Inferring biogeography from the evolutionary history of the giant freshwater prawn (Macrobrachium rosenbergii)

Mark de Bruyn B.App.Sc. (Hons), QUT

School of Natural Resource Sciences

Queensland University of Technology

Gardens Point Campus

Brisbane, Australia

This dissertation is submitted as a requirement of the

Doctor of Philosophy Degree

December 2005

2

Table of Contents

Table of Contents .....................................................................................................2

Statement of Original Authorship ...........................................................................3

Acknowledgments....................................................................................................4

Abstract.....................................................................................................................5

List of Publications ..................................................................................................7

CHAPTER 1. General Introduction and Literature Review ...................................8

Statement of Joint Authorship ..............................................................................26

CHAPTER 2. Huxley’s Line demarcates extensive genetic divergence between

eastern and western forms of the giant freshwater prawn, Macrobrachium

rosenbergii. .............................................................................................................27

Statement of Joint Authorship ..............................................................................43

CHAPTER 3. Reconciling geography and genealogy: phylogeography of giant

freshwater prawns from the Lake Carpentaria region. .......................................44

Statement of Joint Authorship ..............................................................................74

CHAPTER 4. Phylogeographic evidence for the existence of an ancient

biogeographic barrier: the Isthmus of Kra Seaway. ...........................................75

Statement of Joint Authorship ............................................................................100

CHAPTER 5. Past climate change has mediated evolution in giant freshwater

prawns...................................................................................................................101

CHAPTER 6. Final Discussion and Conclusion.................................................128

Statement of Joint Authorship ............................................................................138

APPENDIX 1. Microsatellite loci in the eastern form of the giant freshwater

prawn (Macrobrachium rosenbergii) ..................................................................139

3

Statement of Original Authorship This work has not previously been submitted for a degree or diploma at any

other educational institution. To the best of my knowledge, this thesis

contains no material from any other source, except where due reference is

made.

Mark de Bruyn

1 December, 2005

4

Acknowledgments

This thesis is dedicated to my father, Jack de Bruyn, who passed away

during the course of my Ph.D.

Thank you to my supervisors, John Wilson and Peter Mather, for all

their help and support over the years. In particular, thanks Peter for a

fantastic project concept and for your excellent mentoring and support. I

would like to thank my mother and father for all their love and support over

the years, and for instilling in me a love of nature at an early age - those

camping trips in Namibia were fantastic Mom. I would also like to thank the

rest of my family and my friends for all their support and understanding,

particularly during those times (of which there have been many of late) when

I have been too absorbed in my studies to fully appreciate them - thanks and

sorry guys. Finally, I would like to thank my partner, best friend, and the love

of my life, Kriket, for all her help, support, generosity and love over the past

10 years (how many?!!), a large proportion of which has been taken up by my

studies. Thanks babe - you’re a legend!

I would like to acknowledge Steve Caldwell, a good friend and

colleague who died tragically in a 4WD accident while conducting fieldwork in

northern Australia in 2003. I thank Kriket Broadhurst, Steve Caldwell, Natalie

Baker, Daisy Wowor, Peter Ng, David Milton, John Short, Peter Davie, David

Harvey, Estu Nugroho, Md. Mokarrom Hossain, Melchor Tayamen,

Nuanmanee Pongthana and colleagues, Nguyen Van Hao, Tran Ngoc Hai,

Pek Yee Tang, Selvaraj Oyyan, Abol Munafi Ambok Bolong and anyone else

who may have helped in acquiring specimens for this study. Jane Hughes,

David Hurwood, Andrew Baker, Peter Prentis, and several anonymous

manuscript reviewers provided helpful suggestions that improved this thesis

considerably. Thanks to all in the QUT Ecological Genetics Lab and

Ecological Genetics Group (EGG) for suggestions, advice and assistance. I

received financial support from an Australian Postgraduate Award and a QUT

write-up grant, and my fieldwork was supported partly by research grants

from the Australian Geographic Society, the Ecological Society of Australia

and the Linnean Society of New South Wales, all of which are gratefully

acknowledged.

5

Abstract

The discipline of historical biogeography seeks to understand the contribution

of earth history to the generation of biodiversity. Traditionally, the study of

historical biogeography has been approached by examining the distribution

of a biota at or above the species level. While this approach has provided

important insights into the relationship between biological diversity and earth

history, a significant amount of information recorded below the species level

(intraspecific variation), regarding the biogeographical history of a region,

may be lost. The application of phylogeography - which considers information

recorded below the species level - goes some way to addressing this

problem. Patterns of intraspecific molecular variation in wide-ranging taxa

can be useful for inferring biogeography, and can also be used to test

competing biogeographical hypotheses (often based on the dispersal-

vicariance debate). Moreover, it is argued here that phylogeographical

studies have recently begun to unite these two disparate views, in the

recognition that both dispersal and vicariance have played fundamental roles

in the generation of biodiversity.

Freshwater dependent taxa are ideal model organisms for the current

field of research, as they reflect well the underlying biogeographical history of

a given region, due to limited dispersal abilities - their requirement for

freshwater restricts them. To this end, this study documented the

phylogeographical history of the giant freshwater prawn (Macrobrachium

rosenbergii) utilising both mitochondrial (COI & 16S) and nuclear

(microsatellite) markers. Samples (n = ~1000) were obtained from across

most of the natural distribution of M. rosenbergii [Southern and South East

(SE) Asia, New Guinea, northern Australia]. Initial phylogenetic analyses

identified two highly divergent forms of this species restricted to either side of

Huxley’s extension of Wallace’s Line; a pattern consistent with ancient

vicariance across the Makassar Strait. Subsequent analyses of molecular

variation within the two major clades specifically tested a number of

biogeographical hypotheses, including that: 1.) a major biogeographical

transition zone between the Sundaic and Indochinese biotas, located just

north of the Isthmus of Kra in SE Asia, results from Neogene marine

6

transgressions that breached the Isthmus in two locations for prolonged

periods of time; 2.) Australia’s Lake Carpentaria [circa 80 000 - 8 500 before

present (BP)] facilitated genetic interchange among freshwater organisms

during the Late Pleistocene; 3.) sea-level fluctuations during the Pleistocene

constrained evolutionary diversification of M. rosenbergii within the Indo-

Australian Archipelago (IAA); and 4.) New Guinea’s Fly River changed

course from its current easterly outflow to flow westwards into Lake

Carpentaria during the Late Pleistocene. The results support hypotheses 1-3,

but not 4. The potential for phylogeography to contribute significantly to the

study of historical biogeography is also discussed.

Key words: historical biogeography, phylogeography, freshwater prawn, SE

Asia, Australia, population genetic, demography, Lake Carpentaria, Isthmus

of Kra, Indo-Australian Archipelago

7

List of Publications

de Bruyn M, Wilson JC, Mather PB (2004) Huxley’s Line demarcates

extensive genetic divergence between eastern and western forms of the

giant freshwater prawn, Macrobrachium rosenbergii. Molecular Phylogenetics

and Evolution, 30, 251-257 (Short Communication).

de Bruyn M, Wilson JC, Mather PB (2004) Reconciling geography and

genealogy: phylogeography of giant freshwater prawns from the Lake

Carpentaria region. Molecular Ecology, 13, 3515-3526.

de Bruyn M, Nugroho E, Hossain MM, Wilson JC, Mather PB (2005)

Phylogeographic evidence for the existence of an ancient biogeographic

barrier: the Isthmus of Kra Seaway. Heredity, 94, 370-378.

de Bruyn M, Mather PB (2005) Past climate change has mediated evolution

in giant freshwater prawns. Proceedings of the Royal Society of London B

(Submitted, In Review).

Chand V, de Bruyn M, Mather PB (2005) Microsatellite loci in the eastern

form of the giant freshwater prawn (Macrobrachium rosenbergii). Molecular

Ecology Notes, 5, 308-310 (Technical Note).

8

Inferring Biogeography from the Evolutionary History of the Giant Freshwater Prawn (Macrobrachium rosenbergii)

CHAPTER 1. General Introduction and Literature Review

Description of research program investigated: Historical biogeography as

a discipline is concerned with documenting the influences of past events and

processes on the geographical distributions of taxa. Species are therefore

the fundamental units of analyses in historical biogeographical studies, and a

phylogenetic ‘tree’ can be used to describe the observed genealogical

pattern among related taxa. Alternatively, a general area cladogram can be

generated based on the distributional limits of multiple taxa, which may

illustrate a shared geographical history. These approaches, while providing

considerable insights into the historical effects of earth history events on the

distribution of biological diversity, have an obvious limitation. Biological

diversity is structured hierarchically at all levels, from the community level to

the intraspecific level and below, that is, variation within a single

species/individual. Intraspecific variation can also be strongly influenced by

earth history events and/or ecological processes within a given region, and

thus can provide information on the historical biogeography of that region;

however, this history may go undiscovered if research is focussed only at or

above the species level. This will be most problematical when species have

broad distributions, as an historical biogeographical approach will by default

infer a dispersalist scenario to explain these wide-ranging distributions. In

such a situation, considerable information about the biogeographical history

of a region, which may be recorded at the intraspecific level, may be lost.

To address this issue, biogeographical questions have in recent times

been examined using analyses of intraspecific variation, a discipline known

as Phylogeography, and defined as “…the study of the principles and

processes governing the geographical distributions of genealogical lineages,

including those at the intraspecific level” (Avise 1994, p. 233). The origins of

this discipline can be traced back to the advent of genetic techniques that

enabled rapid and fairly inexpensive screening of variation within and among

species, thus largely eliminating a reliance on morphological traits as

9

character states for analyses. An early classical example of the use of

genetic data in reconstructing genealogical relationships to infer

biogeographical history was that of Hampton Carson (1970, 1983), who

established a phylogeny and a network of derived Drosophila species on the

Hawaiian Archipelago based on polytene chromosome rearrangements. He

used this information to infer routes of colonisation and mechanisms for

speciation arising from the volcanic nature of the relatively young (in

geological terms) Hawaiian island-chain.

Early influential phylogeographical studies utilised mitochondrial

restriction fragment length polymorphisms (mtRFLPs) to reconstruct

intraspecific haplotype trees (e.g. Avise et al. 1979). Many of these early

studies focussed on genetic variation within small mammals and marine

fishes in the southeastern USA (reviewed in Avise 1994). With the advent of

polymerase chain reaction (PCR) in the early 1980’s, DNA sequence

variation could be used directly to determine genealogical relations within

and among species. For the first time, DNA-based studies incorporated both

a spatial and temporal perspective, as mutational sequence changes

accumulate over time (Arbogast et al. 2002). This was important, as earth-

history events leave two distinct imprints on biological diversity - that of

geography and time. A robust phylogeographical analysis of a species’

biogeographical history would thus incorporate inferences about the

geographical relationships among terminal taxa (i.e. individuals), and the

chronology of causal events resulting in such a pattern.

When traditional historical biogeographical and/or phylogeographical

patterns are congruent in indicating disjunctions across multiple taxa (e.g.

comparative phylogeography; Bermingham & Avise 1986), the distinction

between the two methods is minimised. The explanation for the observed

pattern can be relatively straightforward, that is, a widespread ancestral biota

was fragmented by some vicariant event. However, the two approaches differ

widely in their ability to explain incongruent patterns. Incongruent historical

biogeographical patterns (i.e. an unresolved area cladogram or phylogenetic

tree) are difficult to reconcile because of the age of the events under

investigation; the true biogeographical history may be obscured by dispersal,

extinctions of taxa, and/or overlapping earth history events (Cracraft 1988) -

10

in other words “the trace grows colder with time” (Zink 2002). Nonetheless,

traditional historical biogeographical studies may be more appropriate for

investigating relatively ancient earth history events when a good resolution of

genealogical relationships and/or area cladograms is achieved. In contrast,

phylogeographical studies often deal with relatively recent events, and

genealogical relationships may reveal species’ histories whether the

phylogeny is resolved or not.

A resolved or structured gene tree will exhibit a pattern of reciprocal

monophyly among geographical lineages. Reciprocal monophyly has been

described as the “currency” of phylogeography (Zink 2002), and permits the

rejection of the hypothesis that (reciprocally monophyletic) groups are

exchanging genes. Moreover, it is possible to determine how long the groups

have been isolated from each other, either in a relative sense, or by applying

a molecular clock to the data (Arbogast et al. 2002; but see Marko 2002). In

contrast to the view put forward by some cladistic biogeographers (e.g.

Nelson & Platnick 1981; Ebach & Humphries 2002), many recent studies (e.g.

Donoghue & Moore 2003; de Queiroz 2005) report that the history of a

species is equally likely to be shaped by gene flow and range expansion

events as they are by a static history of isolation resulting from vicariance.

Such processes can result in an unstructured, or even a star-like gene tree

(Slatkin & Hudson 1991). This apparent lack of resolution is often mistakenly

believed to be caused by conflicting synapomorphies (i.e. characters that are

shared by a group of sequences due to recentness of common ancestry).

This is a major problem for historical biogeographical inference and for

analyses based on morphological characters in general; although in fact it

usually results from autapomorphies (i.e. a character state that is seen in a

single sequence and no other) (Zink 2002). No matter the amount of

sequence information available, the shape of the phylogeny will remain

unstructured as it illustrates a dynamic history of non-isolation.

To circumvent this lack of resolution, new population genetic methods

were developed, based on coalescent theory (Kingman 1982 a, b), that do

not rely on a traditional structured phylogenetic tree to describe relationships

among genotypes (Excoffier et al. 1992; Crandall & Templeton 1993;

Excoffier & Smouse 1994; and others). Today these methods are collectively

11

known as minimum-spanning trees/networks (see Smouse 1998 for

discussion, and review by Posada & Crandall 2001). An unstructured

phylogeographical tree still allows for further inferences to be made about

biogeographical history. Population genetic analyses based on coalescent

theory can be applied to the spatial distribution of genotypes to provide

information about the relative roles of gene flow (effective dispersal) (Slatkin

1989; Hudson et al. 1992), and vicariance. Similarly, genetic variation within

and among populations can provide information about the demographic

history of a species that is relevant to the biogeographical history of a region.

For example, these data can be used to estimate effective population size

(Fu 1994), and to determine historical changes in population size (e.g. past

bottlenecks, range expansions; Rogers & Harpending 1992), among many

other applications (see Emerson et al. 2001 for review).

These developments have been accompanied by a move away from

earlier descriptive phylogeographical studies that simply overlaid

genealogical relationships upon geography, to a more formal framework that

has allowed the testing of specific biogeographical hypotheses. When the

geological history of a region is well documented, biogeographical

hypotheses can be erected a priori, and tested using phylogeographical

methodology. Moreover, a phylogeographical approach may allow one to

distinguish between competing hypotheses when such hypotheses exist (e.g.

Wallis & Trewick 2001). Alternatively, when the geological history of a region

is poorly understood, phylogeographical analyses may reveal unexpected

patterns (e.g. da Silva & Patton 1998) that can be used as testable

hypotheses by earth scientists. The development of Nested Clade Analysis

(NCA; Templeton et al. 1995) allows such an approach. The first step in NCA

is to test statistically whether there is an actual association between

geography and genealogy. NCA then provides an explicit a posteriori

framework for determining possible causes for the observed pattern of

intraspecific variation, based on predictions from population genetic and

coalescent theory. ‘Statistical phylogeography’ (sensu Knowles & Maddison

2002) is another method that has recently been advocated that allows one to

distinguish between competing hypotheses. This method uses a simulation

approach to measure the discord between alternative tree topologies based

12

on specific a priori hypotheses regarding population history. Similarly, the

application of likelihood frameworks (Goldman et al. 2000) to molecular data

allows an explicit test of competing biogeographical hypotheses based on

independently derived data (e.g. climatological, geological, palaeontological).

Although most of the early phylogeographical studies focussed on

small mammals and marine fishes (reviewed in Avise 1994, 2000), Avise and

co-workers recognised that phylogeographical patterns in freshwater aquatic

taxa could provide good resolution for many biogeographical questions. One

of their early influential papers found that intraspecific genetic breaks were

congruent across four freshwater fish species, and were concordant with

previously described historical biogeographical boundaries; that is, the

distributional limits of species (Bermingham & Avise 1986). This good

resolution results from the fact that historical connections among discrete

drainages (and therefore gene flow) relies directly on the underlying earth

history of the region, which is not always the case in more mobile terrestrial

or avian taxa. Thus, patterns observed in freshwater fauna permit strong

inferences to be made about the biogeographical history of a given region

(Lundberg 1993). Nonetheless, this fact is often overlooked, and

phylogeographical studies of freshwater aquatic taxa are limited, compared

with those, for example, on terrestrial mammals or birds.

Employing phylogeographical approaches to the study of

biogeography in the Indo-Australian Archipelago (IAA) may prove particularly

useful, owing to this regions’ dynamic earth history. Pleistocene sea-level

changes (eustasy) are believed to have played an important role in the

dispersal of both aquatic and terrestrial taxa within this region (Dodson et al.

1995; Voris 2000), which may have somewhat obscured historical

biogeographical relationships. Eustatic changes are also likely to have

influenced the intraspecific genetic structuring of many freshwater taxa,

although the application of phylogeographical techniques should prove useful

in elucidating the regions’ true biogeographical history. The Torres Strait

land-bridge, which connected Australia and New Guinea periodically during

the Pleistocene, is one such example of a major eustatic influence on the

Australian/New Guinean biota. This land bridge was exposed for much of the

Pleistocene, due to lowered sea levels resulting from climatic fluctuations and

13

associated glacial maxima (Voris 2000). The Torres Strait land bridge played

not only a significant role in the vicariance of marine taxa restricted to either

side of this land bridge, but also allowed an interchange of elements of the

terrestrial and freshwater biota between Australia and New Guinea. For

example, some riverine drainage basins that are today restricted to Australia

or New Guinea, respectively, drained into Lake Carpentaria (Torgersen et al.

1985; Voris 2000) during the Pleistocene. This may have provided ample

opportunity for effective dispersal (gene-flow) of freshwater organisms among

river drainages that are today isolated by a marine barrier. Indeed, the

inundation of Lake Carpentaria by rising sea-levels is believed to have

occurred only 8500 years BP (Chivas et al. 2001). Similarly, what is today the

SE Asian mainland was connected in recent geological time (circa 1 million

years BP - 10 000 years BP) to a number of SE Asian islands, including

Sumatra, Borneo, Java, Bali and parts of the Philippine Archipelago (e.g.

Palawan) (Voris 2000; see Fig.1). Thus, the phylogeographical structure of

freshwater taxa within this region is likely to reflect a dynamic history of both

vicariance and dispersal influenced by ancient earth-history events, and more

recent (Pleistocene epoch) sea-level fluctuations; however, such studies are

rare (but see Dodson et al. 1995; Usmani et al. 2003; McConnell 2004).

Contrary to land connections in the region that may have facilitated

dispersal of terrestrial and freshwater taxa in the recent past, long-standing

barriers to dispersal such as the deep-sea trench of the Makassar Strait

(Indonesian Archipelago; Fig. 1) would presumably have impeded dispersal

for these same taxa. The Makassar Strait acts as the western boundary for

the Australian and Asian biotic transition zone (Wallacea). Indeed, of all

vertebrate groups, the distributions of primary freshwater fish fauna most

clearly demarcate this boundary (Moss & Wilson 1998). This ancient deep-

water barrier was formed in the early Tertiary (Moss & Wilson 1998), and was

first recognised by Wallace in the nineteenth century (Wallace 1859). Today,

this biogeographical boundary is known as ‘Wallace’s Line’. Later, Huxley

(1868) modified the path of this line, based on zoological data, and extended

it north into the Philippines. Huxley placed his line to the east of Palawan (the

most westerly of the Philippine islands), effectively linking Palawan

14

biogeographically to Borneo and mainland Asia, and separating it from the

rest of the Philippine Archipelago (Fig. 1).

Major zoogeographic boundaries such as these often result from far

more ancient earth-history events, rather than recent climatic fluctuations and

associated eustatic change - namely plate-tectonic movements. Ancient plate

tectonics may have played a fundamental role in the evolutionary history of

many IAA taxa. The islands of SE Asia form one of the most geologically

complex regions in the world. This is due to their position at the meeting point

of the two former supercontinents of Laurasia and Gondwanaland (Hall 1996).

The islands to the west of this region, including part of Borneo and the whole

of Palawan are on the Sunda continental shelf and are Laurasian in origin.

The islands to the east of this region, including New Guinea, are on the Sahul

shelf and are essentially Gondwanan in origin (Hall 1996). The islands in the

middle, including Sulawesi, the Moluccas and most of the islands in the

Philippine Archipelago, lie in deep sea between the two shelves, which may

have posed a formidable barrier to the dispersal of many freshwater and

terrestrial taxa.

The tectonic history of the Philippine Archipelago, in particular, is

extremely complex. Reconstructions by Hall (1996) suggest that the main

landmass of the Philippines originated as a series of island arcs far out in the

Pacific Ocean more than 50 million years ago (MYA). As the Australian

continent moved northward towards the Asian continent, the plate tectonic

movement formed undersea volcanoes, which gradually emerged from the

sea and underwent considerable tectonic movement and rotation. As recently

as the Miocene (~15 MYA), Mindanao, for example, was widely separated

from Luzon and situated east of the Sulawesi landmass and only a short

distance north of the New Guinean part of the Australian plate. The Philippine

Archipelago may have only taken on its’ current shape over the last 5-10

million years, but the geological history of the region is still poorly understood.

Similarly, Sulawesi (Fig. 1) has a complex history, and is believed to be a

composite landmass of different geological origins. Geologists (Hall 1998;

Moss & Wilson 1998) suggest that: (1.) the SE arm of the island and possibly

parts of the northern arm may have been emergent approximately 20 MYA;

(2.) central Sulawesi was emergent during at least part of the Miocene; (3.)

15

the microcontinental blocks of Banggai-Sula and Buton-Tukang Besi, which

rifted from the Australian-New Guinea continent during the late Mesozoic,

were accreted onto eastern Sulawesi during the Miocene or Pliocene; and

(4.) Sulawesi finally took on its present shape between the Pliocene and the

present. For Wallacea as a whole, Hall (2001) postulated that most of the

smaller islands only emerged within the last 5 million years, and therefore the

biota can only have populated much of Wallacea during this period. Thus,

phylogeographical data on widely-distributed species that occur in the SE

Asian/Australian region may be useful not only for determining mechanisms

that may have shaped the distribution of biodiversity in the region, but also

for unraveling the region’s geological history. This is particularly relevant for

landmasses as geologically complex as Sulawesi and the Philippine

Archipelago.

The decapod crustacean Macrobrachium rosenbergii (giant freshwater

prawn) is an ideal candidate species to investigate the biogeography of this

region using phylogeographical approaches because it: (1.) occurs in

freshwater, (2.) is widespread, and (3.) is locally abundant across its’ natural

range. M. rosenbergii is distributed from Pakistan in the west to southern

Vietnam in the east, and south across SE Asia to New Guinea and northern

Australia. M. rosenbergii is most often associated with coastal river systems,

as it is freshwater dependent as an adult, but requires brackishwater for

breeding and larval development (New & Singholka 1985); however, M.

rosenbergii has also occasionally been found in full marine conditions

(Johnson 1973; Short 2000). Indeed, this species occurs on some isolated de

novo oceanic islands (e.g. Christmas Island & Palau; Short 2000), although

introductions by humans, while unlikely, cannot be discounted. Laboratory

studies suggest, however, that adults are incapable of surviving full marine

conditions for prolonged periods (> 1 week), although a very small

percentage of postlarvae may survive for up to 20 days (Smith et al. 1976;

Sandifer & Smith 1979). Gravid females migrate from freshwater into

estuarine areas to spawn, where free-swimming larvae hatch from eggs

attached to the females’ abdomen. Fully mature M. rosenbergii females are

capable of producing up to 100 000 eggs in a single spawning event (New &

Singholka 1985). Larval duration in M. rosenbergii varies from 3-6 weeks,

16

after which juveniles migrate upstream to freshwater habitat, with massive

migrations of juveniles, estimated at 500 to 1000 million individuals, recorded

for some northern Australian rivers (e.g. Daly, Roper, Fitzroy & Ord Rivers;

Anonymous 1997).

Two sub-species of M. rosenbergii have been recognised by a number

of researchers, and stocks divided into ‘eastern’ and ‘western’ forms,

although the species is still considered a single taxon, i.e. M. rosenbergii. De

Man (1879) and Johnson (1973) based their sub-divisions on traditional

systematic characters (morphology). Lindenfelser (1984) analysed

morphometric and allozyme data and concluded that M. rosenbergii should

be considered a species complex with species boundaries corresponding

approximately with Wallace’s Line. Malecha (1977, 1987) and co-workers

(Hedgecock et al. 1979) also examined stock structure in M. rosenbergii and

identified 3 ‘geographical races’; an Eastern, a Western and an Australian

‘race’, based on allozyme and morphological data. Significant intraspecific

variation was also evident between the only two Australian sites they

sampled (Derby, Western Australia & Darwin, Northern Territory; Malecha

1977). Thus, there are strong, but somewhat contradictory, indications that M.

rosenbergii could be polytypic both regionally and perhaps even within

regions. Early systematic studies are likely to be limited in scope, however,

for two reasons; first, allozymes are highly conserved in many decapod

crustaceans (Nelson & Hedgecock 1980); and second, morphological data

can be ambiguous in freshwater prawns, because morphological traits can be

modified by exposure to different environmental conditions during larval

development (see Dimmock et al. 2004 for work on a related Australian

Macrobrachium species).

Thus, the overall objectives of this study were to: relate the roles

of earth history events and ecological processes to the observed population

genetic structure of wild populations of Macrobrachium rosenbergii, via a

phylogeographical approach. A number of molecular ‘markers’ are available

that may be employed in such phylogeographical studies, although

mitochondrial DNA’s (mtDNA) apparent lack of recombination, rapid rate of

molecular evolution, and uniparental (maternal) inheritance has made this the

marker of choice in such studies on animal species (Riddle 1996). The

17

effective population size of the mtDNA genome is approximately one-fourth

that of the nuclear genome (Avise et al. 1987). These features result in rapid

geographical sorting of lineages through the stages of polyphyly and

paraphyly, to eventual reciprocal monophyly in the absence of gene flow - in

other words, good resolution of geographical patterns of variation may be

achieved. Moreover, discrete regions of the mitochondrial genome evolve at

different rates, allowing one to choose a region that may best address the

time frame under investigation. Two mtDNA markers were utilised in this

study from mtDNA regions that exhibit different evolutionary rates - the

slower evolving 16S ribosomal RNA (16S) gene and the more rapidly

evolving cytochrome c oxidase subunit I (COI) gene. Microsatellites are bi-

parentally inherited nuclear markers that exhibit high mutation rates and often

show considerable population variation, and while the potential for

homoplasy exists, they can provide good insights into both phylogeny and

population history when applied with care (e.g. Angers & Bernatchez 1998;

Grant et al. 2000). A number of microsatellite markers were developed to

complement mtDNA analyses for this study, and were used to address

specific questions about the extent of recent gene flow among subsets of the

populations studied here.

Hence, the specific aims of this study were to: (1.) document the

distribution of genetic diversity and levels of genetic differentiation within and

among wild populations of M. rosenbergii; (2.) relate these findings to causal

mechanisms that may have generated and maintained the observed

population genetic structure of wild M. rosenbergii populations; and (3.) utilise

a molecular approach (phylogeography) to test a number of specific

hypotheses regarding the biogeographical history of the SE Asian/Australian

region.

18

Account of research progress linking the research papers:

The initial research paper (Chapter 2) was essentially a pilot study that

examined the distribution of the eastern and western forms of M. rosenbergii

using a molecular marker (16S mtDNA). The second research paper

(Chapter 3) examined the phylogeographic history of M. rosenbergii sampled

from Australia and New Guinea (eastern form of M. rosenbergii), to identify

the role that Lake Carpentaria played in the evolutionary history of

freshwater-dependent organisms from this region. The third research paper

(Chapter 4) examined the phylogeographic history of the western (Asian)

form of M. rosenbergii, and specifically tested for the influence of an ancient

postulated seaway on population genetic structuring in M. rosenbergii. The

fourth research paper (Chapter 5) extended the sampling design of Chapter 3

to incorporate samples from two de novo oceanic islands, and also extended

the molecular analyses to incorporate nuclear markers (microsatellites). The

specific aim of this study was to assess the influence of Pleistocene climatic

change on the evolutionary history of M. rosenbergii from the eastern Indo-

Australian Archipelago. The fifth and final research paper (Appendix 1) is a

technical note that describes the isolation and characterisation of the six

microsatellite loci (in the eastern form of M. rosenbergii) utilised in Chapter 5.

