. (1996) Late Quartenary deltaic
and carbonate sedimentation in the Gulf of Papua foreland basin:
response to sea-level change. Journal of Sedimentary Research, 66, 801-819.
Johnson MS, Joll LM (1993) Genetic subdivision of the pearl oyster Pinctada
maxima (Jameson, 1901) (Mollusca: Pteridae) in Northern Australia.
Australian Journal of Marine and Freshwater Research, 44, 519-526.
Jones MR, Torgersen T (1988) Late Quartenary evolution of Lake
Carpentaria on the Australia-New Guinea continental shelf. Australian
Journal of Earth Sciences, 35, 313-324.
Keenan CP (1994) Recent evolution of population structure in Australian
barramundi, Lates calcarifer (Bloch): an example of isolation by
distance in one dimension. Australian Journal of Marine and Freshwater
Research, 45, 1123-1148.
Knowles LL, Maddison WP (2002) Statistical phylogeography. Molecular
Ecology, 11, 2623-2635.
Knowlton N, Weigt LA (1998) New dates and new rates for divergence
across the Isthmus of Panama. Proceedings of the Royal Society of
London B, 265, 2257-2263.
Macaranas JM, Mather PB, Hoeben P, Capra MF (1995) Assessment of
genetic variation in wild populations of the redclaw crayfish (Cherax
quadricarinatus, von Martens 1868) by means of allozyme and RAPD-
PCR markers. Marine and Freshwater Research, 46, 1217-1228.
71
Marko PB (2002) Fossil calibration of molecular clocks and the divergence
times of geminate species pairs separated by the Isthmus of Panama.
Molecular Biology and Evolution, 19, 2005-2021.
Masta SE, Laurent NM, Routman EJ (2003) Population genetic structure of
the toad Bufo woodhousii: an empirical assessment of the effects of
haplotype extinction on nested cladistic analysis. Molecular Ecology, 12, 1541-1554.
McGuigan K, Zhu D, Allen GR, Moritz C (2000) Phylogenetic relationships
and historical biogeography of melanotaeniid fishes in Australia and
New Guinea. Marine and Freshwater Research, 51, 713-723.
Mulley JC, Latter BDH (1981) Geographic differentiation of tropical Australian
penaeid prawn populations. Australian Journal of Marine and
Freshwater Research, 32, 897-906.
Norman JA, Moritz C, Limpus CJ (1994) Mitochondrial DNA control region
polymorphisms: genetic markers for ecological studies of marine turtles.
Molecular Ecology, 3, 363-373.
Ovenden JR, Lloyd J, Newman SJ, Keenan CP, Slater LS (2002) Spatial
genetic subdivision between northern Australian and southeast Asian
populations of Pristipomoides multidens: a tropical marine reef fish
species. Fisheries Research, 59, 57-69.
Posada D, Crandall KA (1998) MODELTEST: testing the model of DNA
substitution. Bioinformatics, 14, 817-818.
Posada D, Crandall KA, Templeton AR (2000) GeoDis: a program for the
cladistic nested analysis of the geographical distribution of genetic
haplotypes. Molecular Ecology, 9, 487-488.
Rogers AR (1995) Genetic evidence for a Pleistocene population explosion.
Evolution, 49, 608-615.
Rogers AR, Harpending H (1992) Population growth makes waves in the
distribution of pairwise genetic differences. Molecular Biology and
Evolution, 9, 552-569.
Rozas J, Sanchez-Delbarrio JC, Messeguer X, Rozas R (2003) DnaSP, DNA
polymorphism analyses by the coalescent and other methods.
Bioinformatics, 19, 2496-2497.
72
Sandifer PA, Hopkins JS, Smith TIJ (1975) Observations on salinity tolerance
and osmoregulation in laboratory-reared Macrobrachium rosenbergii
post-larvae (Crustacea: Caridea). Aquaculture, 6, 103-114.
Schneider S, Excoffier L (1999) Estimation of demographic parameters from
the distribution of pairwise differences when the mutation rates vary
among sites: Application to human mitochondrial DNA. Genetics, 152, 1079-1089.
Schneider SD, Roessli D, Excoffier L (2000) ARLEQUIN, Version 2.0: A
Software for Population Genetic Data Analysis. Genetics and Biometry
Laboratory, University of Geneva, Geneva, Switzerland.
Short J (2000) Systematics and biogeography of Australian Macrobrachium
(Crustacea: Decapoda: Palaemonidae) – with descriptions of other new
freshwater Decapoda. Ph.D. thesis, The University of Queensland,
Brisbane, Australia.
Slatkin M, Hudson RR (1991) Pairwise comparisons of mitochondrial DNA
sequences in stable and exponentially growing populations. Genetics,
129, 555-562.
Smart J (1977) Late Quartenary sea level changes, Gulf of Carpentaria,
Australia. Geology, 5, 755-759.
Sponer R, Roy MS (2002) Phylogeographic analysis of the brooding brittle
star Amphipholis squamate (Echinodermata) along the coast of New
Zealand reveals high cryptic genetic variation and cryptic dispersal
potential. Evolution, 56, 1954-1967.
Swofford DL (2002) PAUP*. Phylogenetic Analysis Using Parsimony (*and
Other Methods), Version 4. Sinauer Associates, Sunderland, MA.
Tajima F (1989) Statistical method for testing the neutral mutation hypothesis
by DNA polymorphism. Genetics, 123, 585-595.
Tamura K, Nei M (1993) Estimation of the number of nucleotide substitutions
in the control region of mitochondrial DNA in humans and chimpanzees.
Molecular Biology and Evolution, 10, 512-516.
Templeton AR (1998) Nested clade analyses of phylogeographic data:
testing hypotheses about gene flow and population history. Molecular
Ecology, 7, 381-397.
73
Templeton AR (2004) Statistical phylogeography: methods of evaluating and
minimizing inference errors. Molecular Ecology, 13, 789-809.
Templeton AR, Sing CF (1993) A cladistic analysis of phenotypic
associations with haplotypes inferred from restriction endonuclease
mapping. IV. Nested analyses with cladogram uncertainty and
recombination. Genetics, 134, 659-669.
Templeton AR, Routman E, Phillips C (1995) Separating population structure
from population history: a cladistic analysis of the geographical
distribution of mitochondrial DNA haplotypes in the tiger salamander,
Ambystoma tigrinum. Genetics, 140, 767-782.
Thompson JD, Gibson TJ, Plewniak F, Jeanmougin F, Higgens DG (1997)
The ClustalX windows interface: flexible strategies for multiple
sequence alignment aided by quality analysis tools. Nucleic Acids
Research, 24, 4876-4882.
Torgersen T, Hutchinson MF, Searle DE, Nix HA (1983) General bathymetry
of the Gulf of Carpentaria and the Quartenary physiography of Lake
Carpentaria. Palaeogeography, Palaeoclimatology, Palaeoecology, 41, 207-225.
Torgersen T, Jones MR, Stephens AW, Searle DE, Ullman WJ (1985) Late
Quartenary hydrological changes in the Gulf of Carpentaria. Nature,
313, 785-787.
Torgersen T, Luly J, De Deckker P et al. (1988) Late Quartenary
environments of the Carpentaria Basin, Australia. Palaeogeography,
Palaeoclimatology, Palaeoecology, 67, 245-261.
Voris HK (2000) Maps of Pleistocene sea levels in Southeast Asia:
shorelines, river systems and time durations. Journal of Biogeography,
27, 1153-1167.
Waters JM, Craw D, Youngson JH, Wallis GP (2001) Genes meet geology:
fish phylogeographic pattern reflects ancient, rather than modern,
drainage connections. Evolution, 55, 1844-1851.
Waters JM, Roy MS (2003) Marine biogeography of southern Australia:
phylogeographical structure in a temperate sea-star. Journal of
Biogeography, 30, 1787-1796.
74
Statement of Joint Authorship
Mark de Bruyn, Estu Nugroho, Md. Mokarrom Hossain, John C. Wilson and
Peter B. Mather (2004) Phylogeographic evidence for the existence of an
ancient biogeographic barrier: the Isthmus of Kra Seaway. Heredity, 94, 370-
378.
Mark de Bruyn (candidate) Designed and developed experimental protocol. Carried out field and
laboratory work, and analysed data. Wrote manuscript and acted as
corresponding author.
Estu Nugroho Carried out field work and contributed to the structure and editing of the
manuscript.
Md. Mokarrom Hossain Carried out field work and contributed to the structure and editing of the
manuscript.
John C. Wilson Co-supervised the study design and experimental protocols. Assisted in the
interpretation of data. Contributed to the structure and editing of the
manuscript.
Peter B. Mather Principal supervisor of the study design and experimental protocols. Assisted
in the interpretation of data. Contributed to the structure and editing of the
manuscript.
75
CHAPTER 4. Phylogeographic evidence for the existence of an ancient
biogeographic barrier: the Isthmus of Kra Seaway.
Mark de Bruyn1, Estu Nugroho2, Md. Mokarrom Hossain3, John C. Wilson1
and Peter B. Mather1
Affiliations: 1. School of Natural Resource Sciences, Queensland University of
Technology, GPO Box 2434, Brisbane, Queensland 4001, Australia
2. Research Institute for Freshwater Fisheries, Jakarta Selatan, Indonesia
3. Bangladesh Research Aquaculture Centre, Dhaka, 1212, Bangladesh
ABSTRACT Biogeographic boundaries are characterised by distinct faunal and floral
assemblages restricted on either side, but patterns among groups of taxa
often vary and may not be discrete. Historical biogeography as a
consequence, while providing crucial insights into the relationship between
biological diversity and earth history, has some limitations. Patterns of
intraspecific molecular variation, however, may show unambiguous evidence
for such historical divides, and can be used to test competing biogeographic
hypotheses (often based on the dispersal-vicariance debate). Here we utilise
this method to test the hypothesis that a major biogeographic transition zone
between the Sundaic and Indochinese biotas, located just north of the
Isthmus of Kra in SE Asia, is the result of Neogene marine transgressions
that breached the Isthmus in two locations for prolonged periods of time
(>one million year duration). Phylogeographic analyses of a freshwater
decapod crustacean, the giant freshwater prawn Macrobrachium rosenbergii,
strongly supports the historical existence of the more northerly postulated
seaway. Results presented here highlight the power of utilising intraspecific
molecular variation in testing biogeographic hypotheses.
Keywords: vicariance, introgression, nested clade analysis, SE Asia,
Isthmus of Kra, Macrobrachium rosenbergii
76
INTRODUCTION The biogeographic province of Sundaland (land on the Sunda Shelf south of
the Isthmus of Kra) was greatly affected by eustatic sea-level changes for
much of the Tertiary, including the well-documented flooding of the Sunda
Shelf (Hanebuth et al. 2000). The region is bordered to the east by what is
probably the most well known biogeographic boundary recognised today,
Wallace’s Line. A second but lesser-known biogeographic boundary occurs
at the transition zone between the Sundaic and Indochinese biotas (sensu
Woodruff 2003) in the vicinity of the Isthmus of Kra (Fig. 1), with distinct
assemblages of amphibians (Inger 1966; see review by Inger & Voris 2001),
reptiles (Inger & Voris 2001), birds (Hughes et al. 2003), mammals (Corbett &
Hill 1992), insects (Corbet 1941) and plants (Ridder-Numan 1998;
Denduangboripant & Cronk 2000) limited to varying degrees either side of
this barrier. Recently, it has been hypothesised that marine transgressions
may have produced this pattern (Woodruff 2003); specifically, that Miocene-
(24 - 23 Mya) and Pliocene-era (5.5 - 4.5 Mya) high sea-level stands resulted
in two seaways that dissected the Thai-Malay Peninsula (Fig. 1; Woodruff
2003), for durations in excess of one million years. This hypothesis is based
on an extensive review of both biological and geological evidence (Woodruff
2003), and received strong support specifically from past sea-level
highstands evident from the Vail global eustatic curve (Vail & Hardenbol
1979) and the oxygen isotope curve (see Woodruff 2003).
If seaways had divided the Thai-Malay Peninsula in the past creating
an archipelago for a significant period of time (>1 MY), this should be evident
in the intraspecific molecular ‘signatures’ of organisms sampled from either
side of this barrier, relative to their dispersal potential and the nature (width,
throughflow volume, etc.) of the seaway. Such studies on terrestrial (Hoffman
& Baker 2003; Zeh et al. 2003) and marine taxa (Knowlton et al. 1993;
Collins et al. 1996; Bermingham et al. 1997; Knowlton & Weigt 1998; Tringali
et al. 1999; Marko 2002 and others) from the Isthmus of Panama have
provided a wealth of information on the role that vicariance can play in
shaping genetic divergence among populations, and ultimately, in speciation
events among taxa. Woodruff (2003) identified the need for phylogeographic
77
Figure 1. Study region and relationships among M. rosenbergii COI mtDNA
haplotypes. Solid lines indicate approximate width of proposed Isthmus of
Kra Seaways (Woodruff 2003). Sampling sites labelled a-k (see Table 1 for
details). The size of the circles and rectangle indicate relative frequencies of
the haplotypes (Table 2). The single hatched circle in the southern clade
indicates a ‘southern haplotype’ collected from a northern site (Kraburi River;
site c).
(sensu Avise et al. 1987) or phylogenetic studies of ‘appropriate’ taxa at the
Isthmus of Kra interface to further investigate causal mechanisms leading to
the biogeographic patterns observed. To date, no such studies have been
carried out.
Macrobrachium rosenbergii, the giant freshwater prawn, is an ideal
model species for investigating these mechanisms. Molecular analyses of
freshwater dependent taxa should prove particularly useful in this regard, as
78
such organisms are likely to have remained effectively isolated in discrete
freshwater drainages after the seaways subsided (unlike amphibians,
mammals, birds, etc.), limiting their opportunity for range expansion or
secondary contact that could make interpretation of the data difficult. M.
rosenbergii has a broad distribution in the region, and our previous study (de
Bruyn et al. 2004) indicated that stocks found either side of Huxley’s
extension of Wallace’s Line may have been strongly influenced by the
historical geography of the region. Here, we utilise intraspecific mitochondrial
DNA (mtDNA) variation in the western form (sensu de Bruyn et al. 2004) of
the giant freshwater prawn, Macrobrachium rosenbergii, to test for evidence
for ancient seaways that are believed to have dissected the Thai-Malay
Peninsula. Furthermore, we explore the utility of this intraspecific approach
(i.e. phylogeography sensu Avise et al. 1987) for testing biogeographic
hypotheses.
