of 64 /64
Abbildungsverzeichnis I Inhaltsverzeichnis Abbildungsverzeichnis ............................................................................................................................ III Tabellenverzeichnis ................................................................................................................................. V Abkürzungsverzeichnis ........................................................................................................................... VI 1 Einleitung .............................................................................................................................................. 1 1.1 Mesenchymale Stammzellen, Adipozyten und Osteoblasten....................................................... 2 1.2 Quantitativer Vergleich der mesenchymalen Stammzellen.......................................................... 3 1.2.1 Quantifizierung der Osteoblasten .......................................................................................... 3 1.2.2 Quantifizierung der Adipozyten ............................................................................................. 5 1.2.3 Durchflusszytometrie ............................................................................................................. 5 1.2.4 Polymerase Kettenreaktion, quantitative realtime PCR und cDNA - Synthese...................... 7 1.3 Alterung (Seneszenz) ................................................................................................................... 11 2 Material und Methoden ..................................................................................................................... 14 2.1 Material ....................................................................................................................................... 14 2.2 Methoden .................................................................................................................................... 19 2.2.1 Zellisolation und Zellkultur ................................................................................................... 19 2.2.2 Vergleich der Multipotenz durch adipogene Differenzierung ............................................. 20 2.2.2.1 Differenzierung zu Adipozyten ...................................................................................... 20 2.2.2.2 Methoden zum Vergleich der Multipotenz der Adipozyten ......................................... 21 2.2.3 Vergleich der Multipotenz durch osteogene Differenzierung ............................................. 22 2.2.3.1 Differenzierung zu Osteoblasten ................................................................................... 23 2.2.3.2 Methoden zum Vergleich der Multipotenz der Osteoblasten ...................................... 23 2.2.4 cDNA – Synthese .................................................................................................................. 25 2.2.5 Analyse der Expression von MSC´s – spezifischen Genen .................................................... 26 2.2.6 Flow Cytometry .................................................................................................................... 27 2.2.7 Nachweis der Seneszenz ...................................................................................................... 27 2.2.7.1 Analyse der Proliferationsfähigkeit ............................................................................... 28 2.2.7.2 Nachweis der Telomerlängen........................................................................................ 28 3 Ergebnisse und Auswertung ............................................................................................................... 30 3.1 Adipogene Differenzierung ......................................................................................................... 30 3.2 Osteogene Differenzierung ......................................................................................................... 31 3.3 Durchflusszytometrie .................................................................................................................. 33

Inhaltsverzeichnis · Seneszenz und deren Einfluss auf die Multipotenz gezogen werden. 1.1 Mesenchymale Stammzellen, Adipozyten und Osteoblasten Als MSC´s werden die Zellen bezeichnet,

  • Upload
    others

  • View
    2

  • Download
    0

Embed Size (px)

Citation preview

Page 1: Inhaltsverzeichnis · Seneszenz und deren Einfluss auf die Multipotenz gezogen werden. 1.1 Mesenchymale Stammzellen, Adipozyten und Osteoblasten Als MSC´s werden die Zellen bezeichnet,

Abbildungsverzeichnis I

Inhaltsverzeichnis

Abbildungsverzeichnis ............................................................................................................................ III

Tabellenverzeichnis ................................................................................................................................. V

Abkürzungsverzeichnis ........................................................................................................................... VI

1 Einleitung .............................................................................................................................................. 1

1.1 Mesenchymale Stammzellen, Adipozyten und Osteoblasten ....................................................... 2

1.2 Quantitativer Vergleich der mesenchymalen Stammzellen .......................................................... 3

1.2.1 Quantifizierung der Osteoblasten .......................................................................................... 3

1.2.2 Quantifizierung der Adipozyten ............................................................................................. 5

1.2.3 Durchflusszytometrie ............................................................................................................. 5

1.2.4 Polymerase Kettenreaktion, quantitative realtime PCR und cDNA - Synthese ...................... 7

1.3 Alterung (Seneszenz) ................................................................................................................... 11

2 Material und Methoden ..................................................................................................................... 14

2.1 Material ....................................................................................................................................... 14

2.2 Methoden .................................................................................................................................... 19

2.2.1 Zellisolation und Zellkultur ................................................................................................... 19

2.2.2 Vergleich der Multipotenz durch adipogene Differenzierung ............................................. 20

2.2.2.1 Differenzierung zu Adipozyten ...................................................................................... 20

2.2.2.2 Methoden zum Vergleich der Multipotenz der Adipozyten ......................................... 21

2.2.3 Vergleich der Multipotenz durch osteogene Differenzierung ............................................. 22

2.2.3.1 Differenzierung zu Osteoblasten ................................................................................... 23

2.2.3.2 Methoden zum Vergleich der Multipotenz der Osteoblasten ...................................... 23

2.2.4 cDNA – Synthese .................................................................................................................. 25

2.2.5 Analyse der Expression von MSC´s – spezifischen Genen .................................................... 26

2.2.6 Flow Cytometry .................................................................................................................... 27

2.2.7 Nachweis der Seneszenz ...................................................................................................... 27

2.2.7.1 Analyse der Proliferationsfähigkeit ............................................................................... 28

2.2.7.2 Nachweis der Telomerlängen ........................................................................................ 28

3 Ergebnisse und Auswertung ............................................................................................................... 30

3.1 Adipogene Differenzierung ......................................................................................................... 30

3.2 Osteogene Differenzierung ......................................................................................................... 31

3.3 Durchflusszytometrie .................................................................................................................. 33

Page 2: Inhaltsverzeichnis · Seneszenz und deren Einfluss auf die Multipotenz gezogen werden. 1.1 Mesenchymale Stammzellen, Adipozyten und Osteoblasten Als MSC´s werden die Zellen bezeichnet,

Abbildungsverzeichnis II

3.4 Quantitative realtime PCR ........................................................................................................... 34

3.5 Seneszenz .................................................................................................................................... 36

3.5.1 Passagierung ......................................................................................................................... 36

3.5.2 Nachweis der Telomerlängen ............................................................................................... 39

4 Zusammenfassung und Ausblick ........................................................................................................ 41

5 Quellen ............................................................................................................................................... 42

6 Anhang ................................................................................................................................................ 45

6.1 RNA - Aufreinigung ................................................................................................................... A - 1

6.2 Bilder Oil Red O - Färbung ........................................................................................................ A - 2

6.2 Ergebnisse der adipogenen Differenzierung ............................................................................ A - 4

6.3 Bilder von Kossa – Färbung ...................................................................................................... A - 5

6.4 Ergebnisse der osteogenen Differenzierung ............................................................................ A - 6

6.4.1 Proteinkonzentrationsbestimmung .................................................................................. A - 6

6.5 Ergebnisse Durchflusszytometrie ............................................................................................. A - 8

6.6 Ergebnisse der Zellzählung (Passagierung) ............................................................................ A - 10

Selbstständigkeitserklärung

Page 3: Inhaltsverzeichnis · Seneszenz und deren Einfluss auf die Multipotenz gezogen werden. 1.1 Mesenchymale Stammzellen, Adipozyten und Osteoblasten Als MSC´s werden die Zellen bezeichnet,

Abbildungsverzeichnis III

Abbildungsverzeichnis

Abbildung 1: Adipogenese [5] ................................................................................................................. 2

Abbildung 2: Osteogenese [5] ................................................................................................................. 3

Abbildung 3: Nachweisreaktion [10] ....................................................................................................... 3

Abbildung 4: Hydrolyse von Phosphorsäureester [11]............................................................................ 4

Abbildung 5: Hydrolyse von 4 – NPP [13] ................................................................................................ 4

Abbildung 6: Oil Red O [10] ..................................................................................................................... 5

Abbildung 7: Forward scatter [20] .......................................................................................................... 6

Abbildung 8: Side scatter [20] ................................................................................................................. 6

Abbildung 9: Fluoreszenz [20] ................................................................................................................. 6

Abbildung 10: Aufbau Flow Cytometer [20] ............................................................................................ 6

Abbildung 11: ein kompletter PCR – Zyklus [27] ..................................................................................... 8

Abbildung 12: cDNA – Synthese [31] ..................................................................................................... 10

Abbildung 13: lineare DNA - Enden - Problem [6] ................................................................................. 12

Abbildung 14: Bearbeitungsschema adipogene Differenzierungsplatten + Kontrollplatten ................ 21

Abbildung 15: Bearbeitungsschema osteogene Platten + Kontrollplatten ........................................... 23

Abbildung 16: Vergleich juvenil - adult (adipogen) ............................................................................... 30

Abbildung 17: Vergleich juvenil - adult (osteogen) ............................................................................... 32

Abbildung 18: Schmelzkurvenanalyse aller Ansätze ............................................................................. 35

Abbildung 19: F10 #12 Tag 3 ................................................................................................................. 36

Abbildung 20: F15 #12 Tag 3 ................................................................................................................. 36

Abbildung 21: F10 #13 Tag 3 ................................................................................................................. 36

Abbildung 22: F15 #13 Tag 3 ................................................................................................................. 36

Abbildung 23: F10 #14 Tag 3 ................................................................................................................. 37

Abbildung 24: F15 #14 Tag 3 ................................................................................................................. 37

Abbildung 25: F10 #18 Tag 3 ................................................................................................................. 37

Abbildung 26: F15 #18 Tag 3 ................................................................................................................. 37

Abbildung 27: Vergleich Lebend - Tod .................................................................................................. 38

Abbildung 28: Durchschnitt Vitalität ..................................................................................................... 38

Abbildung 29: Durchschnitt Generationszeiten .................................................................................... 39

Abbildung 30: Primerdimer ................................................................................................................... 40

Abbildung 31: : #9 Oil Red O - Färbung d8 400x ................................................................................ A - 2

Abbildung 32: Kontrolle #9 Oil Red O - Färbung d8 400x ................................................................... A - 2

Abbildung 33: #12 Oil Red O - Färbung d8 400x ................................................................................ A - 2

Page 4: Inhaltsverzeichnis · Seneszenz und deren Einfluss auf die Multipotenz gezogen werden. 1.1 Mesenchymale Stammzellen, Adipozyten und Osteoblasten Als MSC´s werden die Zellen bezeichnet,

Abbildungsverzeichnis IV

Abbildung 34: Kontrolle #12 Orl Red O - Färbung d8 400x ................................................................ A - 2

Abbildung 35: #13 Oil Red O - Färbung d8 400x ................................................................................ A - 2