Please note: Figures and Tables are re-initialised in each chapter to maintain

the independence of each published research paper.

Figure 1. Study region indicating landmasses referred to in Chapter 1. Major river systems are shown.

Huxley’s Line

Wallace’s Line Makassar Strait

Philippine Archipelago Palawan

Sulawesi Sumatra

Borneo (Kalimantan)

New Guinea

Australia

Java Bali

SE Asian Mainland

Mindanao

20

REFERENCES Angers B, Bernatchez L (1998) Combined use of SMM and non-SMM

methods to infer fine structure and evolutionary history of closely related

Brook Charr (Salvelinus fontinalis, Salmonidae) populations from

microsatellites. Molecular Biology and Evolution, 15, 143-159.

Anonymous (1997) Aborigine prawn hopes. Fish Farming International, 24(9), 9.

Arbogast BS, Edwards SV, Wakeley J, Beerli P, Slowinski JB (2002)

Estimating divergence times from molecular data on phylogenetic and

population genetic timescales. Annual Review of Ecology and

Systematics, 33, 707-740.

Avise J (1994) Molecular Markers, Natural History and Evolution. Chapman &

Hall, New York.

Avise (2000) Phylogeography: The History and Formation of Species.

Harvard University Press, Cambridge, MA.

Avise J, Giblin-Davidson C, Laerm J, Patton J, Lansman R (1979)

Mitochondrial DNA clones and matriarchal phylogeny within and among

geographic populations of the pocket gopher, Geomys pinetis.

Proceedings of the National Academy of Sciences of the USA, 76, 6694-6698.

Avise JC, Arnold J, Ball RM, Bermingham E, Lamb T, Neigel JE, Reeb CA,

Saunders NC (1987) Intraspecific phylogeography: the mitochondrial

DNA bridge between population genetics and systematics. Annual

Review of Ecology and Systematics, 18, 489-522.

Bermingham E, Avise JC (1986) Molecular zoogeography of freshwater

fishes in the southeastern United States. Genetics, 113(4), 939-965.

Carson HL (1970) Chromosome tracers of the origin of species. Science, 168, 1414-1418.

Carson HL (1983) Chromosomal sequences and the interisland colonisation

in Hawaiian Drosophila. Genetics, 103, 465-482.

Chivas AR, Garcia A, van der Kaars S et al. (2001) Sea-level and

environmental changes since the last interglacial in the Gulf of

Carpentaria, Australia: an overview. Quartenary International, 83-85, 19-46.

21

Cracraft (1988) Deep-history biogeography: retrieving the historical pattern of

evolving continental biotas. Systematic Zoology, 37, 221-236.

Crandall KA, Templeton AR (1993) Empirical tests and some predictions

from coalescent theory with applications to intraspecific phylogeny

reconstruction. Genetics, 134, 959-969.

da Silva MNF, Patton JL (1998) Molecular phylogeography and the evolution

and conservation of Amazonian mammals. Molecular Ecology, 7, 475-

486.

De Man JG (1879) On some species of the genus Palaemon Fabr. with

descriptions of two new forms. Notes Leyden Museum, 1, 165-184.

de Queiroz A (2005) The resurrection of oceanic dispersal in historical

biogeography. Trends in Ecology and Evolution, 20, 68-73.

Dimmock A, Williamson I, Mather PB (2004) The influence of environment on

the morphology of Macrobrachium australiense (Decapoda:

Palaemonidae). Aquaculture International, 12, 435-456.

Dodson JJ, Colombani F, Ng PKL (1995) Phylogeographic structure in

mitochondrial DNA of a South-east Asian freshwater fish, Hemibagrus

nemurus (Siluroidei; Bagridae) and Pleistocene sea-level changes on

the Sunda shelf. Molecular Ecology, 4, 331-346.

Donoghue MJ, Moore BR (2003) Toward an integrative historical

biogeography. Integrative and Comparative Biology, 43, 261-270.

Ebach MC, Humphries CJ (2002) Cladistic biogeography and the art of

discovery. Journal of Biogeography, 29, 427-444.

Emerson BC, Paradis E, Thébaud C (2001) Revealing the demographic

histories of species using DNA sequences. Trends in Ecology and

Evolution, 16, 707-716.

Excoffier L, Smouse PE (1994) Using allele frequencies and geographic

subdivision to reconstruct gene trees within a species: Molecular

variance parsimony. Genetics, 136, 343-359.

Excoffier L, Smouse PE, Quattro JM (1992) Analysis of molecular variance

inferred from metric distances among DNA haplotypes: Application to

human mitochondrial DNA restriction sites. Genetics, 131, 479-491.

22

Fu Y-X (1994) Estimating effective population size or mutation rate using the

frequencies of mutations of various classes in a sample of DNA

sequences. Genetics, 138, 1375-1386.

Grant PR, Grant BR, Petren K (2000) The allopatric phase of speciation: the

sharp-beaked ground finch (Geospiza difficilis) on the Galapagos

islands. Biological Journal of the Linnean Society, 69, 287-317.

Goldman N, Anderson JP, Rodrigo AG (2000) Likelihood-based tests of

topologies in phylogenetics. Systematic Biology, 49, 652-670.

Hall R (1996) Reconstructing Cenozoic Asia. In ‘Tectonic Evolution of

Southeast Asia.’ (Eds. R. Hall & D.J. Blundell), pp. 153-184. The

Geological Society Publishing House, Bath, UK.

Hall R (1998) The plate tectonics of Cenozoic SE Asia and the distribution of

land and sea. In ‘Biogeography and Geological Evolution of SE Asia.’

(Eds. R. Hall & J.D. Holloway), pp. 99-131. Backhuys Publishers,

Leiden, The Netherlands.

Hall R (2001) Cenozoic reconstructions of SE Asian and the SW Pacific:

changing patterns of land and sea. In ‘Faunal and Floral migrations and

Evolution in SE Asia-Australasia.’ (Eds. I. Metcalfe, J.M.B. Smith, M.

Morwood, I. Davidson), pp. 35-56. A.A. Balkema Publishers, Lisse.

Hedgecock D, Stelmach DJ, Nelson K, Lindenfelser ME, Malecha SR (1979)

Genetic divergence and biogeography of natural populations of

Macrobrachium rosenbergii. Proceedings of the World Mariculture

Society, 10, 873-879.

Hudson RR, Slatkin M, Maddison WP (1992) Estimation of levels of gene

flow from DNA sequence data. Genetics, 132, 583-589.

Huxley TH (1868) On the classification and distribution of the

Alectoromorphae and Heteromorphae. Proceedings of the Zoological

Society of London, 294-319.

Johnson DS (1973) Notes on some species of the genus Macrobrachium

(Crustacea: Decapoda: Caridea: Palaemonidae). Journal of the

Singapore National Academy of Sciences, 3(3), 273-291.

Kingman J (1982 a) The coalescent. Stochastic Processes and their

Applications, 13, 235-248.

23

Kingman J (1982 b) On the genealogy of large populations. In ‘Essays in

Statistical Science.’ (Eds. J. Gani & E. Hannan), pp. 27-43. Applied

Probability Trust, London, UK.

Knowles LL, Maddison WP (2002) Statistical phylogeography. Molecular

Ecology, 11, 2623-2635.

Lindenfelser ME (1984) Morphometric and allozymic congruence: evolution in

the prawn Macrobrachium rosenbergii (Decapoda: Palaemonidae).

Systematic Zoology, 33(2), 195-204.

Lundberg JG (1993) African-South American freshwater fish clades and

continental drift, problems with a paradigm. In ‘Biotic Relationships

Between Africa and South America.’ (Ed. P. Goldblatt), pp. 156-198.

Yale University Press, New Haven, Connecticut, USA.

Malecha SR (1977) Genetics and selective breeding of Macrobrachium

rosenbergii. In ‘Shrimp and Prawn Farming in the Western

Hemisphere.’ (Eds. J.A. Hanson & H.L. Goodwin), pp. 328-355.

Dowden, Hutchinson and Ross, Stroudsberg, Pa, USA.

Malecha SR (1987) Selective breeding and intraspecific hybridization of

crustaceans. In ‘Proceedings of the World Symposium on Selection,

Hybridization, and Genetic Engineering in Aquaculture.’ pp. 323-336.

Vol. 1, Berlin, Germany.

Marko PB (2002) Fossil calibration of molecular clocks and the divergence

times of geminate species pairs separated by the Isthmus of Panama.

Molecular Biology and Evolution, 19, 2005-2021.

McConnell SKJ (2004) Mapping aquatic faunal exchanges across the Sunda

shelf, South-East Asia, using distributional and genetic data sets from

the cyprinid fish Barbodes gonionotus (Bleeker, 1850). Journal of

Natural History, 38, 651-670.

Moss SJ, Wilson MEJ (1998) Biogeographic implications of the Tertiary

palaeogeographic evolution of Sulawesi and Borneo. In ‘Biogeography

and Geological Evolution of SE Asia.’ (Eds. R. Hall & J.D. Holloway), pp.

133-163. Backhuys Publishers, Leiden, The Netherlands.

Nelson K, Hedgecock D (1980) Enzyme polymorphism and adaptive strategy

in the decapod Crustacea. American Naturalist, 116, 238-280.

24

Nelson G, Platnick NI (1981) Systematics and Biogeography; Cladistics and

Vicariance. Columbia University Press, New York.

New MB, Singholka S (1985) Freshwater prawn farming: a manual for the

culture of Macrobrachium rosenbergii. FAO Fisheries Technical Paper

225.

Posada D, Crandall KA (2001) Intraspecific gene genealogies: trees grafting

into networks. Trends in Ecology and Evolution, 16, 37-45.

Riddle BR (1996) The molecular phylogeographic bridge between deep and

shallow history in continental biotas. Trends in Ecology and Evolution,

11, 207-211.

Rogers AR, Harpending H (1992) Population growth makes waves in the

distribution of pairwise genetic differences. Molecular Biology and

Evolution, 9, 552-569.

Sandifer PA, Smith TIJ (1979) Possible significance of variation in the larval

development of Palaemonid shrimp. Journal of Experimental Marine

Biology and Ecology, 39, 55-64.

Short J (2000) Systematics and biogeography of Australian Macrobrachium

(Crustacea: Decapoda: Palaemonidae) – with descriptions of other new

freshwater Decapoda. Ph.D. Thesis, The University of Queensland,

Brisbane, Australia.

Slatkin M (1989) Detecting small amounts of gene flow from phylogenies of

alleles. Genetics, 121, 609-612.

Slatkin M, Hudson RR (1991) Pairwise comparisons of mitochondrial DNA

sequences in stable and exponentially growing populations. Genetics,

129, 555-562.

Smith TIJ, Sandifer PA, Trimble WC (1976) Progress in developing a

recirculating synthetic seawater hatchery for rearing larvae of

Macrobrachium rosenbergii. In ‘Food-drugs from the Sea, Proceedings

1974.’ (Eds. H.H. Webber & G.D. Ruggieri.) pp. 167-181. Marine

Technology Society, Washington DC, USA.

Smouse PE (1998) To tree or not to tree. Molecular Ecology, 7, 399-412.

Templeton AR, Routman E, Phillips C (1995) Separating population structure

from population history: a cladistic analysis of the geographical

25

distribution of mitochondrial DNA haplotypes in the tiger salamander,

Ambystoma tigrinum. Genetics, 140, 767-782.

Torgersen T, Jones MR, Stephens AW, Searle DE, Ullman WJ (1985) Late

Quartenary hydrological changes in the Gulf of Carpentaria. Nature,

313, 785-787.

Usmani S, Tan SG, Siraj SS, Yusoff K (2003) Population structure of the

Southeast Asian river catfish Mystus nemurus. Animal Genetics, 34, 462-464.

Voris HK (2000) Maps of Pleistocene sea levels in Southeast Asia:

shorelines, river systems and time durations. Journal of Biogeography,

27, 1153-1167.

Wallace AR (1859) Letter from Mr Wallace concerning the geographical

distribution of birds. Ibis, 1, 449-454.

Wallis GP, Trewick SA (2001) Finding fault with vicariance: A critique of

Heads (1998). Systematic Biology, 50(4), 602-609.

Zink RM (2002) Methods in comparative phylogeography, and their

application to studying evolution in the North American aridlands.

Integrative and Comparative Biology, 42(5), 953-959.

26

Statement of Joint Authorship

de Bruyn M, Wilson JC, Mather PB (2004) Huxley’s Line demarcates

extensive genetic divergence between eastern and western forms of the

giant freshwater prawn, Macrobrachium rosenbergii. Molecular Phylogenetics

and Evolution, 30, 251-257 (Short Communication).

de Bruyn M (candidate) Designed and developed experimental protocol. Carried out field and

laboratory work, and analysed data. Wrote manuscript and acted as

corresponding author.

Wilson JC Co-supervised the study design and experimental protocols. Assisted in the

interpretation of data. Contributed to the structure and editing of the

manuscript.

Mather PB Principal supervisor of the study design and experimental protocols. Assisted

in the interpretation of data. Contributed to the structure and editing of the

manuscript.

27

CHAPTER 2. Huxley’s Line demarcates extensive genetic divergence between eastern and western forms of the giant freshwater prawn,

Macrobrachium rosenbergii.

de Bruyn M, Wilson JC, Mather PB

School of Natural Resource Sciences, Queensland University of Technology,

GPO Box 2434, Brisbane, Qld 4001, Australia

ABSTRACT Phylogenetic analysis of representatives from 18 wild populations of the giant

freshwater prawn, Macrobrachium rosenbergii, utilising a fragment of the 16S

rRNA mitochondrial gene, identified two major reciprocally monophyletic

clades either side of a well known biogeographic barrier, Huxley’s line. The

level of divergence between the two clades (maximum 6.2%) far exceeds

divergence levels within either clade (maximum 0.9%), and does not concord

with geographical distance among sites. Eastern and western M. rosenbergii

clades have probably been separated since Miocene times. Within-clade

diversity appears to have been shaped by dispersal events influenced by

eustatic change.

Keywords: Macrobrachium rosenbergii; Decapod crustacean; 16S; mtDNA;

Huxley’s line; Wallace’s line; Phylogenetics; Biogeography

28

INTRODUCTION Prawns of the genus Macrobrachium Bate, 1868 (Crustacea: Palaemonidae)

are a highly diverse group of decapod crustaceans found in circumtropical

marine-, estuarine- and fresh-waters. Much debate has surrounded the

systematic relationships of many species within this group (e.g. Holthuis,

1950; Johnson, 1973; Holthuis, 1995; Pereira, 1997), which has until recently

been based exclusively on comparisons of external morphological

characteristics. Molecular genetic approaches to resolving systematic

questions in Macrobrachium have only been applied recently, when Murphy

and Austin (2002) recognised that species and genus level designations did

not correspond to traditional morphology-based classification schemes.

M. rosenbergii, the giant freshwater prawn, is found in coastal river

systems from Pakistan in the west to Vietnam in the east, across SE Asia,

and south to Papua New Guinea and northern Australia. Gravid females

migrate from freshwater to estuarine areas, satisfying larval requirements for

brackish water for survival and early development, where free-swimming

larvae hatch and metamorphose into post-larvae, before migrating to

freshwater after 3-6 weeks (New and Singholka, 1985). Several studies have

reared M. rosenbergii larvae to post-larvae stage in artificial seawater (Smith

et al., 1976; Sandifer and Smith, 1979), and considering this in light of a

relatively prolonged larval duration, suggests that marine dispersal may play

a previously unrecognised role in the life-history of this species.

Two forms of M. rosenbergii (‘eastern’ and ‘western’) have been

described independently (De Man, 1879; Johnson, 1973), although the

species is currently considered to be monophyletic. Lindenfelser (1984)

analysed morphometric and allozyme data, and concluded that the boundary

for eastern and western M. rosenbergii forms corresponds approximately with

Wallace’s Line (although Philippine samples were assigned to the eastern

form, thus Huxley’s Line would seem a more appropriate boundary than

Wallace’s Line; see Fig. 1). Malecha (1977; 1987) and co-workers

(Hedgecock et al., 1979) recognised 3 ‘geographical races’; an eastern, a

western and an Australian ‘race’, based on allozyme and morphological data.

Wowor and Ng (2001) regard the eastern and western forms of M.

rosenbergii as two distinct species, based on adult morphological characters.

29

Thus, M. rosenbergii as currently recognised taxonomically may be polytypic

both regionally and perhaps even within biogeographic regions. Hence, the

goal of the present study was to examine the evolutionary relationships

among wild M. rosenbergii stocks at a regional scale, using 16S ribosomal

RNA mitochondrial DNA (mtDNA) sequences, and relate the findings to the

biogeographical history of the region.

Figure 1. Locations sampled for Macrobrachium rosenbergii. Light grey

shading indicates -120m sea-level contour. Pleistocene drainage basins

indicated on map (Voris 2000). Haplotype labels correspond to Appendix A.

(Map adapted with kind permission Harold K. Voris and the Field Museum of

Natural History, Chicago, USA; Voris 2000.)

30

MATERIALS AND METHODS Specimens, DNA Extraction, Amplification and Sequencing

Prawns used in this study were collected from localities indicated in Appendix

1 and Fig. 1. Macrobrachium australiense and M. lar were used as outgroup

taxa. Tissue samples were incubated overnight at 55ºC in 500µl extraction

buffer (100mM NaCL, 50mM Tris, 10mM EDTA, 0.5% SDS) containing 20µl

of 10µg/µl Proteinase K (Sigma Co.). Total genomic DNA was extracted

using standard phenol: chloroform extraction methods. A 472-bp region of

the mitochondrial 16S ribosomal gene was amplified using primers 16SAR

and 16SBR (Palumbi et al., 1991). DNA sequencing was conducted at the

Australian Genome Research Facility, Brisbane, Australia; using an ABI 377

automated DNA sequencer. Both strands of the PCR product were

sequenced. Because mtDNA sequences were invariant among five

individuals from each of four sampling sites (Mekong and Dongnai, Vietnam;

Wenlock, Australia; Plandez/Pulilan, Philippines; de Bruyn et al., unpublished

data), a single sequence from each sampling site was considered to be

representative for phylogenetic analyses.

Phylogenetic Analyses

Consensus sequences were aligned using ClustalX (Thompson et al., 1997).

A total of 472 bp were aligned for analysis (see Appendix 1 for GenBank

accession numbers). Saturation of nucleotide substitutions in the data set

was tested. A bootstrapped (1000 pseudoreplicates) maximum parsimony

(MP) and neighbour-joining (NJ) phylogeny was constructed using MEGA

version 2.1 (Kumar et al., 2001), based on Kimura 2-parameter distances

(Kimura, 1980). A quartet-puzzling maximum-likelihood tree using the

Hasegawa-Kishino-Yano (HKY) sequence evolution model (Hasegawa et al.,

1985) was constructed in TREE-PUZZLE (Strimmer and von Haesler, 1996),

using 1000 iterations of the puzzling process. Finally, a log-likelihood ratio

test was carried out in TREE-PUZZLE that compared trees generated under

the assumption of a molecular clock, to trees unconstrained by any such

assumption (Felsenstein, 1988).

31

RESULTS A total of 472 base pairs of the 16S mitochondrial gene were amplified

successfully for 18 M. rosenbergii individuals and two outgroup species. Of

these, 90 variable sites were detected, of which 59 were phylogenetically

informative. All sequences were found to be AT-rich (62.9%). Nucleotide

substitutions (excluding outgroups) favoured transitions over transversions,

yielding a transition/transversion ratio of 3.3. No evidence of saturation was

evident. Kimura 2-parameter sequence divergences ranged from 5.1% to

6.2% between haplotypes from eastern and western M. rosenbergii samples,

0.0% to 0.6% among western samples, and 0.0% to 0.9% among eastern

samples. A single deletion was observed in the dataset, for the M.

australiense outgroup sequence. The log-likelihood ratio test rejected the

assumption of clock-like behaviour. Two major reciprocally monophyletic M.

rosenbergii clades (Fig. 2) were identified; corresponding geographically with

the east/west disjunction reported previously (Lindenfelser, 1984). Bootstrap

support for these clades was high in all cases. Relationships within the two

clades were resolved to varying degrees.

32

Figure 2. Neighbour-joining distance tree of the relationships between

Macrobrachium rosenbergii 16S rRNA haplotypes. Haplotype labels

correspond to Appendix A. Bootstrap values (percentages) are shown for

nodes with support >50%. Values correspond to neighbour-joining firstly,

maximum parsimony secondly, and maximum-likelihood thirdly. The trees

produced by all three methods of analyses were not significantly different in

topology.

IJ

PH

PN

1A

6A

5A

2A

3A

4A

1V

4M

JA

1M

2V

2M

3M

1T

2T

M.australiense

M.lar

64/67/82

63/-/54

63/-/-

71/-/97

100/100/99

100/100/100

66/64/92 99/99/99

54/63/53

0.01

WESTERN

EASTERN

33

DISCUSSION Variation in 16S rRNA sequences for M. rosenbergii support Lindenfelser’s

(1984) recognition that wild stocks comprise two major clades, restricted to

either side of Huxley’s Line (Fig. 1). The level of sequence divergence

observed between the two clades exceeds interspecific 16S rRNA

divergence levels reported for diverse crustacean taxa, including penaeid

prawns (Tong et al., 2000) and freshwater crayfish (Grandjean et al., 2002).

The significant phylogenetic break between eastern and western haplotypes

observed indicates the coalescence for these two clades was probably of mid

to late Miocene origin, and approximates 5.3 to 11.7 million years before

present (BP), based on 16S rRNA molecular clocks calibrated for porcelain

crabs (0.53%/MY; Stillman and Reeb, 2001) and fiddler crabs (0.96%/MY;

Sturmbauer et al., 1996; these values represent upper- and lower-bound

extremes for crustacean 16S rRNA molecular clocks identified in a literature

search). This estimate should be approached with caution, however, due to

the rejection of clock-like behaviour of the data set.

Wallace’s Line has long been recognised as a major biogeographical

barrier. Huxley (1868) modified Wallace’s Line by extending it into the

Philippines, based on zoological data, linking the island of Palawan to the

western (Oriental) group, and the rest of the Philippine Archipelago to the

eastern (Australasian) group. Data presented here clearly links a region of

the Philippines (Luzon) to the eastern group. Tree topology indicates that the

Australian OTUs (Operational Taxonomic Units) are basal to the remaining

eastern OTUs examined. The unexpectedly low degree of divergence (1-2

bp) between the Philippine OTU and the rest of the eastern OTUs suggests

recent gene flow has occurred. This has presumably been facilitated by larval

marine dispersal, as the Philippine and Australian/New Guinea landmasses

have been geographically distant since at least Miocene times (Hall, 1996).

Tree topology indicates that gene flow has occurred from a southerly

(Australian) to northerly (Philippines) direction, which appears consistent with

major ocean current movements in the region (South Equatorial Current;

Gordon and Fine, 1996), although this remains to be rigorously tested with a

more comprehensive dataset. Similar genetic signatures of Australian-

34

Philippine dispersal events have been observed in a number of marine

species (reviewed by Benzie, 1998).

The Mekong OTU appears ancestral to all other western OTUs. Sabah

(Borneo) and Java cluster together, while all other western OTUs (Mainland

Malaysia, Thailand, and Vietnam) apart from SW Thailand share identical

16S rRNA haplotypes. Reconstructions of Pleistocene drainage basins on

the Sunda Shelf (Voris, 2000) suggest that the ancient Mekong drainage

system has long been isolated from all other Pleistocene drainages identified.

The Sabah drainage remained isolated throughout the Pleistocene, while the

East Sunda River system, which encompassed the locality of the Javan OTU,

drained eastward to exit near Bali, possibly restricting westward dispersal of

M. rosenbergii. The SW Thai OTU would also have remained isolated during

this time, while all other western OTUs would have been incorporated into

either the Siam or Malacca Straits River Systems (Voris, 2000) that may

have coalesced at some stage in the past. Ongoing gene-flow amongst these

localities, however, cannot be ruled out at present. The possibility that some

form of selective sweep has produced the patterns observed in this study

would appear unlikely, given the concordance of mtDNA (this study),

allozymes (Malecha, 1977, 1987; Hedgecock et al., 1979; Lindenfelser,

1984) and morphological characters (De Man, 1879; Johnson, 1973;

Malecha, 1977, 1987; Lindenfelser, 1984; Wowor and Ng, 2001).

35

CONCLUSION

Significant mtDNA divergence between eastern and western M. rosenbergii

clades supports previous conclusions (De Man, 1879; Johnson, 1973;

Malecha, 1977, 1987; Lindenfelser, 1984; Wowor and Ng, 2001) that M.

rosenbergii may actually represent two distinct phylogenetic ‘species’.

Regardless of whether specific status is accorded to the eastern and western

forms, the divergence levels presented here are highly relevant for

conservation of wild stocks. A number of intriguing questions regarding the

evolutionary history of M. rosenbergii have been raised by this study. If

marine larval dispersal has occurred between New Guinea/Australia and the

Philippine Archipelago, why does that not appear to be the case between

sites separated by lesser geographic distances (e.g. between Sabah and the

Philippines) either side of Huxley’s Line? Can ancient vicariant events explain

the divergence between eastern and western clades? Could the ancestral

(Australian and Vietnamese) haplotypes represent lineages that persisted in

Pleistocene refugia (sensu Hewitt, 1996) during periods of glacial maxima?

Future directions for our research on M. rosenbergii will address these

questions utilising mitochondrial COI markers in conjunction with nuclear

markers.

36

ACKNOWLEDGMENTS

We thank Kriket Broadhurst, Steve Caldwell, Natalie Baker, Marilyn Wyatt,

Daisy Wowor, Peter Ng, David Milton, John Short, Peter Davie, Melchor

Tayamen, Nuanmanee Pongthana and colleagues, Nguyen Van Hao, Tran

Ngoc Hai, Pek Yee Tang, Selvaraj Oyyan and Abol Munafi Ambok Bolong for

their help in acquiring specimens for this study. David Hurwood and two

anonymous reviewers provided comments that greatly improved the

manuscript. Thanks to all in the QUT Ecological Genetics Lab for technical

assistance, and to those who took part in the Ecological Genetics Group

(EGG) discussions. MdB received financial support from an Australian

Postgraduate Award. MdB’s SE Asian and Australian fieldwork was

supported in part by grants from the Australian Geographic Society and the

Ecological Society of Australia.

37

Appendix 1. Samples used in this study for mitochondrial DNA extraction

Collection site location Site

abbr.

Eastern or

western type

GenBank

accession

no.

Bahand R, NW Peninsula Malaysia 1M Western AY203912

Semenyih R, SW Peninsula

Malaysia

2M Western AY203915

Setiu R, NE Peninsula Malaysia 3M Western AY203904

Sandakan R, Sabah, Malaysia 4M Western AY203905

Mekong R, Vietnam 1V Western AY203914

Dongnai R, Sth Vietnam 2V Western AY203907

Kraburi R, SW Thailand 1T Western AY203908

Tapi R, SE Thailand 2T Western AY203911

Bengawan R, Java, Indonesia JA Western AY203913

Plandez/Pulilan R, Luzon,

Philippines

PH Eastern AY203910

Fly R, Papua New Guinea PN Eastern AY203906

Ajkwa R, Irian Jaya, Indonesia IJ Eastern AY203909

Wenlock R, Qld, Australia 1A Eastern AY203918

Leichardt R, Qld, Australia 2A Eastern AY203919

Roper R, NT, Australia 3A Eastern AY203920

McArthur R, NT, Australia 4A Eastern AY203921

Katherine R, NT, Australia 5A Eastern AY203917

Ord R, WA, Australia 6A Eastern AY203916

Macrobrachium australiense AY203922

Macrobrachium lar AY203923

Appendix 2. Variable nucleotide sites among Macrobrachium rosenbergii haplotypes for 472 base pairs of the mtDNA 16s

rRNA gene. Haplotypes compared to sequence Sabah, Malaysia. Synonymous sites denoted by a dot, variable sites

denoted by type of nucleotide substitution.