79
METHODS (a) Taxa, sample collection and molecular analyses
M. rosenbergii is an obligate freshwater crustacean as an adult but requires
brackishwater for larval survival and development. Results of salinity-
tolerance experiments on M. rosenbergii suggest that both adults and
postlarvae can survive in brackish conditions (up to 12ppt) for extended
periods of time without any apparent detrimental effects. They are unable,
however, to tolerate full marine conditions for more than a week as adults
and 20 days as postlarvae (Sandifer et al. 1975). Prawns used in this study
were collected from localities indicated in Fig. 1 and Table 1, and were
identified using Short’s Macrobrachium key (1998). As M. rosenbergii are a
commercially-important species (FAO 2000), a factor that constrained
selection of sampling sites for this study (particularly for sites adjacent to the
postulated seaways) was the need for sites to be free of translocated stock to
eliminate the potential that prawns with non-native genotypes were included
in the analysis (Thai Freshwater Fisheries; N. Pongthana, pers. comm.). This
resulted in an unbalanced sampling design either side of the postulated
seaways i.e. more ‘southern’ than ‘northern’ sites. This lack of balance does
not diminish the findings of this study, as it has been demonstrated that
sampling of at least 90 individuals (from uncontaminated wild stocks
collected from either side of the proposed seaways), provides the statistical
power to detect with 95% probability at least one copy of all haplotypes
occurring at a frequency of 1% (Schwager et al. 1993).
Tissue samples (muscle or pleopod) were stored in 70% ethanol until
required for molecular analyses. For DNA extraction, a small piece of tissue
was first rehydrated for 30 minutes in 1ml GTE buffer (100mM glycine, 10mM
Tris, 1mM EDTA). Tissue samples were then incubated overnight at 55ºC in
500µl extraction buffer (100mM NaCL, 50mM Tris, 10mM EDTA, 0.5% SDS)
containing 20µl of 10µg/µl Proteinase K (Sigma Co.). Total genomic DNA
was extracted using standard phenol: chloroform extraction methods, and
collected by ethanol precipitation. Amplification of a fragment of the mtDNA
cytochrome c oxidase subunit I (COI) gene was carried out using primers
LCO1490 and HCO2198 (Folmer et al. 1994).
80
Table 1. Collection location, site ID and geographical coordinates
for samples used in this study.
collection location site ID
geographical position
Raimangal R, SW Bangladesh a 22°00´N 89°20´E Meghna R, SE Bangladesh b 22°29´N 91°25´E Kraburi R, SW Thailand c 09°58´N 98°37´E Tapi R, SE Thailand d 09°02´N 99°10´E Setiu R, NE Peninsula Malaysia
e 05°20´N 103°07´E
Semenyih R, Peninsula Malaysia
f 03°08´N 101°42´E
Bahand R, Sth Peninsula Malaysia
g 02°12´N 102°15´E
Dongnai R, Vietnam h 10°45´N 106°45´E Mekong R, Vietnam i 10°02´N 105°50´E Musi R, Sth Sumatra j 01°35´S 102°30´E Barito R, SE Kalimantan k 03°15´S 114°38´E
PCR conditions were as follows: each 50µl amplification reaction consisted of
400 ng of template DNA, 5 µl of 10X buffer containing MgCl2 (Roche), an
additional 2µl of 25mM MgCl2 (Roche), 0.5 units of Taq polymerase (Roche),
0.8 µl of each primer (10 µM final conc.), 0.2 mM of each dNTP, and 38.95 µl
autoclaved ddH2O. Samples that proved difficult to PCR were amplified using
READY-TO-GO®BEADS (Pharmacia Biotech). Thermal cycling was
performed on a PTC-100 thermocycler (MJ Research Inc.) under the
following conditions: 3 min denaturation at 94ºC, followed by 30 cycles of 30
sec at 94ºC, 30 sec at 55ºC, 30 sec at 72ºC, and a final 10 min extension at
72ºC, before cooling to 4ºC for 10 mins. Negative controls were included in
all PCR runs. PCR amplifications were confirmed with agarose gel
electrophoresis on a 1% gel. Screening for intrapopulation variation was
carried out using Temperature Gradient Gel Electrophoresis (TGGE)
combined with Outgroup Heteroduplex Analysis (OHA) (Campbell et al.
1995). This method proved to be sensitive enough to consistently distinguish
among haplotypes that varied by a single base pair (bp). All individuals were
analysed by way of TGGE/OHA, and 2-3 individuals exhibiting identical
banding patterns from each population were sequenced to confirm that they
shared identical haplotypes. PCR products from haplotypes identified as
unique using TGGE/OHA were purified using a Qiagen QIAquick PCR
81
purification kit. DNA sequencing of 602 bp of the COI gene was conducted
on an ABI 3730 automated sequencer at the Australian Genome Research
Facility at the University of Queensland, Brisbane, Australia. Both strands of
the PCR product were completely sequenced.
(b) Data analysis
Sequences were aligned in ClustalX (Thompson et al. 1997) with parameters
set to default. Initial data exploration and Kimura 2-parameter (Kimura 1980)
sequence divergences were carried out in MEGA ver. 2.1 (Kumar et al. 2001).
Haplotype (h) and nucleotide diversity (π) indices and Tajima’s D test (Tajima
1989) for neutrality were performed in DnaSP (Rozas et al. 2003). A
bootstrapped (1000 pseudoreplicates; Felsenstein 1988) neighbour-joining
(Saitou & Nei 1987) phylogenetic tree was estimated in MEGA to identify
levels of statistical support for discrete clades identified. An M. rosenbergii
individual sampled from Bali was identified in an unpublished (de Bruyn,
unpublished data) 16S mtDNA phylogeny as an appropriate outgroup to root
the tree. To test for adherence to a clock-like evolution of the mtDNA
sequences, a log-likelihood ratio test was carried out in PAUP* 4.0b10
(Swofford 2002) that compared trees generated under the assumption of a
molecular clock, to trees unconstrained by any such assumption (Felsenstein
1988). The timing of cladogenesis identified in the phylogeny was then
inferred by way of molecular clock approximation.
Geographical associations among haplotypes were tested using
nested clade analysis (NCA; Templeton 1998). A haplotype cladogram was
generated in TCS (Clement et al. 2000), and then manually converted into a
nested design using the nesting rules outlined in Templeton & Sing (1993),
Crandall (1996) and Templeton (1998). This nested design was then
analysed in GeoDis ver. 2.0 (Posada et al. 2000) with the null hypothesis of
no geographic association among haplotypes. We made a qualitative
decision to use geographic coordinates to determine distances among sites,
as opposed to stream distance (Fetzner & Crandall 2003), as most sampling
sites were restricted to geographically isolated drainage basins. Templeton’s
(2004) latest inference key was used to infer processes involved in any
statistically significant associations observed. It has recently been suggested
that some NCA inferences may be flawed, and should therefore be supported
82
by the use of alternative analytical techniques (e.g. Alexandrino et al. 2002;
Masta et al. 2003; Templeton 2004). We therefore applied the
coalescent/maximum-likelihood approach implemented in FLUCTUATE ver.
1.4 (Kuhner et al. 1998) to determine if there was evidence for population
expansion events in clades identified with NCA. Specifically, the exponential
growth or decline of the population can be inferred by positive or negative
values of the exponential growth parameter g. An exploratory search strategy
implementing 20 short chains of 1000 steps each, and 5 long chains of
20000 steps were used to determine parameters for the production runs.
Production runs were implemented using 20 short chains of 8000 steps each,
and 10 long chains of 50000 steps. The program was run multiple times to
ensure concordance of parameter estimates.
83
RESULTS In total, 404 M. rosenbergii individuals (excluding the outgroup) were
analysed for variation in a 602bp fragment of the mtDNA COI gene using
TGGE/OHA analyses. Representatives (2-3) from each population that
displayed identical banding patterns were sequenced to confirm they shared
identical haplotypes, which was confirmed in all cases. This resulted in the
identification of 35 putative haplotypes (GenBank accession numbers:
AY554293-AY554327), defined by 54 segregating sites. No significant
deviations from neutrality were identified in our dataset (Tajima’s D = -1.284,
P > 0.10). Nucleotide substitutions favoured transitions over transversions,
yielding a transition/transversion ratio of 4.16. The neighbour-joining
phylogeny strongly supported the existence of two widely distributed
monophyletic clades situated approximately 120km apart on the Isthmus of
Kra (bootstrap values: 91% for southern clade, 94% for northern clade).
Similar support was observed in the 95% probability cladogram (Fig. 1 & 2),
with populations sampled from sites north and south of the more northerly
seaway restricted to two distinct monophyletic clades, except for site c
(Kraburi River, SW Thailand) situated just north of the northern seaway,
which is characterised by individuals exhibiting both ‘northern’ and ‘southern’
haplotypes (Fig. 1 & Table 2). NCA identified an allopatric fragmentation
event followed by range expansion at the highest nesting level, i.e. between
northern and southern clades either side of the hypothesised northern
seaway (Table 3). Subsequently, we performed Templeton’s supplementary
test for secondary contact (Templeton 2001), which confirmed this
hypothesis.
Within the northern clade, NCA suggested contiguous range
expansion at both ancestral and younger clade levels, i.e. clades 3-2 and 1-5
respectively, and restricted gene flow with isolation-by-distance at the 1-step
level for clade 1-3 (Table 3). Within the southern clade, restricted gene flow
with some long distance dispersal was suggested at both ancestral and
younger clade levels, i.e. clades 2-7 and 1-9 respectively, while at the 1-step
level contiguous range expansion (clade 1-14) and restricted gene flow with
isolation-by-distance (clade 1-15) were also inferred (Table 3).
Figure 2. 95% probability cladogram estimated from the M. rosenbergii COI data. Small black circles indicate inferred missing
haplotypes not observed in the dataset. Haplotype 29 was the haplotype with the highest frequency (n=134) and the highest root
probability (Castelloe & Templeton 1994). See Fig. 1 and Table 2 for haplotype frequencies.
85
FLUCTUATE analyses of maximum likelihood estimates of g
supported the NCA inferences of expansion events in clades 3-2 (g = 235.1 ±
2 s.d. 67.3) and 1-5 (g = 303.3 ± 2 s.d. 64.0). Similarly, concordant patterns
in FLUCTUATE and NCA suggested no evidence for growth in clades 2-7 (g
= -26.1 ± 2 s.d. 45.6) and 1-9 (g = -160.9 ± 2 s.d. 76.2). Accurate testing of
clades 1-3, 1-14 and 1-15 were precluded by the star-like structure of these
clades. Such patterns result in equally high values of Θ and g, which cause
the program to fluctuate wildly on the likelihood surface until estimates
become huge and the program “overflows” (Kuhner 2003). Implementing the
analyses with more steps in each chain, and more chains (Kuhner 2003) did
not alter this outcome.
A fairly low level of divergence was evident within clades (Table 2; Fig.
2), particularly taking into account the considerable geographic distances
among sites e.g. Bangladesh to SW Thailand (~700km). Kimura 2-parameter
sequence divergences ranged from 0.002 to 0.015 within clades to 0.019 to
0.031 between the two clades. Genetic diversity measures were similar in the
two clades: northern clade (h = 0.49, π = 0.00619), southern clade (h = 0.51,
π = 0.00593). A log-likelihood ratio test could not reject the hypothesis that
lineages were evolving according to a clock-like model of evolution (-ln L =
1261.43 with molecular clock enforced vs. -ln L = 1247.17 without molecular
clock enforced, χ2 = 47.4, d.f. = 33, P > 0.10). A COI molecular clock rate of
1.4 %/Myr (Knowlton & Weigt, 1998) based on the smallest sequence
divergence observed among 15 pairs of “geminate” snapping shrimp taxa,
presumably separated by the closure of the Isthmus of Panama seaway, is
commonly used as a calibration point for estimating divergence times in
phylogeographic studies. Recent studies, however, warn against taking these
estimates at face-value, due to a number of factors known to bias such
estimates (see Marko 2002 and references therein for discussion). Indeed,
Knowlton & Weigt’s (1993) earlier COI molecular clock estimates were found
to be erroneous (Knowlton & Weigt 1998). A further complication is the
recent finding that some so-called “geminate” pairs may not be each other’s
closest living relatives, and their divergence may in fact not be related to the
closure of the Panamanian seaway (Craig et al. 2004). It has therefore been
Table 2. Site ID indicating haplotypes identified at each location (absolute frequencies) and sample size (n).
site 1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 n
a 4 2 12 1 1 2 10 32
b 3 16 1 1 11 2 34
c 1 2 1 2 2 2 1 5 1 26 43
d 1 39 40
e 1 14 15
f 46 46
g 1 1 40 42
h 17 1 1 29 1 49
i 1 14 1 2 26 1 45
j 1 1 21 23
k 27 1 8 36
87
suggested that calibrations based on the fossil record may be more
appropriate, although the lack of a suitable fossil record for shrimp/prawns
make this approach problematic. Nonetheless, we approximated a rough
estimate of divergence time between the northern and southern clades based
on Knowlton & Weigt’s (1998) mtDNA COI molecular clock (1.4 %/Myr), and
a single crustacean mtDNA COI calibration based on the fossil record (0.13 -
0.55 %/Myr; Schön et al. 1998) in an attempt to minimize error in our
inferences. The geological calibration suggested a minimum divergence time
in the region of 2.2 - 1.3 Mya, while the fossil record calibration provides a
much more conservative estimate of 14.1 - 3.3 Mya.
88
Table 3. Results of nested clade analysis showing clade (Dc), nested (Dn)
and interior to tip clade (I-T) distances. Only clades with significant
permutational χ2 probabilities for geographic structure have been included. nesting haplotype/clade no. location Dc Dn χ2 - P inference key
conclusion
1-3 4 tip 0S 132.88 0.0310 RG-IBD 5 tip 0 132.88 6 interior 117.24 154.96 I-T 117.24L 22.08 1-5 8 tip 0 288.47 0.0120 CRE 9 tip 0 1385.66L 10 tip 0 1385.66 11 tip 681.28 594.75 12 interior 218.63S 322.25S I-T -159.85 -502.11S 1-9 18 tip 0S 1184.90 0.0000 RG-LDD 19 tip 0 636.90 20 tip 0 683.23 21 tip 0S 1138.68L 22 interior 306.90S 685.03S I-T 306.90L -458.94S 1-14 24 tip 0 944.60 0.0000 CRE 25 tip 0 524.86 26 tip 0 779.94 27 tip 0 944.60 28 tip 0 246.65 29 interior 369.59S 377.17S I-T 369.59 -353.71S 1-15 33 tip 0S 285.91S 0.0170 RG-IBD 34 interior 0 1497.21 35 tip 0 1482.21 I-T 0L 1078.38 2-7 1-11 tip 0S 654.36L 0.0000 RG-LDD 1-12 tip 0S 639.92L 1-13 tip 0S 59.15S 1-14 interior 389.62S 475.92 1-15 tip 479.72 1425.20L I-T 337.47L -165.53S 3-2 2-3 tip 641.73 970.28L 0.0040 CRE 2-4 interior 465.20S 571.97S I-T -176.53 -398.31S 3-3 2-7 tip 496.40S 531.25S 0.0000 no I/T clades 2-8 tip 972.88L 1003.07L I-T n/a n/a 4-1 3-1 tip 136.44S 1937.99L 0.0000 PF-RE-SC 3-2 interior 646.58S 1532.68L 3-3 tip 645.06S 732.39S I-T 508.80L -1111.83S Footnote: Significantly small or large values for Dc, Dn and I-T (Dc and Dn) are indicated by
superscript ‘S’ and ‘L’ respectively. Inference key conclusions using Templeton’s updated
key for NCA (Templeton 2004). Conclusions as follows: RG-IBD, restricted gene flow with
isolation by distance; CRE, contiguous range expansion; RG-LDD, restricted gene flow with
some long distance dispersal; PF-RE-SC, past fragmentation followed by range expansion
and secondary contact.