Abbildung 36: Kontrolle #13 Oil Red O - Färbung d8 400x ................................................................. A - 2

Abbildung 37: #14 Oil Red O - Färbung d8 400x ................................................................................ A - 3

Abbildung 38: Kontrolle #14 Oil Red O - Färbung d8 400x ................................................................. A - 3

Abbildung 39: #17 Oil Red O - Färbung d8 400x ................................................................................ A - 3

Abbildung 40: Kontrolle #17 Oil Red O - Färbung d8 400x ................................................................. A - 3

Abbildung 41: #18 Oil Red O - Färbung d8 400x ................................................................................ A - 3

Abbildung 42: Kontrolle #18 Oil Red O - Färbung d8 400x ................................................................. A - 3

Abbildung 43: Standardkurve Oil Red O ............................................................................................. A - 4

Abbildung 44: #12 von Kossa - Färbung d27 100x ............................................................................. A - 5

Abbildung 45: Kontrolle #12 von Kossa - Färbung d27 100x .............................................................. A - 5

Abbildung 46: #13 von Kossa - Färbung d27 100x ............................................................................. A - 5

Abbildung 47: Kontrolle #13 von Kossa - Färbung d27 100x .............................................................. A - 5

Abbildung 48: #14 von Kossa - Färbung d27 100x ............................................................................. A - 5

Abbildung 49: Kontrolle #14 von Kossa - Färbung d27 100x .............................................................. A - 5

Abbildung 50: #18 von Kossa - Färbung d27 100x ............................................................................. A - 6

Abbildung 51: Kontrolle #18 von Kossa - Färbung d27 100x .............................................................. A - 6

Abbildung 52: Standard Proteinkonzentrationsbestimmung ............................................................ A - 7

Page 5: Inhaltsverzeichnis · Seneszenz und deren Einfluss auf die Multipotenz gezogen werden. 1.1 Mesenchymale Stammzellen, Adipozyten und Osteoblasten Als MSC´s werden die Zellen bezeichnet,

Tabellenverzeichnis V

Tabellenverzeichnis

Tabelle 1: Fluoreszenzfarbstoffe Durchflusszytometrie [26] .................................................................. 7

Tabelle 2: adipogene Primer ................................................................................................................... 9

Tabelle 3: osteogener Primer .................................................................................................................. 9

Tabelle 4: Primer für Seneszenznachweis ............................................................................................. 13

Tabelle 5: verwendete Patienten für die adipogene Differenzierung ................................................... 20

Tabelle 6: Zusammensetzung der Chemikalien für Oil Red O - Färbung ............................................... 21

Tabelle 7: verwendete Patienten für die osteogene Differenzierung ................................................... 22

Tabelle 8: Volumina cDNA - Synthese ................................................................................................... 25

Tabelle 9: Zusammensetzung Mastermix qRT PCR ............................................................................... 26

Tabelle 10: Ablauf qRT PCR ................................................................................................................... 26

Tabelle 11: verwendete Patienten für den Nachweis der Seneszenz ................................................... 27

Tabelle 12: Zusammensetzung Mastermix PCR Telomerlägen ............................................................. 29

Tabelle 13: PCR - Programm Telomerlängen......................................................................................... 29

Tabelle 14: Anteil der gefärbten Zellen + Standardabweichung in Prozent ......................................... 33

Tabelle 15: Ergebnisse qRT PCR ............................................................................................................ 34

Tabelle 16: Werte adipogene Differenzierung ................................................................................... A - 4

Tabelle 17: Werte Kontrolle adipogene Differenzierung ................................................................... A - 4

Tabelle 18: Werte für Standardkurve ................................................................................................. A - 4

Tabelle 19: Mittelwerte der ALP - Messungen bezogen auf die Proteinkonzentration (mmol/g) ..... A - 6

Tabelle 20: Werte der Proteinmessung ............................................................................................. A - 6

Tabelle 21: Standard Proteinkonzentrationsbestimmung ................................................................. A - 7

Tabelle 22: Konzentration AK #9 - #18 ............................................................................................... A - 8

Tabelle 23: Ergebnisse Flow Cytometry ............................................................................................. A - 9

Tabelle 24: Werte der Zellzählungen der Seneszenz ....................................................................... A - 10

Page 6: Inhaltsverzeichnis · Seneszenz und deren Einfluss auf die Multipotenz gezogen werden. 1.1 Mesenchymale Stammzellen, Adipozyten und Osteoblasten Als MSC´s werden die Zellen bezeichnet,

Abkürzungsverzeichnis VI

Abkürzungsverzeichnis

4 – NPP 4 - Nitrophenylphosphat

4 – NP 4 - Nitrophenolat

ß – GP ß – Natriumglycerolphosphat

ALP alkalische Phosphatase

ASAP Ascorbinsäure – 2 – Phosphat

Aqua bidest. bidestilliertes Wasser

BCA Bicinchoninsäure

CD Cluster of Differentiation

cDNA komplementäre DNA (engl.: complementary DNA)

DEPC Diethylpyrocarbonat

Dexa Dexamethason

DMEM Dulbecco's Modified Eagle's Medium

DNA Deoxyribonucleic acid (dt.: Desoxyribonukleinsäure)

dNTPs Desoxyribonukleosidtriphosphate

dsDNA doppelsträngige DNA (engl.: double stranded DNA)

EDTA Ethyldiamintetraessigsäure

ELISA Enzym - linked Immunosorbent Assay

Fn Zahl der Passage (F2 = 2. Passage)

FACS Fluorescence Activated Cell Sorting

FCS Fötales Rinderserum

FITC Fluorescein-Isothiocyanat

Page 7: Inhaltsverzeichnis · Seneszenz und deren Einfluss auf die Multipotenz gezogen werden. 1.1 Mesenchymale Stammzellen, Adipozyten und Osteoblasten Als MSC´s werden die Zellen bezeichnet,

Abkürzungsverzeichnis VII

FSC Vorwärtsstreulicht (engl.: Forward scatter)

fwd forward

GAPDH Glyceraldehyde - 3 - phosphate dehydrogenase

G/C - Gehalt Guanin/Cytosin - Gehalt

IBMX Isobutyl – 1 - methylxanthine

IG Intraglobulin

Indo Indomethacin

ITS Insulin – Transferrin – Selenium

mRNA messenger RNA

MSC´s mesenchymale Stammzellen

MW Mittelwert

NaOH Natriumhydroxid

OD Optische Dichte

Oligo – dT – Primer Desoxythyminidin – Nukleotiden

ORO Oil Red O

PBS Phosphate Buffered Saline

PCR Polymerase – Chain – Reaction (dt.: Polymerase -

Kettenreaktion)

PE Phycoerythrin

PerCP Peridinin Chloropyll Protein

Pen/Strep Penicillin/Streptomycin

PPARγ Peroxisomal proliferator-activated receptor gamma

qRT PCR quantitative realtime Polymerase - Kettenreaktion

rev reverse

Page 8: Inhaltsverzeichnis · Seneszenz und deren Einfluss auf die Multipotenz gezogen werden. 1.1 Mesenchymale Stammzellen, Adipozyten und Osteoblasten Als MSC´s werden die Zellen bezeichnet,

Abkürzungsverzeichnis VIII

RNA Ribonucleic acid (dt.: Ribonukleinsäure)

rpm rounds per minute

RS Rabbitserum

RT Raumtemperatur

SSC Seitwärtsstreulicht (engl.: Side scatter)

ssDNA einzelsträngige DNA (engl.: single stranded DNA)

w/o Ca2+

Mg2+ ohne Calcium und Magnesium

ZKF Zellkulturflasche

Page 9: Inhaltsverzeichnis · Seneszenz und deren Einfluss auf die Multipotenz gezogen werden. 1.1 Mesenchymale Stammzellen, Adipozyten und Osteoblasten Als MSC´s werden die Zellen bezeichnet,

1 Einleitung 1

1 Einleitung

Der Begriff Multipotenz beschreibt die Fähigkeit von Stammzellen sich in verschiedene Zellen einer

bestimmten Linie zu entwickeln. Ein Beispiel für multipotente Zellen bildet die Gruppe der

mesenchymalen Stammzellen (MSC´s), die sich in unseren Körpern durch diese Eigenschaft

auszeichnen. Sie entstammen dem mittleren Keimblatt (Mesoderm) des Menschen und sind

gekennzeichnet als undifferenzierte, sich selbst erneuerbare und proliferationsfähige Zellen. [1]

MSC´ s können sich zu allen Zellen der mesodermalen Linie, jedoch nicht keimblattübergreifend, d.h.

in Zellen der ektodermalen bzw. endodermalen Linie entwickeln. [2] Sie dienen der Regeneration von

mesenchymalen Geweben wie z.B. Knochen, Fett oder Knorpel und sind somit in unseren Körpern

unabhängig vom Alter vorhanden. Verschiedene Studien belegten die Isolation von dermalen

Stammzellen und die positive Differenzierung zu Adipozyten, Osteoblasten und Chondrozyten. [43]

[44] Jedoch gibt es Unterschiede in ihrer Aktivität. Es ist bekannt, dass z.B. Knochenbrüche bei

älteren Personen schlechter verheilen als bei jüngeren Patienten. Das lässt darauf schließen, dass

womöglich die Multipotenz vom Alter der jeweiligen Person abhängt. Um dies zu überprüfen wurden

Fibroblasten von juvenilen Vorhautproben und adulten Hautproben von kosmetischen Operationen

(z.B. Brustverkleinerung) auf ihre Multipotenz untersucht und diese dann miteinander verglichen.

Dabei wurden die Fibroblasten zu Knochen (Osteoblasten) – und Fettzellen (Adipozyten)

ausdifferenziert und durch spezifische qualitative bzw. quantitative Untersuchungen analysiert und

verglichen. Weitere molekularbiologische Vergleiche wurden durch eine quantitative realtime PCR

(qRT PCR) gezogen. Dazu wurde die RNA aus den ausdifferenzierten Zellen isoliert und auf die

Expression ihrer spezifischen adipogenen bzw. osteogenen Marker hin untersucht. Desweiteren

wurde die Expression von MSC´s – spezifischen Oberflächenantigenen mit Hilfe der

Durchflusszytometrie untersucht.

Welchen Einfluss hat das Alter nun noch auf die Effizienz der Multipotenz? Der Prozess des Alterns ist

auf das lineare DNA – Enden – Problem, speziell auf die Verkürzung der Telomere zurückzuführen.