096

101

112

113

114

117

125

156

158

186

196

197

199

211

215

229

233

234

270

281

283

284

288

295

299

318

322

330

334

436

442

4M G A A G C C T T A G A G C T G T C T A A A A C C G C G G A C G 1M . . . . . . . . . A . . . . . . . . . . . . T . . . . . . . . 2M . . . . . . . . . A . . . . . . . . . . . . T . . . . . . . . 3M . . . . . . . . . A . . . . . . . . . . . . T . . . . . . . . 1V . . . . . T . . . A . . . . . . . . . . . . T . . . . . . . . 2V . . . . . . . . . A . . . . . . . . . . . . T . . . . . . . . 1T . . . . . . . . . A . . . . . . . . . . . . T . . . . . . T . 2T . . . . . . . . . A . . . . . . . . . . . . T . . . . . . . . JA . . . . . . . . . . . . . . . . . . . . . . T . . . . . . . . PH A G T A . T . C G . G A T C A C T C T G T T T A A T A A T . . IJ A G T A . T C C G . G A T C A C T C T G T T T A A T A A T . . PN A G T A T T . C G . G A T C A C T C T G T T T A A T A A T . . 1A A G T A . T . C G . G A T G A C T C T G T T T A A T A A T . . 2A A G T A . T . C G . G A T . A C T C T G T T T A A T A A T . . 3A A G T A . T . C G . G A T . A C T C T G T T T A A T A A T . . 4A A G T A . T . C G . G A T . A C T C T G T T T A A T . A T . . 5A A G T A . T . C G . G A T . A C T C T G T T T A A T A A T . A 6A A G T A . T . C G . G A T . A C T C T G T T T A A T A A T . A

39

REFERENCES Benzie, J.A.H. (1998). Genetic structure of marine organisms and SE Asian

biogeography. In ‘Biogeography and Geological Evolution of SE Asia.’

(Eds. R. Hall and J.D. Holloway.), pp. 197-209. Backhuys Publishers,

Leiden, The Netherlands.

De Man, J.G. (1879). On some species of the genus Palaemon Fabr. with

descriptions of two new forms. Notes Leyden Museum 1, 165-184.

Felsenstein, J. (1988). Phylogenies from molecular sequences: inference and

reliability. Ann. Rev. Genetics 22, 521-565.

Gordon, A.L., and Fine, R.A. (1996). Pathways of water between the Pacific

and Indian Oceans in the Indonesian seas. Nature 379, 146-149.

Grandjean, F., Bouchon, D., and Souty-Grosset, C. (2002). Systematics of

the European endangered crayfish species Austropotamobius pallipes

(Decapoda: Astacidae) with a re-examination of the status of

Austropotamobius berndhauseri. J. Crust. Biol. 22, 677-681.

Hall, R. (1996). Reconstructing Cenozoic Asia. In ‘Tectonic Evolution of

Southeast Asia.’ (Eds. R. Hall and D.J. Blundell.), pp. 153-184. The

Geological Society Publishing House, Bath, UK.

Hasegawa, M., Kishino, H., and Yano, K. (1985). Dating of the human-ape

splitting by a molecular clock of mitochondrial DNA. J. Mol. Evol. 22, 160-174.

Hedgecock, D., Stelmach, D.J., Nelson, K., Lindenfelser, N.E., and Malecha,

S.R. (1979). Genetic divergence and biogeography of natural

populations of Macrobrachium rosenbergii. Proc. World Maricult. Soc.

10, 873-879.

Hewitt, G.M. (1996). Some genetic consequences of ice ages, and their role

in divergence and speciation. Biol. J. Linn. Soc. 58, 247-276.

Holthuis, L.B. (1950). The Palaemonidae collected by the Siboga and

Snellius Expeditions, with remarks on other species. The Decapoda of

the Siboga Expedition. Part X. The Palaemonidae. I Subfamily

Palaemoninae. Siboga Expeditie 39(a), Leiden, Netherlands.

Holthuis, L. B. (1995). Notes on Indo-West Pacific Crustacea Decapoda III to

IX. Zoologische Mededelingen 69 (13), 139-151. Leiden, The

Netherlands.

40

Huxley, T.H. (1868). On the classification and distribution of the

Alectoromorphae and Heteromorphae. Proc. Zool. Soc. Lond., 294-319.

Johnson, D.S. (1973). Notes on some species of the genus Macrobrachium

(Crustacea: Decapoda: Caridea: Palaemonidae). J. Sing. Nat. Acad. Sci.

3(3), 273-291.

Kimura, M. (1980). A simple method for estimating evolutionary rate of base

substitutions through comparative studies of nucleotide sequences. J.

Mol. Evol. 16, 111-120.

Kumar, S., Tamura, K., Jakobsen, I.B., and Nei, M. (2001). ‘MEGA2:

Molecular Evolutionary Genetics Analysis software.’ Arizona State

University: Tempe, Arizona, USA.

Lindenfelser, M.E. (1984). Morphometric and allozymic congruence:

evolution in the prawn Macrobrachium rosenbergii (Decapoda:

Palaemonidae). Syst. Zool. 33(2), 195-204.

Malecha, S.R. (1977). Genetics and selective breeding of Macrobrachium

rosenbergii. In ‘Shrimp and Prawn Farming in the Western

Hemisphere.’ (Eds. J.A. Hanson and H.L. Goodwin.), pp 328-355.

Dowden, Hutchinson and Ross, Stroudsberg, Pa, USA.

Malecha, S.R. (1987). Selective breeding and intraspecific hybridization of

crustaceans. In ‘Proceedings of the World Symposium on Selection,

Hybridization, and Genetic Engineering in Aquaculture.’ pp 323-336. Vol.

1, Berlin, Germany.

Murphy, N.P., and Austin, C.M. (2002). A preliminary study of 16S rRNA

sequence variation in Australian Macrobrachium shrimps

(Palaemonidae: Decapoda) reveals inconsistencies in their current

classification. Invert. Syst. 16(5), 697-701.

New, M.B., and Singholka, S. (1985). Freshwater prawn farming. A manual

for the culture of Macrobrachium rosenbergii. FAO Fish. Tech. Paper

(225) Rev.1. 118 pp, FAO, Rome, Italy.

Palumbi, S.R., Martin, A., Romano, S., McMillan, W.O., Stice, L., and

Grabowski, G. (1991). A simple fool’s guide to PCR, v2.0. Special

Publication of the University of Hawaii Department of Zoology and

Kewalo Marine Laboratory, pp. 1-23.

41

Pereira, G. (1997). A cladistic analysis of the freshwater shrimps of the family

Palaemonidae (Crustacea, Decapoda, Caridea). Acta Biol. Venez. 17, 1-69.

Sandifer, P.A., and Smith, T.I.J. (1979). Possible significance of variation in

the larval development of Palaemonid shrimp. J. Exp. Mar. Biol. Ecol.

39, 55-64.

Smith, T.I.J., Sandifer, P.A., and Trimble, W.C. (1976). Progress in

developing a recirculating synthetic seawater hatchery for rearing larvae

of Macrobrachium rosenbergii. In ‘Food-drugs from the Sea,

Proceedings 1974.’ (Eds. H.H. Webber and G.D. Ruggieri.) pp. 167-181.

Marine Technology Society, Washington DC, USA.

Stillman, J.H., and Reeb, C.A. (2001). Molecular phylogeny of eastern Pacific

porcelain crabs, genera Petrolisthes and Pachyceles, based on the

mtDNA 16S rDNA sequence: phylogeographic and systematic

implications. Mol. Phylogenet. Evol. 19(2), 236-245.

Strimmer, K., and von Haesler, A. (1996). Quartet-puzzling: a quartet

maximum-likelihood method for reconstructing tree topologies. Mol. Biol.

Evol. 13, 964-969.

Sturmbauer, C., Levinton, J.S., and Christy, J. (1996). Molecular phylogeny

analysis of fiddler crabs: test of the hypothesis of increasing behavioral

complexity in evolution. Proc. Natl. Acad. Sci. USA 93, 10855-10857.

Thompson, J.D., Gibson, T.J., Plewniak, F., Jeanmougin, F., and Higgens,

D.G. (1997). The ClustalX windows interface: flexible strategies for

multiple sequence alignment aided by quality analysis tools. Nucleic

Acids Res. 24, 4876-4882.

Tong, J.G., Chan, T.-Y, and Chu, K.H. (2000). A preliminary phylogenetic

analysis of Metapenaeopsis (Decapoda: Penaeidae) based on

mitochondrial DNA sequences of selected species from the Indo-West

Pacific. J. Crust. Biol. 20(3), 541-549.

Voris, H. K. (2000). Maps of Pleistocene sea levels in Southeast Asia:

shorelines, river systems and time durations. J. Biogeog. 27, 1153-1167.

Wowor, D. and Ng, P.K.L. (2001). Identity of the Giant Prawn,

Macrobrachium rosenbergii (De Man, 1879) (Crustacea: Decapoda:

42

Caridea: Palaemonidae). In ‘Proceedings of the Fifth International

Crustacean Congress’. Melbourne, Australia, July 9-13, 2001.

43

Statement of Joint Authorship

de Bruyn M, Wilson JC, Mather PB (2004) Reconciling geography and

genealogy: phylogeography of giant freshwater prawns from the Lake

Carpentaria region. Molecular Ecology, 13, 3515-3526.

de Bruyn M (candidate) Designed and developed experimental protocol. Carried out field and

laboratory work, and analysed data. Wrote manuscript and acted as

corresponding author.

Wilson JC Co-supervised the study design and experimental protocols. Assisted in the

interpretation of data. Contributed to the structure and editing of the

manuscript.

Mather PB Principal supervisor of the study design and experimental protocols. Assisted

in the interpretation of data. Contributed to the structure and editing of the

manuscript.

44

CHAPTER 3. Reconciling geography and genealogy: phylogeography of giant freshwater prawns from the Lake Carpentaria region.

de Bruyn M, Wilson JC, Mather PB

School of Natural Resource Sciences, Queensland University of Technology,

GPO Box 2434, Brisbane, Qld 4001, Australia

ABSTRACT There is convincing geological evidence for the historical existence of an

ancient lake on the Australian-New Guinea continental shelf during the late

Pleistocene. Lake Carpentaria was a vast fresh- to brackishwater lake that

would presumably have provided habitat for, and facilitated gene flow among,

aquatic taxa that tolerate low to moderate salinities in this region. Moreover, it

has been argued that the outflow of Papua New Guinea’s Fly River was

diverted westward into Lake Carpentaria during this period, although this

hypothesis is controversial. We predicted that these events, if a true history,

would have promoted gene flow and population growth via range-expansion

events in the giant freshwater prawn (Macrobrachium rosenbergii), and

restricted gene flow subsequently by way of a vicariant event as sea levels

rose during the late Pleistocene, and a marine environment replaced Lake

Carpentaria. We tested these hypotheses using phylogeographic and

phylogenetic analyses of mitochondrial DNA variation in M. rosenbergii

populations sampled from the Lake Carpentaria region. Our results support

the hypothesis that Lake Carpentaria facilitated gene flow among populations

of M. rosenbergii that are today isolated, but contest claims of a westward

diversion of the Fly River. We inferred the timing of initial expansion in the

‘Lake Carpentaria lineage’ and found the timing of this event to be broadly

concordant with geological dating of the formation of Lake Carpentaria.

Reconciling geological and molecular data, as presented here, provides a

powerful framework for investigating the influence of historical earth history

events on the distribution of biological (i.e. molecular) diversity.

Keywords: biogeography, nested clade analysis, Lake Carpentaria,

phylogeography, Fly River, range expansion

45

INTRODUCTION The recent development of statistical phylogeographic methodologies (e.g.

Templeton et al. 1995; Knowles & Maddison 2002) has enabled researchers

to distinguish between competing biological (e.g. dispersal) or earth history

(e.g. vicariance) events that may have influenced patterns of genetic

variation. Intraspecific phylogeographic studies have specifically tested

biogeographical hypotheses and the role of earth history events on the

distribution of taxa and genetic variation (e.g. Bermingham & Martin 1998;

Avise 2000; Waters et al. 2001; Sponer & Roy 2002; Waters & Roy 2003).

The intraspecific approach has been implemented to great effect along the

northern Australian coastline in diverse marine taxa (Benzie et al. 1992;

Keenan 1994; Norman et al. 1994; Elliott 1996; Fitzsimmons et al. 1997;

Begg et al. 1998; Chenoweth et al. 1998; Gopurenko & Hughes 2002), and

has highlighted the important role that vicariance has played in structuring

populations that were effectively isolated by the closure of the Torres Strait,

that separates Papua New Guinea from Australia, during Pleistocene low

sea-level stands. Several of these studies (Benzie et al. 1992; Keenan 1994;

Chenoweth et al. 1998) also demonstrated that subsequent dispersal events

lead to admixture between divergent lineages, and influenced intraspecific

genetic diversity in the region after inundation of the Torres Strait land bridge

by rising sea levels.

In contrast, few molecular studies have addressed the effects of

eustasy on freshwater aquatic taxa in this region (Macaranas et al. 1995;

McGuigan et al. 2000). While gene flow was effectively disrupted for marine

taxa by the closure of the Torres Strait, the same event may actually have

had the opposite effect and facilitated gene flow among fresh- and

brackishwater tolerant taxa, due to the formation of a substantial lake on the

Australia-New Guinea continental shelf during this period (Smart 1977;

Torgersen et al. 1983; Torgersen et al. 1985; Jones & Torgersen 1988). Lake

Carpentaria was a vast (approximate maximum size = 600km x 300km;

Chivas et al. 2001) intermittently fresh- to brackishwater lake hypothesised to

have existed from approximately 80 000-8 500 years before present (BP),

before absolute marine conditions were once again restored by rising sea-

levels cresting the Arafura Sill (Torgersen et al. 1983; Torgersen et al. 1985;

Figure 1. Study region and phylogenetic relationships (neighbour joining tree) among M. rosenbergii COI mtDNA lineages.

Sampling sites indicated by black dots as per Fig. 2. Phylogenetic relationships among haplotypes indicated by location as per map.

Major lineages indicated by Roman numerals to the left of nodes (see text for details), while bootstrap support indicated by numbers

to the right of nodes (neighbour-joining analysis firstly, maximum-likelihood analysis secondly). Genbank accession numbers for

haplotypes: AY614545-AY61458.

47

Jones & Torgersen 1988; Chivas et al. 2001). Lake Carpentaria would

presumably have provided habitat for (Torgersen et al. 1983; McGuigan et al.

2000), and facilitated connectivity among many Australian and New Guinean

fresh- and brackishwater tolerant aquatic taxa that are today separated by a

marine barrier (Fig. 1 & 2). A second significant factor that may have

influenced gene flow among populations of these taxa in the region was the

historical pattern and direction of flow of New Guinea’s Fly River, which has

been hypothesised (Blake & Ollier 1969; Torgersen et al. 1983; Torgersen et

al. 1988) to have drained into Lake Carpentaria until it diverted to its present-

day easterly course into the Coral Sea (Fig. 2) some 40-35 000 years BP

(Blake & Ollier 1969; Torgersen et al. 1988). This hypothesis is controversial,

however, and has been disputed by Harris et al. (1996; and see Voris 2000)

who found no evidence for a past westward diversion of the Fly River, but

argued that the outflow of the river in ‘recent’ geological time has always

remained on an easterly course into the Coral Sea (Fig. 2).

To determine the roles that Lake Carpentaria and the Fly River have

played in the evolutionary history of freshwater organisms in this region, we

examined mitochondrial DNA variation in the giant freshwater prawn,

Macrobrachium rosenbergii (eastern form; sensu de Bruyn et al. 2004). We

collected samples from rivers that are believed to have drained into Lake

Carpentaria (Voris 2000), as well as from rivers within the region that

apparently remained isolated during this period, for comparative analyses

(Fig. 2). M. rosenbergii is a commercially important (FAO 2000) freshwater

crustacean that migrates to estuaries to spawn, as juveniles require

brackishwater for survival and development. Laboratory experiments indicate

that adults and juvenile M. rosenbergii can survive in brackishwater for

extended periods of time, but do not tolerate full marine conditions for more

than a week as adults and approximately 3 weeks as postlarvae (Sandifer et

al. 1975). M. rosenbergii would therefore appear to be an ideal model

organism for investigating the influence of an historical fresh- to

brackishwater lake on the biogeographical history of the region. Taxonomists

(Short 2000; D. Wowor, pers. comm.) recognise 2 distinct ‘races’ of

Figure 2. Minimum-spanning network and study region indicating Lake Carpentaria and sea levels for much of the Pleistocene. Circle size for each haplotype (1 - 43) indicates overall frequency. Small black circles indicate inferred missing haplotypes not observed in the dataset. Site location abbreviations as per Table 1. Light grey shading on map indicates -75 m sea-level contour. Pleistocene drainage basins indicated on map (Map adapted with kind permission Harold K. Voris and the Field Museum of Natural History, Chicago, USA; Voris 2000).

49

Australian M. rosenbergii; a northwestern Australian race distributed from the

Fitzroy (northern Western Australia) to the Keep Rivers, and a northeastern

Australian race distributed from the Roper to the Normanby (NE Cape York

Peninsula) Rivers, with an intermediate form found between these two

regions (Fig. 1 & 2). Thus, a further aim of the present study was to

determine whether relationships based on molecular data presented here

were consistent with previous studies based on morphological characters.

If Lake Carpentaria facilitated gene flow in M. rosenbergii in the

‘recent’ past, populations sampled from rivers that formerly drained into Lake

Carpentaria (Fig. 2) should display the molecular signatures of ‘recent’

genetic interchange, a ‘recent’ range expansion, and a corresponding

population expansion that followed the formation of the Lake. Additional

evidence may be expected for subsequent vicariance when a marine

environment replaced the Lake, presumably restricting gene flow as sea

levels crested the Arafura Sill. Similarly, a signature of ‘recent’ genetic

interchange and subsequent vicariance between Fly River and Gulf of

Carpentaria populations might be expected if the Fly River did indeed flow

into Lake Carpentaria in ‘recent’ times.

We therefore documented the phylogeography of the giant freshwater

prawn, Macrobrachium rosenbergii from the Lake Carpentaria region to

determine:

i.) if molecular evidence indicates that Lake Carpentaria acted as a conduit

for gene flow, and provided habitat for M. rosenbergii during the low sea level

stands of the late Pleistocene (the outcome of which might be cautiously

generalised to other fresh- and brackishwater tolerant taxa in the region)

ii.) if gene flow was subsequently restricted by rising sea levels that

inundated Lake Carpentaria

iii.) if molecular evidence supports the westward diversion of the Fly River

into Lake Carpentaria during the late Pleistocene

iv.) if relationships based on molecular data concord with those based on

morphological variation.

Table 1. Sampling sites and their abbreviations, distribution of mtDNA COI haplotypes, and sample sizes used in this study. Location and abbreviation Haploty

-pe Katheri- ne KA

Keep KE

Roper RO

McArth-ur MC

Wenloc-k

WE

NormanNO

Archer AR

LimmenBight LB

LennardLE

AjkwaAJ

Hann HA

Fly FL

1 4 2 1 3 28 21 4 7 5 2 6 1 7 22 7 8 1 9 31

10 1 11 2 12 1 13 21 14 17 15 1 16 14 3 17 1 18 1 19 1 20 40 6 3 24 21 3 22 1 23 1 24 5 25 10 26 2 27 1 28 4 29 1

Haploty-pe

(cont.)

Katheri- ne KA

Keep KE

Roper RO

McArth-ur MC

Wenloc-k

WE

NormanNO

Archer AR

LimmenBight LB

LennardLE

AjkwaAJ

Hann HA

Fly FL

30 1 31 1 32 29 33 11 34 8 35 1 36 2 37 1 38 3 39 1 40 1 41 28 42 1 43 1 n 33 31 22 49 40 44 25 27 18 42 8 39

52

MATERIALS AND METHODS Sample collection and molecular analyses

A total of 378 individuals collected from 12 sites in Australia, Papua New

Guinea and Irian Jaya were included in the analyses (Table 1; Fig. 1 & 2).

Tissue samples (muscle or pleopod) were stored in 70% ethanol until

required for molecular analyses. For DNA extraction, a small piece of tissue

was first rehydrated for 30 minutes in 1ml GTE buffer (100mM glycine, 10mM

Tris, 1mM EDTA). Tissue samples were then incubated overnight at 55ºC in

500µl extraction buffer (100mM NaCL, 50mM Tris, 10mM EDTA, 0.5% SDS)

containing 20µl of 10µg/µl Proteinase K (Sigma Co.). Total genomic DNA

was extracted using standard phenol: chloroform extraction methods, and

collected by ethanol precipitation. Amplification of a fragment of the mtDNA

cytochrome c oxidase subunit I (COI) gene was carried out using primers

LCO1490 and HCO2198 (Folmer et al. 1994). Each 50µl amplification

reaction consisted of 400 ng of template DNA, 5 µl of 10X buffer containing

MgCl2 (Roche), an additional 2µl of 25mM MgCl2 (Roche), 0.5 units of Taq

polymerase (Roche), 0.8 µl of each primer (10 µM final conc.), 0.2 mM of

each dNTP, and 38.95 µl autoclaved ddH2O. Samples that proved difficult to

PCR were amplified using READY-TO-GO®BEADS (Pharmacia Biotech).

Thermal cycling was performed on a PTC-100 thermocycler (MJ Research

Inc.) under the following conditions: 3 min denaturation at 94ºC, followed by

30 cycles of 30 sec at 94ºC, 30 sec at 55ºC, 30 sec at 72ºC, and a final 10

min extension at 72ºC, before cooling to 4ºC for 10 mins. Negative controls

were included in all PCR runs, and sterile procedures were adhered to

throughout. PCR amplifications were confirmed with agarose gel

electrophoresis on a 1% gel. Screening for intrapopulation variation was

carried out using Temperature Gradient Gel Electrophoresis (TGGE)

combined with Outgroup Heteroduplex Analysis (OHA) (Campbell et al.

1995). This method proved to be sensitive enough to consistently distinguish

among haplotypes that varied by a single base pair (bp). Multiple examples

(~2-3) of PCR products from haplotypes identified as unique using

TGGE/OHA were purified using a Qiagen QIAquick PCR purification kit and

sequenced. DNA sequencing of 602 bp of the COI gene was conducted on

an ABI 3730 automated sequencer at the Australian Genome Research

53

Facility at the University of Queensland, Brisbane, Australia. Both strands of

the PCR product were completely sequenced.

Data analyses

Sequences were aligned in ClustalX (Thompson et al. 1997). Initial data

exploration and standard diversity indices were calculated in ARLEQUIN

(Version 2.0; Schneider et al. 2000). To determine whether the mitochondrial

region employed in the present study was evolving according to neutral

expectations, we employed neutrality tests (Fu & Li 1993; Tajima 1989) in

DnaSP ver.4.00 (Rozas et al. 2003). We investigated whether sequences

had reached substitution saturation by plotting separately the number of

transitions or transversions between pairs of haplotypes vs. the Kimura 2-

parameter genetic distances that corrects for multiple hits. Population

structure was investigated in ARLEQUIN using ΦST statistics, analysis of

molecular variance (AMOVA) with statistical significance determined by

permutation analyses (Excoffier et al. 1992), and the construction of a

minimum-spanning network (MSN; Excoffier & Smouse 1994). We

determined that the TrN model of substitution (Tamura & Nei 1993) plus

invariable sites (I) and a gamma distribution (Γ) of rate heterogeneity across

variable sites provided the best fit to our data set with the program

MODELTEST 3.06 (Posada & Crandall 1998). The estimated parameters

under this model were Γ = 0.5930, I = 0.6928 and Ti/Tv = 4.69. We used the

neighbour-joining method of tree construction with bootstrap analysis (1000

replicates; Felsenstein 1985) to evaluate support for relationships,

implemented in PAUP* 4.0b10 (Swofford 2002). As a comparison to the

neighbour-joining method, we also constructed trees using maximum

likelihood methods. We adopted these methods in an attempt to minimise the

potential for error that may arise from the assumptions inherent in phylogeny

reconstruction methods. A single M. rosenbergii individual from Bali (western

form; de Bruyn et al. 2004) was used as an outgroup. We calculated

maximum-likelihood distances among haplotypes in PAUP*. To test for

adherence to a clock-like evolution of the mtDNA sequences, a log-likelihood

ratio test was carried out in PAUP* that compared trees generated under the

assumption of a molecular clock, to trees unconstrained by any such

assumption (Felsenstein 1988). The timing of cladogenesis identified in the

54

phylogeny was then inferred by way of molecular clock approximation.

Although the accuracy of dates of divergence based on a molecular clock are

debatable (Marko 2002), they do none the less provide a relative time frame

for investigating phylogeographical relationships. To determine relationships

among haplotypes, and factors that may have influenced these relationships,

we employed nested clade analysis (NCA; Templeton et al. 1995). A 95%

probability haplotype cladogram was constructed according to Templeton &

Sing (1993), Crandall (1996) and Templeton (1998) in TCS ver. 1.13

(Clement et al. 2000). This network was then converted into a nested design

and analysed in GeoDis ver. 2.0 (Posada et al. 2000), with the null

hypothesis of no geographic association among haplotypes. Templeton’s

latest inference key (2004) was used to infer processes involved in any

statistically significant association observed. To address the question of

changes in historical population (lineage) size, we employed mismatch

distribution analyses (Rogers & Harpending 1992; Rogers 1995) in DnaSP

and ARLEQUIN. If the distribution identified is unimodal and fits the sudden

expansion model, it is possible to estimate the time to the onset of population

expansion.

55

RESULTS Genetic diversity

A total of 602 bp of the COI mitochondrial gene were amplified successfully

for all samples analysed, for a total of 378 M. rosenbergii individuals,

resulting in 43 unique haplotypes defined by 59 variable sites. All unique

sequences have been deposited with GenBank (accession numbers:

AY614545-AY614587). The sequences were unambiguously aligned with no

insertions or deletions observed in the dataset. No significant deviations from

those expected under neutrality were identified when all haplotypes were

analysed together (Fu & Li 1993; D = -1.12, P = > 0.10; F = -1.08, P = > 0.10;

Tajima 1989; D = - 0.53, P = > 0.10), or when phylogenetic lineages (Fig. 1)

or individual populations were analysed separately (statistics not presented

here). Haplotype diversity ranged from 0.00 - 0.66 (mean 0.376). Maximum-

likelihood distances ranged from 0.002 - 0.05. No evidence was found for

saturation in transitions or transversions in our dataset (graphs not shown).

Conversion of the nucleotide sequences into amino acid sequence indicated

that nearly all polymorphisms were silent substitutions. Only three amino acid

changes were inferred, two from Irian Jayan sequences, and one from a

Western Australian sequence. Moreover, no stop codons were identified and

these data supported our view that pseudogenes were absent from the

dataset.

Phylogeny reconstruction

The neighbour-joining tree (Fig. 1) constructed using the complete dataset of

43 haplotypes resulted in a well-resolved phylogeny, defined by 37

phylogenetically informative sites. Four major clades were identified,

hereafter referred to as lineages I - IV, supported by high bootstrap values

(Fig. 1). These relationships were also strongly supported by the maximum-

likelihood analysis (Fig. 1), although within lineage relationships varied

depending on the method of tree construction. The geographical distributions

of all identified lineages were discrete. Lineage II had the broadest

geographical distribution, and was represented by specimens that were

collected from Australian rivers that discharge into the Gulf of Carpentaria

(Fig. 1 & 2) and from two more westerly Australian sites (Keep & Katherine

Rivers, Northern Territory). The Northern Territory populations formed a sub-

56

group nested within this clade, although bootstrap support for this

relationship was low (neighbour-joining bootstrap value = 44). Lineage I was

restricted to the Western Australian population, the Irian Jayan population

comprised lineage III, while the Papua New Guinean and the Hann River

(Australia) populations together comprised lineage IV (Fig. 1). Bootstrap

support was low for within lineage variation so we examined these

relationships further as described below.