89
DISCUSSION If dispersal (gene flow) of freshwater taxa has been restricted in the past by a
significant geographic barrier that lead to cladogenesis (vicariance) among
populations situated north and south of the proposed seaways, a molecular
signature of allopatric fragmentation between these populations would be
expected. Moreover, if contemporary gene flow has resulted in secondary
contact between northern and southern populations since subsidence of the
marine barriers, this should be evident in two monophyletic clades that
overlap in their geographic distribution, indicating patterns of secondary
intergradation. Results presented here indicate a sharp genetic break
between M. rosenbergii populations situated on the Isthmus of Kra. Our
analyses support the hypothesis that an ancient marine seaway divided the
Thai-Malay Peninsula, resulting in a vicariant event that restricted gene flow
among populations either side of this divide. All populations (except site c)
north and south of the northern proposed seaway, separated by a distance of
only 120km, belong to two widely distributed monophyletic mtDNA clades
that were apparently restricted to either side of this seaway (Fig. 1 & 2). If the
genetic break evident in our data is indeed a result of the Pliocene-era
seaway (5.5 - 4.5 Mya; Woodruff 2003), and not a later unidentified rise in
sea-level, the results of our molecular clock analyses would suggest that
either: i.) rates of COI evolution in M. rosenbergii are significantly slower than
in snapping shrimp, or ii.) the mtDNA COI clock rate calibrated to the closure
of the Panamanian seaway (Knowlton & Weigt 1998) is too great. No matter
the case, our results suggest that the use of such calibrations should be
applied cautiously when a good predictive temporal framework (e.g. used in
this study) is not available.
The Kraburi River population (site c) just north of the seaway was
unique because it possessed both ‘northern’ haplotypes and a single
‘southern’ haplotype, indicating a recent northward expansion of the southern
clade into this northern site leading to admixture of the two groups (Fig. 1).
This molecular signal of a recent range expansion event into the Kraburi
River (site c) is indicated by the occurrence of 9 ‘northern’ haplotypes found
in low frequencies (4 are singletons; see Table 2), and the presence of a
single southern haplotype at a high frequency (n = 26; haplotype 21),
90
suggesting a recent founder event followed by local self-seeding (Mayr 1942).
This scenario was strongly supported by the NCA (Table 3). There is no
explicit support in our data for the second and more southerly seaway,
however this may be a consequence of the lesser width of this seaway (Fig.
1) and the dispersal capabilities of the organism in question.
Because populations that are today geographically isolated from each
other by a marine environment share haplotypes over distances of hundreds
of kilometres, the question arises as to what mechanisms are involved in
maintaining these relationships. In a previous phylogenetic study conducted
at a broader spatial scale (de Bruyn et al. 2004), it was suggested that
Pleistocene drainage basins that linked sites on the Sunda Shelf that are
today geographically isolated, may have acted as conduits for gene-flow
among some populations of M. rosenbergii. Similar studies on freshwater fish
indicate the important role that ancient drainage basins have played in
shaping the distribution of molecular variation in freshwater organisms
(Hurwood & Hughes 1998; Waters et al. 2001; Kotlik et al. 2004 and others).
This ancient drainage basin hypothesis goes some way to describing the
close relationship among populations observed here, particularly for sites d, e,
f, g & h (i.e. southern Thai-Malay Peninsula & Sth. Vietnam). These sites are
likely to have been linked by freshwater via the Siam or Malacca Straits River
Systems that existed during the Pleistocene (Voris 2000; see de Bruyn et al.
2004 for discussion). NCA provides support for this scenario, inferring a fairly
recent (in evolutionary terms; 1-step clade level) contiguous range expansion
among all southern clade sites except for SE Kalimantan. The Kalimantan
population (site k) appears to have been isolated historically for an extended
period of time, as there is virtually no sharing of haplotypes with any other
southern sites (Table 2). Interestingly, SE Kalimantan is the population
involved in both recent and ancestral inferred events utilising NCA; restricted
gene flow with some long distance dispersal, and restricted gene flow with
isolation-by-distance. This pattern warrants further investigation.
The close genetic relationship between the Sumatran (site j) and
Mekong River (site i) populations, and all other populations in the southern
clade, however, cannot be fully explained by Pleistocene drainage basins.
Along similar lines, the close genetic relationship between northern clade
91
populations from Bangladesh (sites a & b) and Thailand (site c) cannot be
explained by inferring past gene-flow via freshwater systems, as these
geographically distant sites have no history of a freshwater connection.
Freshwater plumes from the extensive Ganges system may explain gene
flow between SE and SW Bangladesh, but is unlikely to explain long distance
gene flow between Bangladesh and Thailand (Dai & Trenberth 2002), some
700km distant. NCA again identified biologically feasible processes that may
have resulted in the population genetic structuring observed in the northern
clade, i.e. historical contiguous range expansion between SW Thailand and
Bangladesh, and recent contiguous range expansion accompanied by
restricted gene-flow with isolation-by-distance among all northern sites. At
this stage, this hypothesis must remain mere conjecture (while supported by
the NCA) as no field work could be undertaken in Myanmar so the isolation-
by-distance effect observed in the northern clade may simply result from
inadequate sampling in this region.
Previous work on freshwater organisms (Waters & Burridge 1999;
Waters et al. 2000; McDowall 2002) has highlighted the largely unrecognised
role marine dispersal can play in the evolution of some ‘freshwater’ aquatic
taxa. As M. rosenbergii are estuarine dependent, and all life-stages tolerate
full marine conditions to varying degrees, a stepping-stone model of gene
flow (Kimura & Weiss 1964) via the marine environment between adjacent
estuaries, accompanied by occasional long-distance marine dispersal during
favourable conditions may best explain the observed population structure of
this species. To clarify the role of marine dispersal, drainage basin maps of
Thailand were examined to identify potential routes for southern to northern
clade colonisation, as observed at the Kraburi River site (site c). No
indication of a possible freshwater colonisation route between southern and
northern sites was found, suggesting a marine dispersal route. In addition, if
dispersal was via freshwater, and not a ‘rare’ marine dispersal event, we
might expect to find evidence for bi-directional movement of haplotypes, i.e.
south-north and vice-versa, or at the very least presence of more than a
single southern haplotype at the Kraburi River site. Instead we observed
evidence for uni-directional (south to north) movement, and fixation of a
single derived (tip) southern haplotype at this site. A future analysis of
92
populations sampled from a number of adjacent estuaries will be required to
determine the role of marine dispersal in this species.
The results presented here provide the first molecular support for the
existence of an ancient biogeographic barrier, the Isthmus of Kra Seaway.
Molecular evidence indicates that this seaway was extensive enough to
restrict gene flow in M. rosenbergii, a ‘freshwater’ crustacean that may be
capable of some marine dispersal. Since the time when the seaway subsided,
contemporary gene flow appears to have occurred across this historical
barrier, highlighting the mutually compatible roles that both vicariance and
dispersal have played in the evolutionary history of M. rosenbergii. Our
results emphasise the importance of choosing an appropriate model
organism, and the power provided by a phylogeographic approach, in testing
historical biogeographic hypotheses.
93
ACKNOWLEDGMENTS We thank Kriket Broadhurst, Daisy Wowor, Peter Ng, Nuanmanee
Pongthana and colleagues, Nguyen Van Hao, Tran Ngoc Hai, Pek Yee Tang,
Selvaraj Oyyan and Abol Munafi Ambok Bolong for their help in acquiring
specimens for this study. Jane Hughes, David Hurwood, Andrew Baker and
the EGGers provided helpful discussions on the manuscript. MdB
acknowledges support from an Australian Postgraduate Award, and research
grants from the Australian Geographic Society, the Ecological Society of
Australia and the Linnean Society of New South Wales. PBM acknowledges
support from an ACIAR small-project grant FIS/2002/083 and assistance
from regional fisheries agencies.
94
REFERENCES Alexandrino J, Arntzen JW, Ferrand N (2002). Nested clade analysis and the
genetic evidence for population expansion in the phylogeography of the
golden-striped salamander, Chioglossa lusitanica (Amphibia: Urodela).
Heredity 88: 66-74.
Avise JC, Arnold J, Ball RM, Bermingham E, Lamb T, Neigel JE, Reeb CA,
Saunders NC (1987). Intraspecific phylogeography: the mitochondrial
DNA bridge between population genetics and systematics. Ann Rev
Ecol Syst 18: 489-522.
Bermingham E, McCafferty SS, Martin A, Kocher TD, Stepien CA (Eds.)
(1997). Fish biogeography and molecular clocks: perspectives from the
Panamanian Isthmus. In: Molecular Systematics of Fishes. Academic
Press: San Diego, London, etc. pp 113-128.
Campbell NJH, Harriss FC, Elphinstone MS, Baverstock PR (1995).
Outgroup heteroduplex analysis using temperature gradient gel
electrophoresis: high resolution, large scale, screening of DNA variation
in the mitochondrial control region. Mol Ecol 7: 407-418.
Castelloe J, Templeton AR (1994). Root probabilities for intraspecific gene
trees under neutral coalescent theory. Mol Phyl Evol 3: 102-113.
Clement M, Posada D, Crandall KA (2000). TCS: a computer program to
estimate gene genealogies. Mol Ecol 9: 1657-1659.
Collins LS, Budd AF, Coates AG (1996). Earliest evolution associated with
closure of the Tropical American Seaway. Proc Natl Acad Sci USA 93: 6069-6072.
Corbet AS (1941). The distribution of butterflies in the Malay Peninsula. Proc
R Entom Soc Lond A 16: 101-116.
Corbett GB, Hill JE (1992). The Mammals of the Indomalayan Region: a
Systematic Review. Oxford University Press: Oxford, UK.
Craig MT, Hastings PA, Pondella DJ (2004). Speciation in the Central
American Seaway: The importance of taxon sampling in the
identification of geminate species pairs. Jnl Biogeog 31: 1085-1091.
Crandall KA (1996). Multiple interspecies transmissions of human and simian
T-cell leukemia/lymphoma virus type I sequences. Mol Biol Evol 13: 115-131.
95
Dai A, Trenberth KE (2002). Estimates of freshwater discharge from
continents: Latitudinal and seasonal variations. Jnl Hydrometeorol 3: 660–687.
de Bruyn M, Wilson JC, Mather PB (2004). Huxley’s Line demarcates
extensive genetic divergence between eastern and western forms of the
giant freshwater prawn, Macrobrachium rosenbergii. Mol Phyl Evol 30: 251-257.
Denduangboripant J, Cronk QCB (2000). High intraindividual variation in
internal transcribed spacer sequences in Aeschynanthus
(Gesneriaceae): implications for phylogenetics. Proc R Soc Lond B 267: 1407-1415.
FAO (Food and Agriculture Organisation of the United Nations) (2000).
Aquaculture production statistics 1989-1998. FAO Fisheries Circular
815 (Rev 12). FAO: Rome.
Felsenstein J (1988). Phylogenies from molecular sequences: inference and
reliability. Ann Rev Genetics 22: 521-565.
Fetzner JW Jr., Crandall KA (2003). Linear habitats and the nested clade
analysis: an empirical evaluation of geographic versus river distances
using an Ozark crayfish (Decapoda: Cambaridae). Evol 57: 2101-2118.
Folmer O, Black M, Hoeh W, Lutz R, Vrijenhoek R (1994). DNA primers for
amplification of mitochondrial cytochrome c oxidase subunit I from
diverse metazoan invertebrates. Mol Mar Biol Biotech 3: 294-299.
Hanebuth T, Stattegger K, Grootes PM (2000). Rapid flooding of the Sunda
Shelf: a late-glacial sea-level record. Science 288: 1033-1035.
Hoffman FG, Baker RJ (2003). Comparative phylogeography of short-tailed
bats (Carollia: Phyllostomidae). Mol Ecol 12: 3403-3414.
Hughes JB, Round PD, Woodruff DS (2003). The Indochinese-Sundaic
faunal transition at the Isthmus of Kra: an analysis of resident forest bird
species distributions. Jnl Biogeog 30: 569-580.
Hurwood DA, Hughes JM (1998). Phylogeography of the freshwater fish,
Mogurnda adspersa, in streams of northeastern Queensland, Australia:
evidence for altered drainage patterns. Mol Ecol 7: 1507-1517.
Inger RF (1966). The systematics and zoogeography of the amphibia of
Borneo. Field Zool 52: 1-402.
96
Inger RF, Voris HK (2001). The biogeographical relations of the frogs and
snakes of Sundaland. Jnl Biogeog 28: 863-891.
Kimura M (1980). A simple method for estimating evolutionary rate of base
substitutions through comparative studies of nucleotide sequences. Jnl
Mol Evol 16: 111-120.
Kimura M, Weiss GH (1964). The stepping stone model of population
structure and the decrease of genetic correlation with distance.
Genetics 49: 561-576.
Knowlton N, Weigt LA, Solorzano LA, Mills DK, Bermingham E (1993).
Divergence in proteins, mitochondrial DNA, and reproductive
compatibility across the Isthmus of Panama. Science 260: 1629-1632.
Knowlton N, Weigt LA (1998). New dates and new rates for divergence
across the Isthmus of Panama. Proc R Soc Lond B 265: 2257-2263.
Kotlik P, Bogutskaya NG, Ekmekci FG (2004). Circum Black Sea
phylogeography of Barbus freshwater fishes: divergence in the Pontic
glacial refugium. Mol Ecol 13: 87-96.
Kuhner MK, Yamato J, Felsenstein J (1998). Maximum likelihood estimation
of population growth rates based on the coalescent. Genetics 149: 429-
434.
Kuhner MK (2003). LAMARC: Estimating population genetic parameters from
molecular data. In: Salemi M, Vandamme A (eds). The Phylogenetic
Handbook: a Practical Approach to DNA and Protein Phylogeny,
Cambridge University Press: Cambridge. pp 379-399.