Die Telomere bilden die Enden der linearen Chromosomen, welche sich bei jeder Zellteilung so

kritisch verkürzen, dass es zum sofortigen Abbruch der Zellteilung kommt. [1] [6] Somit kommt es bei

jeder Teilung zu einem Verlust der Stabilität und Integrität der Chromosomen. Dies bedeutet, dass

nach vielen Zellteilungen (im hohen Alter) diese nur noch sehr selten oder gar nicht mehr

vorkommen (Apoptose). [1] [6] Um dies zu überprüfen wurden verschiedene juvenile und adulte

Zellen auf diese Eigenschaften untersucht. Dazu wurden sie über mehrere Passagen kultiviert und

nach jeder Passage die Generationszeit bestimmt, um Unterschiede in der Proliferationsfähigkeit fest

zu stellen. Desweiteren wurde die DNA aus einer frühen und späteren Passage isoliert, um die

Page 10: Inhaltsverzeichnis · Seneszenz und deren Einfluss auf die Multipotenz gezogen werden. 1.1 Mesenchymale Stammzellen, Adipozyten und Osteoblasten Als MSC´s werden die Zellen bezeichnet,

1 Einleitung 2

Telomerverkürzung mittels qRT PCR nachzuweisen. Somit können nun Rückschlüsse auf die

Seneszenz und deren Einfluss auf die Multipotenz gezogen werden.

1.1 Mesenchymale Stammzellen, Adipozyten und Osteoblasten

Als MSC´s werden die Zellen bezeichnet, die aus dem lockeren embryonalen Bindegewebe des

Mesoderms (mittleres Keimblatt) hervorgehen. Sie werden als Vorläuferzellen der verschiedensten

Gewebe gehandelt und können sich innerhalb der Zelllinie des Mesoderms in unterschiedliche

Gewebe entwickeln (z.B. Knochen – bzw. Fettzellen). Diese Eigenschaft der MSC´s, sich nur in Zellen

der mesodermalen Linie zu differenzieren, wird als Multipotenz bezeichnet. Das heißt sie können sich

nicht in Zellen des äußeren Keimblattes (Ektoderm) bzw. inneren Keimblattes (Endoderm)

entwickeln. [2] [3]

Die Induktion der Differenzierung zu Adipozyten (Fettzellen) oder Osteoblasten (Knochenzellen) wird

über verschiedene Stimuli erreicht. Durch Zugabe von Differenzierungsmedien mit spezifischen

Wachstumssubstanzen differenzieren die Zellen in die gewünschte Richtung. Beide Medien

(adipogen und osteogen) enthalten die Stoffe Dexamethason (Dexa), zur Unterstützung der

Proliferation und Penicillin/Streptomycin (Pen/Strep), um eine mögliche Kontamination zu verhin-

dern. [4]

Unterschiede zwischen den Medien bestehen in den jeweiligen Stimuli. Durch die beiden Stoffe 3 –

Isobutyl – 1 - methylxanthine (IBMX) und Indomethacin (Indo) im adipogenen Medium, kommt es zur

Induktion der Bildung von Fettzellen. Jedoch haben die Stoffe Insulin, Rabbitserum (RS) und die darin

befindlichen Fettsäuren den größten Einfluss auf die MSC´s. [1] [7] Durch diese verschiedenen

adipogenen Stimuli prägen die Stammzellen einen für den Adipozyten charakteristischen

Stoffwechsel. Somit kommt es zur sukzessiven Ablagerung von Lipiden und über verschiedene

Formen von Vorläuferzellen bilden sich aus den MSC´s die Adipozyten. Die Zelle besitzt nun die für

einen Adipozyten typische Zellmorphologie, d.h dass das Zellplasma fast vollständig von einer großen

Fettvakuole verdrängt wurde. Dieser Vorgang wird als Adipogenese bezeichnet (Abb. 1). [5] [7]

Abbildung 1: Adipogenese [5]

Page 11: Inhaltsverzeichnis · Seneszenz und deren Einfluss auf die Multipotenz gezogen werden. 1.1 Mesenchymale Stammzellen, Adipozyten und Osteoblasten Als MSC´s werden die Zellen bezeichnet,

1 Einleitung 3

Die Induktion der Knochenzellenbildung wird ebenfalls durch bestimmte osteogene Stimuli induziert.

Dazu zählen ß - Natriumglycerolphosphat (ß – GP) und Ascorbinsäure – 2 – Phosphat (ASAP). Diese

Stoffe spielen eine wichtige Rolle bei der Mineralisierung der Zellen, sie führen zu einem

Aktivitätsanstieg der alkalischen Phosphatase (ALP) und dienen als Phosphatdonor. [8] [9] Durch

diese Stoffe wird die osteogene Differenzierung eingeleitet und es kommt zur Akkumulation von

Kalziumphosphat in der Zelle. Über verschiedene Vorläuferzellen (Osteoprogenitorzellen) bilden sich

aus MSC´s die Präosteoblasten, die sich bei zunehmender Verkalkung zu Osteoblasten umformen.

Diese Zellen bilden nun knochenspezifische Enzyme (z.B. Osteocalcin). Durch diese Enzyme kommt es

zur sukzessiven Verkalkung der Osteoblasten und werden diese in eine Matrix eingebunden, spricht

man von Osteozyten. Die Bildung von Osteoblasten aus MSC´s wird als Osteogenese (Abb. 2)

bezeichnet. [5] [8] [9]

Abbildung 2: Osteogenese [5]

1.2 Quantitativer Vergleich der mesenchymalen Stammzellen

1.2.1 Quantifizierung der Osteoblasten

Nach erfolgreichem Verlauf der Differenzierung zu Osteoblasten bilden sich Kalziumcarbonat – und –

phosphatablagerungen, welche als kleine schwarze Punkte sichtbar werden. Diese können durch die

von Kossa – Färbung nachgewiesen werden. Diese Färbung ist jedoch ein indirekter Nachweis des

Kalziums, da nur die Carbonat – und Phosphat – Ionen nachgewiesen werden. Durch die Zugabe einer

silberionenhaltigen Lösung werden die Carbonat – und Phosphat – Ionen gegen diese Silberionen

ausgetauscht und unter Einfluss von Sonnenlicht und einer Reduktionslösung (Pyrogallollösung) zu

metallischem Silber (schwarze Färbung) reduziert (Abb. 3). [10]

Abbildung 3: Nachweisreaktion [10]

Page 12: Inhaltsverzeichnis · Seneszenz und deren Einfluss auf die Multipotenz gezogen werden. 1.1 Mesenchymale Stammzellen, Adipozyten und Osteoblasten Als MSC´s werden die Zellen bezeichnet,

1 Einleitung 4

Die Fixierung des Ergebnisses und das Auswaschen von nicht reduziertem Silber erfolgt mit einer

Natriumthiosulfatlösung. Als Gegenfärbung wird Kernechtrot für eine rote Kernfärbung eingesetzt.

[10]

Durch den osteogenen Stimulus ASAP kommt es zu einem Aktivitätsanstieg der ALP. Dieses Enzym

dient in unseren Körpern der Hydrolyse von Phosphorsäureestern, in dem sie Phosphatgruppen von

vielen verschiedenen Arten von Molekülen entfernen (Dephosphorylierung, Abb. 4). [11] [12]

Abbildung 4: Hydrolyse von Phosphorsäureester [11]

Eine quantitative Bestimmung kann nun auf dem Weg der Messung der optischen Dichte (OD)

erfolgen. Durch die Zugabe von 4 - Nitrophenylphosphat (4 – NPP) wird dieses zu 4 - Nitrophenolat (4

– NP) hydrolysiert und im alkalischen Milieu bildet sich das gelbliche 4 – NP – Anion. Durch das

Mitführen von mehreren Standards in verschiedenen Konzentrationen, kann eine Standardkurve

erstellt werden, anhand derer dann die Konzentration der zu messenden Probe berechnet werden

kann. [13]

Abbildung 5: Hydrolyse von 4 – NPP [13]

Da eine korrekte Zellzählung nach längerer Zeit bei der osteogenen Differenzierung nicht möglich ist,

wird anstelle der Zellzahlbestimmung die Konzentration, der in den Zellen enthaltenen

Proteinmenge, gemessen. Dazu wurde der Bicinchoninsäure (BCA) – Test durchgeführt, dessen zu

Grunde liegende Reaktion die Biuret – Reaktion ist. Im alkalischen Milieu werden vorhandene Kupfer

– II – Ionen (Cu2+) von den Proteinen zu Kupfer – I – Ionen (Cu+) reduziert. Diese bilden mit den

Natriumsalzen der BCA einen intensiv violettfarbenen Komplex, der photometrisch detektiert

werden kann. Mit einer Kalibrationsreihe verschiedener BCA – Lösungen bekannter Konzen-

trationen, kann die Proteinkonzentration einer Probe bestimmt werden. [14]

Somit konnten die Werte der ALP – Messungen quantitativ auf die Proteinmenge bezogen werden.

Page 13: Inhaltsverzeichnis · Seneszenz und deren Einfluss auf die Multipotenz gezogen werden. 1.1 Mesenchymale Stammzellen, Adipozyten und Osteoblasten Als MSC´s werden die Zellen bezeichnet,

1 Einleitung 5

1.2.2 Quantifizierung der Adipozyten

Eine Methode zum Nachweis des positiven Verlaufes der adipogenen Differenzierung ist die Oil Red

O (ORO) – Färbung. Diese dient zur Darstellung von Neutralfetten. Dazu werden die Fettzellen mit

dem öllöslichen Lysochrom – Diazofarbstoff Oil Red O (Abb. 6) angefärbt. Dieser Farbstoff ist in

lipiden Substanzen (Fettvakuolen) besser löslich als im eigentlichen Lösungsmittel selbst (z.B.

Isopropanol). So diffundiert er vom Ort der höheren Konzentration (Lösungsmittel) zum Ort der

niedrigeren Konzentration (Lipidtropfen), geht aber dabei keine Bindung mit den Lipiden ein. [10]

Abbildung 6: Oil Red O [10]

Bei positiver Färbung erscheinen die Lipide rot. Als Gegenfärbung werden die Zellkerne durch eine

Hämalaun – Lösung gefärbt, welche die Zellkerne bläulich anfärbt. [10]

Um nun eine Quantifizierung der Adipozyten zu erreichen, muss der diffundierte Farbstoff wieder

eluiert werden. Durch die Zugabe von 100 %igem Isopropanol wird der Farbstoff wieder aus den

Zellen herausgelöst und dieses Farbstoff – Isopropanol – Gemisch kann nun mittels Photometer auf

seine OD hin untersucht werden. Um die Werte der OD´s quantifizieren zu können, wurden in dieser

Arbeit zusätzlich die Zellzahlen bestimmt, sodass die OD – Werte auf die Zellzahlen bezogen werden

konnten.