Genetic structuring among and within lineages

AMOVA identified 75% of the variation to be present among phylogenetic

lineages, 16.5% of the variation to be among populations within lineages, and

only 8.5% of the variation to be within populations. This evidence for

restricted gene flow among populations representing discrete phylogenetic

lineages was supported by pairwise ΦST and exact test values (Table 2).

These data suggest that gene flow among populations representing discrete

lineages has not taken place for a significant period of evolutionary time.

Even within lineages, little or no ongoing gene flow among populations was

suggested by pairwise ΦST and exact test values, as all populations were

significantly differentiated from each other (Table 2). The Katherine and Keep

River populations (lineage II) were genetically most similar (ΦST = 0.161),

while the Roper and Hann River populations (lineages II & IV respectively)

were most dissimilar (ΦST = 1.000). Interestingly, these four populations were

all collected from Australian sites (Fig. 1 & 2).

Network estimation and nested clade analysis

Relationships among haplotypes in the MSN (Fig. 2) supported the presence

of the 4 discrete lineages identified in the phylogenetic reconstruction (Fig. 1).

Lineage II (Australian Gulf of Carpentaria & Northern Territory populations)

formed a central clade dominated by 4 haplotypes (haplotypes 3, 9, 16 & 20)

occurring at high frequencies at the centre of a star-like radiation, separated

from one another by 1 – 5 bp differences (Fig. 2). Of these 4 haplotypes, 3

were found in more than one geographical location (haplotype 3 = Keep &

Katherine Rivers; haplotype 16 = Wenlock & Norman Rivers; haplotype 20 =

Norman, McArthur, Archer & Limmen Bight Rivers), while the fourth was

restricted to the Norman River (haplotype 9; Table 1).

57

Table 2. Pairwise ΦST values and exact test of population differentiation

among sites. ΦST above diagonal based on nucleotide content and haplotype

frequencies (all values significant; P < 0.05). Exact test probabilities of non-

differentiation below the diagonal based on 10 000 Markov permutational

steps, significance values indicated by * = P < 0.05 and *** = P < 0.0005 (i.e.

all pairwise comparisons significant). See Table 1 for sampling site codes. KA KE RO MC WE NO AR LB LE AJ FL HA

KA - 0.16 0.94 0.76 0.55 0.56 0.76 0.95 0.94 0.94 0.93 0.97KE * - 0.90 0.74 0.54 0.57 0.72 0.92 0.93 0.93 0.92 0.96RO *** *** - 0.77 0.65 0.49 0.82 0.98 0.95 0.95 0.93 1.00MC *** *** *** - 0.45 0.53 0.54 0.10 0.89 0.89 0.89 0.89WE *** *** *** *** - 0.30 0.37 0.63 0.86 0.88 0.87 0.85NO *** *** *** *** *** - 0.49 0.72 0.88 0.89 0.89 0.88AR *** *** *** *** *** *** - 0.77 0.89 0.90 0.90 0.91LB *** *** *** * *** *** *** - 0.95 0.94 0.93 0.99LE *** *** *** *** *** *** *** *** - 0.92 0.91 0.93AJ *** *** *** *** *** *** *** *** *** - 0.91 0.92FL *** *** *** *** *** *** *** *** *** *** - 0.80HA *** *** *** *** *** *** *** *** *** *** *** -

Only one other haplotype from the total dataset (haplotype 7) was identified

at multiple geographic locations, namely in the Roper & McArthur River

populations. There were few intermediate missing haplotypes, and lineage II

was separated by 11 bp from lineage I, and 10 bp from both lineages III and

IV respectively. Lineages I and III formed two well-resolved clades with only a

single missing haplotype evident in lineage III. Relationships within lineage IV

were more complex, with a number of missing intermediate haplotypes. The

Fly River (Papua New Guinea) population had the greatest number of

haplotypes (9) compared with all other populations (Table 1). The Hann River

population from the eastern Cape York Peninsula (Australia) was only 5 bp

divergent from the Fly River population, but a minimum of 11 bp divergent

from any other Australian haplotype (Fig. 2). We adopted a conservative

approach, and only analysed lineage II by approximation of a 95% parsimony

network, followed by nested clade analysis (Templeton et al. 1995). This

decision was made based on the extensive intermediate (unsampled)

geographic areas between populations from each respective lineage, which

may result in an ambiguous outcome in NCA (Templeton 2004), and the

large number of inferred missing haplotypes among lineages identified in the

58

MSN (Fig. 2). In contrast, lineage II’s range was well sampled and there were

few inferred missing haplotypes (Fig. 3). NCA enabled us to reject the null

hypothesis of no association between the distribution of haplotypes and

geography for a number of clades, and we therefore inferred likely causes for

the observed patterns using Templeton’s (2004) latest inference key (see

Table 3 for nested clade distances and inferred processes). For clades 1-5,

2-1 and 2-3 the inference key did not allow us to distinguish between

contiguous range expansion, long distance colonisation or past fragmentation.

The inference key suggested contiguous range expansion for both clades 1-

10 and 2-2, while at the entire cladogram level either isolation by distance or

long distance dispersal was suggested.

Timing of cladogenesis and lineage expansions

A log-likelihood ratio test could not reject the hypothesis that lineages were

evolving according to a clock-like model of evolution (-ln L = 1576.76 with

molecular clock enforced vs. -ln L = 1553.55 without molecular clock

enforced, χ2 = 46.42, d.f. = 41, P > 0.10). Knowlton & Weigt (1998) calibrated

a caridean shrimp (caridea is the infraorder of Macrobrachium rosenbergii)

COI molecular clock at 1.4 X 10-8 based on the rise of the Isthmus of

Panama. Assuming a molecular clock and applying this divergence rate to:

firstly, the uncorrected genetic distances, and secondly, the corrected

maximum-likelihood distances (as per Knowlton & Weigt 1998) between

lineages, coalescence between the central lineage II and lineages I, III & IV

respectively dates back to the early Pleistocene (1 - 1.4 million years ago

(Mya) uncorrected; 1.2 - 1.7 Mya corrected). To determine whether lineages

fitted the predicted distribution under a sudden expansion model, we

employed mismatch distribution analyses. The validity of the model was

tested using the parametric bootstrap approach in ARLEQUIN, where P =

(number of SSDsim ≥ SSDobs)/B (Schneider & Excoffier 1999). Lineages II &

IV fitted well the predicted distribution under a sudden expansion model, but

the fit for lineages I & III were rejected. Mismatch distributions (Slatkin &

Hudson 1991; Rogers & Harpending 1992) and P values are presented in

Figure 4. To determine the approximate timing of the expansion of lineages II

& IV the equation for tau (τ = 2ut) was rearranged to solve for t (generations

since expansion).

59

Table 3. Results of nested clade analysis showing clade (Dc), nested (Dn)

and interior to tip clade (I-T) distances. Only clades with significant

permutational χ2 probabilities for geographic structure have been included. nesting

level haplotype/clade

no. location Dc Dn χ2 - P inference key

conclusion 1-2 1 tip 0 154.89 0.0730* RG-IBD 2 tip 0 211.11 3 interior 180.73L* 179.85L* I-T 180.73L* 13.71 1-5 9 interior 0S 453.44L 0.0000 CRE/LDC/PF? 7 tip 55.09S 306.57S 8 tip 0 658.26L 11 tip 0 453.44 10 tip 0 107..05 I-T -48.41S 133.35L 1-10 20 interior 165.02S 182.07S 0.0000 CRE 18 tip 0 155.39 23 tip 0 155.39 19 tip 0 155.39 21 tip 0 677.99L 22 tip 0 677.99 I-T 165.02 -271.95S 2-1 1-1 tip 0 183.23 0.0020 CRE/LDC/PF? 1-2 interior 178.65S 183.04L 1-3 tip 0S 182.77S I-T 178.65L 0.22L 2-2 1-4 interior 48.30S 385.25S 0.0000 CRE 1-5 tip 365.84S 463.70L 1-6 interior 0S 393.00S I-T -341.69S -74.58S 2-3 1-7 interior 0S 587.24L 0.0000 CRE/LDC/PF? 1-8 tip 0 477.40 1-9 tip 0 167.61 1-10 tip 201.29S 261.67S I-T -196.44S 324.11L 3-1 2-1 tip 183.00S 653.09L 0.0000 IBD/LDD? 2-2 interior 426.99 426.40S 2-3 tip 399.36S 391.67S I-T 102.49L -55.71 Footnote: Significantly small or large values for Dc, Dn and I-T (Dc and Dn) are indicated by

superscript ‘S’ and ‘L’ respectively, and ‘*’ indicates P < 0.08. Inference key conclusions

using Templeton’s updated key for NCA (Templeton 2004). Conclusions as follows: RG-IBD,

restricted gene flow with isolation by distance; CRE, contiguous range expansion; LDC, long

distance colonisation; PF, past fragmentation; IBD, isolation by distance; LDD, long distance

dispersal. ‘?’ indicates inconclusive outcome discriminating between the listed conclusions.

60

The product of μ and 602 nucleotide sites used in this study replaced the

parameter u in the equation. Substituting these values into the equation and

assuming a generation time of 6 months - 1 year, it is suggested that the

initial timing of these expansion events took place approximately 154 000-77

000 years BP for lineage II, and 370 000-185 000 years BP for lineage IV.

61

DISCUSSION Four discrete genealogical lineages of giant freshwater prawns were

identified in this study (Fig. 1): a Western Australian lineage (lineage I); a

Gulf of Carpentaria/Northern Territory lineage (II); an Irian Jayan lineage (III);

and a Papua New Guinean/NE Cape York lineage (IV). This relationship

coincides with the phylogeographic structuring of a number of marine

organisms sampled from Australian waters that have displayed genetic

breaks between i.) Western Australia ii.) NE Australia and/or iii.) Northern

Territory/Gulf of Carpentaria (Mulley & Latter 1981; Benzie et al. 1992;

Johnson & Joll 1993; Keenan 1994; Norman et al. 1994; Elliott 1996;

Fitzsimmons et al. 1997; Begg et al. 1998; Chenoweth et al. 1998; Brooker et

al. 2000; Benzie et al. 2002; Gopurenko & Hughes 2002; Ovenden et al.

2002). It also coincides with results from the only two molecular studies

undertaken on freshwater taxa in this region to date. The first identified low

levels of divergence between populations of redclaw crayfish from the Gulf of

Carpentaria and the Northern Territory (Macaranas et al. 1995), while the

second found a close phylogenetic relationship between rainbowfish from

southern Papua New Guinea and northern Australia indicative of recent

speciation and range expansion events (McGuigan et al. 2000).

Morphological variation among Australian M. rosenbergii populations also

appears broadly concordant with genetic relationships presented here. While

the reciprocal monophyly of the northwestern and northeastern Australian

races (lineages I & II respectively) are supported in the phylogenetic and

phylogeographic reconstructions (Fig. 1 & 2), the intermediate form, while

comprising a distinct sub-grouping (Northern Territory haplotypes), remains

nested within the Eastern Australian lineage (lineage II; Fig. 1). Based on

molecular data, the Keep River specimens collected for the present study do

not represent the northwestern race, as suggested by the morphological data

(Short 2000), but rather the intermediate form. Alternatively, specimen

collections for these two studies may have been from two geographically

isolated locations from the Keep River drainage, thus the Keep River region

may be a zone of contact between the northwestern race and the

intermediate form. This hypothesis warrants further investigation, and we

propose to investigate this further using microsatellite markers in the near

62

Figure 3. Statistical parsimony cladogram (95%) for lineage II estimated from

the M. rosenbergii COI data. Small black circles indicate inferred missing

haplotypes not observed in the dataset. See Fig. 2 and Table 1 for haplotype

frequencies.

future. In direct contrast to the molecular data, no morphological divergence

was reported between NW and NE Cape York populations (Short 2000).

Analysis of molecular variance indicated that the regional structuring

of the four lineages explained much of the total genetic variance presented

here. Complete lineage sorting and the high ΦST values (Table 2) among

populations from discrete lineages suggest that these lineages are on

independent evolutionary pathways, and have been so for a considerable

time frame. Indeed, a molecular clock estimate of the time to coalescence

5

4 2

6

1

3

13

12

9

7

8

10

11

14

24

16 15

17

22 20 18

23

19

21

1-1

1-2

1-3

1-4

1-5

1-6

1-7

1-8

1-9

1-10

2-1 2-2

2-3

63

between these groups indicates that events during the early Pleistocene,

some 1-1.7 Mya, initiated the regional structuring of haplotypes. Any

inferences regarding the timing of colonisation based on a partial phylogeny

such as that presented here however, may not reveal a true history. Hence,

we did not attempt to elucidate the chronology of ancestry among these

lineages, as our sampling was limited to a fairly small part of M. rosenbergii’s

(eastern form) known distribution (de Bruyn et al. 2004). We propose to

investigate ancestral relations among lineages in more detail in the future.

Within-lineage variation was also highly structured, with all populations

significantly differentiated from each other in the two lineages that were

represented by more than a single population (lineages II & IV; Table 2). In

population genetic terms, these data suggest that gene flow among

populations within regions is not sufficient to counter the effects of random

genetic drift. Out of a total of 43 unique haplotypes, only 4 were distributed in

multiple populations, all of which represented lineage II. Sharing of

haplotypes among the Keep & Katherine Rivers; the Wenlock & Norman

Rivers; the Norman, McArthur, Archer & Limmen Bight Rivers; and the Roper

& McArthur Rivers respectively, could indicate either the retention of

ancestral polymorphisms or alternatively that low levels of gene flow

occur(ed) among these populations. That 3 of these 4 haplotypes were

interior (ancestral) haplotypes (Fig. 3) would suggest that the retention of

ancestral polymorphisms is a more likely scenario.

Within lineage IV, the close phylogenetic relationship between the

Hann River population (NE coast of Cape York Peninsula, Australia) and the

Fly River population (Papua New Guinea) was surprising, given the much

greater geographic distance between the Hann and Fly Rivers compared with

that between the Hann River and western Cape York sites (e.g. Wenlock and

Archer Rivers, see Fig. 2). Nonetheless, the Hann and Fly River populations

do not share haplotypes, and it would appear (Fig. 1 & 2; Table 3) that the

relationship between them is historical, and not a consequence of

contemporary processes. The lack of evidence for ‘recent’ genetic

interchange between the Fly River and the Gulf of Carpentaria populations

challenges the hypothesis (Blake & Ollier 1969; Torgersen et al. 1983;

Torgersen et al. 1988) that the Fly River drained into Lake Carpentaria for an

Figure 4. Distribution of pairwise differences among mtDNA COI haplotypes for lineages I-IV. F(i): relative frequency of haplotypes

with i differences. (a) lineage I, (b) lineage II, (c) lineage III, (d) lineage IV.

(a). (b).

(c). (d).

65

extensive period of time during the late Pleistocene. Rather, the data

supports the alternative view (Harris et al. 1996) that the Fly River remained

on an easterly course draining into the Coral Sea during this time. Indeed, an

estimate of the time to coalescence between populations from the Fly River

and the Gulf of Carpentaria dates back some 1.5 Mya. Additional molecular

studies of freshwater taxa sampled from southern New Guinea rivers (that

are believed to have drained into Lake Carpentaria; see Fig. 2) are warranted

to further elucidate historical connectivity between Australia and New Guinea.

Interestingly, the time frame estimated here for coalescence between

lineages restricted to western and eastern flowing rivers on the Cape York

Peninsula (lineages II & IV respectively) concords with that identified for

divergence between populations of the estuarine mud crab, Scylla serrata,

sampled from either side of the Cape York Peninsula (~1 Mya; Gopurenko et

al. 1999).

The hypothesis that Lake Carpentaria provided habitat for, and

facilitated gene flow among giant freshwater prawn populations during the

late Pleistocene is supported by our analyses. NCA of lineage II strongly

indicated a range expansion event at both 1-step and 2-step clade levels for

present day Gulf of Carpentaria populations (Table 3). This expansion is also

evident in the star-like structuring of lineage II haplotypes (Fig. 3; Slatkin &

Hudson 1991). Inferring the timing of this lineage expansion (154 000 - 77

000 years BP) indicated that the formation of Lake Carpentaria some 80 000

years BP (Jones & Torgersen 1988) may have initiated this event.

Subsequently, Lake Carpentaria was replaced by a marine environment

some 8 500 years BP as sea-levels rose (Torgersen et al. 1983; Torgersen et

al. 1985; Jones & Torgersen 1988; Chivas et al. 2001), which evidently

restricted gene flow among populations formerly connected by the Lake. This

subsequent restriction of gene flow is suggested by significant values for all

pairwise tests of non-differentiation among populations from the Gulf region

(Table 2), while the low number of nucleotide differences and the lack of

geographic structuring among these haplotypes indicates that divergence

was ‘recent’. This fragmentation event highlights one recognised limitation of

NCA, i.e. the fragmentation event was too recent to detect using NCA (see

Masta et al. 2003 & Templeton 2004 for discussion). This problem can be

66

circumvented, however, by incorporating frequency-based analyses (e.g.

FST’s; A.R. Templeton, pers. comm.) as illustrated here. It would appear that

Northern Territory sites included in this study were either colonised shortly

after the time of Lake Carpentaria’s formation, or in situ haplotypes were

replaced by ‘Lake Carpentaria type’ haplotypes that have diverged

subsequently in apparent isolation (Fig. 1 & 2).

In conclusion, Lake Carpentaria appears to have played an important

role in the evolutionary history of aquatic taxa during the late Pleistocene

(this study; Macaranas et al. 1995; McGuigan et al. 2000), and may also

prove to have been a significant influence on pre-historic human migrations

in the region. Moreover, our results do not support the hypothesis (Blake &

Ollier 1969; Torgersen et al. 1983; Torgersen et al. 1988) of a westward

diversion of the Fly River during this time. The combination of geological and

molecular data presented here provides a powerful framework for

investigating the influence of historical earth history events on the distribution

of biological (i.e. molecular) diversity.

67

ACKNOWLEDGMENTS This paper is dedicated to the memory of our friend and colleague, Steve

Caldwell. We thank Steve Caldwell, Natalie Baker, Daisy Wowor, Peter Ng,

David Milton, John Short, Peter Davie and David Harvey for help in collecting

samples for this study. David Hurwood and Andrew Baker provided helpful

suggestions that improved the manuscript. Thanks to all in the QUT

Ecological Genetics Lab and Ecological Genetics Group (EGG) for

suggestions and assistance. MdB received financial support from an

Australian Postgraduate Award. MdB’s SE Asian and Australian fieldwork

was supported partly by research grants from the Australian Geographic

Society, the Ecological Society of Australia and the Linnean Society of New

South Wales. PBM acknowledges support from an ACIAR small-project grant

FIS/2002/083 and assistance from Western Australian Fisheries.

AUTHOR INFORMATION BOX This research forms part of Mark de Bruyn’s PhD thesis on the evolutionary

history of giant freshwater prawns, and the application thereof in addressing

questions related to earth history events. John Wilson (Mark’s co-supervisor)

and members of his group focus mainly on the ecology and population

dynamics of small mammal populations, particularly in northern Queensland.

Peter Mather leads research in the QUT Ecological Genetics lab, which often

focuses on the management implications of molecular variation in fishes and

crustaceans, although studies on other animals, and occasionally plants, are

also tolerated.

68

REFERENCES Avise JC (2000) Phylogeography. The history and formation of species.

Harvard University Press, Cambridge, MA, USA.

Begg GA, Keenan CP, Salini MJ (1998) Genetic variation and stock structure

of school mackerel and spotted mackerel in northern Australian waters.

Journal of Fish Biology, 53, 543-559.

Benzie JAH, Frusher S, Ballment E (1992) Geographical variation in

allozyme frequencies of populations of Penaeus monodon (Crustacea:

Decapoda) in Australia. Australian Journal of Marine and Freshwater

Research, 43, 715-725.

Benzie JAH, Ballment E, Forbes AT et al. (2002) Mitochondrial DNA variation

in Indo-Pacific populations of the giant tiger prawn, Penaeus monodon.

Molecular Ecology, 11, 2553-2569.

Bermingham E, Martin AP (1998) Comparative phylogeography of

neotropical freshwater fish: testing shared history to infer the

evolutionary landscape of Central America. Molecular Ecology, 7, 499-

517.

Blake DH, Ollier CD (1969) Geomorphological evidence of Quartenary

tectonics in Southwestern Papua. Revue de Geomorphologie

Dynamique, 19, 28-32.

Brooker AL, Benzie JAH, Blair D, Versini J-J (2000) Population structure of

the giant tiger prawn Penaeus monodon in Australian waters,

determined using microsatellite markers. Marine Biology, 136, 149-157.

Campbell NJH, Harriss FC, Elphinstone MS, Baverstock PR (1995) Outgroup

heteroduplex analysis using temperature gradient gel electrophoresis:

high resolution, large scale, screening of DNA variation in the

mitochondrial control region. Molecular Ecology, 7, 407-418.

Chenoweth SF, Hughes JM, Keenan CP, Lavery S (1998) When oceans

meet: a teleost shows secondary intergradation at an Indian-Pacific

interface. Proceedings of the Royal Society of London B, 265, 415-420.

Chivas AR, Garcia A, van der Kaars S et al. (2001) Sea-level and

environmental changes since the last interglacial in the Gulf of

Carpentaria, Australia: an overview. Quartenary International, 83-85, 19-46.

69

Clement M, Posada D, Crandall KA (2000) TCS: a computer program to

estimate gene genealogies. Molecular Ecology, 9, 1657-1659.

Crandall KA (1996) Multiple interspecies transmissions of human and simian

T-cell leukemia/lymphoma virus type I sequences. Molecular Biology

and Evolution, 13, 115-131.

de Bruyn M, Wilson JC, Mather PB (2004) Huxley’s Line demarcates

extensive genetic divergence between eastern and western forms of the

giant freshwater prawn, Macrobrachium rosenbergii. Molecular

Phylogenetics and Evolution, 30, 251-257.

Elliott NG (1996) Allozyme and mitochondrial DNA analysis of the tropical

saddle-tail sea perch, Lutjanus malabaricus (Schneider), from

Australian waters. Marine and Freshwater Research, 47, 869-876.

Excoffier L, Smouse PE, Quattro JM (1992) Analysis of molecular variance

inferred from metric distances among DNA haplotypes: application to

human mitochondrial DNA restriction data. Genetics, 131, 479-491.

Excoffier L, Smouse PE (1994) Using allele frequencies and geographic

subdivision to reconstruct gene genealogies within a species. Molecular

variance parsimony. Genetics, 136, 343-359.

FAO (Food and Agriculture Organisation of the United Nations) (2000)

Aquaculture production statistics 1989-1998. FAO Fisheries Circular

815 (Rev 12). FAO, Rome.

Felsenstein J (1985) Confidence limits on phylogenies: an approach using

the bootstrap. Evolution, 39, 783-791.

Felsenstein J (1988) Phylogenies from molecular sequences: inference and

reliability. Annual Review of Genetics, 22, 521-565.

Fitzsimmons NN, Moritz C, Limpus CJ, Pope L, Prince R (1997) Geographic

structure of mitochondrial and nuclear gene polymorphisms in

Australian green turtle populations and male-biased gene flow.

Genetics, 147, 1843-1854.

Folmer O, Black M, Hoeh W, Lutz R, Vrijenhoek R (1994) DNA primers for

amplification of mitochondrial cytochrome c oxidase subunit I from

diverse metazoan invertebrates. Molecular Marine Biology and

Biotechnology, 3, 294-299.

70

Fu Y-X, Li WH (1993) Statistical tests of neutrality of mutations. Genetics,

133, 693-709.

Gopurenko D, Hughes JM, Keenan CP (1999) Mitochondrial DNA evidence

for rapid colonisation of the Indo-West Pacific by the mudcrab Scylla

serrata. Marine Biology, 134, 227-233.

Gopurenko D, Hughes JM (2002) Regional patterns of genetic structure

among Australian populations of the mud crab, Scylla Serrata

(Crustacea: Decapoda): evidence from mitochondrial DNA. Marine and

Freshwater Research, 53, 849-857.

Harris PT, Pattiaratchi CB, Keene JB, et al. (1996) Late Quartenary deltaic

and carbonate sedimentation in the Gulf of Papua foreland basin:

response to sea-level change. Journal of Sedimentary Research, 66, 801-819.

Johnson MS, Joll LM (1993) Genetic subdivision of the pearl oyster Pinctada

maxima (Jameson, 1901) (Mollusca: Pteridae) in Northern Australia.

Australian Journal of Marine and Freshwater Research, 44, 519-526.

Jones MR, Torgersen T (1988) Late Quartenary evolution of Lake

Carpentaria on the Australia-New Guinea continental shelf. Australian

Journal of Earth Sciences, 35, 313-324.

Keenan CP (1994) Recent evolution of population structure in Australian

barramundi, Lates calcarifer (Bloch): an example of isolation by

distance in one dimension. Australian Journal of Marine and Freshwater

Research, 45, 1123-1148.

Knowles LL, Maddison WP (2002) Statistical phylogeography. Molecular

Ecology, 11, 2623-2635.

Knowlton N, Weigt LA (1998) New dates and new rates for divergence

across the Isthmus of Panama. Proceedings of the Royal Society of

London B, 265, 2257-2263.

Macaranas JM, Mather PB, Hoeben P, Capra MF (1995) Assessment of

genetic variation in wild populations of the redclaw crayfish (Cherax

quadricarinatus, von Martens 1868) by means of allozyme and RAPD-

PCR markers. Marine and Freshwater Research, 46, 1217-1228.

71

Marko PB (2002) Fossil calibration of molecular clocks and the divergence

times of geminate species pairs separated by the Isthmus of Panama.

Molecular Biology and Evolution, 19, 2005-2021.

Masta SE, Laurent NM, Routman EJ (2003) Population genetic structure of

the toad Bufo woodhousii: an empirical assessment of the effects of

haplotype extinction on nested cladistic analysis. Molecular Ecology, 12, 1541-1554.

McGuigan K, Zhu D, Allen GR, Moritz C (2000) Phylogenetic relationships

and historical biogeography of melanotaeniid fishes in Australia and

New Guinea. Marine and Freshwater Research, 51, 713-723.

Mulley JC, Latter BDH (1981) Geographic differentiation of tropical Australian

penaeid prawn populations. Australian Journal of Marine and

Freshwater Research, 32, 897-906.

Norman JA, Moritz C, Limpus CJ (1994) Mitochondrial DNA control region

polymorphisms: genetic markers for ecological studies of marine turtles.

Molecular Ecology, 3, 363-373.

Ovenden JR, Lloyd J, Newman SJ, Keenan CP, Slater LS (2002) Spatial

genetic subdivision between northern Australian and southeast Asian

populations of Pristipomoides multidens: a tropical marine reef fish

species. Fisheries Research, 59, 57-69.

Posada D, Crandall KA (1998) MODELTEST: testing the model of DNA

substitution. Bioinformatics, 14, 817-818.

Posada D, Crandall KA, Templeton AR (2000) GeoDis: a program for the

cladistic nested analysis of the geographical distribution of genetic

haplotypes. Molecular Ecology, 9, 487-488.

Rogers AR (1995) Genetic evidence for a Pleistocene population explosion.

Evolution, 49, 608-615.

Rogers AR, Harpending H (1992) Population growth makes waves in the

distribution of pairwise genetic differences. Molecular Biology and

Evolution, 9, 552-569.

Rozas J, Sanchez-Delbarrio JC, Messeguer X, Rozas R (2003) DnaSP, DNA

polymorphism analyses by the coalescent and other methods.

Bioinformatics, 19, 2496-2497.

72

Sandifer PA, Hopkins JS, Smith TIJ (1975) Observations on salinity tolerance

and osmoregulation in laboratory-reared Macrobrachium rosenbergii

post-larvae (Crustacea: Caridea). Aquaculture, 6, 103-114.

Schneider S, Excoffier L (1999) Estimation of demographic parameters from

the distribution of pairwise differences when the mutation rates vary

among sites: Application to human mitochondrial DNA. Genetics, 152, 1079-1089.

Schneider SD, Roessli D, Excoffier L (2000) ARLEQUIN, Version 2.0: A

Software for Population Genetic Data Analysis. Genetics and Biometry

Laboratory, University of Geneva, Geneva, Switzerland.