Kumar S, Tamura K, Jakobsen IB, Nei M (2001). MEGA2: Molecular
Evolutionary Genetics Analysis Software. Arizona State Univ: Tempe,
Arizona, USA.
Marko PB (2002). Fossil calibration of molecular clocks and the divergence
times of geminate species pairs separated by the Isthmus of Panama.
Mol Biol Evol 19: 2005-2021.
Masta SE, Laurent NM, Routman EJ (2003). Population genetic structure of
the toad Bufo woodhousii: an empirical assessment of the effects of
haplotype extinction on nested cladistic analysis. Mol Ecol 12: 1541-
1554.
97
Mayr E (1942). Systematics and the Origin of Species. Columbia University
Press: New York, USA.
McDowall RM (2002). Accumulating evidence for a dispersal biogeography of
southern cool temperate freshwater fishes. Jnl Biogeog 29: 207-219.
Posada D, Crandall KA, Templeton AR (2000). GeoDis: a program for the
cladistic nested analysis of the geographical distribution of genetic
haplotypes. Mol Ecol 9: 487-488.
Ridder-Numan JWA (1998). Historical biogeography of Spatholobus
(Leguminosae-Papillionoideae) and allies in SE Asia. In: Hall R,
Holloway JD (eds) Biogeography and Geological Evolution of Southeast
Asia. Backhuys: Leiden, Netherlands. pp. 259-277.
Rozas J, Sanchez-DelBarrio JC, Messueger X, Rozas R (2003). DnaSp,
DNA polymorphism analyses by the coalescent and other methods.
Bioinformatics 19: 2496-2497.
Saitou N, Nei M (1987). The neighbour-joining method: a new method for
reconstructing phylogenetic trees. Mol Biol Evol 4: 406-426.
Sandifer PA, Hopkins JS, Smith TIJ (1975). Observations on salinity
tolerance and osmoregulation in laboratory-reared Macrobrachium
rosenbergii post-larvae (Crustacea: Caridea). Aquaculture 6: 103-114.
Schön I, Butlin RK, Griffiths HI, Martens K (1998). Slow molecular evolution
in an ancient asexual ostracod. Proc R Soc Lond B 265: 235-242.
Schwager SJ, Mutschler MA, Federer WT, Scully BT (1993). The effect of
linkage on sample size determination for multiple trait selection. Theor
Appl Genet 86: 964-974.
Short J (1998). Pictorial key to Australian Macrobrachium. Queensland
Museum Publication, Brisbane, Australia.
Swofford DL (2002). PAUP*. Phylogenetic Analysis Using Parsimony (*and
Other Methods), Version 4. Sinauer Associates, Sunderland, MA.
Tajima F (1989). Statistical method for testing the neutral mutation
hypothesis by DNA polymorphism. Genetics 123: 585-595.
Templeton AR (1998). Nested clade analyses of phylogeographic data:
testing hypotheses about gene flow and population history. Mol Ecol 7: 381-397.
98
Templeton AR (2001). Using phylogeographic analyses of gene trees to test
species status and processes. Mol Ecol 10: 779-791.
Templeton AR (2004). Statistical phylogeography: methods of evaluating and
minimizing inference errors. Mol Ecol 13: 789-810.
Templeton AR, Sing CF (1993). A cladistic analysis of phenotypic
associations with haplotypes inferred from restriction endonuclease
mapping. IV. Nested analyses with cladogram uncertainty and
recombination. Genetics 134: 659-669.
Thompson JD, Gibson TJ, Plewniak F, Jeanmougin F, Higgens DG (1997).
The ClustalX windows interface: flexible strategies for multiple
sequence alignment aided by quality analysis tools. Nucl Acids Res 24: 4876-4882.
Tringali MD, Bert TM, Seyoum S, Bermingham E, Bartolacci D (1999).
Molecular phylogenetics and ecological diversification of the
transisthmian fish genus Centropomus (Perciformes: Centropomidae).
Mol Phyl Evol 13: 193-207.
Vail PR, Hardenbol J (1979). Sea-level changes during the tertiary. Oceanus
22: 71-79.
Voris HK (2000). Maps of Pleistocene sea levels in Southeast Asia:
shorelines, river systems and time durations. J Biogeog 27: 1153-1167.
Waters JM, Burridge CP (1999). Extreme intraspecific mitochondrial DNA
sequence divergence in Galaxias maculatus (Osteichthys: Galaxidae),
one of the world’s most widespread freshwater fish. Mol Phyl Evol 11: 1-12.
Waters JM, Dijkstra LH, Wallis GP (2000). Biogeography of a southern
hemisphere freshwater fish: how important is marine dispersal? Mol
Ecol 9: 1815-1821.
Waters JM, Craw D, Youngson JH, Wallis GP (2001). Genes meet geology:
fish phylogeographic pattern reflects ancient, rather than modern,
drainage connections. Evol 55: 1844-1851.
Woodruff DS (2003). Neogene marine transgressions, palaeogeography and
biogeographic transitions on the Thai-Malay Peninsula. Jnl Biogeog 30: 551-567.
99
Zeh A, Zeh DW, Bonilla MM (2003). Phylogeography of the harlequin beetle-
riding pseudoscorpion and the rise of the Isthmus of Panama. Mol Ecol
12: 2759-2769.
100
Statement of Joint Authorship
Mark de Bruyn, Peter B. Mather (2005) Past climate change has mediated
evolution in giant freshwater prawns. Proceedings of the Royal Society of
London B (In Review).
Mark de Bruyn (candidate) Designed and developed experimental protocol. Carried out field and
laboratory work, and analysed data. Wrote manuscript and acted as
corresponding author.
Peter B. Mather Principal supervisor of the study design and experimental protocols. Assisted
in the interpretation of data. Contributed to the structure and editing of the
manuscript.
101
CHAPTER 5. Past climate change has mediated evolution in giant freshwater prawns
Mark de Bruyn, Peter B. Mather
School of Natural Resource Sciences, Queensland University of Technology,
GPO Box 2434, Brisbane, Qld 4001, Australia
Tel: +61-7-3864-1737
E-mail: [email protected]
ABSTRACT A major paradigm in evolutionary biology asserts that global climate change
during the Pleistocene often led to rapid and extensive diversification in
numerous taxa. We used nuclear and mitochondrial molecular variation in a
freshwater-dependent decapod crustacean (Macrobrachium rosenbergii),
sampled widely from the Indo-Australian Archipelago (IAA), to assess the
impact of Pleistocene sea level changes on major demographic events in this
species. The timing of extensive migration events among both mainland-
mainland and mainland-island lineages are consistent with mid-Pleistocene
periods of glacial maxima when sea levels were low, and geographic
distances between discrete river systems were greatly reduced. Similarly, the
timing of population specific overseas migration events, and population
expansion events, are consistent with periods of extremely low sea levels
leading into the Last Glacial Maximum (LGM). Contrary to traditional
expectations that Pleistocene climate change led to extensive diversification,
our results show that chronologically nested overseas migration events
among geographically widespread locations, in response to Pleistocene
climatic change, significantly constrained evolutionary diversification of this
species.
Keywords: Last Glacial Maximum, Pleistocene, demography, dispersal,
phylogeography, Indo-Australian Archipelago
102
1. INTRODUCTION The impact that Pleistocene [2 million to 10, 000 years before the present
(kyr B.P.)] ice ages had on driving evolutionary diversification has been
debated for more than a century (Darwin 1859; Wallace 1862; Hofreiter et al.
2003). Accumulating evidence from Europe and North America indicates that
glacial events during the Pleistocene epoch resulted in major shifts in species
distributions (Avise 2000; Hewitt 2000; Davis & Shaw 2001), and may have
been the principal factor that contributed to the decline and eventual
extinction of some species (Guthrie 2003; Shapiro et al. 2004). As climate
oscillated through the Pleistocene, fossil (Coope 1994; Bennett 1997) and
other evidence (reviewed in Hewitt 2000) shows that the geographical
distributions of some species responded by expanding and contracting during
times of glacial cycling. Furthermore, it has been suggested that these
responses may have been swift, and may have occurred repeatedly (Hewitt
2000). If true, the repeated isolation and admixture of diverged populations
on evolutionarily short time-scales may act to limit the speciation-potential of
the taxon in question (Dobzhansky 1936). Supporting empirical evidence for
this climate-driven mechanism is constrained, however, by the inherent
difficulty in extracting a signal of recurring, but chronologically nested,
demographic events from either extant or fossil taxa.
M. rosenbergii is widely distributed and locally abundant throughout
the Indo-Australian Archipelago. This species is most often associated with
coastal river systems, as it inhabits freshwater as an adult, but requires
brackishwater for larval development. Females migrate from freshwater into
estuarine areas to spawn, where free-swimming larvae hatch from eggs
attached to the females’ abdomen. Larval duration is approximately 3 - 6
weeks, following which juveniles migrate upstream to freshwater habitat. The
ability of larvae to tolerate marine conditions is unknown. However,
laboratory studies indicate that adults do not survive in marine conditions for
more than a week, although a small percentage of postlarvae may survive for
up to 20 days (Sandifer et al. 1975). Even given their apparent limited
euryhalinity, M. rosenbergii are found on some de novo oceanic islands (e.g.
Christmas Island, Palau, Sulawesi, the Philippine Archipelago), which
suggests at the least limited marine dispersal in the past. Two discrete forms
103
of M. rosenbergii have been recognised, based on morphological
(Lindenfelser 1984), allozyme (Lindenfelser 1984), and mitochondrial DNA
(mtDNA) (de Bruyn et al. 2004a) variation, with the boundary between these
forms coinciding with Huxley’s extension of Wallace’s Line. Time of
divergence between the two forms is most likely quite ancient [~5 - 12 million
years ago (MYA)], mirroring the ancient origins of this globally distributed
genus (de Bruyn et al. 2004a).
Here we show that the genetic history of the giant freshwater prawn
(Macrobrachium rosenbergii) was shaped largely by chronologically nested
overseas migration events during Pleistocene glacial cycles. Results suggest
that recurring widespread migration, facilitated by periods of extreme global
climatic change, may have acted as a significant constraint on the
evolutionary diversification of this ancient species.
104
2. MATERIAL AND METHODS (a) Sampling
To investigate the evolutionary impact of Pleistocene glacial events on the
history of M. rosenbergii, we sampled 541 M. rosenbergii from 14 locations
east of Huxley’s Line [sensu the eastern form of M. rosenbergii (de Bruyn et
al. 2004a)] (figure 1). We sequenced a 602 base pair (bp) fragment of the
mitochondrial cytochrome oxidase I gene (COI), and genotyped individuals at
six Mendelian-inherited microsatellite loci (Chand et al. 2005). (b) Genotyping
Methods for genomic DNA extractions, PCR amplification and sequencing of
a 602 bp fragment of the mtDNA COI region, and PCR amplification and
screening of six microsatellite loci are available elsewhere (de Bruyn et al.
2004b; Chand et al. 2005). The microsatellite flanking sequences and
primers are available on GenBank under accession numbers AY791965–
AY791970.
(c) Phylogenetic inference
A parsimony network was constructed from the mtDNA sequences using
TCS ver. 1.13 (Clement et al. 2000). Further support for clades was obtained
by constructing bootstrapped (1,000 pseudo-replicates) maximum-likelihood
and neighbour-joining trees in TREE-PUZZLE (Schmidt et al. 2002) and
MEGA version 3.0 (Kumar et al. 2004), respectively. All bootstrap values
supporting unique clades were > 70%. Cavalli-Sforza & Edwards (1967)
chord distance (DCE) was used to construct a neighbour joining phylogenetic
tree in PHYLIP version 3.5c (Felsenstein 1993) from raw microsatellite allelic
frequencies. Support for tree nodes was assessed by bootstrapping over loci
(2,000 iterations).
(d) Population genetic analyses
We determined that the TrN model of substitution (Tamura & Nei 1993) plus
invariable sites (I) and a gamma distribution (Γ) of rate heterogeneity across
variable sites provided the best fit to our COI dataset with the program
MODELTEST 3.06 (Posada & Crandall 1998). The estimated parameters
under this model were Γ = 5.8053, I = 0.8099 and Ti/Tv = 4.60. The TrN
model and its estimated parameters were used for subsequent analyses
where appropriate. For microsatellite loci, allele frequencies, expected (HE)
105
and observed (HO) heterozygosites, and tests for linkage disequilbrium (LD)
and Hardy-Weinberg equilibrium (HWE) were performed in GENEPOP
(Raymond & Rousset 1995). No significant LD was identified for
microsatellite locus-pair population comparisons. Probability tests detected
12 significant deviations from HWE out of 84 comparisons. Seven of twelve
departures from HWE were evident at the Mr-95 locus due to heterozygote
deficiencies. This could result from the presence of null alleles or the
Wahlund effect. To eliminate the possibility that null alleles might bias our
results, we compared our microsatellite results when all six loci were
incorporated in the analyses, and with locus Mr-95 removed from the
analyses. Both methods gave similar outcomes, thus, results presented here
are those based on all six microsatellite loci. For the Sulawesi population
alone, only loci Mr-95 and Mr-88 amplified consistently for most individuals
sampled. Unbiased estimates of Fisher’s exact test employing the Markov
chain method (10,000 iterations) were used to calculate values of
significance for all tests performed in GENEPOP. Population divergence was
estimated by computing ΦST for the COI dataset in ARLEQUIN (Schneider et
al. 2000), and FST for the microsatellite dataset in F-STAT (Goudet 1995). A
hierarchical analysis of molecular variance (AMOVA) was performed in
ARLEQUIN. We used Mantel tests in IBD (Bohonak 2002) to determine
whether a correlation existed between pairwise Φ/(1- Φ) and FST, respectively,
vs. geographical distance. Data were analysed both untransformed, or with
only geographic distance log-transformed (Rousset 1997).