1.2.3 Durchflusszytometrie

Mit Hilfe der Durchflusszytometrie (engl.: Flow Cytometry) können in kürzester Zeit eine Vielzahl von

Zellen auf physiologische Eigenschaften untersucht werden. [15] Im Rahmen dieser Arbeit sollen die

MSC ´s der jeweiligen Biopsien hauptsächlich in Hinblick auf Morphologie (Größe und Granularität)

und die Expression verschiedener Oberflächenantigene detektiert und quantitativ erfasst werden.

[16] [17] Die flowcytometrische Detektion der Zellparameter erfolgt durch Streulicht - und Fluores-

zenzmessungen. Durch den sogenannten Hüllstrom wird der Durchmesser des Probenstroms im

Mikrokanal der Durchflusskammer eingestellt und die Zellen werden ähnlich einer Perlenkette

Page 14: Inhaltsverzeichnis · Seneszenz und deren Einfluss auf die Multipotenz gezogen werden. 1.1 Mesenchymale Stammzellen, Adipozyten und Osteoblasten Als MSC´s werden die Zellen bezeichnet,

1 Einleitung 6

aufgereiht. [18] [19] Dies nennt man hydrodynamische Fokussierung. Anschließend passieren die

Zellen einen (bzw. mehrere) fokussierten Laserstrahl(en). [16] [18] [19] Hierbei werden die Zellgröße

durch quantitative Messung der Beugung des Streulichts in der Vorwärtsrichtung im flachen Winkel

(Vorwärtsstreulicht (FSC, engl.: Forward scatter), Abb. 7), sowie die Granularität durch quantitative

Detektion der Brechung des Lichts rechtwinklig zur Laserachse (Seitwärtsstreulicht (SSC, engl.: Side

scatter), Abb.8) erfasst. [18] [19] Wurden die Zellen mit Fluoreszenzfarbstoffen behandelt, so können

gleichzeitig (zu FSC und SSC) die emittierten Fluoreszenzsignale der Farbstoffe, welche molekulare

Eigenschaften der Zelle widerspiegeln, analysiert werden (Abb. 9). [16] [18]

Abbildung 7: Forward scatter [20]

Abbildung 8: Side scatter [20]

Abbildung 9: Fluoreszenz [20]

Die Fluorophore sind in der Lage, nach Absorption energiereicher Strahlung, die dabei auf-

genommenen Photonen über energieärmere Strahlung wieder abzugeben. [21] Zur optischen

Trennung der Fluoreszenzsignale der einzelnen Farbstoffe werden dichroitische Spiegel

(Farbteilerspiegel) und Spektralfilter (Kurzpass-, Langpass - und Bandpassfilter) eingesetzt. Die farb-

stoffspezifischen Emissionen (Photonen) werden durch verschiedene Detektorsysteme mit Photo-

multipliern (engl.: photomultiplier tube) erfasst und in elektrische Signale umgewandelt. [16] [18]

In Abbildung 10 ist der gesamte Aufbau des Flow Cytometers noch einmal zusammengefasst.

Abbildung 10: Aufbau Flow Cytometer [20]

Page 15: Inhaltsverzeichnis · Seneszenz und deren Einfluss auf die Multipotenz gezogen werden. 1.1 Mesenchymale Stammzellen, Adipozyten und Osteoblasten Als MSC´s werden die Zellen bezeichnet,

1 Einleitung 7

In dieser Arbeit wurden die spezifischen Oberflächenantigene der MSC´s nachgewiesen. Dabei macht

man sich das Antigen – Antikörper – Bindungs – Prinzip zunutze: Ein antigenspezifischer Primär-

antikörper bindet an sein Epitop auf dem Antigen. Nachdem die Antikörper, die mit einem

Fluoreszenzfarbstoff versehen sind, an das spezifische Antigen gebunden haben, können diese durch

die Fluoreszenzanregung im entsprechenden Wellenlängenbereich gemessen werden. [22] [23]

Es ist noch kein eindeutiges Antigen für MSC´s bekannt, was sie als solches identifiziert. Deswegen

werden immer verschiedene Antigene nachgewiesen, die zum einen zum Expressionsprofil der MSC´s

gehören und deren Existenz zum anderen schon mehrfach nachgewiesen wurde. Sogenannte Cluster

of Differentiation (CD) kennzeichnen die spezifischen Epitope auf den Antigenen. Die in dieser Arbeit

nachgewiesenen CD´s, welche positiv für MSC´s sind, waren: CD105, CD29, CD73, CD166, CD90. Zur

Kontrolle wurden die Zellen noch auf CD45, CD34 und CD31 hin untersucht, die nicht zum

Expressionsprofil der MSC´s gehören. [25] [22] [23] [24]

Die verwendeten Fluoreszenzfarbstoffe sind in Tabelle 1 mit ihren jeweiligen Absorptions – bzw.

Emissionspektren dargestellt.

Tabelle 1: Fluoreszenzfarbstoffe Durchflusszytometrie [26]

Fluoreszenzfarbstoff Fluoreszenzanregung

in nm

Emission in

nm

Fluorescein-Isothiocyanat (FITC) 488 530

Phycoerythrin (PE) 496 575

Peridinin Chloropyll Protein (PerCP) 482 675

Alexa 700 633 719

1.2.4 Polymerase Kettenreaktion, quantitative realtime PCR und cDNA - Synthese

Die Polymerase Kettenreaktion (PCR, engl.: Polymerase Chain Reaction) ist im Allgemeinen eine

Methode zur in vitro Vervielfältigung (Amplifikation) definierter DNA - Stücke mit Hilfe des Enzyms

DNA - Polymerase. Die PCR beruht auf drei grundlegenden Schritten, die zyklisch wiederholt werden:

Denaturierung, Anlagerung (Annealing) und Elongation. [27] [28]

Grundlegend für die PCR ist eine intakte DNA – Matrize, die die Sequenz der DNA enthält, die

amplifiziert werden soll. Neben der Ausgangs – DNA befinden sich noch die Taq – Polymerase,

Magnesiumionen (Katalysatoren oder Cofaktoren), Desoxyribonukleosidtriphosphate (dNTPs),

nukleasefreies Wasser und die Primer (forward und reverse) in der Reaktionslösung. Ein Salzpuffer

garantiert optimale Bedingungen (z.B. pH – Wert).

Page 16: Inhaltsverzeichnis · Seneszenz und deren Einfluss auf die Multipotenz gezogen werden. 1.1 Mesenchymale Stammzellen, Adipozyten und Osteoblasten Als MSC´s werden die Zellen bezeichnet,

1 Einleitung 8

Bei der Denaturierung wird die Ausganglsösung auf ca. 94 °C erhitzt, wodurch die doppelsträngige

DNA - Matrize in zwei einzelsträngige Moleküle aufgeschmolzen wird. Durch die hohen Tempera-

turen werden die Wasserstoffbrückenbindungen in der DNA aufgebrochen und es liegen die beiden

Einzelstränge vor. [27] [29]

Bei dem Annealing wird die Temperatur auf ca. 60 °C herabgesetzt. Dadurch verbinden

(hybridisieren) sich die Primer mit den komplementären Einzelsträngen, wobei das eine

komplementär zu einem Abschnitt auf dem 5` - 3` DNA - Strang ist und das andere komplementär zu

einem Abschnitt auf dem 3` - 5` DNA - Strang. Die genaue Temperatur wird hierbei durch die Länge

und die Sequenz der Primer bestimmt. Diese Primer dienen als Startpunkte für die DNA Amplifikation

(Elongation).

Bei der Elongation werden die neu entstandenen Stränge weiter durch die DNA – Polymerase

aufgefüllt, die die einzelnen dNTPs einbaut (Amplifizierung). Dabei wird die Temperatur auf ca. 72 °C

erhöht, was die ideale Arbeitstemperatur für die verwendete Polymerase ist.

Dieser Ablauf (Abb. 11) wird mehrmals wiederholt. [27]

Abbildung 11: ein kompletter PCR – Zyklus [27]

Als DNA – Polymerasen können die Enzyme von verschiedenen Mikroorganismen verwendet werden.

Solche Mikroorganismen können unter anderem Thermus aquaticus, Thermus thermophilus und

Pyrococcus furiosus sein. [27]

Die qRT PCR ist eine Weiterentwicklung der klassischen PCR. Sie beruht auf dem Prinzip der normalen

PCR, jedoch kann mit dieser Methode neben der Vervielfältigung auch die DNA in Echtzeit

Page 17: Inhaltsverzeichnis · Seneszenz und deren Einfluss auf die Multipotenz gezogen werden. 1.1 Mesenchymale Stammzellen, Adipozyten und Osteoblasten Als MSC´s werden die Zellen bezeichnet,

1 Einleitung 9

quantifiziert werden. Die Quantifizierung wird mit Hilfe von Floureszenzfarbstoffen ermöglicht. Als

Fluoreszenzstoffe können u.a. Sybr Green oder Ethidiumbromid verwendet werden. Diese

interkalieren (binden) innerhalb doppelsträngiger DNA, was zu einem Anstieg der Fluoreszenz führt.

Dieser Anstieg ist proportional zu dem Anstieg der Target – DNA und die Messung der Fluoreszenz

kann z.B. am Ende jedes Elongationszykluses durchgeführt werden. [29] [30] Ein Nachteil dieser

Methode ist die geringe Spezifität, da nicht zwischen verschiedenen PCR - Produkten unterschieden

wird (z.B. unspezifisches Produkt). Dieser Nachteil kann durch die Schmelzkurvenanalyse, bei der die

Spezifität anhand der Fragmentlängen bestimmt wird, beseitigt werden. Bei der Schmelz-

kurvenanalyse wird durch langsame kontinuierliche Temperaturerhöhung die DNA aufgeschmolzen.