Short J (2000) Systematics and biogeography of Australian Macrobrachium

(Crustacea: Decapoda: Palaemonidae) – with descriptions of other new

freshwater Decapoda. Ph.D. thesis, The University of Queensland,

Brisbane, Australia.

Slatkin M, Hudson RR (1991) Pairwise comparisons of mitochondrial DNA

sequences in stable and exponentially growing populations. Genetics,

129, 555-562.

Smart J (1977) Late Quartenary sea level changes, Gulf of Carpentaria,

Australia. Geology, 5, 755-759.

Sponer R, Roy MS (2002) Phylogeographic analysis of the brooding brittle

star Amphipholis squamate (Echinodermata) along the coast of New

Zealand reveals high cryptic genetic variation and cryptic dispersal

potential. Evolution, 56, 1954-1967.

Swofford DL (2002) PAUP*. Phylogenetic Analysis Using Parsimony (*and

Other Methods), Version 4. Sinauer Associates, Sunderland, MA.

Tajima F (1989) Statistical method for testing the neutral mutation hypothesis

by DNA polymorphism. Genetics, 123, 585-595.

Tamura K, Nei M (1993) Estimation of the number of nucleotide substitutions

in the control region of mitochondrial DNA in humans and chimpanzees.

Molecular Biology and Evolution, 10, 512-516.

Templeton AR (1998) Nested clade analyses of phylogeographic data:

testing hypotheses about gene flow and population history. Molecular

Ecology, 7, 381-397.

73

Templeton AR (2004) Statistical phylogeography: methods of evaluating and

minimizing inference errors. Molecular Ecology, 13, 789-809.

Templeton AR, Sing CF (1993) A cladistic analysis of phenotypic

associations with haplotypes inferred from restriction endonuclease

mapping. IV. Nested analyses with cladogram uncertainty and

recombination. Genetics, 134, 659-669.

Templeton AR, Routman E, Phillips C (1995) Separating population structure

from population history: a cladistic analysis of the geographical

distribution of mitochondrial DNA haplotypes in the tiger salamander,

Ambystoma tigrinum. Genetics, 140, 767-782.

Thompson JD, Gibson TJ, Plewniak F, Jeanmougin F, Higgens DG (1997)

The ClustalX windows interface: flexible strategies for multiple

sequence alignment aided by quality analysis tools. Nucleic Acids

Research, 24, 4876-4882.

Torgersen T, Hutchinson MF, Searle DE, Nix HA (1983) General bathymetry

of the Gulf of Carpentaria and the Quartenary physiography of Lake

Carpentaria. Palaeogeography, Palaeoclimatology, Palaeoecology, 41, 207-225.

Torgersen T, Jones MR, Stephens AW, Searle DE, Ullman WJ (1985) Late

Quartenary hydrological changes in the Gulf of Carpentaria. Nature,

313, 785-787.

Torgersen T, Luly J, De Deckker P et al. (1988) Late Quartenary

environments of the Carpentaria Basin, Australia. Palaeogeography,

Palaeoclimatology, Palaeoecology, 67, 245-261.

Voris HK (2000) Maps of Pleistocene sea levels in Southeast Asia:

shorelines, river systems and time durations. Journal of Biogeography,

27, 1153-1167.

Waters JM, Craw D, Youngson JH, Wallis GP (2001) Genes meet geology:

fish phylogeographic pattern reflects ancient, rather than modern,

drainage connections. Evolution, 55, 1844-1851.

Waters JM, Roy MS (2003) Marine biogeography of southern Australia:

phylogeographical structure in a temperate sea-star. Journal of

Biogeography, 30, 1787-1796.

74

Statement of Joint Authorship

Mark de Bruyn, Estu Nugroho, Md. Mokarrom Hossain, John C. Wilson and

Peter B. Mather (2004) Phylogeographic evidence for the existence of an

ancient biogeographic barrier: the Isthmus of Kra Seaway. Heredity, 94, 370-

378.

Mark de Bruyn (candidate) Designed and developed experimental protocol. Carried out field and

laboratory work, and analysed data. Wrote manuscript and acted as

corresponding author.

Estu Nugroho Carried out field work and contributed to the structure and editing of the

manuscript.

Md. Mokarrom Hossain Carried out field work and contributed to the structure and editing of the

manuscript.

John C. Wilson Co-supervised the study design and experimental protocols. Assisted in the

interpretation of data. Contributed to the structure and editing of the

manuscript.

Peter B. Mather Principal supervisor of the study design and experimental protocols. Assisted

in the interpretation of data. Contributed to the structure and editing of the

manuscript.

75

CHAPTER 4. Phylogeographic evidence for the existence of an ancient

biogeographic barrier: the Isthmus of Kra Seaway.

Mark de Bruyn1, Estu Nugroho2, Md. Mokarrom Hossain3, John C. Wilson1

and Peter B. Mather1

Affiliations: 1. School of Natural Resource Sciences, Queensland University of

Technology, GPO Box 2434, Brisbane, Queensland 4001, Australia

2. Research Institute for Freshwater Fisheries, Jakarta Selatan, Indonesia

3. Bangladesh Research Aquaculture Centre, Dhaka, 1212, Bangladesh

ABSTRACT Biogeographic boundaries are characterised by distinct faunal and floral

assemblages restricted on either side, but patterns among groups of taxa

often vary and may not be discrete. Historical biogeography as a

consequence, while providing crucial insights into the relationship between

biological diversity and earth history, has some limitations. Patterns of

intraspecific molecular variation, however, may show unambiguous evidence

for such historical divides, and can be used to test competing biogeographic

hypotheses (often based on the dispersal-vicariance debate). Here we utilise

this method to test the hypothesis that a major biogeographic transition zone

between the Sundaic and Indochinese biotas, located just north of the

Isthmus of Kra in SE Asia, is the result of Neogene marine transgressions

that breached the Isthmus in two locations for prolonged periods of time

(>one million year duration). Phylogeographic analyses of a freshwater

decapod crustacean, the giant freshwater prawn Macrobrachium rosenbergii,

strongly supports the historical existence of the more northerly postulated

seaway. Results presented here highlight the power of utilising intraspecific

molecular variation in testing biogeographic hypotheses.

Keywords: vicariance, introgression, nested clade analysis, SE Asia,

Isthmus of Kra, Macrobrachium rosenbergii

76

INTRODUCTION The biogeographic province of Sundaland (land on the Sunda Shelf south of

the Isthmus of Kra) was greatly affected by eustatic sea-level changes for

much of the Tertiary, including the well-documented flooding of the Sunda

Shelf (Hanebuth et al. 2000). The region is bordered to the east by what is

probably the most well known biogeographic boundary recognised today,

Wallace’s Line. A second but lesser-known biogeographic boundary occurs

at the transition zone between the Sundaic and Indochinese biotas (sensu

Woodruff 2003) in the vicinity of the Isthmus of Kra (Fig. 1), with distinct

assemblages of amphibians (Inger 1966; see review by Inger & Voris 2001),

reptiles (Inger & Voris 2001), birds (Hughes et al. 2003), mammals (Corbett &

Hill 1992), insects (Corbet 1941) and plants (Ridder-Numan 1998;

Denduangboripant & Cronk 2000) limited to varying degrees either side of

this barrier. Recently, it has been hypothesised that marine transgressions

may have produced this pattern (Woodruff 2003); specifically, that Miocene-

(24 - 23 Mya) and Pliocene-era (5.5 - 4.5 Mya) high sea-level stands resulted

in two seaways that dissected the Thai-Malay Peninsula (Fig. 1; Woodruff

2003), for durations in excess of one million years. This hypothesis is based

on an extensive review of both biological and geological evidence (Woodruff

2003), and received strong support specifically from past sea-level

highstands evident from the Vail global eustatic curve (Vail & Hardenbol

1979) and the oxygen isotope curve (see Woodruff 2003).

If seaways had divided the Thai-Malay Peninsula in the past creating

an archipelago for a significant period of time (>1 MY), this should be evident

in the intraspecific molecular ‘signatures’ of organisms sampled from either

side of this barrier, relative to their dispersal potential and the nature (width,

throughflow volume, etc.) of the seaway. Such studies on terrestrial (Hoffman

& Baker 2003; Zeh et al. 2003) and marine taxa (Knowlton et al. 1993;

Collins et al. 1996; Bermingham et al. 1997; Knowlton & Weigt 1998; Tringali

et al. 1999; Marko 2002 and others) from the Isthmus of Panama have

provided a wealth of information on the role that vicariance can play in

shaping genetic divergence among populations, and ultimately, in speciation

events among taxa. Woodruff (2003) identified the need for phylogeographic

77

Figure 1. Study region and relationships among M. rosenbergii COI mtDNA

haplotypes. Solid lines indicate approximate width of proposed Isthmus of

Kra Seaways (Woodruff 2003). Sampling sites labelled a-k (see Table 1 for

details). The size of the circles and rectangle indicate relative frequencies of

the haplotypes (Table 2). The single hatched circle in the southern clade

indicates a ‘southern haplotype’ collected from a northern site (Kraburi River;

site c).

(sensu Avise et al. 1987) or phylogenetic studies of ‘appropriate’ taxa at the

Isthmus of Kra interface to further investigate causal mechanisms leading to

the biogeographic patterns observed. To date, no such studies have been

carried out.

Macrobrachium rosenbergii, the giant freshwater prawn, is an ideal

model species for investigating these mechanisms. Molecular analyses of

freshwater dependent taxa should prove particularly useful in this regard, as

78

such organisms are likely to have remained effectively isolated in discrete

freshwater drainages after the seaways subsided (unlike amphibians,

mammals, birds, etc.), limiting their opportunity for range expansion or

secondary contact that could make interpretation of the data difficult. M.

rosenbergii has a broad distribution in the region, and our previous study (de

Bruyn et al. 2004) indicated that stocks found either side of Huxley’s

extension of Wallace’s Line may have been strongly influenced by the

historical geography of the region. Here, we utilise intraspecific mitochondrial

DNA (mtDNA) variation in the western form (sensu de Bruyn et al. 2004) of

the giant freshwater prawn, Macrobrachium rosenbergii, to test for evidence

for ancient seaways that are believed to have dissected the Thai-Malay

Peninsula. Furthermore, we explore the utility of this intraspecific approach

(i.e. phylogeography sensu Avise et al. 1987) for testing biogeographic

hypotheses.

79

METHODS (a) Taxa, sample collection and molecular analyses

M. rosenbergii is an obligate freshwater crustacean as an adult but requires

brackishwater for larval survival and development. Results of salinity-

tolerance experiments on M. rosenbergii suggest that both adults and

postlarvae can survive in brackish conditions (up to 12ppt) for extended

periods of time without any apparent detrimental effects. They are unable,

however, to tolerate full marine conditions for more than a week as adults

and 20 days as postlarvae (Sandifer et al. 1975). Prawns used in this study

were collected from localities indicated in Fig. 1 and Table 1, and were

identified using Short’s Macrobrachium key (1998). As M. rosenbergii are a

commercially-important species (FAO 2000), a factor that constrained

selection of sampling sites for this study (particularly for sites adjacent to the

postulated seaways) was the need for sites to be free of translocated stock to

eliminate the potential that prawns with non-native genotypes were included

in the analysis (Thai Freshwater Fisheries; N. Pongthana, pers. comm.). This

resulted in an unbalanced sampling design either side of the postulated

seaways i.e. more ‘southern’ than ‘northern’ sites. This lack of balance does

not diminish the findings of this study, as it has been demonstrated that

sampling of at least 90 individuals (from uncontaminated wild stocks

collected from either side of the proposed seaways), provides the statistical

power to detect with 95% probability at least one copy of all haplotypes

occurring at a frequency of 1% (Schwager et al. 1993).

Tissue samples (muscle or pleopod) were stored in 70% ethanol until

required for molecular analyses. For DNA extraction, a small piece of tissue

was first rehydrated for 30 minutes in 1ml GTE buffer (100mM glycine, 10mM

Tris, 1mM EDTA). Tissue samples were then incubated overnight at 55ºC in

500µl extraction buffer (100mM NaCL, 50mM Tris, 10mM EDTA, 0.5% SDS)

containing 20µl of 10µg/µl Proteinase K (Sigma Co.). Total genomic DNA

was extracted using standard phenol: chloroform extraction methods, and

collected by ethanol precipitation. Amplification of a fragment of the mtDNA

cytochrome c oxidase subunit I (COI) gene was carried out using primers

LCO1490 and HCO2198 (Folmer et al. 1994).

80

Table 1. Collection location, site ID and geographical coordinates

for samples used in this study.

collection location site ID

geographical position

Raimangal R, SW Bangladesh a 22°00´N 89°20´E Meghna R, SE Bangladesh b 22°29´N 91°25´E Kraburi R, SW Thailand c 09°58´N 98°37´E Tapi R, SE Thailand d 09°02´N 99°10´E Setiu R, NE Peninsula Malaysia

e 05°20´N 103°07´E

Semenyih R, Peninsula Malaysia

f 03°08´N 101°42´E

Bahand R, Sth Peninsula Malaysia

g 02°12´N 102°15´E

Dongnai R, Vietnam h 10°45´N 106°45´E Mekong R, Vietnam i 10°02´N 105°50´E Musi R, Sth Sumatra j 01°35´S 102°30´E Barito R, SE Kalimantan k 03°15´S 114°38´E

PCR conditions were as follows: each 50µl amplification reaction consisted of

400 ng of template DNA, 5 µl of 10X buffer containing MgCl2 (Roche), an

additional 2µl of 25mM MgCl2 (Roche), 0.5 units of Taq polymerase (Roche),

0.8 µl of each primer (10 µM final conc.), 0.2 mM of each dNTP, and 38.95 µl

autoclaved ddH2O. Samples that proved difficult to PCR were amplified using

READY-TO-GO®BEADS (Pharmacia Biotech). Thermal cycling was

performed on a PTC-100 thermocycler (MJ Research Inc.) under the

following conditions: 3 min denaturation at 94ºC, followed by 30 cycles of 30

sec at 94ºC, 30 sec at 55ºC, 30 sec at 72ºC, and a final 10 min extension at

72ºC, before cooling to 4ºC for 10 mins. Negative controls were included in

all PCR runs. PCR amplifications were confirmed with agarose gel

electrophoresis on a 1% gel. Screening for intrapopulation variation was

carried out using Temperature Gradient Gel Electrophoresis (TGGE)

combined with Outgroup Heteroduplex Analysis (OHA) (Campbell et al.

1995). This method proved to be sensitive enough to consistently distinguish

among haplotypes that varied by a single base pair (bp). All individuals were

analysed by way of TGGE/OHA, and 2-3 individuals exhibiting identical

banding patterns from each population were sequenced to confirm that they

shared identical haplotypes. PCR products from haplotypes identified as

unique using TGGE/OHA were purified using a Qiagen QIAquick PCR

81

purification kit. DNA sequencing of 602 bp of the COI gene was conducted

on an ABI 3730 automated sequencer at the Australian Genome Research

Facility at the University of Queensland, Brisbane, Australia. Both strands of

the PCR product were completely sequenced.

(b) Data analysis

Sequences were aligned in ClustalX (Thompson et al. 1997) with parameters

set to default. Initial data exploration and Kimura 2-parameter (Kimura 1980)

sequence divergences were carried out in MEGA ver. 2.1 (Kumar et al. 2001).

Haplotype (h) and nucleotide diversity (π) indices and Tajima’s D test (Tajima

1989) for neutrality were performed in DnaSP (Rozas et al. 2003). A

bootstrapped (1000 pseudoreplicates; Felsenstein 1988) neighbour-joining

(Saitou & Nei 1987) phylogenetic tree was estimated in MEGA to identify

levels of statistical support for discrete clades identified. An M. rosenbergii

individual sampled from Bali was identified in an unpublished (de Bruyn,

unpublished data) 16S mtDNA phylogeny as an appropriate outgroup to root

the tree. To test for adherence to a clock-like evolution of the mtDNA

sequences, a log-likelihood ratio test was carried out in PAUP* 4.0b10

(Swofford 2002) that compared trees generated under the assumption of a

molecular clock, to trees unconstrained by any such assumption (Felsenstein

1988). The timing of cladogenesis identified in the phylogeny was then

inferred by way of molecular clock approximation.

Geographical associations among haplotypes were tested using

nested clade analysis (NCA; Templeton 1998). A haplotype cladogram was

generated in TCS (Clement et al. 2000), and then manually converted into a

nested design using the nesting rules outlined in Templeton & Sing (1993),

Crandall (1996) and Templeton (1998). This nested design was then

analysed in GeoDis ver. 2.0 (Posada et al. 2000) with the null hypothesis of

no geographic association among haplotypes. We made a qualitative

decision to use geographic coordinates to determine distances among sites,

as opposed to stream distance (Fetzner & Crandall 2003), as most sampling

sites were restricted to geographically isolated drainage basins. Templeton’s

(2004) latest inference key was used to infer processes involved in any

statistically significant associations observed. It has recently been suggested

that some NCA inferences may be flawed, and should therefore be supported

82

by the use of alternative analytical techniques (e.g. Alexandrino et al. 2002;

Masta et al. 2003; Templeton 2004). We therefore applied the

coalescent/maximum-likelihood approach implemented in FLUCTUATE ver.

1.4 (Kuhner et al. 1998) to determine if there was evidence for population

expansion events in clades identified with NCA. Specifically, the exponential

growth or decline of the population can be inferred by positive or negative

values of the exponential growth parameter g. An exploratory search strategy

implementing 20 short chains of 1000 steps each, and 5 long chains of

20000 steps were used to determine parameters for the production runs.

Production runs were implemented using 20 short chains of 8000 steps each,

and 10 long chains of 50000 steps. The program was run multiple times to

ensure concordance of parameter estimates.

83

RESULTS In total, 404 M. rosenbergii individuals (excluding the outgroup) were

analysed for variation in a 602bp fragment of the mtDNA COI gene using

TGGE/OHA analyses. Representatives (2-3) from each population that

displayed identical banding patterns were sequenced to confirm they shared

identical haplotypes, which was confirmed in all cases. This resulted in the

identification of 35 putative haplotypes (GenBank accession numbers:

AY554293-AY554327), defined by 54 segregating sites. No significant

deviations from neutrality were identified in our dataset (Tajima’s D = -1.284,

P > 0.10). Nucleotide substitutions favoured transitions over transversions,

yielding a transition/transversion ratio of 4.16. The neighbour-joining

phylogeny strongly supported the existence of two widely distributed

monophyletic clades situated approximately 120km apart on the Isthmus of

Kra (bootstrap values: 91% for southern clade, 94% for northern clade).

Similar support was observed in the 95% probability cladogram (Fig. 1 & 2),

with populations sampled from sites north and south of the more northerly

seaway restricted to two distinct monophyletic clades, except for site c

(Kraburi River, SW Thailand) situated just north of the northern seaway,

which is characterised by individuals exhibiting both ‘northern’ and ‘southern’

haplotypes (Fig. 1 & Table 2). NCA identified an allopatric fragmentation

event followed by range expansion at the highest nesting level, i.e. between

northern and southern clades either side of the hypothesised northern

seaway (Table 3). Subsequently, we performed Templeton’s supplementary

test for secondary contact (Templeton 2001), which confirmed this

hypothesis.

Within the northern clade, NCA suggested contiguous range

expansion at both ancestral and younger clade levels, i.e. clades 3-2 and 1-5

respectively, and restricted gene flow with isolation-by-distance at the 1-step

level for clade 1-3 (Table 3). Within the southern clade, restricted gene flow

with some long distance dispersal was suggested at both ancestral and

younger clade levels, i.e. clades 2-7 and 1-9 respectively, while at the 1-step

level contiguous range expansion (clade 1-14) and restricted gene flow with

isolation-by-distance (clade 1-15) were also inferred (Table 3).

Figure 2. 95% probability cladogram estimated from the M. rosenbergii COI data. Small black circles indicate inferred missing

haplotypes not observed in the dataset. Haplotype 29 was the haplotype with the highest frequency (n=134) and the highest root

probability (Castelloe & Templeton 1994). See Fig. 1 and Table 2 for haplotype frequencies.

85

FLUCTUATE analyses of maximum likelihood estimates of g

supported the NCA inferences of expansion events in clades 3-2 (g = 235.1 ±

2 s.d. 67.3) and 1-5 (g = 303.3 ± 2 s.d. 64.0). Similarly, concordant patterns

in FLUCTUATE and NCA suggested no evidence for growth in clades 2-7 (g

= -26.1 ± 2 s.d. 45.6) and 1-9 (g = -160.9 ± 2 s.d. 76.2). Accurate testing of

clades 1-3, 1-14 and 1-15 were precluded by the star-like structure of these

clades. Such patterns result in equally high values of Θ and g, which cause

the program to fluctuate wildly on the likelihood surface until estimates

become huge and the program “overflows” (Kuhner 2003). Implementing the

analyses with more steps in each chain, and more chains (Kuhner 2003) did

not alter this outcome.

A fairly low level of divergence was evident within clades (Table 2; Fig.

2), particularly taking into account the considerable geographic distances

among sites e.g. Bangladesh to SW Thailand (~700km). Kimura 2-parameter

sequence divergences ranged from 0.002 to 0.015 within clades to 0.019 to

0.031 between the two clades. Genetic diversity measures were similar in the

two clades: northern clade (h = 0.49, π = 0.00619), southern clade (h = 0.51,

π = 0.00593). A log-likelihood ratio test could not reject the hypothesis that

lineages were evolving according to a clock-like model of evolution (-ln L =

1261.43 with molecular clock enforced vs. -ln L = 1247.17 without molecular

clock enforced, χ2 = 47.4, d.f. = 33, P > 0.10). A COI molecular clock rate of

1.4 %/Myr (Knowlton & Weigt, 1998) based on the smallest sequence

divergence observed among 15 pairs of “geminate” snapping shrimp taxa,

presumably separated by the closure of the Isthmus of Panama seaway, is

commonly used as a calibration point for estimating divergence times in

phylogeographic studies. Recent studies, however, warn against taking these

estimates at face-value, due to a number of factors known to bias such

estimates (see Marko 2002 and references therein for discussion). Indeed,

Knowlton & Weigt’s (1993) earlier COI molecular clock estimates were found

to be erroneous (Knowlton & Weigt 1998). A further complication is the

recent finding that some so-called “geminate” pairs may not be each other’s

closest living relatives, and their divergence may in fact not be related to the

closure of the Panamanian seaway (Craig et al. 2004). It has therefore been

Table 2. Site ID indicating haplotypes identified at each location (absolute frequencies) and sample size (n).

site 1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 n

a 4 2 12 1 1 2 10 32

b 3 16 1 1 11 2 34

c 1 2 1 2 2 2 1 5 1 26 43

d 1 39 40

e 1 14 15

f 46 46

g 1 1 40 42

h 17 1 1 29 1 49

i 1 14 1 2 26 1 45

j 1 1 21 23

k 27 1 8 36

87

suggested that calibrations based on the fossil record may be more

appropriate, although the lack of a suitable fossil record for shrimp/prawns

make this approach problematic. Nonetheless, we approximated a rough

estimate of divergence time between the northern and southern clades based

on Knowlton & Weigt’s (1998) mtDNA COI molecular clock (1.4 %/Myr), and

a single crustacean mtDNA COI calibration based on the fossil record (0.13 -

0.55 %/Myr; Schön et al. 1998) in an attempt to minimize error in our

inferences. The geological calibration suggested a minimum divergence time

in the region of 2.2 - 1.3 Mya, while the fossil record calibration provides a

much more conservative estimate of 14.1 - 3.3 Mya.

88

Table 3. Results of nested clade analysis showing clade (Dc), nested (Dn)

and interior to tip clade (I-T) distances. Only clades with significant

permutational χ2 probabilities for geographic structure have been included. nesting haplotype/clade no. location Dc Dn χ2 - P inference key

conclusion

1-3 4 tip 0S 132.88 0.0310 RG-IBD 5 tip 0 132.88 6 interior 117.24 154.96 I-T 117.24L 22.08 1-5 8 tip 0 288.47 0.0120 CRE 9 tip 0 1385.66L 10 tip 0 1385.66 11 tip 681.28 594.75 12 interior 218.63S 322.25S I-T -159.85 -502.11S 1-9 18 tip 0S 1184.90 0.0000 RG-LDD 19 tip 0 636.90 20 tip 0 683.23 21 tip 0S 1138.68L 22 interior 306.90S 685.03S I-T 306.90L -458.94S 1-14 24 tip 0 944.60 0.0000 CRE 25 tip 0 524.86 26 tip 0 779.94 27 tip 0 944.60 28 tip 0 246.65 29 interior 369.59S 377.17S I-T 369.59 -353.71S 1-15 33 tip 0S 285.91S 0.0170 RG-IBD 34 interior 0 1497.21 35 tip 0 1482.21 I-T 0L 1078.38 2-7 1-11 tip 0S 654.36L 0.0000 RG-LDD 1-12 tip 0S 639.92L 1-13 tip 0S 59.15S 1-14 interior 389.62S 475.92 1-15 tip 479.72 1425.20L I-T 337.47L -165.53S 3-2 2-3 tip 641.73 970.28L 0.0040 CRE 2-4 interior 465.20S 571.97S I-T -176.53 -398.31S 3-3 2-7 tip 496.40S 531.25S 0.0000 no I/T clades 2-8 tip 972.88L 1003.07L I-T n/a n/a 4-1 3-1 tip 136.44S 1937.99L 0.0000 PF-RE-SC 3-2 interior 646.58S 1532.68L 3-3 tip 645.06S 732.39S I-T 508.80L -1111.83S Footnote: Significantly small or large values for Dc, Dn and I-T (Dc and Dn) are indicated by

superscript ‘S’ and ‘L’ respectively. Inference key conclusions using Templeton’s updated

key for NCA (Templeton 2004). Conclusions as follows: RG-IBD, restricted gene flow with

isolation by distance; CRE, contiguous range expansion; RG-LDD, restricted gene flow with

some long distance dispersal; PF-RE-SC, past fragmentation followed by range expansion

and secondary contact.

89

DISCUSSION If dispersal (gene flow) of freshwater taxa has been restricted in the past by a

significant geographic barrier that lead to cladogenesis (vicariance) among

populations situated north and south of the proposed seaways, a molecular

signature of allopatric fragmentation between these populations would be

expected. Moreover, if contemporary gene flow has resulted in secondary

contact between northern and southern populations since subsidence of the

marine barriers, this should be evident in two monophyletic clades that

overlap in their geographic distribution, indicating patterns of secondary

intergradation. Results presented here indicate a sharp genetic break

between M. rosenbergii populations situated on the Isthmus of Kra. Our

analyses support the hypothesis that an ancient marine seaway divided the

Thai-Malay Peninsula, resulting in a vicariant event that restricted gene flow

among populations either side of this divide. All populations (except site c)

north and south of the northern proposed seaway, separated by a distance of

only 120km, belong to two widely distributed monophyletic mtDNA clades

that were apparently restricted to either side of this seaway (Fig. 1 & 2). If the

genetic break evident in our data is indeed a result of the Pliocene-era

seaway (5.5 - 4.5 Mya; Woodruff 2003), and not a later unidentified rise in

sea-level, the results of our molecular clock analyses would suggest that

either: i.) rates of COI evolution in M. rosenbergii are significantly slower than

in snapping shrimp, or ii.) the mtDNA COI clock rate calibrated to the closure

of the Panamanian seaway (Knowlton & Weigt 1998) is too great. No matter

the case, our results suggest that the use of such calibrations should be

applied cautiously when a good predictive temporal framework (e.g. used in

this study) is not available.

The Kraburi River population (site c) just north of the seaway was

unique because it possessed both ‘northern’ haplotypes and a single

‘southern’ haplotype, indicating a recent northward expansion of the southern

clade into this northern site leading to admixture of the two groups (Fig. 1).

This molecular signal of a recent range expansion event into the Kraburi

River (site c) is indicated by the occurrence of 9 ‘northern’ haplotypes found

in low frequencies (4 are singletons; see Table 2), and the presence of a

single southern haplotype at a high frequency (n = 26; haplotype 21),

90

suggesting a recent founder event followed by local self-seeding (Mayr 1942).