(e) Timing of demographic events We tested for evidence in our COI dataset for population expansion events
using Tajima’s D, Fu’s Fs, and mismatch distributions calculated in
ARLEQUIN, and a coalescent maximum-likelihood approach implemented in
FLUCTUATE (Kuhner et al. 1998), according to (Kuhner 2003). Tajima’s D
and Fu’s Fs were developed originally as tests for selection, but in its’
absence, negative values are believed to be evidence of an expanding
population. Populations that have been stable historically are predicted to
display a multimodal mismatch distribution, while those that have expanded
recently are predicted to display a unimodal distribution. The validity of the
model was tested using the parametric bootstrap approach implemented in
106
ARLEQUIN under the sudden expansion model, where P = (number of
SSDsim = SSDobs)/B. The exponential growth of a population can also be
inferred from positive values of the exponential growth parameter g obtained
using FLUCTUATE. If all four methods suggested rapid population growth,
we compared the chronology of these events by rearranging the equation for
tau to solve for t. We used the mtDNA COI molecular clock rate of 1.4 x 10-8
derived independently by Knowlton & Weigt (1998) and Morrison et al. (2004)
for Caridean shrimp (the infraorder of Macrobrachium) to convert the
estimate of the time parameter, t, to divergence in years. We estimated the
chronology of pairwise lineage, and lineage-specific population divergence
times, respectively, using the coalescent-based Bayesian/likelihood methods
implemented in the programs MDIV (Nielsen & Wakeley 2001) and IM (Hey &
Nielsen 2004), using the same COI molecular clock as above. We used both
programs to ensure that similar results were being obtained. Prior
distributions were set to m = 0 and t = 15 for most lineage comparisons, and
m = 0 and t = 10 for population comparisons. Preliminary runs with larger
parameter intervals were used to ensure we were using appropriate priors,
and that different priors did not change the posterior distributions. Following a
burn-in period of 105 steps, individual simulations were run at least three
times (with a different random seed) for 60 million updates or more to ensure
similar distributions were being obtained. To ensure adequate mixing of the
Markov chain, we ran the program until the smallest ESS estimates were
greater than 300, and update rates were greater than 20%. For credibility
intervals, we assessed the 90% highest posterior density (HPD) interval; that
is, the boundaries of the shortest span that incorporates 90% of the posterior
density of a parameter.
3. RESULTS AND DISCUSSION (a) Phylogenetic relationships The 58 unique COI haplotypes [GenBank accession numbers AY614545-
AY614587 (de Bruyn et al. 2004b) and DQ060194-DQ060208] define five
well-supported clades (figure 1). These clades comprised samples from:
Western Australia (WA); the Lake Carpentaria region, Australia [LC (de
Bruyn et al. 2004b)]; Papua New Guinea and Eastern Cape York, Australia
107
(PNG/ECY); Luzon Island, Philippines (PH); and a final clade comprising
individuals from Irian Jaya, Sulawesi and Luzon Island, Philippines
(IJ/SU/PH) (figure 1). Further support for this geographical pattern of genetic
differentiation is provided by a phenogram based on microsatellite variation
(figure 2). Relationships among populations based on nuclear data were
largely concordant with that estimated from the COI data, although bootstrap
support was low in some cases.
(b) Genetic divergence and Mantel tests
Analysis of molecular variance (AMOVA) supported the existence of
significant structure among lineages (COI: ΦST = 0.900, ΦCT = 0.769, ΦSC =
0.568, P < 0.001; 10,000 iterations). Moreover, pairwise FST matrices based
on both mtDNA (91 cases; range 0.161 - 1.000) and microsatellite loci (86
cases; range 0.019 - 0.185) showed significant population structure among
most sites, indicating a lack of ongoing gene flow among populations. Only
five pairwise comparisons (among populations from the LC clade) based on
microsatellite data were non-significant (range 0.004 - 0.011). M. rosenbergii
in these locations are believed to have been connected by a freshwater lake
(Lake Carpentaria) that existed ~80 – 8.5 kyr B.P. in what is today the marine
Gulf of Carpentaria (de Bruyn et al. 2004b) (figure 1). Regressions obtained
using permutated Mantel tests (COI: untransformed r = 0.053, P = 0.400,
transformed r = 0.220, P = 0.065; microsatellites: untransformed r = 0.192, P
= 0.165, transformed r = 0.249, P = 0.135) were not significantly different
from zero, indicating that isolation-by-distance has played little or no role in
structuring genetic variation.
(c) Recombination and selection
M. rosenbergii mtDNA displayed no signs of recombination [four gamete test
(Hudson & Kaplan 1985): R = 0.001, P = 0.159] or selection [McDonald
Kreitman test (McDonald & Kreitman 1991): no differences in the ratios of
nonsynonomous to synonymous changes within and between ‘species’, in
this case the eastern and western (de Bruyn et al. 2005) forms of M.
rosenbergii; Fisher’s exact test, P = 1.000], and has been evolving at a
relatively constant rate (log-likelihood ratio test: χ2 = 67.53, d.f. = 56, P >
0.10). These features allowed us to determine nested times of divergence
among lineages, and populations within lineages, respectively, using the
108
recently developed “Isolation with Migration” evolutionary genetic model
(Nielsen & Wakeley 2001). This approach is particularly well suited to
unraveling a range of demographic parameters within recently diverged
populations or species, as it can discriminate between ongoing migration and
recent divergence (Palsbøll et al. 2004).
(d) Timing of major demographic events in the eastern form of M.
rosenbergii
To gain a more accurate estimate of the age of the eastern form of M.
rosenbergii, we estimated the divergence time between the eastern (n = 541)
and the western [n = 404 (de Bruyn et al. 2005)] forms of M. rosenbergii,
sampled from across their entire distributions. Divergence of the two forms
(figure S1; electronic supplementary material) is consistent with an ancient
separation [approximately 5.6 million years (MY)] without subsequent gene
flow. One possible cause for this divergence is geographic separation across
what is today the Makassar Strait, due to extremely high sea levels resulting
from climatic change. Benthic δ18O data suggest that global sea levels over
the past 5.5 million years achieved their maximum height approximately 5.1
million years ago [Marine Isotope Stage (MIS) T7] (Lisiecki & Raymo 2005).
The shallow parsimony network (figure 1) suggests a fairly recent (in
evolutionary terms) connection among lineages within the eastern form of M.
rosenbergii, which is supported by pairwise comparisons of lineage
divergence times (figures 3, S1; electronic supplementary material). The
timing of these events (9 cases; range 886 – 610 kyr B. P.) is consistent with
a disruption of migration after periods of low global sea level during glacial
maxima (MIS 22, 20, 18 & 16; figure 3). Pleistocene sea levels in the Indo-
Australian Archipelago are believed to have dropped periodically by as much
as 120 m, although some authors have suggested that sea levels may have
dropped by up to 150 m (Chappell & Shackleton 1986). Such a dramatic
decrease in sea level would have exposed vast areas of the Sahul Shelf,
revealing extensive riverine drainage systems, and would have reduced
oceanic distances between landmasses considerably (figure 1).
In contrast to the land bridge that united Australia and New Guinea for
much of the Pleistocene (figure 1), the de novo oceanic islands of Sulawesi
and Luzon (Philippines) were never physically linked to other major
109
landmasses in this region (Hall 2002). Taken together, lineage-specific data
suggest that during mid-Pleistocene glacial cycles (MIS 22, 20, 18 & 16;
figure 3), migration between both mainland-mainland and mainland-island
sites, which are today genetically isolated, was extensive. Since this time,
gene flow has been virtually non-existent, and lineage sorting has lead to
geographically restricted reciprocally monophyletic lineages. This is
particularly evident in our mtDNA dataset - as expected from theoretical
expectations of a fourfold reduction in effective population size for mtDNA
(Birky et al. 1989).
Even so, the IJ/SU/PH clade and the PH clade, taken together,
provide an exception to a mid-Pleistocene restriction to migration. The
occurrence of these two divergent (9 bp) mitochondrial lineages sampled
from the same location [Plandez/Pulilan River, Luzon Island (PH)] suggests a
secondary migration event into the PH site. All four haplotypes in the
IJ/SU/PH clade were sampled from the IJ site. All SU samples (n = 35) were
fixed for one of these haplotypes, while 9 individuals sampled from PH were
fixed for another (figure 1). This pattern indicates a fairly recent (but not
ongoing; all pairwise FSTs were significant) migration of IJ individuals into the
SU and PH sites. Indeed, estimating times of divergence (figures 3, S1;
electronic supplementary material) for these populations (3 cases; range 27 –
20 kyr B.P.) provides support for a second round of overseas migration
during a glacial maxima, namely leading into the LGM, followed by a
termination of migration as sea levels subsequently began to rise. Estimates
of posterior density distributions (figure S2; electronic supplementary
material) of the migration parameter, m, and the patterns of molecular
variation in these populations support the directionality of dispersal outlined
above. Even so, the microsatellite dataset indicated that the two divergent
mtDNA lineages sampled from the same site (PH) are not genetically
segregated (FST = 0.001). Indeed, we would expect future lineage sorting to
drive these two lineages to eventual monophyly, barring further incoming
overseas migration.
To examine further the effects of glacial maxima on M. rosenbergii
migration, we estimated pairwise population divergence times within all other
clades (PNG/ECY & LC) where multiple populations were present. Estimates
110
of population divergence times (figure S1; electronic supplementary material)
provide further support for a termination of migration following extremely low
sea levels leading into the LGM (PNG vs. ECY, 22 kyr B.P.; KE vs. KA, 24
kyr B.P.; figure 3). Similarly, times of divergence among all other populations
that comprise the LC clade (15 cases; range = 31 - 17 kyr B.P.) support the
contention that they were recently connected via Lake Carpentaria during
MIS 4 – 2 (~90 – 10 kyr B.P.) leading into the LGM, but are now genetically
isolated (de Bruyn et al. 2004b). The probability that all times of divergence
coincided with Pleistocene glacial maxima by chance alone is extremely
unlikely (sign tests: all pairwise lineage divergence times, 9 cases, P =
0.00391; all pairwise population divergence times, 20 cases, P =
0.00000191).
To examine further the timing of major demographic events in M.
rosenbergii, and specifically whether these events were again consistent with
the timing of extreme climatic changes during the Pleistocene, we estimated
the onset of population expansion events (table 1, figure 3). Again, the timing
of all such events occurred during periods of glacial maxima (MIS 10, 8, 6, 4
– 2; figure 3), a correlation that is equally unlikely by chance alone (sign test:
6 cases, P = 0.0313). Notably, the onset of four of the six population
expansion events coincided remarkably well with the onset of a specific
glacial event (figure 3). These population expansion events most probably
resulted from a direct increase in freshwater habitat availability as sea levels
fell (figure 1).
(e) Chronologically nested migration constrains evolutionary
diversification
During the Pleistocene epoch, MIS 16 (~630 kyr B.P.) and the LGM (~30 –
18 kyr B.P.) were two periods when Antarctic ice sheets were at their maxima,
and thus when global sea levels are believed to have been at their lowest
(Epica Community Members 2004). Indeed, these two episodes of extreme
reductions (Lisiecki & Raymo 2005) in global mean sea level appear to have
played the most prominent roles in facilitating both widespread overseas, and
mainland-mainland, migration in M. rosenbergii (figure 3). Our results
suggest that these cyclical processes act to reduce overall levels of genetic
variation in this freshwater-dependent species by periodically ‘swamping’
111
established monophyletic lineages with an influx of ‘foreign’ genotypes from
geographically distant locations. Geographical isolation over evolutionary
time, leading to the accumulation of highly divergent genotypes, is believed
to be a critical factor on the road to eventual speciation (Mayr 1942). The
absence of both in the widely-distributed eastern form of M. rosenbergii,
apparently due to chronologically nested migration events during periods of
extreme climatic change, may explain why this freshwater-dependent
‘species’ has persisted for so long, and yet has not speciated (Lindenfelser
1984; de Bruyn et al. 2004a; Wowor 2004; this study), even over such large
natural geographic distributional scales. A phylogenetic study of the globally
distributed freshwater genus Macrobrachium hints at a similar scenario, albeit
at the species level, of an evolutionary history shaped largely by historically
widespread migration (Murphy & Austin 2005).
ACKNOWLEDGMENTS We thank J. Hey and R. Nielsen for advice on their “isolation with migration”
genetic analyses programs; P. Prentis and D. Hurwood for comments and
advice on the manuscript; A. Duffy, C. Streatfeild, K. Horskins and V. Chand
for technical support; S. Caldwell, P. K. L. Ng, D. Wowor, M. Tayamen, E.
Nugroho, J. Short, P. Davie, D. Milton and D. Harvey for assistance with
specimen collections. Supported by grants from the Australian Geographic
Society, Ecological Society of Australia, Linnean Society of NSW,
Queensland University of Technology (all to M.d.B.) and ACIAR (P.B.M.).
112
REFERENCES Avise, J. C. 2000 Phylogeography: The history and formation of species.
Cambridge, MA: Harvard University Press.
Bennett, K. J. 1997 Evolution and ecology: the pace of life. Cambridge:
Cambridge University Press.
Birky, C. W., Fuerst, P. & Maruyama, T. 1989 Organelle gene diversity under
migration, mutation, and drift: equilibrium expectations, approach to
equilibrium, effects of heteroplasmic cells, and comparison to nuclear
genes. Genetics 121, 613-627.
Bohonak, A. J. 2002 IBD (Isolation By Distance): A program for analyses of
isolation by distance. J. Heredity 93, 153-154.
Cavalli-Sforza, L. L., & Edwards, A. W. F. 1967 Phylogenetic analysis:
models and estimation procedures. Am. J. Hum. Gen. 19, 233-257.
Chand, V., de Bruyn, M. & Mather, P. B. 2005 Microsatellite loci in the
eastern form of the giant freshwater prawn (Macrobrachium rosenbergii).
Mol. Ecol. Notes 5, 308-310.
Chappell, J., & Shackleton, N. J. 1986 Oxygen isotopes and sea level.
Nature 324, 137-140.
Clement, M., Posada, D. & Crandall, K. A. 2000 TCS: a computer program to
estimate gene genealogies. Mol. Ecol. 9, 1657-1659.
Coope, G. R. 1994 The response of insect faunas to glacial-interglacial
climatic fluctuations. Phil. Trans. R. Soc. Lond. B 344, 19-26.
Darwin, C. 1859 The origin of species. London: John Murray.
Davis, M. B., & Shaw, R. G. 2001 Range shifts and adaptive responses to
Quaternary climate change. Science 292, 673-679.
de Bruyn, M., Wilson, J. C. & Mather, P. B. 2004a Huxley’s line demarcates
extensive genetic divergence between eastern and western forms of the
giant freshwater prawn, Macrobrachium rosenbergii. Mol. Phyl. Evol. 30, 251-257.
de Bruyn, M., Wilson, J. C. & Mather, P. B. 2004b Reconciling geography
and genealogy: phylogeography of giant freshwater prawns from the
Lake Carpentaria region. Mol. Ecol. 13, 3515-3526.
113
de Bruyn, M., Nugroho, E., Hossain, Md. M., Wilson, J. C. & Mather, P. B.
2005 Phylogeographic evidence for the existence of an ancient
biogeographic barrier: the Isthmus of Kra Seaway. Heredity 94, 370-378.
Dobzhansky, T. 1936 Studies on hybrid sterility. II. Localization of sterility
factors in Drosophila pseudoobscura hybrids. Genetics 21, 113-135.
Epica Community Members. 2004 Eight glacial cycles from an Antarctic ice
core. Nature 429, 623-628.