Bei einer für das Amplifikat spezifischen Temperatur wird der Doppelstrang in seine Einzelstränge

aufgespalten. Dabei wird der Fluoreszenzstoff freigesetzt, wodurch es zu einer Abnahme der

Fluoreszenz kommt. So hat ein spezifisches Produkt eine höhere Schmelztemperatur als ein

unspezifisches Produkt (z.B. Primerdimere), sodass eine Unterscheidung möglich ist. [29] [30]

Für den Vergleich der Multipotenz wurden in dieser Arbeit jeweils ein adipogenes und osteogenes

Gen auf seine Expression hin untersucht. Tabelle 2 zeigt die Sequenz der Primer für das adipogene

Gen Peroxisomal proliferator - activated receptor gamma (PPARγ) und des Housekeeping – Gens

Glyceraldehyde - 3 - phosphate dehydrogenase (GAPDH). Dieses dient als Referenzgen, da es in jeder

Zelle gleich exprimiert wird und später die Werte der Schmelzkurvenanalyse auf die Werte des

GAPDH bezogen werden.

Tabelle 2: adipogene Primer

adipogene Gene Sequenz der Primer

PPARγ

fwd: GCA GGA GCA GAG CAA AGA GG

rev: CCA GGA ATG CTT TTG GCA TAC

GAPDH

fwd: CTGCACCACCAACTGCTTAG

rev: AGCTCAGGGATGACCTTGC

Tabelle 3 zeigt die Sequenzen des Primers für den Nachweis des osteogenen Gens Osteocalcin. Als

Referenzgen dient hier auch das GAPDH.

Tabelle 3: osteogener Primer

Gen Sequenz der Primer

Osteocalcin fwd: GGCAGCGAGGTAGTGAAGAGAC

rev: GGCAAGGGGAAGAGGAAAGAAG

Page 18: Inhaltsverzeichnis · Seneszenz und deren Einfluss auf die Multipotenz gezogen werden. 1.1 Mesenchymale Stammzellen, Adipozyten und Osteoblasten Als MSC´s werden die Zellen bezeichnet,

1 Einleitung 10

Bevor jedoch die PCR durchgeführt werden kann, muss die isolierte RNA noch in ihre komplementäre

DNA (cDNA, Abb. 12) umgeschrieben werden, da nur eine doppelsträngige DNA – Matrize als

Grundlage für die PCR genutzt werden kann. Diese Umwandlung kann durch das Enzym Reverse

Transkriptase erreicht werden. Diese spezifische, RNA - abhängige DNA - Polymerase benötigt wie

andere DNA - Polymerasen einen Primer zur Synthese, welcher an die RNA bindet. [32] [33] In

eukaryotischen Zellen wird die DNA von den Genen im Zellkern in die pre – mRNA umgeschrieben.

Nach der Entfernung der Introns (Spleißen) wird der pre – mRNA ein Poly – A – Schwanz hinzugefügt.

Dieser schützt die mRNA vor Degradation und gibt ihr zusätzliche Stabilität. [33] Allgemein bestehen

die Primer für die cDNA – Synthese aus mehreren Desoxythyminidin – Nukleotiden (Oligo – dT –

Primer). Es können aber auch spezifische Primer eingesetzt werden, um ein bestimmtes Transkript zu

isolieren. [33] [34] Die Oligo – dT – Primer binden an komplementären Poly – A – Schwanz der pre –

mRNA und bilden somit den Startpunkt für die Reverse Transkriptase. Diese verlängert den

komplementären DNA - Strang, in dem sie die passenden Nukleotide einbaut. Um nun eine

doppelsträngige DNA zu erhalten, wird die pre – mRNA durch das Enzym RNase abgebaut und es

bleibt die einzelsträngige DNA (ssDNA) zurück. Da ssDNA jedoch hydrophob ist, bildet sie am 3‘ –

Ende eine Haarnadelschleifen um sich selbst. Diese dient der DNA – Polymerase als Ausgang und sie

bildet den komplementären DNA – Strang. So wurde zu der mRNA die dazu gehörige doppelsträngige

DNA (dsDNA) mit gleicher Sequenz gebildet. [33] Im Gegensatz zur natürlichen eukaryotischen DNA

befinden sich keine Introns mehr auf der cDNA, da die pre – mRNA den Vorgang des Spleißen schon

durchlaufen hat.

Abbildung 12: cDNA – Synthese [31]

Page 19: Inhaltsverzeichnis · Seneszenz und deren Einfluss auf die Multipotenz gezogen werden. 1.1 Mesenchymale Stammzellen, Adipozyten und Osteoblasten Als MSC´s werden die Zellen bezeichnet,

1 Einleitung 11

1.3 Alterung (Seneszenz)

Für den Begriff des Alterns gibt es noch keine einheitliche Definition. Jedoch wird das Altern mit der

zeitlichen Entwicklung eines Organismus von der Geburt bis hin zum Tod gleichgesetzt. [35] Im

Allgemeinen sind die Alterungsprozesse als irreversibel zu betrachten. Die Seneszenz hingegen

beschreibt nur einen Teilaspekt des Alterns bzw. der Entwicklung, d.h. sie beschreibt die Zunahme

der Wahrscheinlichkeit zu sterben. [36] Dies bedeutet, dass mit zunehmendem Alter auch die Wahr-

scheinlichkeit steigt, eines natürlichen Todes zu sterben. Aufgrund des linearen DNA – Enden –

Problems kommt es bei jeder Zellteilung zur Verkürzung der Enden der Telomere an den

Chromosomen. [35] [36] Als Telomere werden die besonderen Strukturen an den Enden linearer

Chromosomen bezeichnet. Ihre Aufgaben bestehen in der Bewahrung der Integrität und Stabilität

der Chromosomen, Schutz der Chromosomen vor Abbau durch Endonukleasen (Degradation),

Verhinderung der Fusion der Chromosomenden mit anderen Chromosomen und Schutz vor

Rekombination. Wäre dieser Schutz nicht gegeben, könnten die genannten Probleme zur Beendigung

der Zellteilung und zum programmierten Zelltod (Apoptose) führen. [37] [38] Weiterhin hat die

Länge der Telomere einen großen Einfluss auf das Replikationspotential einer Zelle, d.h. wie häufig

sie sich noch teilen kann. Mit abnehmender Länge der Telomere nimmt auch das

Replikationspotential ab. [6] [37]

Bei der Sequenz der telomerischen DNA handelt es sich um die Wiederholung der repetitiven

Sequenz 5'-TTAGGG-3'. Diese Sequenz ist hoch konserviert, d.h. sie befindet sich bei fast allen

Säugetieren einschließlich des Menschen am Guanin – reichen Strang. [6] [39]

Vor jeder Zellteilung muss zunächst die DNA repliziert werden. Dazu wird der Doppelstrang in seine

beiden Einzelstränge aufgespalten, die nun als Matrize für die DNA – Polymerase dienen. Diese stellt

zu jedem Mutterstrang den komplementären Tochterstrang her. Jedoch wird das Ende des einen

Tochterstranges nicht vollständig verdoppelt. Ursächlich hierfür ist die Replikationsrichtung der

DNA – Polymerase (5‘ - 3‘ - Richtung, unidirektional) und die Tatsache, dass die beiden Einzelstränge

sich antiparallel zueinander verhalten. Während der Leitstrang (Leadingstrand) vollständig in 5‘ - 3‘ -

Richtung synthetisiert wird, wird der Folgestrang (Laggingstrand) nur stückweise in Form kleiner

DNA – Fragmente (Okazaki – Fragmente) verdoppelt. Diese Fragmente werden miteinander

verknüpft. Als Startpunkt für die DNA – Polymerase dienen RNA – Primer, an denen die Polymerase

andockt und beginnt die Tochtersträng mit komplementären Nukleotiden aufzufüllen. Während für

den Leitstrang nur ein RNA – Primer notwendig ist, sind bei dem Folgestrang mehrere RNA – Primer

von Nöten, da die DNA – Polymerase für jedes Okazaki – Fragment neu an dem zu synthetisierenden

Page 20: Inhaltsverzeichnis · Seneszenz und deren Einfluss auf die Multipotenz gezogen werden. 1.1 Mesenchymale Stammzellen, Adipozyten und Osteoblasten Als MSC´s werden die Zellen bezeichnet,

1 Einleitung 12

Tochterstrang ansetzen muss. Wenn die Replikation abgeschlossen ist, werden die RNA – Primer

entfernt und durch DNA ersetzt. Nur am 3‘ – Ende des parentalen Stranges kann der RNA – Primer

nicht durch Nukleotide ersetzt werden, sodass es bei jeder Zellteilung zu einer Verkürzung der

Telomere am 5‘ – Ende des Tochterstranges kommt. Der komplette Ablauf der Replikation ist in

Abbildung 13 dargestellt. [6] [37] [38]

Abbildung 13: lineare DNA - Enden - Problem [6]

In dieser Arbeit soll die Verkürzung der Telomere durch eine qRT PCR nachgewiesen werden. Dazu

werden Primer, die komplementär zur Sequenz der Telomere sind, eingesetzt. Der interkalierende

Farbstoff (Sybr Green) bindet dabei an die doppelsträngige DNA und je größer das Fluoreszenzsignal

ist, desto mehr Produkt ist entstanden und umso länger sind die Telomere.

Desweiteren kann in vivo die Seneszenz durch die Passagierung der Zellen über einen längeren

Zeitraum hin untersucht werden. Dadurch kann die Generationszeit bestimmt werden. Die

Generationszeit ist die Zeit, die für eine Verdopplung der Zellzahl benötigt wird. Sie berechnet sich

aus der Zahl der ausgesäten Zellen (N0) und der gezählten Zellen (N) nach einem bestimmten

Zeitintervall (∆t in h oder d) mit folgender Formel:

Page 21: Inhaltsverzeichnis · Seneszenz und deren Einfluss auf die Multipotenz gezogen werden. 1.1 Mesenchymale Stammzellen, Adipozyten und Osteoblasten Als MSC´s werden die Zellen bezeichnet,

1 Einleitung 13

Somit lassen sich Rückschlüsse auf die Proliferationsfähigkeit der juvenilen und adulten Zellen ziehen.

Mit zunehmender Zahl der Passagierungen altern die MSC´s, was zu einer Verkürzung der Telomere

führt. Dies kann durch die Isolation der DNA und mit Hilfe einer qRT PCR nachgewiesen werden. [40]

Tabelle 4 zeigt die Sequenzen der forward und reverse Primer zum Nachweis der Telomerlängen. Wie

auch schon bei der qRT PCR der MSC´s – spezifischen Gene wird bei dem Nachweis der Telomer-

längen ein Housekeeping – Gen (Albumin) verwendet.