This scenario was strongly supported by the NCA (Table 3). There is no

explicit support in our data for the second and more southerly seaway,

however this may be a consequence of the lesser width of this seaway (Fig.

1) and the dispersal capabilities of the organism in question.

Because populations that are today geographically isolated from each

other by a marine environment share haplotypes over distances of hundreds

of kilometres, the question arises as to what mechanisms are involved in

maintaining these relationships. In a previous phylogenetic study conducted

at a broader spatial scale (de Bruyn et al. 2004), it was suggested that

Pleistocene drainage basins that linked sites on the Sunda Shelf that are

today geographically isolated, may have acted as conduits for gene-flow

among some populations of M. rosenbergii. Similar studies on freshwater fish

indicate the important role that ancient drainage basins have played in

shaping the distribution of molecular variation in freshwater organisms

(Hurwood & Hughes 1998; Waters et al. 2001; Kotlik et al. 2004 and others).

This ancient drainage basin hypothesis goes some way to describing the

close relationship among populations observed here, particularly for sites d, e,

f, g & h (i.e. southern Thai-Malay Peninsula & Sth. Vietnam). These sites are

likely to have been linked by freshwater via the Siam or Malacca Straits River

Systems that existed during the Pleistocene (Voris 2000; see de Bruyn et al.

2004 for discussion). NCA provides support for this scenario, inferring a fairly

recent (in evolutionary terms; 1-step clade level) contiguous range expansion

among all southern clade sites except for SE Kalimantan. The Kalimantan

population (site k) appears to have been isolated historically for an extended

period of time, as there is virtually no sharing of haplotypes with any other

southern sites (Table 2). Interestingly, SE Kalimantan is the population

involved in both recent and ancestral inferred events utilising NCA; restricted

gene flow with some long distance dispersal, and restricted gene flow with

isolation-by-distance. This pattern warrants further investigation.

The close genetic relationship between the Sumatran (site j) and

Mekong River (site i) populations, and all other populations in the southern

clade, however, cannot be fully explained by Pleistocene drainage basins.

Along similar lines, the close genetic relationship between northern clade

91

populations from Bangladesh (sites a & b) and Thailand (site c) cannot be

explained by inferring past gene-flow via freshwater systems, as these

geographically distant sites have no history of a freshwater connection.

Freshwater plumes from the extensive Ganges system may explain gene

flow between SE and SW Bangladesh, but is unlikely to explain long distance

gene flow between Bangladesh and Thailand (Dai & Trenberth 2002), some

700km distant. NCA again identified biologically feasible processes that may

have resulted in the population genetic structuring observed in the northern

clade, i.e. historical contiguous range expansion between SW Thailand and

Bangladesh, and recent contiguous range expansion accompanied by

restricted gene-flow with isolation-by-distance among all northern sites. At

this stage, this hypothesis must remain mere conjecture (while supported by

the NCA) as no field work could be undertaken in Myanmar so the isolation-

by-distance effect observed in the northern clade may simply result from

inadequate sampling in this region.

Previous work on freshwater organisms (Waters & Burridge 1999;

Waters et al. 2000; McDowall 2002) has highlighted the largely unrecognised

role marine dispersal can play in the evolution of some ‘freshwater’ aquatic

taxa. As M. rosenbergii are estuarine dependent, and all life-stages tolerate

full marine conditions to varying degrees, a stepping-stone model of gene

flow (Kimura & Weiss 1964) via the marine environment between adjacent

estuaries, accompanied by occasional long-distance marine dispersal during

favourable conditions may best explain the observed population structure of

this species. To clarify the role of marine dispersal, drainage basin maps of

Thailand were examined to identify potential routes for southern to northern

clade colonisation, as observed at the Kraburi River site (site c). No

indication of a possible freshwater colonisation route between southern and

northern sites was found, suggesting a marine dispersal route. In addition, if

dispersal was via freshwater, and not a ‘rare’ marine dispersal event, we

might expect to find evidence for bi-directional movement of haplotypes, i.e.

south-north and vice-versa, or at the very least presence of more than a

single southern haplotype at the Kraburi River site. Instead we observed

evidence for uni-directional (south to north) movement, and fixation of a

single derived (tip) southern haplotype at this site. A future analysis of

92

populations sampled from a number of adjacent estuaries will be required to

determine the role of marine dispersal in this species.

The results presented here provide the first molecular support for the

existence of an ancient biogeographic barrier, the Isthmus of Kra Seaway.

Molecular evidence indicates that this seaway was extensive enough to

restrict gene flow in M. rosenbergii, a ‘freshwater’ crustacean that may be

capable of some marine dispersal. Since the time when the seaway subsided,

contemporary gene flow appears to have occurred across this historical

barrier, highlighting the mutually compatible roles that both vicariance and

dispersal have played in the evolutionary history of M. rosenbergii. Our

results emphasise the importance of choosing an appropriate model

organism, and the power provided by a phylogeographic approach, in testing

historical biogeographic hypotheses.

93

ACKNOWLEDGMENTS We thank Kriket Broadhurst, Daisy Wowor, Peter Ng, Nuanmanee

Pongthana and colleagues, Nguyen Van Hao, Tran Ngoc Hai, Pek Yee Tang,

Selvaraj Oyyan and Abol Munafi Ambok Bolong for their help in acquiring

specimens for this study. Jane Hughes, David Hurwood, Andrew Baker and

the EGGers provided helpful discussions on the manuscript. MdB

acknowledges support from an Australian Postgraduate Award, and research

grants from the Australian Geographic Society, the Ecological Society of

Australia and the Linnean Society of New South Wales. PBM acknowledges

support from an ACIAR small-project grant FIS/2002/083 and assistance

from regional fisheries agencies.

94

REFERENCES Alexandrino J, Arntzen JW, Ferrand N (2002). Nested clade analysis and the

genetic evidence for population expansion in the phylogeography of the

golden-striped salamander, Chioglossa lusitanica (Amphibia: Urodela).

Heredity 88: 66-74.

Avise JC, Arnold J, Ball RM, Bermingham E, Lamb T, Neigel JE, Reeb CA,

Saunders NC (1987). Intraspecific phylogeography: the mitochondrial

DNA bridge between population genetics and systematics. Ann Rev

Ecol Syst 18: 489-522.

Bermingham E, McCafferty SS, Martin A, Kocher TD, Stepien CA (Eds.)

(1997). Fish biogeography and molecular clocks: perspectives from the

Panamanian Isthmus. In: Molecular Systematics of Fishes. Academic

Press: San Diego, London, etc. pp 113-128.

Campbell NJH, Harriss FC, Elphinstone MS, Baverstock PR (1995).

Outgroup heteroduplex analysis using temperature gradient gel

electrophoresis: high resolution, large scale, screening of DNA variation

in the mitochondrial control region. Mol Ecol 7: 407-418.

Castelloe J, Templeton AR (1994). Root probabilities for intraspecific gene

trees under neutral coalescent theory. Mol Phyl Evol 3: 102-113.

Clement M, Posada D, Crandall KA (2000). TCS: a computer program to

estimate gene genealogies. Mol Ecol 9: 1657-1659.

Collins LS, Budd AF, Coates AG (1996). Earliest evolution associated with

closure of the Tropical American Seaway. Proc Natl Acad Sci USA 93: 6069-6072.

Corbet AS (1941). The distribution of butterflies in the Malay Peninsula. Proc

R Entom Soc Lond A 16: 101-116.

Corbett GB, Hill JE (1992). The Mammals of the Indomalayan Region: a

Systematic Review. Oxford University Press: Oxford, UK.

Craig MT, Hastings PA, Pondella DJ (2004). Speciation in the Central

American Seaway: The importance of taxon sampling in the

identification of geminate species pairs. Jnl Biogeog 31: 1085-1091.

Crandall KA (1996). Multiple interspecies transmissions of human and simian

T-cell leukemia/lymphoma virus type I sequences. Mol Biol Evol 13: 115-131.

95

Dai A, Trenberth KE (2002). Estimates of freshwater discharge from

continents: Latitudinal and seasonal variations. Jnl Hydrometeorol 3: 660–687.

de Bruyn M, Wilson JC, Mather PB (2004). Huxley’s Line demarcates

extensive genetic divergence between eastern and western forms of the

giant freshwater prawn, Macrobrachium rosenbergii. Mol Phyl Evol 30: 251-257.

Denduangboripant J, Cronk QCB (2000). High intraindividual variation in

internal transcribed spacer sequences in Aeschynanthus

(Gesneriaceae): implications for phylogenetics. Proc R Soc Lond B 267: 1407-1415.

FAO (Food and Agriculture Organisation of the United Nations) (2000).

Aquaculture production statistics 1989-1998. FAO Fisheries Circular

815 (Rev 12). FAO: Rome.

Felsenstein J (1988). Phylogenies from molecular sequences: inference and

reliability. Ann Rev Genetics 22: 521-565.

Fetzner JW Jr., Crandall KA (2003). Linear habitats and the nested clade

analysis: an empirical evaluation of geographic versus river distances

using an Ozark crayfish (Decapoda: Cambaridae). Evol 57: 2101-2118.

Folmer O, Black M, Hoeh W, Lutz R, Vrijenhoek R (1994). DNA primers for

amplification of mitochondrial cytochrome c oxidase subunit I from

diverse metazoan invertebrates. Mol Mar Biol Biotech 3: 294-299.

Hanebuth T, Stattegger K, Grootes PM (2000). Rapid flooding of the Sunda

Shelf: a late-glacial sea-level record. Science 288: 1033-1035.

Hoffman FG, Baker RJ (2003). Comparative phylogeography of short-tailed

bats (Carollia: Phyllostomidae). Mol Ecol 12: 3403-3414.

Hughes JB, Round PD, Woodruff DS (2003). The Indochinese-Sundaic

faunal transition at the Isthmus of Kra: an analysis of resident forest bird

species distributions. Jnl Biogeog 30: 569-580.

Hurwood DA, Hughes JM (1998). Phylogeography of the freshwater fish,

Mogurnda adspersa, in streams of northeastern Queensland, Australia:

evidence for altered drainage patterns. Mol Ecol 7: 1507-1517.

Inger RF (1966). The systematics and zoogeography of the amphibia of

Borneo. Field Zool 52: 1-402.

96

Inger RF, Voris HK (2001). The biogeographical relations of the frogs and

snakes of Sundaland. Jnl Biogeog 28: 863-891.

Kimura M (1980). A simple method for estimating evolutionary rate of base

substitutions through comparative studies of nucleotide sequences. Jnl

Mol Evol 16: 111-120.

Kimura M, Weiss GH (1964). The stepping stone model of population

structure and the decrease of genetic correlation with distance.

Genetics 49: 561-576.

Knowlton N, Weigt LA, Solorzano LA, Mills DK, Bermingham E (1993).

Divergence in proteins, mitochondrial DNA, and reproductive

compatibility across the Isthmus of Panama. Science 260: 1629-1632.

Knowlton N, Weigt LA (1998). New dates and new rates for divergence

across the Isthmus of Panama. Proc R Soc Lond B 265: 2257-2263.

Kotlik P, Bogutskaya NG, Ekmekci FG (2004). Circum Black Sea

phylogeography of Barbus freshwater fishes: divergence in the Pontic

glacial refugium. Mol Ecol 13: 87-96.

Kuhner MK, Yamato J, Felsenstein J (1998). Maximum likelihood estimation

of population growth rates based on the coalescent. Genetics 149: 429-

434.

Kuhner MK (2003). LAMARC: Estimating population genetic parameters from

molecular data. In: Salemi M, Vandamme A (eds). The Phylogenetic

Handbook: a Practical Approach to DNA and Protein Phylogeny,

Cambridge University Press: Cambridge. pp 379-399.

Kumar S, Tamura K, Jakobsen IB, Nei M (2001). MEGA2: Molecular

Evolutionary Genetics Analysis Software. Arizona State Univ: Tempe,

Arizona, USA.

Marko PB (2002). Fossil calibration of molecular clocks and the divergence

times of geminate species pairs separated by the Isthmus of Panama.

Mol Biol Evol 19: 2005-2021.

Masta SE, Laurent NM, Routman EJ (2003). Population genetic structure of

the toad Bufo woodhousii: an empirical assessment of the effects of

haplotype extinction on nested cladistic analysis. Mol Ecol 12: 1541-

1554.

97

Mayr E (1942). Systematics and the Origin of Species. Columbia University

Press: New York, USA.

McDowall RM (2002). Accumulating evidence for a dispersal biogeography of

southern cool temperate freshwater fishes. Jnl Biogeog 29: 207-219.

Posada D, Crandall KA, Templeton AR (2000). GeoDis: a program for the

cladistic nested analysis of the geographical distribution of genetic

haplotypes. Mol Ecol 9: 487-488.

Ridder-Numan JWA (1998). Historical biogeography of Spatholobus

(Leguminosae-Papillionoideae) and allies in SE Asia. In: Hall R,

Holloway JD (eds) Biogeography and Geological Evolution of Southeast

Asia. Backhuys: Leiden, Netherlands. pp. 259-277.

Rozas J, Sanchez-DelBarrio JC, Messueger X, Rozas R (2003). DnaSp,

DNA polymorphism analyses by the coalescent and other methods.

Bioinformatics 19: 2496-2497.

Saitou N, Nei M (1987). The neighbour-joining method: a new method for

reconstructing phylogenetic trees. Mol Biol Evol 4: 406-426.

Sandifer PA, Hopkins JS, Smith TIJ (1975). Observations on salinity

tolerance and osmoregulation in laboratory-reared Macrobrachium

rosenbergii post-larvae (Crustacea: Caridea). Aquaculture 6: 103-114.

Schön I, Butlin RK, Griffiths HI, Martens K (1998). Slow molecular evolution

in an ancient asexual ostracod. Proc R Soc Lond B 265: 235-242.

Schwager SJ, Mutschler MA, Federer WT, Scully BT (1993). The effect of

linkage on sample size determination for multiple trait selection. Theor

Appl Genet 86: 964-974.

Short J (1998). Pictorial key to Australian Macrobrachium. Queensland

Museum Publication, Brisbane, Australia.

Swofford DL (2002). PAUP*. Phylogenetic Analysis Using Parsimony (*and

Other Methods), Version 4. Sinauer Associates, Sunderland, MA.

Tajima F (1989). Statistical method for testing the neutral mutation

hypothesis by DNA polymorphism. Genetics 123: 585-595.

Templeton AR (1998). Nested clade analyses of phylogeographic data:

testing hypotheses about gene flow and population history. Mol Ecol 7: 381-397.

98

Templeton AR (2001). Using phylogeographic analyses of gene trees to test

species status and processes. Mol Ecol 10: 779-791.

Templeton AR (2004). Statistical phylogeography: methods of evaluating and

minimizing inference errors. Mol Ecol 13: 789-810.

Templeton AR, Sing CF (1993). A cladistic analysis of phenotypic

associations with haplotypes inferred from restriction endonuclease

mapping. IV. Nested analyses with cladogram uncertainty and

recombination. Genetics 134: 659-669.

Thompson JD, Gibson TJ, Plewniak F, Jeanmougin F, Higgens DG (1997).

The ClustalX windows interface: flexible strategies for multiple

sequence alignment aided by quality analysis tools. Nucl Acids Res 24: 4876-4882.

Tringali MD, Bert TM, Seyoum S, Bermingham E, Bartolacci D (1999).

Molecular phylogenetics and ecological diversification of the

transisthmian fish genus Centropomus (Perciformes: Centropomidae).

Mol Phyl Evol 13: 193-207.

Vail PR, Hardenbol J (1979). Sea-level changes during the tertiary. Oceanus

22: 71-79.

Voris HK (2000). Maps of Pleistocene sea levels in Southeast Asia:

shorelines, river systems and time durations. J Biogeog 27: 1153-1167.

Waters JM, Burridge CP (1999). Extreme intraspecific mitochondrial DNA

sequence divergence in Galaxias maculatus (Osteichthys: Galaxidae),

one of the world’s most widespread freshwater fish. Mol Phyl Evol 11: 1-12.

Waters JM, Dijkstra LH, Wallis GP (2000). Biogeography of a southern

hemisphere freshwater fish: how important is marine dispersal? Mol

Ecol 9: 1815-1821.

Waters JM, Craw D, Youngson JH, Wallis GP (2001). Genes meet geology:

fish phylogeographic pattern reflects ancient, rather than modern,

drainage connections. Evol 55: 1844-1851.

Woodruff DS (2003). Neogene marine transgressions, palaeogeography and

biogeographic transitions on the Thai-Malay Peninsula. Jnl Biogeog 30: 551-567.

99

Zeh A, Zeh DW, Bonilla MM (2003). Phylogeography of the harlequin beetle-

riding pseudoscorpion and the rise of the Isthmus of Panama. Mol Ecol

12: 2759-2769.

100

Statement of Joint Authorship

Mark de Bruyn, Peter B. Mather (2005) Past climate change has mediated

evolution in giant freshwater prawns. Proceedings of the Royal Society of

London B (In Review).

Mark de Bruyn (candidate) Designed and developed experimental protocol. Carried out field and

laboratory work, and analysed data. Wrote manuscript and acted as

corresponding author.

Peter B. Mather Principal supervisor of the study design and experimental protocols. Assisted

in the interpretation of data. Contributed to the structure and editing of the

manuscript.

101

CHAPTER 5. Past climate change has mediated evolution in giant freshwater prawns

Mark de Bruyn, Peter B. Mather

School of Natural Resource Sciences, Queensland University of Technology,

GPO Box 2434, Brisbane, Qld 4001, Australia

Tel: +61-7-3864-1737

E-mail: m.debruyn@qut.edu.au

ABSTRACT A major paradigm in evolutionary biology asserts that global climate change

during the Pleistocene often led to rapid and extensive diversification in

numerous taxa. We used nuclear and mitochondrial molecular variation in a

freshwater-dependent decapod crustacean (Macrobrachium rosenbergii),

sampled widely from the Indo-Australian Archipelago (IAA), to assess the

impact of Pleistocene sea level changes on major demographic events in this

species. The timing of extensive migration events among both mainland-

mainland and mainland-island lineages are consistent with mid-Pleistocene

periods of glacial maxima when sea levels were low, and geographic

distances between discrete river systems were greatly reduced. Similarly, the

timing of population specific overseas migration events, and population

expansion events, are consistent with periods of extremely low sea levels

leading into the Last Glacial Maximum (LGM). Contrary to traditional

expectations that Pleistocene climate change led to extensive diversification,

our results show that chronologically nested overseas migration events

among geographically widespread locations, in response to Pleistocene

climatic change, significantly constrained evolutionary diversification of this

species.

Keywords: Last Glacial Maximum, Pleistocene, demography, dispersal,

phylogeography, Indo-Australian Archipelago

102

1. INTRODUCTION The impact that Pleistocene [2 million to 10, 000 years before the present

(kyr B.P.)] ice ages had on driving evolutionary diversification has been

debated for more than a century (Darwin 1859; Wallace 1862; Hofreiter et al.

2003). Accumulating evidence from Europe and North America indicates that

glacial events during the Pleistocene epoch resulted in major shifts in species

distributions (Avise 2000; Hewitt 2000; Davis & Shaw 2001), and may have

been the principal factor that contributed to the decline and eventual

extinction of some species (Guthrie 2003; Shapiro et al. 2004). As climate

oscillated through the Pleistocene, fossil (Coope 1994; Bennett 1997) and

other evidence (reviewed in Hewitt 2000) shows that the geographical

distributions of some species responded by expanding and contracting during

times of glacial cycling. Furthermore, it has been suggested that these

responses may have been swift, and may have occurred repeatedly (Hewitt

2000). If true, the repeated isolation and admixture of diverged populations

on evolutionarily short time-scales may act to limit the speciation-potential of

the taxon in question (Dobzhansky 1936). Supporting empirical evidence for

this climate-driven mechanism is constrained, however, by the inherent

difficulty in extracting a signal of recurring, but chronologically nested,

demographic events from either extant or fossil taxa.

M. rosenbergii is widely distributed and locally abundant throughout

the Indo-Australian Archipelago. This species is most often associated with

coastal river systems, as it inhabits freshwater as an adult, but requires

brackishwater for larval development. Females migrate from freshwater into

estuarine areas to spawn, where free-swimming larvae hatch from eggs

attached to the females’ abdomen. Larval duration is approximately 3 - 6

weeks, following which juveniles migrate upstream to freshwater habitat. The

ability of larvae to tolerate marine conditions is unknown. However,

laboratory studies indicate that adults do not survive in marine conditions for

more than a week, although a small percentage of postlarvae may survive for

up to 20 days (Sandifer et al. 1975). Even given their apparent limited

euryhalinity, M. rosenbergii are found on some de novo oceanic islands (e.g.

Christmas Island, Palau, Sulawesi, the Philippine Archipelago), which

suggests at the least limited marine dispersal in the past. Two discrete forms

103

of M. rosenbergii have been recognised, based on morphological

(Lindenfelser 1984), allozyme (Lindenfelser 1984), and mitochondrial DNA

(mtDNA) (de Bruyn et al. 2004a) variation, with the boundary between these

forms coinciding with Huxley’s extension of Wallace’s Line. Time of

divergence between the two forms is most likely quite ancient [~5 - 12 million

years ago (MYA)], mirroring the ancient origins of this globally distributed

genus (de Bruyn et al. 2004a).

Here we show that the genetic history of the giant freshwater prawn

(Macrobrachium rosenbergii) was shaped largely by chronologically nested

overseas migration events during Pleistocene glacial cycles. Results suggest

that recurring widespread migration, facilitated by periods of extreme global

climatic change, may have acted as a significant constraint on the

evolutionary diversification of this ancient species.

104

2. MATERIAL AND METHODS (a) Sampling

To investigate the evolutionary impact of Pleistocene glacial events on the

history of M. rosenbergii, we sampled 541 M. rosenbergii from 14 locations

east of Huxley’s Line [sensu the eastern form of M. rosenbergii (de Bruyn et

al. 2004a)] (figure 1). We sequenced a 602 base pair (bp) fragment of the

mitochondrial cytochrome oxidase I gene (COI), and genotyped individuals at

six Mendelian-inherited microsatellite loci (Chand et al. 2005). (b) Genotyping

Methods for genomic DNA extractions, PCR amplification and sequencing of

a 602 bp fragment of the mtDNA COI region, and PCR amplification and

screening of six microsatellite loci are available elsewhere (de Bruyn et al.

2004b; Chand et al. 2005). The microsatellite flanking sequences and

primers are available on GenBank under accession numbers AY791965–

AY791970.

(c) Phylogenetic inference

A parsimony network was constructed from the mtDNA sequences using

TCS ver. 1.13 (Clement et al. 2000). Further support for clades was obtained

by constructing bootstrapped (1,000 pseudo-replicates) maximum-likelihood

and neighbour-joining trees in TREE-PUZZLE (Schmidt et al. 2002) and

MEGA version 3.0 (Kumar et al. 2004), respectively. All bootstrap values

supporting unique clades were > 70%. Cavalli-Sforza & Edwards (1967)

chord distance (DCE) was used to construct a neighbour joining phylogenetic

tree in PHYLIP version 3.5c (Felsenstein 1993) from raw microsatellite allelic

frequencies. Support for tree nodes was assessed by bootstrapping over loci

(2,000 iterations).

(d) Population genetic analyses

We determined that the TrN model of substitution (Tamura & Nei 1993) plus

invariable sites (I) and a gamma distribution (Γ) of rate heterogeneity across

variable sites provided the best fit to our COI dataset with the program

MODELTEST 3.06 (Posada & Crandall 1998). The estimated parameters

under this model were Γ = 5.8053, I = 0.8099 and Ti/Tv = 4.60. The TrN

model and its estimated parameters were used for subsequent analyses

where appropriate. For microsatellite loci, allele frequencies, expected (HE)

105

and observed (HO) heterozygosites, and tests for linkage disequilbrium (LD)

and Hardy-Weinberg equilibrium (HWE) were performed in GENEPOP

(Raymond & Rousset 1995). No significant LD was identified for

microsatellite locus-pair population comparisons. Probability tests detected

12 significant deviations from HWE out of 84 comparisons. Seven of twelve

departures from HWE were evident at the Mr-95 locus due to heterozygote

deficiencies. This could result from the presence of null alleles or the

Wahlund effect. To eliminate the possibility that null alleles might bias our

results, we compared our microsatellite results when all six loci were

incorporated in the analyses, and with locus Mr-95 removed from the

analyses. Both methods gave similar outcomes, thus, results presented here

are those based on all six microsatellite loci. For the Sulawesi population

alone, only loci Mr-95 and Mr-88 amplified consistently for most individuals

sampled. Unbiased estimates of Fisher’s exact test employing the Markov

chain method (10,000 iterations) were used to calculate values of

significance for all tests performed in GENEPOP. Population divergence was

estimated by computing ΦST for the COI dataset in ARLEQUIN (Schneider et

al. 2000), and FST for the microsatellite dataset in F-STAT (Goudet 1995). A

hierarchical analysis of molecular variance (AMOVA) was performed in

ARLEQUIN. We used Mantel tests in IBD (Bohonak 2002) to determine

whether a correlation existed between pairwise Φ/(1- Φ) and FST, respectively,

vs. geographical distance. Data were analysed both untransformed, or with

only geographic distance log-transformed (Rousset 1997).

(e) Timing of demographic events We tested for evidence in our COI dataset for population expansion events

using Tajima’s D, Fu’s Fs, and mismatch distributions calculated in

ARLEQUIN, and a coalescent maximum-likelihood approach implemented in

FLUCTUATE (Kuhner et al. 1998), according to (Kuhner 2003). Tajima’s D

and Fu’s Fs were developed originally as tests for selection, but in its’

absence, negative values are believed to be evidence of an expanding

population. Populations that have been stable historically are predicted to

display a multimodal mismatch distribution, while those that have expanded

recently are predicted to display a unimodal distribution. The validity of the

model was tested using the parametric bootstrap approach implemented in

106

ARLEQUIN under the sudden expansion model, where P = (number of

SSDsim = SSDobs)/B. The exponential growth of a population can also be

inferred from positive values of the exponential growth parameter g obtained

using FLUCTUATE. If all four methods suggested rapid population growth,

we compared the chronology of these events by rearranging the equation for

tau to solve for t. We used the mtDNA COI molecular clock rate of 1.4 x 10-8

derived independently by Knowlton & Weigt (1998) and Morrison et al. (2004)

for Caridean shrimp (the infraorder of Macrobrachium) to convert the

estimate of the time parameter, t, to divergence in years. We estimated the

chronology of pairwise lineage, and lineage-specific population divergence

times, respectively, using the coalescent-based Bayesian/likelihood methods

implemented in the programs MDIV (Nielsen & Wakeley 2001) and IM (Hey &

Nielsen 2004), using the same COI molecular clock as above. We used both

programs to ensure that similar results were being obtained. Prior

distributions were set to m = 0 and t = 15 for most lineage comparisons, and

m = 0 and t = 10 for population comparisons. Preliminary runs with larger

parameter intervals were used to ensure we were using appropriate priors,

and that different priors did not change the posterior distributions. Following a

burn-in period of 105 steps, individual simulations were run at least three

times (with a different random seed) for 60 million updates or more to ensure

similar distributions were being obtained. To ensure adequate mixing of the

Markov chain, we ran the program until the smallest ESS estimates were

greater than 300, and update rates were greater than 20%. For credibility

intervals, we assessed the 90% highest posterior density (HPD) interval; that

is, the boundaries of the shortest span that incorporates 90% of the posterior

density of a parameter.

3. RESULTS AND DISCUSSION (a) Phylogenetic relationships The 58 unique COI haplotypes [GenBank accession numbers AY614545-

AY614587 (de Bruyn et al. 2004b) and DQ060194-DQ060208] define five

well-supported clades (figure 1). These clades comprised samples from:

Western Australia (WA); the Lake Carpentaria region, Australia [LC (de

Bruyn et al. 2004b)]; Papua New Guinea and Eastern Cape York, Australia

107

(PNG/ECY); Luzon Island, Philippines (PH); and a final clade comprising

individuals from Irian Jaya, Sulawesi and Luzon Island, Philippines

(IJ/SU/PH) (figure 1). Further support for this geographical pattern of genetic

differentiation is provided by a phenogram based on microsatellite variation

(figure 2). Relationships among populations based on nuclear data were

largely concordant with that estimated from the COI data, although bootstrap

support was low in some cases.