Felsenstein, J. 1993 PHYLIP v. 3.5 (phylogeny inference package). Seattle,
WA: University of Washington.
Goudet, J. 1995 FSTAT version 1.2: a computer program to calculate F-
statistics. J. Heredity 86, 485-486.
Guthrie, R. D. 2003 Rapid body size decline in Alaskan Pleistocene horses
before extinction. Nature 426, 169-171.
Hall, R. 2002 Cenozoic geological and plate tectonic evolution of SE Asia
and the SW Pacific: computer-based reconstructions, model and
animations. J. Asian Earth Sci. 20, 353-431.
Hewitt, G. 2000 The genetic legacy of the Quaternary ice ages. Nature 405, 907-913.
Hey, J. & Nielsen, R. 2004 Multilocus methods for estimating population
sizes, migration rates and divergence time, with applications to the
divergence of Drosophila pseudoobscura and D. persimilis. Genetics
167, 747-760.
Hofreiter, M., Serre, D., Rohland, N., Rabeder, G., Nagel, D., Conard, N.,
Münzel, S. & Pääbo, S. 2003 Lack of phylogeography in European
mammals before the last glaciation. Proc. Natl. Acad. Sci. U.S.A. 101, 12963-12968.
Hudson, R. R. & Kaplan, N. L. 1985 Statistical properties of the number of
recombination events in the history of a sample of DNA sequences.
Genetics 111, 147-164.
Knowlton, N. & Weigt, L. A. 1998 New dates and new rates for divergence
across the Isthmus of Panama. Proc. Roy. Soc. Lond. B. 265, 2257-
2263.
Kuhner, M. K. 2003 LAMARC: Estimating population genetic parameters
from molecular data. In The phylogenetic handbook: a practical
114
approach to DNA and protein phylogeny. (ed. M. Salemi & A.-M.
Vandamme), pp. 378-399. Cambridge: Cambridge University Press.
Kuhner, M. K., Yamato, J. & Felsenstein, J. 1998 Maximum likelihood
estimates of population growth rates based on the coalescent. Genetics
149, 429-434.
Kumar, S., Tamura, K. & Nei, M. 2004 MEGA3: Integrated software for
Molecular Evolutionary Genetics Analysis and sequence alignment.
Brief. Bioinf. 5, 150-163.
Lindenfelser, M. E. 1984 Morphometric and allozymic congruence: evolution
in the prawn Macrobrachium rosenbergii (Decapoda: Palaemonidae).
Syst. Zool. 33, 195-204.
Lisiecki, L. E. & Raymo, M. E. 2005 A Pliocene-Pleistocene stack of 57
globally distributed benthic δ18O records. Paleocean. 20, PA1003,
doi:10.1029/2004PA001071.
Mayr, E. 1942 Systematics and the origin of species. New York: Columbia
University Press.
McDonald, J. H. & Kreitman, M. E. 1991 Adaptive protein evolution at the
Adh locus in Drosophila. Nature 351, 652-654.
Morrison, C. L., Rió, R. & Duffy, J. E. 2004 Phylogenetic evidence for an
ancient rapid radiation of Caribbean sponge-dwelling snapping shrimps
(Synalpheus). Mol. Phyl. Evol. 30, 563-581.
Murphy, N. P. & Austin, C. M. 2005 Phylogenetic relationships of the globally
distributed freshwater prawn genus Macrobrachium (Crustacea:
Decapoda: Palaemonidae): biogeography, taxonomy and the
convergent evolution of abbreviated larval development. Zool. Scripta
34, 187-197.
Nielsen, R. & Wakeley, J. 2001 Distinguishing migration from isolation: a
Markov chain Monte Carlo approach. Genetics 158, 885-896.
Palsbøll, P. J., Bėrubė, M., Aguilar, A., Notarbartolo-Di-Sciara, G. & Nielsen,
R. 2004 Discerning between recurrent gene flow and recent divergence
under a finite-site mutation model applied to North Atlantic and
Mediterranean Sea fin whale (Balaenoptera physalus) populations.
Evolution 58, 670-675.
115
Posada, D. & Crandall, K. A. 1998 MODELTEST: testing the model of DNA
substitution. Bioinformatics 14, 817-818.
Raymond, M. & Rousset, F. 1995 GENEPOP (version 1.2): population
genetics software for exact tests and ecumenicism. J. Heredity 86, 248-
249.
Rousset, F. 1997 Genetic differentiation and estimation of gene flow from
F-statistics under isolation by distance. Genetics 145, 1219-1228.
Sandifer, P. A., Hopkins, J. S. & Smith, T. I. J. 1975 Observations on salinity
tolerance and osmoregulation in laboratory-reared Macrobrachium
rosenbergii postlarvae (Crustacea: Caridea). Aquaculture 6, 103-114.
Schmidt, H. A., Strimmer, K., Vingron, M. & von Haeseler, A. 2002 TREE-
PUZZLE: maximum likelihood phylogenetic analysis using quartets and
parallel computing. Bioinformatics 18, 502-504.
Schneider, S. D., Roessli, D. & Excoffier, L. 2000 ARLEQUIN ver. 2.0: A
Software for Population Genetic Data Analysis. Geneva: Genetics and
Biometry Laboratory, University of Geneva.
Shapiro, B., Drummond, A. J., Rambaut, A., Wilson, M. C., Matheus, P. E.,
Sher, A. V., Pybus, O. G., Gilbert, M. T. P., Barnes, I., Binladen, J.,
Willerslev, E., Hansen, A. J., Baryshnikov, G. F., Burns, J. A., Davydov,
S., Driver, J. C., Froese, D. G., Harington, C. R., Keddie, G., Kosintsev,
P., Kunz, M. L., Martin, L. D., Stephenson, R. O., Storer, J., Tedford, R.,
Zimov, S. & Cooper, A. 2004 Rise and fall of the Beringian steppe bison.
Science 306, 1561-1565.
Tamura, K. & Nei, M. 1993 Estimation of the number of nucleotide
substitutions in the control region of mitochondrial DNA in humans and
chimpanzees. Mol. Biol. Evol. 10, 512-526.
Voris, H. K. 2000 Maps of Pleistocene sea levels in South East Asia:
shorelines, river systems, time durations. J. Biogeog. 27, 1153-1167.
Wallace, A. R. 1862 Narrative of search after birds of paradise. Proc. Zool.
Soc. Lond, 1862. 153-161.
Wowor, D. 2004 A systematic revision of the freshwater prawns of the genus
Macrobrachium (Crustacea: Decapoda: Caridea: Palaemonidae). PhD
Thesis, National University of Singapore, Singapore.
116
Table 1. Population expansion events in Macrobrachium rosenbergii (eastern
form) based on mtDNA COI region sequences.
(Tajima’s D values (* indicates significance at 0.05 level), Fu’s Fs values (*
indicates significance at 0.05 level), mismatch distribution P values, and the
growth parameter g (± 2 standard deviations) are shown. Estimates of these
parameters could not be performed for the RO and SU populations, which
each comprised only a single haplotype. Populations that displayed evidence
for growth using all 4 methods are indicated in bold with the inferred timing of
their initial expansion estimated from tau (τ).)
Locality Tajima’s D Fu’s
Fs
Mismatch P Fluctuate
g
Timing of
expansion
(kyr B.P.)
WA 0.00 0.16 0.01 315±352 -
KE -0.42 -0.71 0.45 3520±1386 42 KA -1.23 -0.61 0.64 8533±1856 63 RO NA NA NA NA -
LB -1.73* -3.21* 0.42 9800±2745 178 MC -0.02 -2.81 0.06 301±163 179 NO -0.36 0.63 0.14 -10±197 -
AR 0.26 2.47 0.04 -316±251 -
WE 0.10 2.09 0.00 -6±190 -
ECY 2.70 7.21 0.01 -260±107 -
PNG -1.76* -1.45 0.16 270±118 348 IJ 0.88 1.41 0.01 -78±440 -
SU NA NA NA NA -
PH -0.36 -3.23 0.47 552±154 296
117
Figure 1. Map of sampling locations and parsimony network for 58 unique
mitochondrial COI haplotypes obtained from sampling 541 M. rosenbergii
from 14 locations in the Indo-Australian Archipelago east of Huxley’s Line.
Light grey shading on map indicates –120m sea level contour (Voris 2000).
Pleistocene drainage basins are shown (Voris 2000). Numbers in
parentheses indicate the number of identical haplotypes from a given locality.
Closed circles indicate inferred missing haplotypes. Dashed lines indicate
alternative inferred connections among haplotypes. Populations are as
follows, PNG/ECY clade (shown in brown): Fly R, Papua New Guinea (PNG),
Olive R, Eastern Cape York (ECY); PH clade (shown in pale blue):
Plandez/Pulilan R, Luzon, Philippines (PH); WA clade (shown in yellow):
Lennard R, Western Australia (WA); IJ/SU/PH clade (shown in red): Maros R,
Sulawesi (SU), Ajkwa R, Irian Jaya (IJ), Plandez/Pulilan R, Luzon,
Philippines (PH); LC clade (shown in green): Keep R (KE), Katherine R (KA),
Roper R (RO), Limmen Bight R (LB), McArthur R (MC), Norman R (NO),
Wenlock R (WE) and Archer R (AR).
LB WE WE(3) LB LB
WE(14) NO(3) MC
NO
MC(40) NO(6) AR(3)
LB(24)
AR(17) AR(5)
NO
WE(21) NO(31)
KA(28) KE(21)
KE(7)
KE(2)
KA
KA(4)
KE
RO(22) MC(7)
WE NO(2) MC
WA(10)
WA WA
WA(4) WA(2)
IJ(1) PH(9)
SU(35) IJ(29)
IJ
IJ(11)
PH
PH(2)
PH
PH(4) PH(2)
PH
PH PH(7)
PH
PH
PH
PH(3)
PH(2) ECY(8) PNG
PNG(3)
PNG
PNG(28) ECY(4)
ECY(4) PNG PNG PNG
PNG(2) PNG
PHILIPPINES
SULAWESI
IRIAN JAYA
PAPUA NEW GUINEA
AUSTRALIA
PH
SU IJ
PNG
ECY
WA
KE
KA RO
LB MC
NO
WE
AR
N
Gulf of Carpentaria
15º
15º
0º
118
Figure 2. Neighbour-joining phenogram depicting genetic relationships
based on Cavalli-Sforza and Edwards’ chord distances (DCE) among 14 M.
rosenbergii populations sampled from the Indo-Australian Archipelago east of
Huxley’s Line. The percentage of bootstrap replicates (n = 2,000) over 6
microsatellite loci (except for SU; see Materials and Methods) is indicated by
the values on the nodes.
LB RO
KA KE
WA
MC
WF
AF
NO
ECY
PNG
IJ
PH SU
95
65
72
80 63
55
100
46
74 52
45 39
39
119
Figure 3. Estimated M. rosenbergii population (numbered 1 - 5) and lineage
(numbered 6 - 15) divergence times, population expansion times (a - f), and
their relation to Pleistocene glacial maxima (even numbers in white boxes)
inferred from 57 globally distributed δ18O records (Lisiecki and Raymo 2005).
All times fall within periods of glacial maxima. Lineage-specific population
pairwise divergence times as follows with divergence time in parentheses
(kyr B.P.): 1. IJ vs. SU (20); 2. PNG vs. ECY (22); 3. PH vs. SU (25); 4. KA
vs. KE (25); 5. IJ vs. PH (27). All other LC pairwise population comparisons
(n = 15) are not shown, but do fall within MIS 4 - 2 (range 31 - 17 kyr B.P.).
Pairwise lineage divergence times as follows (kyr B. P.): 6. IJ/SU/PH vs. LC
(610); 7. PNG/ECY vs. PH (622); 8. PH vs. LC (635); 9. IJ/SU/PH vs. PH
(641); 10. WA vs. LC (712); 11. IJ/SU/PH vs. PNG/ECY (798); 12. PNG/ECY
vs. WA (803); 13. WA vs. PH (806); 14. IJ/SU/PH vs. WA (880); 15.
PNG/ECY vs. WA (886). Inferred onset of population expansion times as
follows (kyr B.P.): a. KE (42); b. KA (63); c. LB (178); d. MC (179); e. PH
(296); f. PNG (347).
1 2 3 4 5 6 7 8 9 11 10 12 13 14 15 16 17 18 19 20 21 22
0 100 200 300 400 500 600 700 900 kyr B.P.
Marine Isotope Stage (MIS)
8
67
9
1012 11
13
14 15
1 2 3 4 5
a b
c ef
Onset of population expansion event
Pairwise divergence times (populations = 1 - 5; lineages = 6 - 15)
Divergence times and population expansion events 5
4.5
4
3.5
δ18O Marine
δ18O Marine (‰ )
d
800
120
Supporting Online Material A. ‘Species’ splitting parameter: Eastern vs. Western form of M. rosenbergii
0
0.002
0.004
0.006
0.008
t
Like
lihoo
d
B. Lineage splitting parameter: IJ/SU/PH vs. LC
0
0.001
0.002
0.003
0.004
0.005
Like
lihoo
d
C. Lineage splitting parameter: PNG/ECY vs. PH
00.00050.001
0.00150.002
0.00250.003
0.00350.004
0 5 10 15
t
Like
lihoo
d
5 10 15t
50 100
121
D. Lineage splitting parameter: PH vs. LC
0
0.002
0.004
0.006
0.008
t
Like
lihoo
d
E. Lineage splitting parameter: IJ/SU/PH vs. PH
0
0.001
0.002
0.003
0.004
0 5 10 15
t
Like
lihoo
d
F. Lineage splitting parameter: WA vs. LC
00.00050.001
0.00150.002
0.00250.003
0.00350.004
0 5 10 15
t
Like
lihoo
d
5 10 15 20
122
G. Lineage splitting parameter: PNG/ECY vs. IJ/SU/PH
0
0.0005
0.001
0.0015
0.002
0.0025
0.003
0.0035
0 5 10 15
Like
lihoo
d
H. Lineage splitting parameter: WA vs. PNG/ECY
0
0.0005
0.001
0.0015
0.002
0.0025
0.003
Like
lihoo
d
I. Lineage splitting parameter: WA vs. PH
5 10 15t
t
00.00050.001
0.00150.002
0.00250.003
0 5 10 15
t
Like
lihoo
d
123
J. Lineage splitting parameter: WA vs. IJ/SU/PH
00.00050.001
0.00150.002
0.00250.003
0 5 10 15
t
Like
lihoo
d
K. Lineage splitting parameter: PNG/ECY vs. WA
00.00050.001
0.00150.002
0.00250.003
t
Like
lihoo
d
L. Population splitting parameter: IJ vs. SU
0
0.002
0.004
0.006
0.008
0.01
t
Like
lihoo
d
5 10
0.2 0.4 0.6 0.8
124
M. Population splitting parameter: PH vs. SU
0
0.002
0.004
0.006
0.008
t
Like
lihoo
d
N. Population splitting parameter: KA vs. KE
O. Population splitting parameter: IJ vs. PH
0
0.002
0.004
0.006
0.008
0.01
t
Like
lihoo
d
0.5 1.0 1.5 2.0
0.25 0.50 0.75 1.00 1.25
0
0.002
0.004
0.006
0.008
t
Like
lihoo
d
0.5 1.0 1.5 2.0
125
P. Population splitting parameter: PNG vs. ECY
0
0.001
0.002
0.003
0.004
0.005
t
Like
lihoo
d
Figure S1. The marginal likelihood surfaces for the time of splitting
parameter t, estimated in IM (Hey & Nielsen 2004) with 90% highest posterior
densities (HPD) indicated by dashed lines. All other LC pairwise population
comparisons (n = 15) are not shown, but do fall within MIS 4 - 2 (range 31 -
17 kyr B.P.). Note that the scale of the x- and y-axes change throughout the
series.