Tabelle 4: Primer für Seneszenznachweis

Nachweisgen bzw. -

abschnit Sequenz der Primer

Telomer fwd: ACACTAAGGTTTGGGTTTGGGTTTGGGTTTGGGTTAGTGT

rev: TGTTAGGTATCCCTATCCCTATCCCTATCCCTATCCCTAACA

Albumin fwd: CGGCGGCGGGCGGCGCGGGCTGGGCGGaaatgctgcacagaatccttg

rev: GCCCGGCCCGCCGCGCCCGTCCCGCCGgaaaagcatggtcgcctgtt

Page 22: Inhaltsverzeichnis · Seneszenz und deren Einfluss auf die Multipotenz gezogen werden. 1.1 Mesenchymale Stammzellen, Adipozyten und Osteoblasten Als MSC´s werden die Zellen bezeichnet,

2 Material und Methoden 14

2 Material und Methoden

2.1 Material

Zellkultur

• Trypan blue stain 0,4 % (15250, Gibco, Carlsbad – USA)

• Neubauerzählkammer (Neubauer improved, 0,100 mm Tiefe, 0,0025 mm², Laboroptik, Bad

Homburg – DE)

• Betaisodona (5564-0509, Mundipharma GmbH, Limburg – DE)

• Dispase II (165859, Roche, Grenzach-Wyhlen –DE)

• Collagenase A (1088793, Roche, Grenzach-Wyhlen –DE)

• Phosphate buffered saline (PBS) ohne Calcium und Magnesium (w/o Ca2+ Mg2+) (L182-10,

Biochrom AG, Berlin – DE)

• Zellsieb 100 µm (REF 352360, , BD Bioscience, Berlin – DE)

• Phosphate buffered saline (PBS) ohne Calcium und Magnesium (w/o Ca2+ Mg2+) (L182-10,

Biochrom AG, Berlin – DE)

• Zentrifuge Labofuge 400R (40281392, Heraeus, Thermo Scientific, Waltham – USA )

• Dulbecco's Modified Eagle's Medium (DMEM), High Glucose, Natriumpyrovat, Glutamax

(31966, Invitrogen, Carlsbad – USA)

• 175 cm² Zellkulturflasche (REF 353112, BD Bioscience, Berlin – DE)

• Trypsin/EDTA (0,5 % / 0,2 %) (w/v) (65368, Biochrom AG, Berlin – DE)

• Fötales Rinderserum (FCS) (F7524, Lot 047K3395, Sigma, St. Louis – USA)

• Pen/Strep (P11-010, PAA, Pasching – AUS)

• Lichtmikroskop Nikon Eclipse TE 2000 S (501149,Nikon, Tokyo – JP)

• Brutschrank Heraeus Cytoperm 2 (40309866, Kendro, Langenselbold – DE)

• Thermomixer comfort (535508129, Eppendorf, Hamburg – DE)

• 12 Well – Platte (353043, Becton Dickinson Labware, Franklin Lakes – USA)

• Rabbitserum (R-4505, Sigma, St. Louis – USA)

• IBMX (I-5879, Sigma, St. Louis – USA)

• Indomethacin (Indo) (I-7379, Sigma, St. Louis – USA)

• Dexamethason (Dexa) (D-2915, Sigma, St. Louis – USA)

• Insulin (I-9278, Sigma, St. Louis – USA)

Page 23: Inhaltsverzeichnis · Seneszenz und deren Einfluss auf die Multipotenz gezogen werden. 1.1 Mesenchymale Stammzellen, Adipozyten und Osteoblasten Als MSC´s werden die Zellen bezeichnet,

2 Material und Methoden 15

• Ascorbinsäure – 2 – Phosphat (ASAP) (A-8960, Sigma, St. Louis – USA)

• ß – Natriumglycerolphosphat (ß GP) (G-9891, Sigma, St. Louis – USA)

• Mikroskop Olympus IX51 (5H07510, Olympus, Tokio – JP)

• RNeasy Mini Kit (74106, Qiagen, Berlin – DE)

• Zellschaber (20080296, TPP – CH)

• Gefrierschrank -86 °C ULT Freezer (Thermo Forma, Thermo Scientific, Waltham – USA)

Chemikalien

• 10 % DMEM – Medium (DMEM + 50 ml FCS + 5 ml Pen/Strep)

• adipogenes Medium mit RS und Insulin (RS + Insulin)

� 15 % Rabbitserum (v/v)

� 1 % Pen/Strep (100x) (v/v)

� 0,5 mM IBMX (250x) (v/v)

� 0,1 mM Indo (1000x) (v/v)

� 1 µM Dexa (100x) (v/v)

� 700 nM Insulin (2500x) (v/v)

� bis zum Endvolumen auffüllen mit DMEM – Medium

• osteogenes Medium

� 10 % FCS (v/v)

� 1 % Pen/Strep (100x) (v/v)

� 100 nM Dexa (1000x) (v/v)

� 0,05 mM ASAP (1000x) (v/v)

� 10 mM ß - GP (100x) (v/v)

� bis zum Endvolumen auffüllen mit DMEM – Medium

Oil Red O – Färbung + von Kossa - Färbung

• Mikroskop Olympus IX51 (5H07510, Olympus, Tokio – JP)

• 4 % Formaldehyd (4979.1, Roth, Frankfurt – DE)

• Oil Red O – Pulver (O-0625, Sigma, St. Louis – USA)

• Isopropanol (9866.2, Roth, Frankfurt – DE)

• Mayer´s Hämatoxylin (Lillie´s Modified) (S3309, DakoCytomation, Hamburg – DE)

• Phosphate buffered saline (PBS) ohne Calcium und Magnesium (w/o Ca2+ Mg2+) (L182-10,

Biochrom AG, Berlin – DE)

Page 24: Inhaltsverzeichnis · Seneszenz und deren Einfluss auf die Multipotenz gezogen werden. 1.1 Mesenchymale Stammzellen, Adipozyten und Osteoblasten Als MSC´s werden die Zellen bezeichnet,

2 Material und Methoden 16

• Ethanol (K928.2, Roth, Frankfurt – DE)

• Schüttler MS2 Minishaker Duomax (543-32210-00-3, IKA, Staufen – DE)

• Spektralphotometer UV/VIS S22 (89924, Libra Biochrom, Berlin – DE)

• Silbernitrat (31630, Sigma, St. Louis – USA)

• Pyrogallol (1,2,4 – Trihydroxybenzol) (1.00612.0050, Merck, Darmstadt – DE)

• Sodium Thiosulfat (S-1648, Sigma, St. Louis – USA)

• Kernechtrot – Aluminiumsulfatlösung (N069.1, Roth, Frankfurt – DE)

ALP – und Proteinkonzentrationsbestimmung

• PBS (L182-10, Biochrom AG, Berlin – DE)

• Triton X (X-100, Sigma, St. Louis – USA)

• Homogenisator Ultraturrax + Dispergierwerkzeug (T 25 basic + S 25 N-8G, 10.006680,

Omnilab-Laborzentrum, Bremen – DE)

• 96 Well – Platte (353936, Becton Dickinson Labware, Franklin Lakes – USA)

• 4 – NPP (020M8214, Sigma, St. Louis – USA)

• Platten – Reader (Safire, Tecan, Männedorf – CH)

• peqGold Trifast (30-2020, peqlab, Erlangen – DE)

• Chloroform (3313.1, Roth, Frankfurt – DE)

• Zentrifuge fresco Heraeus (40338868, Kendro, Langenselbold – DE)

• Isopropanol (9866.2, Roth, Frankfurt – DE)

• Guanidinhydrochloride (2702575, OMNI – Life Science, Bremen – DE)

• Rotations-Vakuum-Konzentrator + LABOVAC-Membranvacuumsystem (100225 + 103042,

Christ + ILMVAC, Osterode am Harz + Ilmenau – DE)

• Thermomixer comfort (535508129, Eppendorf, Hamburg – DE)

• BCA Protein Assay Kit (23227, Pierce, Bonn – DE)

cDNA - Synthese

• dNTP´s (201900, Qiagen, Berlin – DE)

• Oligo – dt – Primer (S0132, Fermentas, St. Leon - Rot – DE)

• 5x First Strand Buffer (M531A, Promega, Madison – USA)

• M – MLV – Reverse Transkriptase (M170B, Promega, Madison – USA)

• RNase Inhibitor (N211B, Promega, Madison – USA)

• DEPC – Wasser (K028.2, Roth, Frankfurt – DE)

Page 25: Inhaltsverzeichnis · Seneszenz und deren Einfluss auf die Multipotenz gezogen werden. 1.1 Mesenchymale Stammzellen, Adipozyten und Osteoblasten Als MSC´s werden die Zellen bezeichnet,

2 Material und Methoden 17

• Thermomixer comfort (535508129, Eppendorf, Hamburg – DE)

qRT PCR

• Quantifast Sybr Green PCR Kit (204052, Qiagen, Berlin – DE)

• Rotor – Gene 3000 (Corbett Research, Berlin – DE)

Primer

• PPARγ (eurofins mwg|operon, Ebersberg – DE)

• GAPDH (eurofins mwg|operon, Ebersberg – DE)

• Osteocalcin (eurofins mwg|operon, Ebersberg – DE)

Durchflusszytometrie

• Trypsin/EDTA (0,5 % / 0,2 %) (w/v) (65368, Biochrom AG, Berlin – DE)

• FACS – Puffer ( auf 1 l: 80 g Natriumchlorid, 2 g Kaliumchlorid, 12,2 g

Natriumhydrogenphosphat, 2 g, Kaliumdihydrogenphosphat, 10 m 0,5 M EDTA und bis zum

Schluss mit aqua bidest. auffüllen

• 96 Well – Platte (353936, Becton Dickinson Labware, Franklin Lakes – USA)

• Neubauerzählkammer (Neubauer improved, 0,100 mm Tiefe, 0,0025 mm², Laboroptik, Bad

Homburg – DE)

• Plattenzentrifuge Multifuge 3 S-R (40286002, Kendro, Langenselbold – DE)

• FACS – Messgerät LSR II Cell Analyzer (Becton Dickinson Labware, Franklin Lakes – USA)

Primärantikörper

• CD73 PE (550257, BD Bioscience, Berlin – DE)

• CD90 Fitc (555593, BD Bioscience, Berlin – DE)