(b) Genetic divergence and Mantel tests

Analysis of molecular variance (AMOVA) supported the existence of

significant structure among lineages (COI: ΦST = 0.900, ΦCT = 0.769, ΦSC =

0.568, P < 0.001; 10,000 iterations). Moreover, pairwise FST matrices based

on both mtDNA (91 cases; range 0.161 - 1.000) and microsatellite loci (86

cases; range 0.019 - 0.185) showed significant population structure among

most sites, indicating a lack of ongoing gene flow among populations. Only

five pairwise comparisons (among populations from the LC clade) based on

microsatellite data were non-significant (range 0.004 - 0.011). M. rosenbergii

in these locations are believed to have been connected by a freshwater lake

(Lake Carpentaria) that existed ~80 – 8.5 kyr B.P. in what is today the marine

Gulf of Carpentaria (de Bruyn et al. 2004b) (figure 1). Regressions obtained

using permutated Mantel tests (COI: untransformed r = 0.053, P = 0.400,

transformed r = 0.220, P = 0.065; microsatellites: untransformed r = 0.192, P

= 0.165, transformed r = 0.249, P = 0.135) were not significantly different

from zero, indicating that isolation-by-distance has played little or no role in

structuring genetic variation.

(c) Recombination and selection

M. rosenbergii mtDNA displayed no signs of recombination [four gamete test

(Hudson & Kaplan 1985): R = 0.001, P = 0.159] or selection [McDonald

Kreitman test (McDonald & Kreitman 1991): no differences in the ratios of

nonsynonomous to synonymous changes within and between ‘species’, in

this case the eastern and western (de Bruyn et al. 2005) forms of M.

rosenbergii; Fisher’s exact test, P = 1.000], and has been evolving at a

relatively constant rate (log-likelihood ratio test: χ2 = 67.53, d.f. = 56, P >

0.10). These features allowed us to determine nested times of divergence

among lineages, and populations within lineages, respectively, using the

108

recently developed “Isolation with Migration” evolutionary genetic model

(Nielsen & Wakeley 2001). This approach is particularly well suited to

unraveling a range of demographic parameters within recently diverged

populations or species, as it can discriminate between ongoing migration and

recent divergence (Palsbøll et al. 2004).

(d) Timing of major demographic events in the eastern form of M.

rosenbergii

To gain a more accurate estimate of the age of the eastern form of M.

rosenbergii, we estimated the divergence time between the eastern (n = 541)

and the western [n = 404 (de Bruyn et al. 2005)] forms of M. rosenbergii,

sampled from across their entire distributions. Divergence of the two forms

(figure S1; electronic supplementary material) is consistent with an ancient

separation [approximately 5.6 million years (MY)] without subsequent gene

flow. One possible cause for this divergence is geographic separation across

what is today the Makassar Strait, due to extremely high sea levels resulting

from climatic change. Benthic δ18O data suggest that global sea levels over

the past 5.5 million years achieved their maximum height approximately 5.1

million years ago [Marine Isotope Stage (MIS) T7] (Lisiecki & Raymo 2005).

The shallow parsimony network (figure 1) suggests a fairly recent (in

evolutionary terms) connection among lineages within the eastern form of M.

rosenbergii, which is supported by pairwise comparisons of lineage

divergence times (figures 3, S1; electronic supplementary material). The

timing of these events (9 cases; range 886 – 610 kyr B. P.) is consistent with

a disruption of migration after periods of low global sea level during glacial

maxima (MIS 22, 20, 18 & 16; figure 3). Pleistocene sea levels in the Indo-

Australian Archipelago are believed to have dropped periodically by as much

as 120 m, although some authors have suggested that sea levels may have

dropped by up to 150 m (Chappell & Shackleton 1986). Such a dramatic

decrease in sea level would have exposed vast areas of the Sahul Shelf,

revealing extensive riverine drainage systems, and would have reduced

oceanic distances between landmasses considerably (figure 1).

In contrast to the land bridge that united Australia and New Guinea for

much of the Pleistocene (figure 1), the de novo oceanic islands of Sulawesi

and Luzon (Philippines) were never physically linked to other major

109

landmasses in this region (Hall 2002). Taken together, lineage-specific data

suggest that during mid-Pleistocene glacial cycles (MIS 22, 20, 18 & 16;

figure 3), migration between both mainland-mainland and mainland-island

sites, which are today genetically isolated, was extensive. Since this time,

gene flow has been virtually non-existent, and lineage sorting has lead to

geographically restricted reciprocally monophyletic lineages. This is

particularly evident in our mtDNA dataset - as expected from theoretical

expectations of a fourfold reduction in effective population size for mtDNA

(Birky et al. 1989).

Even so, the IJ/SU/PH clade and the PH clade, taken together,

provide an exception to a mid-Pleistocene restriction to migration. The

occurrence of these two divergent (9 bp) mitochondrial lineages sampled

from the same location [Plandez/Pulilan River, Luzon Island (PH)] suggests a

secondary migration event into the PH site. All four haplotypes in the

IJ/SU/PH clade were sampled from the IJ site. All SU samples (n = 35) were

fixed for one of these haplotypes, while 9 individuals sampled from PH were

fixed for another (figure 1). This pattern indicates a fairly recent (but not

ongoing; all pairwise FSTs were significant) migration of IJ individuals into the

SU and PH sites. Indeed, estimating times of divergence (figures 3, S1;

electronic supplementary material) for these populations (3 cases; range 27 –

20 kyr B.P.) provides support for a second round of overseas migration

during a glacial maxima, namely leading into the LGM, followed by a

termination of migration as sea levels subsequently began to rise. Estimates

of posterior density distributions (figure S2; electronic supplementary

material) of the migration parameter, m, and the patterns of molecular

variation in these populations support the directionality of dispersal outlined

above. Even so, the microsatellite dataset indicated that the two divergent

mtDNA lineages sampled from the same site (PH) are not genetically

segregated (FST = 0.001). Indeed, we would expect future lineage sorting to

drive these two lineages to eventual monophyly, barring further incoming

overseas migration.

To examine further the effects of glacial maxima on M. rosenbergii

migration, we estimated pairwise population divergence times within all other

clades (PNG/ECY & LC) where multiple populations were present. Estimates

110

of population divergence times (figure S1; electronic supplementary material)

provide further support for a termination of migration following extremely low

sea levels leading into the LGM (PNG vs. ECY, 22 kyr B.P.; KE vs. KA, 24

kyr B.P.; figure 3). Similarly, times of divergence among all other populations

that comprise the LC clade (15 cases; range = 31 - 17 kyr B.P.) support the

contention that they were recently connected via Lake Carpentaria during

MIS 4 – 2 (~90 – 10 kyr B.P.) leading into the LGM, but are now genetically

isolated (de Bruyn et al. 2004b). The probability that all times of divergence

coincided with Pleistocene glacial maxima by chance alone is extremely

unlikely (sign tests: all pairwise lineage divergence times, 9 cases, P =

0.00391; all pairwise population divergence times, 20 cases, P =

0.00000191).

To examine further the timing of major demographic events in M.

rosenbergii, and specifically whether these events were again consistent with

the timing of extreme climatic changes during the Pleistocene, we estimated

the onset of population expansion events (table 1, figure 3). Again, the timing

of all such events occurred during periods of glacial maxima (MIS 10, 8, 6, 4

– 2; figure 3), a correlation that is equally unlikely by chance alone (sign test:

6 cases, P = 0.0313). Notably, the onset of four of the six population

expansion events coincided remarkably well with the onset of a specific

glacial event (figure 3). These population expansion events most probably

resulted from a direct increase in freshwater habitat availability as sea levels

fell (figure 1).

(e) Chronologically nested migration constrains evolutionary

diversification

During the Pleistocene epoch, MIS 16 (~630 kyr B.P.) and the LGM (~30 –

18 kyr B.P.) were two periods when Antarctic ice sheets were at their maxima,

and thus when global sea levels are believed to have been at their lowest

(Epica Community Members 2004). Indeed, these two episodes of extreme

reductions (Lisiecki & Raymo 2005) in global mean sea level appear to have

played the most prominent roles in facilitating both widespread overseas, and

mainland-mainland, migration in M. rosenbergii (figure 3). Our results

suggest that these cyclical processes act to reduce overall levels of genetic

variation in this freshwater-dependent species by periodically ‘swamping’

111

established monophyletic lineages with an influx of ‘foreign’ genotypes from

geographically distant locations. Geographical isolation over evolutionary

time, leading to the accumulation of highly divergent genotypes, is believed

to be a critical factor on the road to eventual speciation (Mayr 1942). The

absence of both in the widely-distributed eastern form of M. rosenbergii,

apparently due to chronologically nested migration events during periods of

extreme climatic change, may explain why this freshwater-dependent

‘species’ has persisted for so long, and yet has not speciated (Lindenfelser

1984; de Bruyn et al. 2004a; Wowor 2004; this study), even over such large

natural geographic distributional scales. A phylogenetic study of the globally

distributed freshwater genus Macrobrachium hints at a similar scenario, albeit

at the species level, of an evolutionary history shaped largely by historically

widespread migration (Murphy & Austin 2005).

ACKNOWLEDGMENTS We thank J. Hey and R. Nielsen for advice on their “isolation with migration”

genetic analyses programs; P. Prentis and D. Hurwood for comments and

advice on the manuscript; A. Duffy, C. Streatfeild, K. Horskins and V. Chand

for technical support; S. Caldwell, P. K. L. Ng, D. Wowor, M. Tayamen, E.

Nugroho, J. Short, P. Davie, D. Milton and D. Harvey for assistance with

specimen collections. Supported by grants from the Australian Geographic

Society, Ecological Society of Australia, Linnean Society of NSW,

Queensland University of Technology (all to M.d.B.) and ACIAR (P.B.M.).

112

REFERENCES Avise, J. C. 2000 Phylogeography: The history and formation of species.

Cambridge, MA: Harvard University Press.

Bennett, K. J. 1997 Evolution and ecology: the pace of life. Cambridge:

Cambridge University Press.

Birky, C. W., Fuerst, P. & Maruyama, T. 1989 Organelle gene diversity under

migration, mutation, and drift: equilibrium expectations, approach to

equilibrium, effects of heteroplasmic cells, and comparison to nuclear

genes. Genetics 121, 613-627.

Bohonak, A. J. 2002 IBD (Isolation By Distance): A program for analyses of

isolation by distance. J. Heredity 93, 153-154.

Cavalli-Sforza, L. L., & Edwards, A. W. F. 1967 Phylogenetic analysis:

models and estimation procedures. Am. J. Hum. Gen. 19, 233-257.

Chand, V., de Bruyn, M. & Mather, P. B. 2005 Microsatellite loci in the

eastern form of the giant freshwater prawn (Macrobrachium rosenbergii).

Mol. Ecol. Notes 5, 308-310.

Chappell, J., & Shackleton, N. J. 1986 Oxygen isotopes and sea level.

Nature 324, 137-140.

Clement, M., Posada, D. & Crandall, K. A. 2000 TCS: a computer program to

estimate gene genealogies. Mol. Ecol. 9, 1657-1659.

Coope, G. R. 1994 The response of insect faunas to glacial-interglacial

climatic fluctuations. Phil. Trans. R. Soc. Lond. B 344, 19-26.

Darwin, C. 1859 The origin of species. London: John Murray.

Davis, M. B., & Shaw, R. G. 2001 Range shifts and adaptive responses to

Quaternary climate change. Science 292, 673-679.

de Bruyn, M., Wilson, J. C. & Mather, P. B. 2004a Huxley’s line demarcates

extensive genetic divergence between eastern and western forms of the

giant freshwater prawn, Macrobrachium rosenbergii. Mol. Phyl. Evol. 30, 251-257.

de Bruyn, M., Wilson, J. C. & Mather, P. B. 2004b Reconciling geography

and genealogy: phylogeography of giant freshwater prawns from the

Lake Carpentaria region. Mol. Ecol. 13, 3515-3526.

113

de Bruyn, M., Nugroho, E., Hossain, Md. M., Wilson, J. C. & Mather, P. B.

2005 Phylogeographic evidence for the existence of an ancient

biogeographic barrier: the Isthmus of Kra Seaway. Heredity 94, 370-378.

Dobzhansky, T. 1936 Studies on hybrid sterility. II. Localization of sterility

factors in Drosophila pseudoobscura hybrids. Genetics 21, 113-135.

Epica Community Members. 2004 Eight glacial cycles from an Antarctic ice

core. Nature 429, 623-628.

Felsenstein, J. 1993 PHYLIP v. 3.5 (phylogeny inference package). Seattle,

WA: University of Washington.

Goudet, J. 1995 FSTAT version 1.2: a computer program to calculate F-

statistics. J. Heredity 86, 485-486.

Guthrie, R. D. 2003 Rapid body size decline in Alaskan Pleistocene horses

before extinction. Nature 426, 169-171.

Hall, R. 2002 Cenozoic geological and plate tectonic evolution of SE Asia

and the SW Pacific: computer-based reconstructions, model and

animations. J. Asian Earth Sci. 20, 353-431.

Hewitt, G. 2000 The genetic legacy of the Quaternary ice ages. Nature 405, 907-913.

Hey, J. & Nielsen, R. 2004 Multilocus methods for estimating population

sizes, migration rates and divergence time, with applications to the

divergence of Drosophila pseudoobscura and D. persimilis. Genetics

167, 747-760.

Hofreiter, M., Serre, D., Rohland, N., Rabeder, G., Nagel, D., Conard, N.,

Münzel, S. & Pääbo, S. 2003 Lack of phylogeography in European

mammals before the last glaciation. Proc. Natl. Acad. Sci. U.S.A. 101, 12963-12968.

Hudson, R. R. & Kaplan, N. L. 1985 Statistical properties of the number of

recombination events in the history of a sample of DNA sequences.

Genetics 111, 147-164.

Knowlton, N. & Weigt, L. A. 1998 New dates and new rates for divergence

across the Isthmus of Panama. Proc. Roy. Soc. Lond. B. 265, 2257-

2263.

Kuhner, M. K. 2003 LAMARC: Estimating population genetic parameters

from molecular data. In The phylogenetic handbook: a practical

114

approach to DNA and protein phylogeny. (ed. M. Salemi & A.-M.

Vandamme), pp. 378-399. Cambridge: Cambridge University Press.

Kuhner, M. K., Yamato, J. & Felsenstein, J. 1998 Maximum likelihood

estimates of population growth rates based on the coalescent. Genetics

149, 429-434.

Kumar, S., Tamura, K. & Nei, M. 2004 MEGA3: Integrated software for

Molecular Evolutionary Genetics Analysis and sequence alignment.

Brief. Bioinf. 5, 150-163.

Lindenfelser, M. E. 1984 Morphometric and allozymic congruence: evolution

in the prawn Macrobrachium rosenbergii (Decapoda: Palaemonidae).

Syst. Zool. 33, 195-204.

Lisiecki, L. E. & Raymo, M. E. 2005 A Pliocene-Pleistocene stack of 57

globally distributed benthic δ18O records. Paleocean. 20, PA1003,

doi:10.1029/2004PA001071.

Mayr, E. 1942 Systematics and the origin of species. New York: Columbia

University Press.

McDonald, J. H. & Kreitman, M. E. 1991 Adaptive protein evolution at the

Adh locus in Drosophila. Nature 351, 652-654.

Morrison, C. L., Rió, R. & Duffy, J. E. 2004 Phylogenetic evidence for an

ancient rapid radiation of Caribbean sponge-dwelling snapping shrimps

(Synalpheus). Mol. Phyl. Evol. 30, 563-581.

Murphy, N. P. & Austin, C. M. 2005 Phylogenetic relationships of the globally

distributed freshwater prawn genus Macrobrachium (Crustacea:

Decapoda: Palaemonidae): biogeography, taxonomy and the

convergent evolution of abbreviated larval development. Zool. Scripta

34, 187-197.

Nielsen, R. & Wakeley, J. 2001 Distinguishing migration from isolation: a

Markov chain Monte Carlo approach. Genetics 158, 885-896.

Palsbøll, P. J., Bėrubė, M., Aguilar, A., Notarbartolo-Di-Sciara, G. & Nielsen,

R. 2004 Discerning between recurrent gene flow and recent divergence

under a finite-site mutation model applied to North Atlantic and

Mediterranean Sea fin whale (Balaenoptera physalus) populations.

Evolution 58, 670-675.

115

Posada, D. & Crandall, K. A. 1998 MODELTEST: testing the model of DNA

substitution. Bioinformatics 14, 817-818.

Raymond, M. & Rousset, F. 1995 GENEPOP (version 1.2): population

genetics software for exact tests and ecumenicism. J. Heredity 86, 248-

249.

Rousset, F. 1997 Genetic differentiation and estimation of gene flow from

F-statistics under isolation by distance. Genetics 145, 1219-1228.

Sandifer, P. A., Hopkins, J. S. & Smith, T. I. J. 1975 Observations on salinity

tolerance and osmoregulation in laboratory-reared Macrobrachium

rosenbergii postlarvae (Crustacea: Caridea). Aquaculture 6, 103-114.

Schmidt, H. A., Strimmer, K., Vingron, M. & von Haeseler, A. 2002 TREE-

PUZZLE: maximum likelihood phylogenetic analysis using quartets and

parallel computing. Bioinformatics 18, 502-504.

Schneider, S. D., Roessli, D. & Excoffier, L. 2000 ARLEQUIN ver. 2.0: A

Software for Population Genetic Data Analysis. Geneva: Genetics and

Biometry Laboratory, University of Geneva.

Shapiro, B., Drummond, A. J., Rambaut, A., Wilson, M. C., Matheus, P. E.,

Sher, A. V., Pybus, O. G., Gilbert, M. T. P., Barnes, I., Binladen, J.,

Willerslev, E., Hansen, A. J., Baryshnikov, G. F., Burns, J. A., Davydov,

S., Driver, J. C., Froese, D. G., Harington, C. R., Keddie, G., Kosintsev,

P., Kunz, M. L., Martin, L. D., Stephenson, R. O., Storer, J., Tedford, R.,

Zimov, S. & Cooper, A. 2004 Rise and fall of the Beringian steppe bison.

Science 306, 1561-1565.

Tamura, K. & Nei, M. 1993 Estimation of the number of nucleotide

substitutions in the control region of mitochondrial DNA in humans and

chimpanzees. Mol. Biol. Evol. 10, 512-526.

Voris, H. K. 2000 Maps of Pleistocene sea levels in South East Asia:

shorelines, river systems, time durations. J. Biogeog. 27, 1153-1167.

Wallace, A. R. 1862 Narrative of search after birds of paradise. Proc. Zool.

Soc. Lond, 1862. 153-161.

Wowor, D. 2004 A systematic revision of the freshwater prawns of the genus

Macrobrachium (Crustacea: Decapoda: Caridea: Palaemonidae). PhD

Thesis, National University of Singapore, Singapore.

116

Table 1. Population expansion events in Macrobrachium rosenbergii (eastern

form) based on mtDNA COI region sequences.

(Tajima’s D values (* indicates significance at 0.05 level), Fu’s Fs values (*

indicates significance at 0.05 level), mismatch distribution P values, and the

growth parameter g (± 2 standard deviations) are shown. Estimates of these

parameters could not be performed for the RO and SU populations, which

each comprised only a single haplotype. Populations that displayed evidence

for growth using all 4 methods are indicated in bold with the inferred timing of

their initial expansion estimated from tau (τ).)

Locality Tajima’s D Fu’s

Fs

Mismatch P Fluctuate

g

Timing of

expansion

(kyr B.P.)

WA 0.00 0.16 0.01 315±352 -

KE -0.42 -0.71 0.45 3520±1386 42 KA -1.23 -0.61 0.64 8533±1856 63 RO NA NA NA NA -

LB -1.73* -3.21* 0.42 9800±2745 178 MC -0.02 -2.81 0.06 301±163 179 NO -0.36 0.63 0.14 -10±197 -

AR 0.26 2.47 0.04 -316±251 -

WE 0.10 2.09 0.00 -6±190 -

ECY 2.70 7.21 0.01 -260±107 -

PNG -1.76* -1.45 0.16 270±118 348 IJ 0.88 1.41 0.01 -78±440 -

SU NA NA NA NA -

PH -0.36 -3.23 0.47 552±154 296

117

Figure 1. Map of sampling locations and parsimony network for 58 unique

mitochondrial COI haplotypes obtained from sampling 541 M. rosenbergii

from 14 locations in the Indo-Australian Archipelago east of Huxley’s Line.

Light grey shading on map indicates –120m sea level contour (Voris 2000).

Pleistocene drainage basins are shown (Voris 2000). Numbers in

parentheses indicate the number of identical haplotypes from a given locality.

Closed circles indicate inferred missing haplotypes. Dashed lines indicate

alternative inferred connections among haplotypes. Populations are as

follows, PNG/ECY clade (shown in brown): Fly R, Papua New Guinea (PNG),

Olive R, Eastern Cape York (ECY); PH clade (shown in pale blue):

Plandez/Pulilan R, Luzon, Philippines (PH); WA clade (shown in yellow):

Lennard R, Western Australia (WA); IJ/SU/PH clade (shown in red): Maros R,

Sulawesi (SU), Ajkwa R, Irian Jaya (IJ), Plandez/Pulilan R, Luzon,

Philippines (PH); LC clade (shown in green): Keep R (KE), Katherine R (KA),

Roper R (RO), Limmen Bight R (LB), McArthur R (MC), Norman R (NO),

Wenlock R (WE) and Archer R (AR).

LB WE WE(3) LB LB

WE(14) NO(3) MC

NO

MC(40) NO(6) AR(3)

LB(24)

AR(17) AR(5)

NO

WE(21) NO(31)

KA(28) KE(21)

KE(7)

KE(2)

KA

KA(4)

KE

RO(22) MC(7)

WE NO(2) MC

WA(10)

WA WA

WA(4) WA(2)

IJ(1) PH(9)

SU(35) IJ(29)

IJ

IJ(11)

PH

PH(2)

PH

PH(4) PH(2)

PH

PH PH(7)

PH

PH

PH

PH(3)

PH(2) ECY(8) PNG

PNG(3)

PNG

PNG(28) ECY(4)

ECY(4) PNG PNG PNG

PNG(2) PNG

PHILIPPINES

SULAWESI

IRIAN JAYA

PAPUA NEW GUINEA

AUSTRALIA

PH

SU IJ

PNG

ECY

WA

KE

KA RO

LB MC

NO

WE

AR

N

Gulf of Carpentaria

15º

15º

0º

118

Figure 2. Neighbour-joining phenogram depicting genetic relationships

based on Cavalli-Sforza and Edwards’ chord distances (DCE) among 14 M.

rosenbergii populations sampled from the Indo-Australian Archipelago east of

Huxley’s Line. The percentage of bootstrap replicates (n = 2,000) over 6

microsatellite loci (except for SU; see Materials and Methods) is indicated by

the values on the nodes.

LB RO

KA KE

WA

MC

WF

AF

NO

ECY

PNG

IJ

PH SU

95

65

72

80 63

55

100

46

74 52

45 39

39

119

Figure 3. Estimated M. rosenbergii population (numbered 1 - 5) and lineage

(numbered 6 - 15) divergence times, population expansion times (a - f), and

their relation to Pleistocene glacial maxima (even numbers in white boxes)

inferred from 57 globally distributed δ18O records (Lisiecki and Raymo 2005).

All times fall within periods of glacial maxima. Lineage-specific population

pairwise divergence times as follows with divergence time in parentheses

(kyr B.P.): 1. IJ vs. SU (20); 2. PNG vs. ECY (22); 3. PH vs. SU (25); 4. KA

vs. KE (25); 5. IJ vs. PH (27). All other LC pairwise population comparisons

(n = 15) are not shown, but do fall within MIS 4 - 2 (range 31 - 17 kyr B.P.).

Pairwise lineage divergence times as follows (kyr B. P.): 6. IJ/SU/PH vs. LC

(610); 7. PNG/ECY vs. PH (622); 8. PH vs. LC (635); 9. IJ/SU/PH vs. PH

(641); 10. WA vs. LC (712); 11. IJ/SU/PH vs. PNG/ECY (798); 12. PNG/ECY

vs. WA (803); 13. WA vs. PH (806); 14. IJ/SU/PH vs. WA (880); 15.

PNG/ECY vs. WA (886). Inferred onset of population expansion times as

follows (kyr B.P.): a. KE (42); b. KA (63); c. LB (178); d. MC (179); e. PH

(296); f. PNG (347).

1 2 3 4 5 6 7 8 9 11 10 12 13 14 15 16 17 18 19 20 21 22

0 100 200 300 400 500 600 700 900 kyr B.P.

Marine Isotope Stage (MIS)

8

67

9

1012 11

13

14 15

1 2 3 4 5

a b

c ef

Onset of population expansion event

Pairwise divergence times (populations = 1 - 5; lineages = 6 - 15)

Divergence times and population expansion events 5

4.5

4

3.5

δ18O Marine

δ18O Marine (‰ )

d

800

120

Supporting Online Material A. ‘Species’ splitting parameter: Eastern vs. Western form of M. rosenbergii

0

0.002

0.004

0.006

0.008

t

Like

lihoo

d

B. Lineage splitting parameter: IJ/SU/PH vs. LC

0

0.001

0.002

0.003

0.004

0.005

Like

lihoo

d

C. Lineage splitting parameter: PNG/ECY vs. PH

00.00050.001

0.00150.002

0.00250.003

0.00350.004

0 5 10 15

t

Like

lihoo

d

5 10 15t

50 100

121

D. Lineage splitting parameter: PH vs. LC

0

0.002

0.004

0.006

0.008

t

Like

lihoo

d

E. Lineage splitting parameter: IJ/SU/PH vs. PH

0

0.001

0.002

0.003

0.004

0 5 10 15

t

Like

lihoo

d

F. Lineage splitting parameter: WA vs. LC

00.00050.001

0.00150.002

0.00250.003

0.00350.004

0 5 10 15

t

Like

lihoo

d

5 10 15 20

122

G. Lineage splitting parameter: PNG/ECY vs. IJ/SU/PH

0

0.0005

0.001

0.0015

0.002

0.0025

0.003

0.0035

0 5 10 15

Like

lihoo

d

H. Lineage splitting parameter: WA vs. PNG/ECY

0

0.0005

0.001

0.0015

0.002

0.0025

0.003

Like

lihoo

d

I. Lineage splitting parameter: WA vs. PH

5 10 15t

t

00.00050.001

0.00150.002

0.00250.003

0 5 10 15

t

Like

lihoo

d

123

J. Lineage splitting parameter: WA vs. IJ/SU/PH

00.00050.001

0.00150.002

0.00250.003

0 5 10 15

t

Like

lihoo

d

K. Lineage splitting parameter: PNG/ECY vs. WA

00.00050.001

0.00150.002

0.00250.003

t

Like

lihoo

d

L. Population splitting parameter: IJ vs. SU

0

0.002

0.004

0.006

0.008

0.01

t

Like

lihoo

d

5 10

0.2 0.4 0.6 0.8

124

M. Population splitting parameter: PH vs. SU

0

0.002

0.004

0.006

0.008

t

Like

lihoo

d

N. Population splitting parameter: KA vs. KE

O. Population splitting parameter: IJ vs. PH

0

0.002

0.004

0.006

0.008

0.01

t

Like

lihoo

d

0.5 1.0 1.5 2.0

0.25 0.50 0.75 1.00 1.25

0

0.002

0.004

0.006

0.008

t

Like

lihoo

d

0.5 1.0 1.5 2.0

125

P. Population splitting parameter: PNG vs. ECY

0

0.001

0.002

0.003

0.004

0.005

t

Like

lihoo

d

Figure S1. The marginal likelihood surfaces for the time of splitting

parameter t, estimated in IM (Hey & Nielsen 2004) with 90% highest posterior

densities (HPD) indicated by dashed lines. All other LC pairwise population

comparisons (n = 15) are not shown, but do fall within MIS 4 - 2 (range 31 -

17 kyr B.P.). Note that the scale of the x- and y-axes change throughout the

series.