3.5 7.0 10.5
126
A. Population migration parameter: IJ to PH
00.0020.0040.0060.0080.01
0.012
0 2 4 6 8
m
Like
lihoo
d
B. Population migration parameter: PH to IJ
0
0.05
0.1
0.15
0.2
0 2 4 6 8
m
Like
lihoo
d
C. Population migration parameter: IJ to SU
0
0.01
0.02
0.03
0.04
0 2 4 6 8
m
Like
lihoo
d
127
D. Population migration parameter: SU to IJ
00.050.1
0.150.2
0.25
0 2 4 6 8
m
Like
lihoo
d
Figure S2. The marginal likelihood surfaces for the population migration
parameter m, estimated in IM (Hey & Nielsen 2004). Highest posterior
density (HPD) values are not shown, as in all cases the lower bound HPD
incorporated zero. Note that the scale of the y-axis changes throughout the
series.
128
CHAPTER 6. Final Discussion and Conclusion
A recent review has listed phylogeography as one of the principle methods
applied in the discipline of historical biogeography (Crisci 2001). Debate has
continued ever since regarding the merits of phylogeography for studying
historical biogeography. Ebach, Humphries and co-workers (Humphries
2000; Ebach & Humphries 2003; Ebach et al. 2003) have been particularly
vocal in challenging the legitimacy of phylogeography for this purpose. They
apparently view the field as largely a ‘chimera of scenario building’ based on
‘dispersal scenarios’ (Humphries 2000). This view has earned rebuttals from
phylogeographers (Arbogast & Kenagy 2001; McDowall 2004). These
contrasting views can be traced back to the advent of two opposing schools
of thought in historical biogeography that emerged during the late 1970’s -
the vicariant and dispersalist schools. The vicariance view, propounded
initially by Rosen (1978), and Nelson and Platnick (1981), regarded that
generation of biodiversity resulted primarily from fragmentation via vicariant
events, such as the fragmentation of landmasses. The vicariant paradigm
requires the phylogenetic analyses of multiple lineages from at least 3 taxa,
in a search for congruence across phylogenies (Nelson & Platnick 1981). The
most parsimonious explanation for a common pattern across lineages is that
all lineages have been affected in similar ways by a vicariant event. If,
however, incongruence were identified across phylogenies, the explanation
invoked for such a pattern would be one of differential dispersal among taxa.
In this school of thought, dispersal can only be invoked after falsification of a
vicariance model (Rosen 1978). In contrast, dispersalists argued that
dispersal played a more prominent role in the establishment of new lineages,
and ultimately, of new species. Recently, there has been a move towards
unifying the two opposing views, in recognition that both vicariance and
dispersal are fundamental processes that contribute to the generation of
biodiversity (Ronquist 1997; Zink et al. 2000; de Queiroz 2005).
One major concern with the vicariant method is that phylogenetic trees
of species with widespread distributions will fail to display differentiation in
response to a barrier that is observable in the phylogeny of some other taxa,
that is, phylogenies may conflict. This would result in the vicariance method
129
defaulting to a scenario of dispersal to explain such widespread distributions.
While such a result may in some cases be true, it is equally likely that the
taxa in question will have experienced a history shaped by both vicariance
and dispersal. This concern is addressed by the field of phylogeography,
which incorporates and expands on these views, by providing a bridge
between macroevolutionary (e.g. historical biogeography, phylogenetics) and
microevolutionary (e.g. demography and population genetics) change (Riddle
& Hafner 2004). The analysis of variation at the intraspecific level may reveal
the true biogeographical history of the taxon, including cryptic vicariance (e.g.
Riddle et al. 2000), which may be lost if units of analyses were based at or
above the species-level. Where this situation is true, the vicariant approach
may be deeply flawed, as the method may actually underestimate the
influence of vicariant events on a biota. In contrast, phylogeography
considers the relative importance of both vicariance and dispersal, and can
be helpful in dealing with reticulation (see Introduction), which may remain
unresolved when the vicariant method is employed.
A molecular phylogeographical approach can also provide a temporal
perspective on the underlying mechanisms involved in shaping a phylogeny.
Assuming a molecular clock, that is, that the rate of molecular change will be
fairly constant over evolutionary time, it may be possible to distinguish
between competing vicariance or dispersal hypotheses for a single taxon. In
a recent review of the literature, for example, molecular dating clearly
supported oceanic dispersal over vicariance for a multitude of taxa including:
freshwater teleosts, carnivores, lemurs, monkeys, squamate reptiles, frogs,
flightless insects and angiosperms, among others (reviewed in de Queiroz
2005). Thus, it is argued here that phylogeography has played a prominent
role in a recent shift in historical biogeography to a more balanced approach,
where both vicariance and dispersal are likely over evolutionary time.
Moreover, the phylogeographical method enables the estimation of temporal
frameworks for testing specific a priori biogeographical hypotheses.
Phylogeography may also highlight other aspects of a species’ history related
to biogeography, for example, the relative roles of range expansion,
population or lineage expansion, and gene flow, among others (Templeton
1998).
130
To this end, the present study investigated the phylogeographical
structure of the giant freshwater prawn, Macrobrachium rosenbergii, sampled
from across most of the species’ natural range. M. rosenbergii has a wide
distribution - from Pakistan in the west to Vietnam in the east, and south
throughout SE Asia to New Guinea, across northern Australia, and some
Pacific and Indian Ocean Islands. Thus, by default, a vicariance approach
would interpret this distribution pattern as evidence for widespread dispersal
by M. rosenbergii throughout this region. Closer examination of the literature,
however, would reveal some evidence for geographical sub-division within M.
rosenbergii (De Man 1879; Johnson 1973; Lindenfelser 1984; Wowor 2004).
To investigate further this apparent discrepancy between taxonomy and
evolutionary history, an initial broadscale mtDNA (16S) pilot study, presented
here (Chapter 2; de Bruyn et al. 2004a), revealed a deep divergence
between ‘eastern’ and ‘western’ forms, coinciding with Huxley’s extension of
Wallace’s Line (Fig. 1). The current study confirmed and extended previous
results based on morphological (De Man 1879; Johnson 1973; Lindenfelser
1984; Wowor 2004) and allozyme (Malecha 1977; Hedgecock et al. 1979;
Lindenfelser 1984; Malecha 1987) variation in M. rosenbergii, and suggested
that time of divergence between the two forms probably dates back to 5-12
million years ago (MYA). Thus, the initial findings of this study confirmed the
presence of two cryptic and deeply divergent lineages, a situation that is not
reflected in the current species’ taxonomy. A reliance on a species-level
phylogeny in this case would have underestimated the role of vicariance on
diversification within the study region.
Further support for both vicariance and dispersal as driving forces for
diversification of M. rosenbergii within the Indo-Australian Archipelago (IAA)
was identified in subsequent studies (de Bruyn et al. 2004b; 2005) conducted
at finer geographical scales. Sampling of M. rosenbergii from west of
Huxley’s Line (Fig. 1) found evidence for vicariance (Chapter 4; de Bruyn et
al. 2005) either side of a postulated ‘Isthmus of Kra Seaway’ (Woodruff 2003).
A pattern consistent with subsequent northward dispersal of the ‘southern
lineage’ across this former barrier was also identified, however, which
apparently lead to the admixture of these two divergent lineages just north of
this seaway. Similar patterns concordant with vicariance are apparent in
131
studies on amphibians (Inger 1966; see review by Inger & Voris 2001),
reptiles (Inger & Voris 2001), birds (Hughes et al. 2003), mammals (Corbett &
Hill 1992), insects (Corbet 1941) and plants (Ridder-Numan 1998;
Denduangboripant & Cronk 2000), in the vicinity of the Isthmus of Kra.
Similarly, sampling of M. rosenbergii from east of Huxley’s line (Chapter
3; de Bruyn et al. 2004b), across northern Australia, indicated that a vast
freshwater lake (Lake Carpentaria) that existed in the past facilitated
dispersal among populations that were subsequently isolated by a rise in
mean sea levels. Vicariance occurred as these rising sea levels, which
replaced Lake Carpentaria with what is today the marine Gulf of Carpentaria,
isolated formerly contiguous populations. These results were extended in a
comparative study (Chapter 5; de Bruyn & Mather, In Review) of M.
rosenbergii sampled from the Lake Carpentaria region, and from two de novo
oceanic islands. Oceanic islands have long been recognised as ideal natural
laboratories for studying evolution (e.g. Darwin 1859; Wallace 1869), as the
most parsimonious explanation for the occurrence of terrestrial and
freshwater biota on such islands is by way of dispersal. Coalescent-based
analyses indicated that the evolutionary history of M. rosenbergii from the
eastern Indo-Australian Archipelago was shaped largely by widespread,
chronologically nested, migration events during times of extremely low sea
levels, resulting from climatic cycling during the Pleistocene. Thus, it is
apparent that diversification of M. rosenbergii within the IAA retains a
signature of ancient geological events overlain by imprints of Pleistocene
climatic change. This fine scale biogeographical history of M. rosenbergii
provides an explicit temporal and geographical framework for freshwater
diversification in the IAA for future comparative studies. Moreover, the well-
documented geological history of the region places the diversification of
lineages within the context of earth history events that have shaped the IAA,
and thus driven and/or constrained diversification within this region (e.g.
Bermingham & Martin 1998).
While it is generally agreed that comparative phylogeography (the
comparative analyses of evolutionary lineages sampled from multiple taxa
across a given region) is a more robust approach for inferring biogeography
(Riddle & Hafner 2004), it is demonstrated here that a single taxon approach
132
can also provide a great deal of information about a region’s biogeographical
history. This rich history may be overlooked if the analyses are focussed only
at the species level or above. Indeed, it would seem ill advised for historical
biogeography to rely on the assumption that currently recognised species -
described often solely on the basis of morphological characters - encompass
the full spectrum of evolutionary and biogeographical information. These data
are essential for understanding pattern and process in ecology and
biogeography, for example, in conservation planning (e.g. the demarcation of
reproductively isolated lineages); macroecological studies (e.g. range sizes,
shape, stability, etc.); and inferences about historical evolutionary processes
(e.g. evolution of regional biotas), among others (Riddle & Hafner 1998).
In conclusion, while the dynamic geological and climatic history of the
IAA region has clearly played a prominent role in the diversification of the M.
rosenbergii ‘species complex’, this information is cryptically embedded below
the species level within this widespread taxon. This information would
probably have remained undetected if an intraspecific approach (i.e.
phylogeography) were not employed to investigate the evolutionary history of
M. rosenbergii, which in turn has facilitated inferences about the rich
biogeographical history of the study region.
Figure 1. Study region indicating sampling sites and the distribution of major mtDNA COI phylogeographic
lineages (neighbour-joining tree with bootstrap support). Coloured bars correspond to sampling site. 0.02
COI: 1056 individuals
100
100
98 56
67 99
79
86
96
67Huxley’s Line Western
clade
Eastern clade
0.02
Makassar Strait
134
REFERENCES Arbogast BS, Kenagy GJ (2001) Comparative phylogeography as an
integrative approach to historical biogeography. Journal of
Biogeography, 28, 819-825.
Bermingham E, Martin AP (1998) Comparative mtDNA phylogeography of
neotropical freshwater fishes: testing shared history to infer the
evolutionary landscape of lower Central America. Molecular Ecology, 7, 499-517.
Corbet AS (1941) The distribution of butterflies in the Malay Peninsula.
Proceedings of the Royal Entomological Society of London A, 16, 101-
116.
Corbett GB, Hill JE (1992) The Mammals of the Indomalayan Region: a
Systematic Review. Oxford University Press, Oxford, UK.
Crisci JV (2001) The voice of historical biogeography. Journal of
Biogeography, 28, 157-168.
Darwin (1859) On the Origin of Species. John Murray, UK.
de Bruyn M, Wilson JC, Mather PB (2004a) Huxley’s Line demarcates
extensive genetic divergence between eastern and western forms of the
giant freshwater prawn, Macrobrachium rosenbergii. Molecular
Phylogenetics and Evolution, 30, 251-257.
de Bruyn M, Wilson JC, Mather PB (2004b) Reconciling geography and
genealogy: phylogeography of giant freshwater prawns from the Lake
Carpentaria region. Molecular Ecology, 13, 3515-3526.
de Bruyn M, Nugroho E, Hossain MM, Wilson JC, Mather PB (2005)
Phylogeographic evidence for the existence of an ancient
biogeographic barrier: the Isthmus of Kra Seaway. Heredity, 94, 370-
378.
de Bruyn M, Mather PB (2005) Past climate change has mediated evolution
in giant freshwater prawns. Proceedings of the Royal Society of London
B (In Review).
De Man JG (1879) On some species of the genus Palaemon Fabr. with
descriptions of two new forms. Notes Leyden Museum, 1, 165-184.
Denduangboripant J, Cronk QCB (2000) High intraindividual variation in
internal transcribed spacer sequences in Aeschynanthus
135
(Gesneriaceae): implications for phylogenetics. Proceedings of the
Royal Society of London B, 267, 1407-1415.
De Queiroz A (2005) The resurrection of oceanic dispersal in historical
biogeography. Trends in Ecology and Evolution, 20, 68-73.
Ebach M, Humphries CJ (2003) Ontology of biogeography. Journal of
Biogeography, 30, 959-962.
Ebach M, Humphries CJ, Williams DM (2003) Phylogenetic biogeography
deconstructed. Journal of Biogeography, 30, 1285-1296.
Hedgecock D, Stelmach DJ, Nelson K, Lindenfelser ME, Malecha SR (1979)
Genetic divergence and biogeography of natural populations of
Macrobrachium rosenbergii. Proceedings of the World Mariculture
Society, 10, 873-879.