• CD105 Fitc (01993, Biozol, Eching – DE)

• IgG1 (Fitc) (M075-4, MBL, Madison – USA)

• CD105 (Fitc) (01993, Biozol, Eching – DE)

• IgG1 (PE) (550617, BD Bioscience, Berlin – DE)

• CD29 (PE) (303004, Biolegend, San Diego – USA)

• CD31 (PE) (303106, Biolegend, San Diego – USA)

• CD45 (PE) (P7687, Sigma, St. Louis – USA)

• CD73 (PE) (550257, BD Bioscience, Berlin – DE)

• CD166 (PE) (343903, Biolegend, San Diego – USA)

Page 26: Inhaltsverzeichnis · Seneszenz und deren Einfluss auf die Multipotenz gezogen werden. 1.1 Mesenchymale Stammzellen, Adipozyten und Osteoblasten Als MSC´s werden die Zellen bezeichnet,

2 Material und Methoden 18

• IgG1 (Alexa 700) (400143, Biolegend, San Diego – USA)

• CD90 (Alexa 700) (328119, Biolegend, San Diego – USA)

• IgG1 (PerCP) (400147, Biolegend, San Diego – USA)

• CD34 (PerCP) (343519, Biolegend, San Diego – USA)

Seneszenz

• 175 cm² Zellkulturflasche (REF 353112, BD Bioscience, Berlin – DE)

• 25 cm² Zellkulturflasche (REF 353014, BD Bioscience, Berlin – DE)

• Trypan blue stain 0,4 % (15250, Gibco, Carlsbad – USA)

• Neubauerzählkammer (Neubauer improved, 0,100 mm Tiefe, 0,0025 mm², Laboroptik, Bad

Homburg – DE)

• Phosphate buffered saline (PBS) ohne Calcium und Magnesium (w/o Ca2+ Mg2+) (L182-10,

Biochrom AG, Berlin – DE)

• Zentrifuge Labofuge 400R (40281392, Heraeus, Thermo Scientific, Waltham – USA)

• Dulbecco's Modified Eagle's Medium (DMEM), High Glucose, Natriumpyrovat, Glutamax

(31966, Invitrogen, Carlsbad – USA)

• Trypsin/EDTA (0,5 % / 0,2 %) (w/v) (65368, Biochrom AG, Berlin – DE)

• Brutschrank Heraeus Cytoperm 2 (40309866, Kendro, Langenselbold – DE)

• peqGold Trifast (30-2020, peqlab, Erlangen – DE)

• Chloroform (3313.1, Roth, Frankfurt – DE)

• Ethanol (K928.2, Roth, Frankfurt – DE)

• Thermomixer comfort (535508129, Eppendorf, Hamburg – DE)

• Rotations-Vakuum-Konzentrator + LABOVAC-Membranvacuumsystem (100225 + 103042,

Christ + ILMVAC, Osterode am Harz + Ilmenau – DE)

• Zentrifuge fresco Heraeus (40338868, Kendro, Langenselbold – DE)

• Natriumcitrat (1.06448.1000, Merck, Darmstadt – DE)

• NanoDrop ND – 100 (5354, peqlab, Erlangen – DE)

• Natriumhydroxid (6771.1, Roth, Frankfurt – DE)

• Thermocycler Primus 96 (1539021812, eurofins mwg|operon, Ebersberg – DE)

• AmpliTaq Gold 360 DNA Polymerase (4398833, Applied Biosystems, Darmstadt – DE)

Primer

• Telomer (eurofins mwg|operon, Ebersberg – DE)

• Albumin (eurofins mwg|operon, Ebersberg – DE)

Page 27: Inhaltsverzeichnis · Seneszenz und deren Einfluss auf die Multipotenz gezogen werden. 1.1 Mesenchymale Stammzellen, Adipozyten und Osteoblasten Als MSC´s werden die Zellen bezeichnet,

2 Material und Methoden 19

2.2 Methoden

Alle sterilen Arbeiten wurden unter der Sterilwerkbank der Firma Heraeus durchgeführt. Die

verwendeten Chemikalien wurden bevor sie genutzt wurden auf 37 °C vorgewärmt und die

Zellzählungen erfolgten im Verhältnis 1 : 10 oder 1 : 5 (Analyse der Proliferationsfähigkeit, Abschnitt

2.2.7.1) mit Trypanblau. Dabei gelangt der Farbstoff nur in tote Zellen, da diese keine intakte

Zellmembran mehr besitzen. Desweiteren betrug die zu pipettierende Menge an Lösungen, wenn

nicht anders angegeben, für ein Well einer 12 - Well – Platte 1 ml.

2.2.1 Zellisolation und Zellkultur

Die Hautbiopsien stammten aus Kliniken in Leipzig und wurden nur nach dem Einverständnis der

Patienten und gemäß den ethischen Richtlinien der Universität Leipzig verwendet.

Diese wurden direkt nach der Operation in sterilem PBS bei 4 °C gelagert. Für die Weiterverarbeitung

der Hautbiopsien wurden diese zunächst gesäubert und desinfiziert. Dazu wurden die Hautproben

mit frischem PBS gewaschen und für 20 min mit Betaisodona desinfiziert. Anschließend wurden die

Hautbiopsien nochmals mit PBS gespült, bis diese frei von dem Desinfektionsmittel waren. Mit Hilfe

einer Pinzette und eines Skalpells wurde die subkutane Fettschicht entfernt und die Hautbiopsien in

5 x 5 mm große Stücke zerschnitten.

Um nun das Ablösen der Epidermis von der Dermis zu erleichtern, wurden die Hautstückchen in

Dispase II – Lösung (2,5mg/ml in DMEM) gelegt und bei 4 °C für minimal 18 und maximal 24 h

inkubiert. Danach wurden die Biopsien für 30 min bei 37 °C inkubiert, um die Proben zu erwärmen.

Nun konnte die Epidermis mittels Pinzette von der Dermis abgezogen werden.

Für die Isolierung der Fibroblasten aus den Dermisstücken wurden diese in 15 ml Collagenase

(0,075% in PBS) über Nacht bei 37 °C und 300 rounds per minute (rpm) inkubiert. Danach wurde die

Zellsuspension durch ein 100 µm Zellsieb gegeben und für 5 min bei 1800 rpm zentrifugiert.

Anschließend wurde das Pellet in 10 %igem DMEM resuspendiert und in 175 - cm² -

Zellkulturflaschen (ZKF) mit DMEM bei 37 °C und 5 % CO2 kultiviert.

Bei konfluentem Zellwachstum der Zellen (ca. 85 % des ZKF – bodens bedeckt) wurden diese

subkultiviert. Dazu wurde das Medium abgesaugt und die ZKF zweimal mit PBS gespült. Um die Zellen

abzulösen, wurden diese mit 5 ml Trypsin für 5 min bei 37 °C inkubiert. Nachdem sich die Zellen

vollständig abgelöst hatten, wurde die Enzymreaktion durch die Zugabe von 15 ml 10 %igen DMEM

gestoppt und die Zellsuspension wurde für 5 min bei 1800 rpm zentrifugiert. Anschließend wurde das

Page 28: Inhaltsverzeichnis · Seneszenz und deren Einfluss auf die Multipotenz gezogen werden. 1.1 Mesenchymale Stammzellen, Adipozyten und Osteoblasten Als MSC´s werden die Zellen bezeichnet,

2 Material und Methoden 20

Pellet in 10 ml 10 %igem DMEM resuspendiert und die Zellzahl bestimmt. Es wurden immer

1 – 1,5 ∙ 106 Zellen pro 175 cm² ZKF ausgesät und bei 37 °C und 5 % CO2 kultiviert.

2.2.2 Vergleich der Multipotenz durch adipogene Differenzierung

Für den Vergleich der Multipotenz durch adipogene Differenzierung wurden Zellen von drei juvenilen

und drei adulten Hautproben eingesetzt. Tabelle 5 zeigt um welche Art der Hautbiopsie es sich

handelt. Desweiteren wird noch das Alter des Patienten und welche Passage für die Differenzierung

genutzt wurde, angegeben.

Tabelle 5: verwendete Patienten für die adipogene Differenzierung

Patient Alter des

Patienten Art der Biopsie Passage Alterung

# 9 43 Jahre Brust F5 adult

# 12 24 Jahre Schamlippe F5 adult

# 13 10 Jahre Vorhaut F5 juvenil

# 14 5 Jahre Vorhaut F5 juvenil

# 17 10 Jahre Vorhaut F5 juvenil

# 18 40 jahre Brust F5 adult

2.2.2.1 Differenzierung zu Adipozyten

Zunächst wurden zwei 12 - Well – Platten (RS + Insulin und Kontrolle) pro Patient mit jeweils 30 000

Zellen pro Well ausgesät. Nach zweitägiger Inkubation bei 37 °C und 5 % CO2 wurde das

Differenzierungsmedien RS + Insulin hinzugegeben. Die Platten wurden bei 37 °C und 5 % CO2

inkubiert und alle 3 – 4 Tage wurde das adipogene Differenzierungsmedium gewechselt. Die

Differenzierung erstreckte sich über einen Zeitraum von 8 Tagen. Nach Ablauf dieser Zeit wurden die

Platten wie folgt behandelt: 3 Wells dienten der Zellzählung, 3 Wells wurden mit Oil Red O angefärbt

und 6 Wells dienten der RNA – Isolation. Die Kontrollplatten wurden mit 10 %igen DMEM kultiviert.

Auch hier wurde aller 3 – 4 Tage das Medium gewechselt. Abbildung 14 fasst noch einmal das

Bearbeitungsschema der adipogenen Differenzierungsplatten und ihrer jeweiligen Kontrollplatten

zusammen.

Page 29: Inhaltsverzeichnis · Seneszenz und deren Einfluss auf die Multipotenz gezogen werden. 1.1 Mesenchymale Stammzellen, Adipozyten und Osteoblasten Als MSC´s werden die Zellen bezeichnet,

2 Material und Methoden 21

Abbildung 14: Bearbeitungsschema adipogene Differenzierungsplatten + Kontrollplatten

2.2.2.2 Methoden zum Vergleich der Multipotenz der Adipozyten

Um die Zellen färben zu können, wurden zunächst die Oil Red O – Stammlösung, - Gebrauchslösung

und die Mayers´s Hämatoxylin – Lösung hergestellt. Tabelle 6 zeigt in welchem Verhältnis und in

welchen Substanzen die verwendeten Chemikalien gelöst wurden.