3.5 7.0 10.5

126

A. Population migration parameter: IJ to PH

00.0020.0040.0060.0080.01

0.012

0 2 4 6 8

m

Like

lihoo

d

B. Population migration parameter: PH to IJ

0

0.05

0.1

0.15

0.2

0 2 4 6 8

m

Like

lihoo

d

C. Population migration parameter: IJ to SU

0

0.01

0.02

0.03

0.04

0 2 4 6 8

m

Like

lihoo

d

127

D. Population migration parameter: SU to IJ

00.050.1

0.150.2

0.25

0 2 4 6 8

m

Like

lihoo

d

Figure S2. The marginal likelihood surfaces for the population migration

parameter m, estimated in IM (Hey & Nielsen 2004). Highest posterior

density (HPD) values are not shown, as in all cases the lower bound HPD

incorporated zero. Note that the scale of the y-axis changes throughout the

series.

128

CHAPTER 6. Final Discussion and Conclusion

A recent review has listed phylogeography as one of the principle methods

applied in the discipline of historical biogeography (Crisci 2001). Debate has

continued ever since regarding the merits of phylogeography for studying

historical biogeography. Ebach, Humphries and co-workers (Humphries

2000; Ebach & Humphries 2003; Ebach et al. 2003) have been particularly

vocal in challenging the legitimacy of phylogeography for this purpose. They

apparently view the field as largely a ‘chimera of scenario building’ based on

‘dispersal scenarios’ (Humphries 2000). This view has earned rebuttals from

phylogeographers (Arbogast & Kenagy 2001; McDowall 2004). These

contrasting views can be traced back to the advent of two opposing schools

of thought in historical biogeography that emerged during the late 1970’s -

the vicariant and dispersalist schools. The vicariance view, propounded

initially by Rosen (1978), and Nelson and Platnick (1981), regarded that

generation of biodiversity resulted primarily from fragmentation via vicariant

events, such as the fragmentation of landmasses. The vicariant paradigm

requires the phylogenetic analyses of multiple lineages from at least 3 taxa,

in a search for congruence across phylogenies (Nelson & Platnick 1981). The

most parsimonious explanation for a common pattern across lineages is that

all lineages have been affected in similar ways by a vicariant event. If,

however, incongruence were identified across phylogenies, the explanation

invoked for such a pattern would be one of differential dispersal among taxa.

In this school of thought, dispersal can only be invoked after falsification of a

vicariance model (Rosen 1978). In contrast, dispersalists argued that

dispersal played a more prominent role in the establishment of new lineages,

and ultimately, of new species. Recently, there has been a move towards

unifying the two opposing views, in recognition that both vicariance and

dispersal are fundamental processes that contribute to the generation of

biodiversity (Ronquist 1997; Zink et al. 2000; de Queiroz 2005).

One major concern with the vicariant method is that phylogenetic trees

of species with widespread distributions will fail to display differentiation in

response to a barrier that is observable in the phylogeny of some other taxa,

that is, phylogenies may conflict. This would result in the vicariance method

129

defaulting to a scenario of dispersal to explain such widespread distributions.

While such a result may in some cases be true, it is equally likely that the

taxa in question will have experienced a history shaped by both vicariance

and dispersal. This concern is addressed by the field of phylogeography,

which incorporates and expands on these views, by providing a bridge

between macroevolutionary (e.g. historical biogeography, phylogenetics) and

microevolutionary (e.g. demography and population genetics) change (Riddle

& Hafner 2004). The analysis of variation at the intraspecific level may reveal

the true biogeographical history of the taxon, including cryptic vicariance (e.g.

Riddle et al. 2000), which may be lost if units of analyses were based at or

above the species-level. Where this situation is true, the vicariant approach

may be deeply flawed, as the method may actually underestimate the

influence of vicariant events on a biota. In contrast, phylogeography

considers the relative importance of both vicariance and dispersal, and can

be helpful in dealing with reticulation (see Introduction), which may remain

unresolved when the vicariant method is employed.

A molecular phylogeographical approach can also provide a temporal

perspective on the underlying mechanisms involved in shaping a phylogeny.

Assuming a molecular clock, that is, that the rate of molecular change will be

fairly constant over evolutionary time, it may be possible to distinguish

between competing vicariance or dispersal hypotheses for a single taxon. In

a recent review of the literature, for example, molecular dating clearly

supported oceanic dispersal over vicariance for a multitude of taxa including:

freshwater teleosts, carnivores, lemurs, monkeys, squamate reptiles, frogs,

flightless insects and angiosperms, among others (reviewed in de Queiroz

2005). Thus, it is argued here that phylogeography has played a prominent

role in a recent shift in historical biogeography to a more balanced approach,

where both vicariance and dispersal are likely over evolutionary time.

Moreover, the phylogeographical method enables the estimation of temporal

frameworks for testing specific a priori biogeographical hypotheses.

Phylogeography may also highlight other aspects of a species’ history related

to biogeography, for example, the relative roles of range expansion,

population or lineage expansion, and gene flow, among others (Templeton

1998).

130

To this end, the present study investigated the phylogeographical

structure of the giant freshwater prawn, Macrobrachium rosenbergii, sampled

from across most of the species’ natural range. M. rosenbergii has a wide

distribution - from Pakistan in the west to Vietnam in the east, and south

throughout SE Asia to New Guinea, across northern Australia, and some

Pacific and Indian Ocean Islands. Thus, by default, a vicariance approach

would interpret this distribution pattern as evidence for widespread dispersal

by M. rosenbergii throughout this region. Closer examination of the literature,

however, would reveal some evidence for geographical sub-division within M.

rosenbergii (De Man 1879; Johnson 1973; Lindenfelser 1984; Wowor 2004).

To investigate further this apparent discrepancy between taxonomy and

evolutionary history, an initial broadscale mtDNA (16S) pilot study, presented

here (Chapter 2; de Bruyn et al. 2004a), revealed a deep divergence

between ‘eastern’ and ‘western’ forms, coinciding with Huxley’s extension of

Wallace’s Line (Fig. 1). The current study confirmed and extended previous

results based on morphological (De Man 1879; Johnson 1973; Lindenfelser

1984; Wowor 2004) and allozyme (Malecha 1977; Hedgecock et al. 1979;

Lindenfelser 1984; Malecha 1987) variation in M. rosenbergii, and suggested

that time of divergence between the two forms probably dates back to 5-12

million years ago (MYA). Thus, the initial findings of this study confirmed the

presence of two cryptic and deeply divergent lineages, a situation that is not

reflected in the current species’ taxonomy. A reliance on a species-level

phylogeny in this case would have underestimated the role of vicariance on

diversification within the study region.

Further support for both vicariance and dispersal as driving forces for

diversification of M. rosenbergii within the Indo-Australian Archipelago (IAA)

was identified in subsequent studies (de Bruyn et al. 2004b; 2005) conducted

at finer geographical scales. Sampling of M. rosenbergii from west of

Huxley’s Line (Fig. 1) found evidence for vicariance (Chapter 4; de Bruyn et

al. 2005) either side of a postulated ‘Isthmus of Kra Seaway’ (Woodruff 2003).

A pattern consistent with subsequent northward dispersal of the ‘southern

lineage’ across this former barrier was also identified, however, which

apparently lead to the admixture of these two divergent lineages just north of

this seaway. Similar patterns concordant with vicariance are apparent in

131

studies on amphibians (Inger 1966; see review by Inger & Voris 2001),

reptiles (Inger & Voris 2001), birds (Hughes et al. 2003), mammals (Corbett &

Hill 1992), insects (Corbet 1941) and plants (Ridder-Numan 1998;

Denduangboripant & Cronk 2000), in the vicinity of the Isthmus of Kra.

Similarly, sampling of M. rosenbergii from east of Huxley’s line (Chapter

3; de Bruyn et al. 2004b), across northern Australia, indicated that a vast

freshwater lake (Lake Carpentaria) that existed in the past facilitated

dispersal among populations that were subsequently isolated by a rise in

mean sea levels. Vicariance occurred as these rising sea levels, which

replaced Lake Carpentaria with what is today the marine Gulf of Carpentaria,

isolated formerly contiguous populations. These results were extended in a

comparative study (Chapter 5; de Bruyn & Mather, In Review) of M.

rosenbergii sampled from the Lake Carpentaria region, and from two de novo

oceanic islands. Oceanic islands have long been recognised as ideal natural

laboratories for studying evolution (e.g. Darwin 1859; Wallace 1869), as the

most parsimonious explanation for the occurrence of terrestrial and

freshwater biota on such islands is by way of dispersal. Coalescent-based

analyses indicated that the evolutionary history of M. rosenbergii from the

eastern Indo-Australian Archipelago was shaped largely by widespread,

chronologically nested, migration events during times of extremely low sea

levels, resulting from climatic cycling during the Pleistocene. Thus, it is

apparent that diversification of M. rosenbergii within the IAA retains a

signature of ancient geological events overlain by imprints of Pleistocene

climatic change. This fine scale biogeographical history of M. rosenbergii

provides an explicit temporal and geographical framework for freshwater

diversification in the IAA for future comparative studies. Moreover, the well-

documented geological history of the region places the diversification of

lineages within the context of earth history events that have shaped the IAA,

and thus driven and/or constrained diversification within this region (e.g.

Bermingham & Martin 1998).

While it is generally agreed that comparative phylogeography (the

comparative analyses of evolutionary lineages sampled from multiple taxa

across a given region) is a more robust approach for inferring biogeography

(Riddle & Hafner 2004), it is demonstrated here that a single taxon approach

132

can also provide a great deal of information about a region’s biogeographical

history. This rich history may be overlooked if the analyses are focussed only

at the species level or above. Indeed, it would seem ill advised for historical

biogeography to rely on the assumption that currently recognised species -

described often solely on the basis of morphological characters - encompass

the full spectrum of evolutionary and biogeographical information. These data

are essential for understanding pattern and process in ecology and

biogeography, for example, in conservation planning (e.g. the demarcation of

reproductively isolated lineages); macroecological studies (e.g. range sizes,

shape, stability, etc.); and inferences about historical evolutionary processes

(e.g. evolution of regional biotas), among others (Riddle & Hafner 1998).

In conclusion, while the dynamic geological and climatic history of the

IAA region has clearly played a prominent role in the diversification of the M.

rosenbergii ‘species complex’, this information is cryptically embedded below

the species level within this widespread taxon. This information would

probably have remained undetected if an intraspecific approach (i.e.

phylogeography) were not employed to investigate the evolutionary history of

M. rosenbergii, which in turn has facilitated inferences about the rich

biogeographical history of the study region.

Figure 1. Study region indicating sampling sites and the distribution of major mtDNA COI phylogeographic

lineages (neighbour-joining tree with bootstrap support). Coloured bars correspond to sampling site. 0.02

COI: 1056 individuals

100

100

98 56

67 99

79

86

96

67Huxley’s Line Western

clade

Eastern clade

0.02

Makassar Strait

134

REFERENCES Arbogast BS, Kenagy GJ (2001) Comparative phylogeography as an

integrative approach to historical biogeography. Journal of

Biogeography, 28, 819-825.

Bermingham E, Martin AP (1998) Comparative mtDNA phylogeography of

neotropical freshwater fishes: testing shared history to infer the

evolutionary landscape of lower Central America. Molecular Ecology, 7, 499-517.

Corbet AS (1941) The distribution of butterflies in the Malay Peninsula.

Proceedings of the Royal Entomological Society of London A, 16, 101-

116.

Corbett GB, Hill JE (1992) The Mammals of the Indomalayan Region: a

Systematic Review. Oxford University Press, Oxford, UK.

Crisci JV (2001) The voice of historical biogeography. Journal of

Biogeography, 28, 157-168.

Darwin (1859) On the Origin of Species. John Murray, UK.

de Bruyn M, Wilson JC, Mather PB (2004a) Huxley’s Line demarcates

extensive genetic divergence between eastern and western forms of the

giant freshwater prawn, Macrobrachium rosenbergii. Molecular

Phylogenetics and Evolution, 30, 251-257.

de Bruyn M, Wilson JC, Mather PB (2004b) Reconciling geography and

genealogy: phylogeography of giant freshwater prawns from the Lake

Carpentaria region. Molecular Ecology, 13, 3515-3526.

de Bruyn M, Nugroho E, Hossain MM, Wilson JC, Mather PB (2005)

Phylogeographic evidence for the existence of an ancient

biogeographic barrier: the Isthmus of Kra Seaway. Heredity, 94, 370-

378.

de Bruyn M, Mather PB (2005) Past climate change has mediated evolution

in giant freshwater prawns. Proceedings of the Royal Society of London

B (In Review).

De Man JG (1879) On some species of the genus Palaemon Fabr. with

descriptions of two new forms. Notes Leyden Museum, 1, 165-184.

Denduangboripant J, Cronk QCB (2000) High intraindividual variation in

internal transcribed spacer sequences in Aeschynanthus

135

(Gesneriaceae): implications for phylogenetics. Proceedings of the

Royal Society of London B, 267, 1407-1415.

De Queiroz A (2005) The resurrection of oceanic dispersal in historical

biogeography. Trends in Ecology and Evolution, 20, 68-73.

Ebach M, Humphries CJ (2003) Ontology of biogeography. Journal of

Biogeography, 30, 959-962.

Ebach M, Humphries CJ, Williams DM (2003) Phylogenetic biogeography

deconstructed. Journal of Biogeography, 30, 1285-1296.

Hedgecock D, Stelmach DJ, Nelson K, Lindenfelser ME, Malecha SR (1979)

Genetic divergence and biogeography of natural populations of

Macrobrachium rosenbergii. Proceedings of the World Mariculture

Society, 10, 873-879.

Hughes JB, Round PD, Woodruff DS (2003) The Indochinese-Sundaic faunal

transition at the Isthmus of Kra: an analysis of resident forest bird

species distributions. Journal of Biogeography, 30, 569-580.

Humphries CJ (2000) Form, space and time; which comes first? Journal of

Biogeography, 27, 11-15.

Inger RF (1966) The systematics and zoogeography of the amphibia of

Borneo. Field Zoology, 52, 1-402.

Inger RF, Voris HK (2001) The biogeographical relations of the frogs and

snakes of Sundaland. Journal of Biogeography, 28, 863-891.

Johnson DS (1973) Notes on some species of the genus Macrobrachium

(Crustacea: Decapoda: Caridea: Palaemonidae). Journal of the

Singapore National Academy of Sciences, 3(3), 273-291.

Lindenfelser ME (1984) Morphometric and allozymic congruence: evolution in

the prawn Macrobrachium rosenbergii (Decapoda: Palaemonidae).

Systematic Zoology, 33(2), 195-204.

Malecha SR (1977) Genetics and selective breeding of Macrobrachium

rosenbergii. In ‘Shrimp and Prawn Farming in the Western Hemisphere.’

(Eds. J.A. Hanson & H.L. Goodwin), pp. 328-355. Dowden, Hutchinson

and Ross, Stroudsberg, Pa, USA.

Malecha SR (1987) Selective breeding and intraspecific hybridization of

crustaceans. In ‘Proceedings of the World Symposium on Selection,

136

Hybridization, and Genetic Engineering in Aquaculture.’ pp. 323-336.

Vol. 1, Berlin, Germany.

McDowall RM (2004) What biogeography is: a place for process. Journal of

Biogeography, 31, 345-351.

Nelson G, Platnick NI (1981) Systematics and Biogeography: Cladistics and

Vicariance. Columbia University Press, New York.

Ridder-Numan JWA (1998) Historical biogeography of Spatholobus

(Leguminosae-Papillionoideae) and allies in SE Asia. In ‘Biogeography

and Geological Evolution of Southeast Asia’. (Eds. R. Hall & J.D.

Holloway), pp. 259-277. Backhuys Publishers, Leiden, The Netherlands.

Riddle BR, Hafner DJ (1998) Species as units of analysis in ecology and

biogeography: time to take the blinders off. Global Ecology and

Biogeography, 8, 433-441.

Riddle BR, Hafner DJ (2004) The past and future roles of phylogeography in

historical biogeography. In ‘Frontiers of Biogeography: New Directions

in the Geography of Nature.’ (Eds. M.V. Lomolino & L.R. Heaney), pp.

93-110. Sinauer Associates, Sunderland, USA.

Riddle BR, Hafner DJ, Alexander LF, Jaeger JR (2000) Cryptic vicariance in

the historical assembly of a Baja California Peninsular Desert biota.

Proceedings of the National Academy of Sciences USA, 97, 14438-

14443.

Ronquist F (1997) Dispersal-vicariance analysis: a new approach to the

quantification of historical biogeography. Systematic Biology, 46, 195-

203.

Rosen DE (1978) Vicariant patterns and historical explanation in

biogeography. Systematic Zoology, 27, 159-188.

Templeton AR (1998) Nested clade analyses of phylogeographic data:

testing hypotheses about gene flow and population history. Molecular

Ecology, 7, 381-397.

Wallace AR (1869) The Malay Archipelago. Macmillan and Co., London.

Woodruff DS (2003) Neogene marine transgressions, palaeogeography and

biogeographic transitions on the Thai-Malay Peninsula. Journal of

Biogeography, 30, 551-567.

137

Wowor D (2004) A systematic revision of the freshwater prawns of the genus

Macrobrachium (Crustacea: Decapoda: Caridea: Palaemonidae) of

Sundaland. Ph.D. Thesis, National University of Singapore, Singapore.

Zink RM, Blackwell-Rago RC, Ronquist F (2000) The shifting roles of

dispersal and vicariance in biogeography. Proceedings of the Royal

Society of London B, 267, 497-503.

138

Statement of Joint Authorship

Chand V, de Bruyn M, Mather PB (2005) Microsatellite loci in the eastern

form of the giant freshwater prawn (Macrobrachium rosenbergii). Molecular

Ecology Notes, 5, 308-310.

Chand V* Designed and developed experimental protocol. Carried out laboratory work

and analysed data. Contributed to the structure and editing of the manuscript.

de Bruyn M* (candidate) Designed and developed experimental protocol. Carried out field and

laboratory work, and analysed data. Wrote manuscript and acted as

corresponding author.

Mather PB Principal supervisor of the study design and experimental protocols. Assisted

in the interpretation of data. Contributed to the structure and editing of the

manuscript.

* These authors contributed equally to the design, development, preparation

and presentation of the material presented in this paper. Either of these

authors could be nominated as the senior author.

139

APPENDIX 1. Microsatellite loci in the eastern form of the giant

freshwater prawn (Macrobrachium rosenbergii)

Vincent Chand, Mark de Bruyn and Peter B. Mather

School of Natural Resource Sciences, Queensland University of Technology,

GPO Box 2434, Brisbane, Qld 4001, Australia

ABSTRACT Six microsatellite loci are identified and characterised from the eastern form

of the widespread and commercially important giant freshwater prawn

(Macrobrachium rosenbergii). The loci were detected by randomly screening

for di- and tri-nucleotide repeat units within a partial genomic library

developed for the species. Number of alleles and heterozygosity per locus in

a sample of 29 prawns ranged from 12 to 18 and from 0.66 to 0.90,

respectively. These markers provide powerful tools for the conservation and

management of wild stocks, the improvement of cultured stocks of M.

rosenbergii; and for investigating evolutionary processes underlying genetic

divergence among populations.

Keywords: Macrobrachium, Decapoda, Palaemonidae, microsatellite, primer

140

The decapod crustacean, Macrobrachium rosenbergii (giant freshwater

prawn), is commercially important in culture and as a wild capture-fishery

species, particularly in SE Asia. The natural distribution of M. rosenbergii

extends from Pakistan in the west to southern Vietnam in the east, across SE

Asia, and south to northern Australia, New Guinea, and some Pacific and

Indian Ocean Islands. Recent studies have recognised two distinct forms of

M. rosenbergii, an ‘eastern’ and a ‘western’ form (these forms may receive

elevation to specific taxonomic status in the near future; D. Wowor, pers.

comm.), based on morphology (Lindenfelser 1984), allozymes (Hedgecock et

al. 1979; Lindenfelser 1984; and others) and mtDNA (de Bruyn et al. 2004 a).

The western form is the common form used in culture in most parts of the

world, with the Philippines being a notable exception. Understanding the

distribution of genetic diversity in wild and cultured stocks is important for

developing sound conservation strategies aimed at preserving wild genetic

diversity levels, which are believed to be declining due to over exploitation.

Recognition of unique genetic diversity will also allow for informed choices in

breeding programs regarding the selection of genetically diverse broodstock,

and the maintenance of genetic diversity in cultured stocks. Here we report

the development and characterisation of microsatellite DNA markers in the

eastern form of M. rosenbergii, and we test their utility in the western form.

Approximately 10 μg of M. rosenbergii genomic DNA was digested

with restriction enzyme DpnII for 3 hours, and then separated on a 1.5%

agarose gel. DNA fragments in the 300-700 bp size range were excised,

purified and ligated to an equal volume of plasmid vector pUC18 (Amersham-

Pharmacia). The plasmids came digested with BamHI, and dephosphorylated

to allow the overhanging ends to match those resulting from the DpnII digest.

Recombinant plasmids were heatshocked into competent Eschericia coli

cells (strain JM109, Promega) and incubated for one hour at 37°C. Cells

were spread onto agar plates containing LB-Ampicillin/KGAC/IPTG and

incubated at 37°C overnight. A total of ~2500 recombinant colonies were

picked from plates and incubated overnight on new LB-Ampicillin agar plates

in a grid formation and then stored at 4°C. Recombinant colonies were

blotted from the plates onto filter membranes (Hybond-N, Amersham). DNA

from this transfer was cross-linked with the membrane, denatured and

141

probed with oligonucleotides [(ACC)8, (AAC)8, (AAG)8, (AGC)8, (ACG)8,

(ACT)8, (CA)15, (AG)12] that had been end labelled with [γ32P]dATP (Perkin

Elmer). Cross-linked single-stranded DNA was hybridised with the probes

overnight before being exposed onto X-ray film for 12 hours. Autoradiographs

revealed sixty one positive clones that hybridised with probed repeats.

Colonies containing repeats were identified and picked from the stored agar

plates and cultured overnight at 37°C. Plasmid DNA was extracted from

cultures by an alkaline-lysis miniprep and sequenced using Big Dye

Terminators (Perkin Elmer) and universal plasmid primers (M13 F & R,

Amersham Pharmacia Biotech). DNA sequencing was conducted on an ABI

3730 automated sequencer at the Australian Genome Research Facility at

the University of Queensland, Brisbane, Australia. Thirty four clones

contained recognisable microsatellite arrays. Nineteen of the candidate

microsatellites had an adequate flanking region for primer design. Primers

were designed using OLIGO and PRIMER 3 software. Polymerase chain

reaction (PCR) amplification of targeted microsatellites was successful for six

of the primer pairs (Table 1). PCR reactions contained 50-100 ng template

DNA, 0.2 U Taq DNA polymerase (Biotech), 0.25mM dNTP’s, 1mM MgCl2,

0.5µM each primer (forward primer end-labelled with fluorescent HEX), in

10x reaction buffer (670mM Tris-HCL, 166mM [NH4]2SO4, 4.5% Triton X-100,

2mg/mL gelatin; Biotech) up to 20 μL total reaction volume. After a

preliminary denaturing step at 95° for 3 min, PCR amplification was

performed for 30-35 cycles: 30 sec denaturing at 94°, 30 sec at annealing

temperature (Table 1) and 30 sec extension at 72°, with a final 10 min

extension at 72°. After amplification, 1 part each PCR product was mixed

with 1 part loading buffer, heated for 3 mins at 95°, and then set on ice for at

least 3 mins. Denatured PCR products and TAMRA (Genescan-350) size

markers were separated electrophoretically on 5% denaturing acrylamide

gels using a Gelscan 2000 rig (Corbett Research) and analysed for product

size with ONE-DSCAN software (Scanalytics).

Microsatellite typing of a wild ‘eastern’ (n = 29) population (de Bruyn et

al. 2004 a, b) of M. rosenbergii sampled from the Norman River (Queensland,

Australia) indicated that all six loci were polymorphic. Number of alleles per

locus and the observed and expected heterozygosities are presented in

142

Table 1. Analyses of allele frequencies in GENEPOP V3.1d (Raymond &

Rousset 1995) indicated loci Mr-89 (P = 0.013) and Mr-95 (P = 0.025)

deviated from Hardy-Weinberg expectations due to heterozygote deficiency,

which may result from presence of null alleles or a Wahlund effect. No

evidence for linkage disequilibrium was detected in locus-pair comparisons.

We tested the efficacy of the six microsatellite loci in ten individuals sampled

from across the entire distribution of the ‘western’ form of M. rosenbergii (de

Bruyn et al. 2004 a, c), but none amplified successfully. This result adds

further support to the contention that the two forms of M. rosenbergii have

been genetically isolated for a significant evolutionary time frame (de Bruyn

et al. 2004 a). We are presently in the process of developing microsatellites

specifically for use in ‘western form’ populations.

This suite of microsatellite markers should prove useful for genetic

studies of both wild and cultured stocks of the eastern form of M. rosenbergii,

and provides the foundation for future nuclear DNA-based studies that will

complement previous research on mitochondrial, allozyme and morphological

variation in M. rosenbergii. Table 1. PCR primer sequences, number of alleles, size range, and

observed and expected heterozygosity for microsatellite loci in the eastern

form of Macrobrachium rosenbergii. Genbank accession nos: AY791965-

AY791970.

Primer sequences 5´- 3´ Annealingtemp(°C)

Repeat motif

No. of alleles

Size range

HO HE

Mr-70

F: CATCAGCATTTGGCAGTCAC R: GGGGATCGTTCCGTAGTTTT

52 (ATT)7 12 235-283

22 23.83

Mr-74

F: TGTGAAAGGAAGTAAACTG R: GCAATAGATAAGTGAACCTC

57 (CT)32 16 126-174

22 23.75

Mr-78

F: GGACAAAACAAGCAGAAAAGR: CAGGCACAGTGATAACCAA

60 (GA)31 16 102-144

23 26.99

Mr-88

F: CTTCGGGTGTCATTGACCTT R: CCGGGGATCTGAGGTTTTAT

48 (GA)32 18 176-218

26 25.28

Mr-89

F: CTCAAAAGGCGGGATTGATA R: CCCGGGGATCATGTATTCTA

48 GAA(GA)17GA

A

13 252-278

19 22.39

Mr-95

F: CCAACTATAAAACAAACGAC R: TAATTTTCTTTCAACTGCTT

54 (GA)33 15 156-190

21 24.70

143

ACKNOWLEDGMENTS MdB received financial support from an Australian Postgraduate Award.

MdB’s Australian fieldwork was supported partly by research grants from the

Australian Geographic Society, the Ecological Society of Australia and the

Linnean Society of New South Wales. We thank QUT Ecological Genetics

lab members for assistance with microsatellite optimisation.

REFERENCES de Bruyn M, Wilson JC, Mather PB (2004a) Huxley’s Line demarcates

extensive genetic divergence between eastern and western forms of the

giant freshwater prawn, Macrobrachium rosenbergii. Molecular

Phylogenetics and Evolution, 30, 251-257.

de Bruyn M, Wilson JC, Mather PB (2004b) Reconciling geography and

genealogy: phylogeography of giant freshwater prawns from the Lake

Carpentaria region. Molecular Ecology, 13, 3515-3526.

de Bruyn M, Nugroho E, Hossain MM, Wilson JC, Mather PB (2005)

Phylogeographic evidence for the existence of an ancient

biogeographic barrier: the Isthmus of Kra Seaway. Heredity, 94, 370-

378.

Hedgecock D, Stelmach DJ, Nelson K, Lindenfelser ME, Malecha SR (1979)

Genetic divergence and biogeography of natural populations of

Macrobrachium rosenbergii. Proceedings of the World Mariculture

Society, 10, 873-879.

Lindenfelser ME (1984) Morphometric and allozymic congruence: evolution in

the prawn Macrobrachium rosenbergii (Decapoda: Palaemonidae).

Systematic Zoology, 33, 195-204.

Raymond M, Rousset F (1995) GENEPOP (version 1.2): population genetics

software for exact tests and ecumenicism. Journal of Heredity, 86, 248-

249.