Hughes JB, Round PD, Woodruff DS (2003) The Indochinese-Sundaic faunal
transition at the Isthmus of Kra: an analysis of resident forest bird
species distributions. Journal of Biogeography, 30, 569-580.
Humphries CJ (2000) Form, space and time; which comes first? Journal of
Biogeography, 27, 11-15.
Inger RF (1966) The systematics and zoogeography of the amphibia of
Borneo. Field Zoology, 52, 1-402.
Inger RF, Voris HK (2001) The biogeographical relations of the frogs and
snakes of Sundaland. Journal of Biogeography, 28, 863-891.
Johnson DS (1973) Notes on some species of the genus Macrobrachium
(Crustacea: Decapoda: Caridea: Palaemonidae). Journal of the
Singapore National Academy of Sciences, 3(3), 273-291.
Lindenfelser ME (1984) Morphometric and allozymic congruence: evolution in
the prawn Macrobrachium rosenbergii (Decapoda: Palaemonidae).
Systematic Zoology, 33(2), 195-204.
Malecha SR (1977) Genetics and selective breeding of Macrobrachium
rosenbergii. In ‘Shrimp and Prawn Farming in the Western Hemisphere.’
(Eds. J.A. Hanson & H.L. Goodwin), pp. 328-355. Dowden, Hutchinson
and Ross, Stroudsberg, Pa, USA.
Malecha SR (1987) Selective breeding and intraspecific hybridization of
crustaceans. In ‘Proceedings of the World Symposium on Selection,
136
Hybridization, and Genetic Engineering in Aquaculture.’ pp. 323-336.
Vol. 1, Berlin, Germany.
McDowall RM (2004) What biogeography is: a place for process. Journal of
Biogeography, 31, 345-351.
Nelson G, Platnick NI (1981) Systematics and Biogeography: Cladistics and
Vicariance. Columbia University Press, New York.
Ridder-Numan JWA (1998) Historical biogeography of Spatholobus
(Leguminosae-Papillionoideae) and allies in SE Asia. In ‘Biogeography
and Geological Evolution of Southeast Asia’. (Eds. R. Hall & J.D.
Holloway), pp. 259-277. Backhuys Publishers, Leiden, The Netherlands.
Riddle BR, Hafner DJ (1998) Species as units of analysis in ecology and
biogeography: time to take the blinders off. Global Ecology and
Biogeography, 8, 433-441.
Riddle BR, Hafner DJ (2004) The past and future roles of phylogeography in
historical biogeography. In ‘Frontiers of Biogeography: New Directions
in the Geography of Nature.’ (Eds. M.V. Lomolino & L.R. Heaney), pp.
93-110. Sinauer Associates, Sunderland, USA.
Riddle BR, Hafner DJ, Alexander LF, Jaeger JR (2000) Cryptic vicariance in
the historical assembly of a Baja California Peninsular Desert biota.
Proceedings of the National Academy of Sciences USA, 97, 14438-
14443.
Ronquist F (1997) Dispersal-vicariance analysis: a new approach to the
quantification of historical biogeography. Systematic Biology, 46, 195-
203.
Rosen DE (1978) Vicariant patterns and historical explanation in
biogeography. Systematic Zoology, 27, 159-188.
Templeton AR (1998) Nested clade analyses of phylogeographic data:
testing hypotheses about gene flow and population history. Molecular
Ecology, 7, 381-397.
Wallace AR (1869) The Malay Archipelago. Macmillan and Co., London.
Woodruff DS (2003) Neogene marine transgressions, palaeogeography and
biogeographic transitions on the Thai-Malay Peninsula. Journal of
Biogeography, 30, 551-567.
137
Wowor D (2004) A systematic revision of the freshwater prawns of the genus
Macrobrachium (Crustacea: Decapoda: Caridea: Palaemonidae) of
Sundaland. Ph.D. Thesis, National University of Singapore, Singapore.
Zink RM, Blackwell-Rago RC, Ronquist F (2000) The shifting roles of
dispersal and vicariance in biogeography. Proceedings of the Royal
Society of London B, 267, 497-503.
138
Statement of Joint Authorship
Chand V, de Bruyn M, Mather PB (2005) Microsatellite loci in the eastern
form of the giant freshwater prawn (Macrobrachium rosenbergii). Molecular
Ecology Notes, 5, 308-310.
Chand V* Designed and developed experimental protocol. Carried out laboratory work
and analysed data. Contributed to the structure and editing of the manuscript.
de Bruyn M* (candidate) Designed and developed experimental protocol. Carried out field and
laboratory work, and analysed data. Wrote manuscript and acted as
corresponding author.
Mather PB Principal supervisor of the study design and experimental protocols. Assisted
in the interpretation of data. Contributed to the structure and editing of the
manuscript.
* These authors contributed equally to the design, development, preparation
and presentation of the material presented in this paper. Either of these
authors could be nominated as the senior author.
139
APPENDIX 1. Microsatellite loci in the eastern form of the giant
freshwater prawn (Macrobrachium rosenbergii)
Vincent Chand, Mark de Bruyn and Peter B. Mather
School of Natural Resource Sciences, Queensland University of Technology,
GPO Box 2434, Brisbane, Qld 4001, Australia
ABSTRACT Six microsatellite loci are identified and characterised from the eastern form
of the widespread and commercially important giant freshwater prawn
(Macrobrachium rosenbergii). The loci were detected by randomly screening
for di- and tri-nucleotide repeat units within a partial genomic library
developed for the species. Number of alleles and heterozygosity per locus in
a sample of 29 prawns ranged from 12 to 18 and from 0.66 to 0.90,
respectively. These markers provide powerful tools for the conservation and
management of wild stocks, the improvement of cultured stocks of M.
rosenbergii; and for investigating evolutionary processes underlying genetic
divergence among populations.
Keywords: Macrobrachium, Decapoda, Palaemonidae, microsatellite, primer
140
The decapod crustacean, Macrobrachium rosenbergii (giant freshwater
prawn), is commercially important in culture and as a wild capture-fishery
species, particularly in SE Asia. The natural distribution of M. rosenbergii
extends from Pakistan in the west to southern Vietnam in the east, across SE
Asia, and south to northern Australia, New Guinea, and some Pacific and
Indian Ocean Islands. Recent studies have recognised two distinct forms of
M. rosenbergii, an ‘eastern’ and a ‘western’ form (these forms may receive
elevation to specific taxonomic status in the near future; D. Wowor, pers.
comm.), based on morphology (Lindenfelser 1984), allozymes (Hedgecock et
al. 1979; Lindenfelser 1984; and others) and mtDNA (de Bruyn et al. 2004 a).
The western form is the common form used in culture in most parts of the
world, with the Philippines being a notable exception. Understanding the
distribution of genetic diversity in wild and cultured stocks is important for
developing sound conservation strategies aimed at preserving wild genetic
diversity levels, which are believed to be declining due to over exploitation.
Recognition of unique genetic diversity will also allow for informed choices in
breeding programs regarding the selection of genetically diverse broodstock,
and the maintenance of genetic diversity in cultured stocks. Here we report
the development and characterisation of microsatellite DNA markers in the
eastern form of M. rosenbergii, and we test their utility in the western form.
Approximately 10 μg of M. rosenbergii genomic DNA was digested
with restriction enzyme DpnII for 3 hours, and then separated on a 1.5%
agarose gel. DNA fragments in the 300-700 bp size range were excised,
purified and ligated to an equal volume of plasmid vector pUC18 (Amersham-
Pharmacia). The plasmids came digested with BamHI, and dephosphorylated
to allow the overhanging ends to match those resulting from the DpnII digest.
Recombinant plasmids were heatshocked into competent Eschericia coli
cells (strain JM109, Promega) and incubated for one hour at 37°C. Cells
were spread onto agar plates containing LB-Ampicillin/KGAC/IPTG and
incubated at 37°C overnight. A total of ~2500 recombinant colonies were
picked from plates and incubated overnight on new LB-Ampicillin agar plates
in a grid formation and then stored at 4°C. Recombinant colonies were
blotted from the plates onto filter membranes (Hybond-N, Amersham). DNA
from this transfer was cross-linked with the membrane, denatured and
141
probed with oligonucleotides [(ACC)8, (AAC)8, (AAG)8, (AGC)8, (ACG)8,
(ACT)8, (CA)15, (AG)12] that had been end labelled with [γ32P]dATP (Perkin
Elmer). Cross-linked single-stranded DNA was hybridised with the probes
overnight before being exposed onto X-ray film for 12 hours. Autoradiographs
revealed sixty one positive clones that hybridised with probed repeats.
Colonies containing repeats were identified and picked from the stored agar
plates and cultured overnight at 37°C. Plasmid DNA was extracted from
cultures by an alkaline-lysis miniprep and sequenced using Big Dye
Terminators (Perkin Elmer) and universal plasmid primers (M13 F & R,
Amersham Pharmacia Biotech). DNA sequencing was conducted on an ABI
3730 automated sequencer at the Australian Genome Research Facility at
the University of Queensland, Brisbane, Australia. Thirty four clones
contained recognisable microsatellite arrays. Nineteen of the candidate
microsatellites had an adequate flanking region for primer design. Primers
were designed using OLIGO and PRIMER 3 software. Polymerase chain
reaction (PCR) amplification of targeted microsatellites was successful for six
of the primer pairs (Table 1). PCR reactions contained 50-100 ng template
DNA, 0.2 U Taq DNA polymerase (Biotech), 0.25mM dNTP’s, 1mM MgCl2,
0.5µM each primer (forward primer end-labelled with fluorescent HEX), in
10x reaction buffer (670mM Tris-HCL, 166mM [NH4]2SO4, 4.5% Triton X-100,
2mg/mL gelatin; Biotech) up to 20 μL total reaction volume. After a
preliminary denaturing step at 95° for 3 min, PCR amplification was
performed for 30-35 cycles: 30 sec denaturing at 94°, 30 sec at annealing
temperature (Table 1) and 30 sec extension at 72°, with a final 10 min
extension at 72°. After amplification, 1 part each PCR product was mixed
with 1 part loading buffer, heated for 3 mins at 95°, and then set on ice for at
least 3 mins. Denatured PCR products and TAMRA (Genescan-350) size
markers were separated electrophoretically on 5% denaturing acrylamide
gels using a Gelscan 2000 rig (Corbett Research) and analysed for product
size with ONE-DSCAN software (Scanalytics).
Microsatellite typing of a wild ‘eastern’ (n = 29) population (de Bruyn et
al. 2004 a, b) of M. rosenbergii sampled from the Norman River (Queensland,
Australia) indicated that all six loci were polymorphic. Number of alleles per
locus and the observed and expected heterozygosities are presented in
142
Table 1. Analyses of allele frequencies in GENEPOP V3.1d (Raymond &
Rousset 1995) indicated loci Mr-89 (P = 0.013) and Mr-95 (P = 0.025)
deviated from Hardy-Weinberg expectations due to heterozygote deficiency,
which may result from presence of null alleles or a Wahlund effect. No
evidence for linkage disequilibrium was detected in locus-pair comparisons.
We tested the efficacy of the six microsatellite loci in ten individuals sampled
from across the entire distribution of the ‘western’ form of M. rosenbergii (de
Bruyn et al. 2004 a, c), but none amplified successfully. This result adds
further support to the contention that the two forms of M. rosenbergii have
been genetically isolated for a significant evolutionary time frame (de Bruyn
et al. 2004 a). We are presently in the process of developing microsatellites
specifically for use in ‘western form’ populations.
This suite of microsatellite markers should prove useful for genetic
studies of both wild and cultured stocks of the eastern form of M. rosenbergii,
and provides the foundation for future nuclear DNA-based studies that will
complement previous research on mitochondrial, allozyme and morphological
variation in M. rosenbergii. Table 1. PCR primer sequences, number of alleles, size range, and
observed and expected heterozygosity for microsatellite loci in the eastern
form of Macrobrachium rosenbergii. Genbank accession nos: AY791965-
AY791970.
Primer sequences 5´- 3´ Annealingtemp(°C)
Repeat motif
No. of alleles
Size range
HO HE
Mr-70
F: CATCAGCATTTGGCAGTCAC R: GGGGATCGTTCCGTAGTTTT
52 (ATT)7 12 235-283
22 23.83
Mr-74
F: TGTGAAAGGAAGTAAACTG R: GCAATAGATAAGTGAACCTC
57 (CT)32 16 126-174
22 23.75
Mr-78
F: GGACAAAACAAGCAGAAAAGR: CAGGCACAGTGATAACCAA
60 (GA)31 16 102-144
23 26.99
Mr-88
F: CTTCGGGTGTCATTGACCTT R: CCGGGGATCTGAGGTTTTAT
48 (GA)32 18 176-218
26 25.28
Mr-89
F: CTCAAAAGGCGGGATTGATA R: CCCGGGGATCATGTATTCTA
48 GAA(GA)17GA
A
13 252-278
19 22.39
Mr-95
F: CCAACTATAAAACAAACGAC R: TAATTTTCTTTCAACTGCTT
54 (GA)33 15 156-190
21 24.70
143
ACKNOWLEDGMENTS MdB received financial support from an Australian Postgraduate Award.
MdB’s Australian fieldwork was supported partly by research grants from the
Australian Geographic Society, the Ecological Society of Australia and the
Linnean Society of New South Wales. We thank QUT Ecological Genetics
lab members for assistance with microsatellite optimisation.
REFERENCES de Bruyn M, Wilson JC, Mather PB (2004a) Huxley’s Line demarcates
extensive genetic divergence between eastern and western forms of the
giant freshwater prawn, Macrobrachium rosenbergii. Molecular
Phylogenetics and Evolution, 30, 251-257.
de Bruyn M, Wilson JC, Mather PB (2004b) Reconciling geography and
genealogy: phylogeography of giant freshwater prawns from the Lake
Carpentaria region. Molecular Ecology, 13, 3515-3526.
de Bruyn M, Nugroho E, Hossain MM, Wilson JC, Mather PB (2005)
Phylogeographic evidence for the existence of an ancient
biogeographic barrier: the Isthmus of Kra Seaway. Heredity, 94, 370-
378.
Hedgecock D, Stelmach DJ, Nelson K, Lindenfelser ME, Malecha SR (1979)
Genetic divergence and biogeography of natural populations of
Macrobrachium rosenbergii. Proceedings of the World Mariculture
Society, 10, 873-879.
Lindenfelser ME (1984) Morphometric and allozymic congruence: evolution in
the prawn Macrobrachium rosenbergii (Decapoda: Palaemonidae).
Systematic Zoology, 33, 195-204.
Raymond M, Rousset F (1995) GENEPOP (version 1.2): population genetics
software for exact tests and ecumenicism. Journal of Heredity, 86, 248-
249.