Tabelle 6: Zusammensetzung der Chemikalien für Oil Red O - Färbung

Lösung Zusammensetzung Volumen

Oil Red O - Stammlösung Oil Red O – Pulver + Isopropanol 530 mg + 150 ml

Oil Red O -

Gebrauchslösung Stammlösung + Aqua bidest. 36 ml + 24 ml

Mayer´s Hämatoxylin –

Lösung Hämatoxylin + PBS 20 ml + 40 ml

Nach dem Absaugen der Differenzierungsmedien wurden die Wells zweimal mit PBS gewaschen und

die Zellen mit 4 %igen Formaldehyd für 10 min fixiert. Danach wurden die Zellen einmal mit Aqua

bidest. und einmal mit 50 %igen Ethanol gewaschen. Anschließend wurden die Zellen für 15 min mit

der Oil Red O – Gebrauchslösung angefärbt. Um überschüssige Färbelösung zu beseitigen, wurden

die Wells erneut zweimal mit 50 % Ethanol gewaschen. Im Anschluss daran erfolgte die

Gegenfärbung der Zellkerne mit Mayer´s Hämatoxylin – Lösung für 2 min bei RT. Die Wells wurden

danach vorsichtig unter Leitungswasser abgespült und unter dem Mikroskop ausgewertet. Wichtig

dabei war, dass immer etwas Wasser auf den Zellen war, damit sie nicht austrockneten.

Um nun den Farbstoff wieder herauszulösen, wurde zunächst das Wasser abgesaugt und die Wells

leicht angetrocknet. Danach wurde der Farbstoff mit 100 %igem Isopropanol für 10 min und bei

Page 30: Inhaltsverzeichnis · Seneszenz und deren Einfluss auf die Multipotenz gezogen werden. 1.1 Mesenchymale Stammzellen, Adipozyten und Osteoblasten Als MSC´s werden die Zellen bezeichnet,

2 Material und Methoden 22

300 rpm eluiert. Von dieser eluierten Lösung wurde nun 1 ml in eine Küvette pipettiert und für jedes

Well die Absorption bei 500 nm gemessen. Der 100 %ige Isopropanol diente dazu als Leerwert. Um

später die Konzentration des Oil Red O´s zu bestimmen, wurde eine Standardkurve angelegt. Diese

wurde aus 3 verschiedenen Verdünnungen (0,75; 0,1; 0,05 mM) angelegt. Anhand der

Regressionsgerade (Anhang Kapitel 6.2 Ergebnisse der adipogenen Differenzierung, Abb. 43) und der

gemessenen OD´s, konnten nun die Konzentrationen für die einzelnen Wells bestimmt werden.

Für die Quantifizierung der gemessenen OD - Werte wurden zunächst die Zellzahlen von 3 Wells pro

Patient bestimmt. Dafür wurde das Differenzierungsmedium abgesaugt und die Wells mit 500 µl

Trypsin/EDTA bei 37 °C und 5 % CO2 für 5 min inkubiert. Wenn nach dieser Zeit die Zellen noch nicht

vollständig abgelöst oder vereinzelt waren, wurde dies durch leichtes Klopfen an der Platte oder

durch einen Zellschaber erreicht. Danach wurden in die Wells jeweils 500 µl FCS pipettiert und die

Zellsuspension mehrfach resuspendiert. Anschließend wurden die Zellen mittels Neubauer-

zählkammer gezählt.

Für die Isolation der RNA wurde das RNeasy® Mini Kit von Qiagen verwendet. Dazu wurde zu dem

mitgelieferten RLT – Puffer im Verhältnis 1 : 100 ß – Merkaptoethanol hinzugegeben. Von dieser

Lösung wurde dann in jedes Well, aus dem RNA isoliert werden sollte, 150 µl hinein pipettiert.

Zusätzlich wurden die Zellen noch mit einem Zellschaber zerstört. Der Puffer wurde aus den Wells in

ein 1,5 ml Eppi überführt und bei -80 °C bis zur Weiterverarbeitung gelagert. Es wurden immer 3

Wells einer Platte miteinander gepoolt, um so eine ausreichende Menge an RNA zu erhalten.

Zur Aufreinigung der RNA wurde das bereitgestellte Protokoll des Kits genutzt (6.1 RNA -

Aufreinigung).

2.2.3 Vergleich der Multipotenz durch osteogene Differenzierung

Für die osteogene Differenzierung wurden 2 juvenile und 2 adulte Patienten verwendet. Tabelle 7

zeigt welche Patienten genutzt wurden.

Tabelle 7: verwendete Patienten für die osteogene Differenzierung

Patient Alter des

Patienten

Art der Biopsie Passage Alterung

# 12 24 Jahre Schamlippe F5 adult

# 13 10 Jahre Vorhaut F5 juvenil

# 14 5 Jahre Vorhaut F5 juvenil

# 18 40 Jahre Brust F5 adult

Page 31: Inhaltsverzeichnis · Seneszenz und deren Einfluss auf die Multipotenz gezogen werden. 1.1 Mesenchymale Stammzellen, Adipozyten und Osteoblasten Als MSC´s werden die Zellen bezeichnet,

2 Material und Methoden 23

2.2.3.1 Differenzierung zu Osteoblasten

Wie auch bei der adipogenen Differenzierung wurden bei der osteogenen Differenzierung 30 000

Zellen pro Well einer 12 Well – Platte ausgesät. Nach 2 Tagen Inkubation bei 37 °C und 5 % CO2

wurde das osteogene Medium auf die Zellen gegeben. Zu jeder Differenzierungsplatte wurde eine

Kontrollplatte mit 10% DMEM angelegt. Aller 3 – 4 Tage wurde das osteogene Medium bzw.

Kontrollmedium gewechselt und die Differenzierung erstreckte sich über einen Zeitraum von

27 Tagen. Die Inkubation der Platten erfolgte über den gesamten Differenzierungszeitraum bei 37 °C

und 5 % CO2. Nach Beendigung der Differenzierung wurden 3 Wells zur Bestimmung der ALP –

Aktivität, 1 Well für die von Kossa – Färbung, 6 Wells zur RNA – Isolierung und bei 2 Wells die

Proteinkonzentration bestimmt. Abbildung 15 zeigt noch einmal das Bearbeitungsschema der

osteogen Platten + Kontrollplatten.

Abbildung 15: Bearbeitungsschema osteogene Platten + Kontrollplatten

2.2.3.2 Methoden zum Vergleich der Multipotenz der Osteoblasten

Für die qualitative Kontrolle der Osteoblasten wurden diese durch die von Kossa – Färbung

angefärbt. Zunächst wurden die zu färbenden Wells zweimal mit PBS gewaschen und anschließend

für 10 min mit 10 % Formaldehyd fixiert. Danach wurden die Zellen einmal mit PBS und zweimal mit

Aqua bidest. gewaschen. Zum Austausch der Carbonat – und Phosphationen wurden die Wells für

30 min mit einer 5 %igen Silbernitratlösung bei Tageslicht inkubiert. Anschließend wurden die Wells

zweimal mit Aqua bidest. gewaschen. Die Reduzierung der Silberionen erfolgte durch eine 1 %ige

Pyrogallollösung für 2 – 3 min. Nach einem erneutem Waschvorgang (2 mal mit Aqua bidest.) wurden

die Zellen mit einer 5 %igen Natriumthiosulfatlösung inkubiert (2 – 3 min), um das Ergebnis der

Färbung zu fixieren. Nach einem letzten Waschschritt mit Aqua bidest. wurden die Zellkerne mit

Kernechtrot für 7 min und bei RT angefärbt. Nachdem die Wells kurz mit Aqua bidest. gespült

wurden, konnten die Zellen unter dem Mikroskop ausgewertet werden.

Page 32: Inhaltsverzeichnis · Seneszenz und deren Einfluss auf die Multipotenz gezogen werden. 1.1 Mesenchymale Stammzellen, Adipozyten und Osteoblasten Als MSC´s werden die Zellen bezeichnet,

2 Material und Methoden 24

Die Quantifizierung der Osteoblasten erfolgte durch die Bestimmung der Alkalischen Phosphatase –

Aktivität. Dazu wurde das Differenzierungsmedium abgesaugt und die Zellen einmal vorsichtig mit

PBS gewaschen. Danach wurden die Zellen mit 0,5 %igen Triton X (in PBS) abgelöst (2 ml bei 12 Well

– Platte) und in ein 15 ml Falcon überführt. Die Zellsuspension wurde mittels eines Homogenisators

lysiert und 3 Wells mit je 50 µl des Lysats in eine 96 Well – Platte als Dreifachbestimmung gegeben.

Um später die aufgenommene ALP – Konzentration zu bestimmen, wurde einmal ein Standard

verschiedener Konzentrationen mitgeführt. Dieser setzte sich aus Nitrophenol in 0,5 % Triton X in PBS

zusammen. (Konzentrationen: 0; 0,5; 0,075; 0,1; 0,5; 0,75; 1 mM). In jedes Well, das Lysat enthielt,

wurden 200 µl des Substrats (4 – NPP) gegeben. Danach wurde die Platte bei 37 °C in den Platten -

Reader gestellt. Die Absorption wurde bei 405 nm und nach 5, 10, 15, 20, 25 und 30 min gemessen.

Für die Berechnung wurden letztendlich die ALP-Werte nach 30 min Inkubation verwendet.

Um die gemessenen ALP – Werte zu quantifizieren, wurden zusätzlich aus 2 Wells pro Platte, die

Proteine isoliert und gemessen. Dazu wurde in die Wells jeweils 500 µl Trifast gegeben, die Zellen mit

Hilfe eines Zellschabers abgelöst und die Suspension in ein 2 ml - Eppi überführt. Danach wurden zu

jeder Zellsuspension 100 µl Chloroform hinzu gegeben, die Eppis für 15 sec fest geschüttelt und für

5 min bei RT inkubiert. Nach einem Zentrifugationsschritt bei 12 000 rpm, 4 °C und für 5 min waren in

dem Eppi 3 Phasen zu erkennen: untere rote Phase (Phenol – Chloroform – Phase) beinhaltet

Proteine und DNA, die mittlere – oder Interphase beinhaltet ebenfalls Proteine und DNA und die

farblose wässrige obere Phase enthält die RNA. Diese farblose Phase wurde vorsichtig entfernt und

nun konnten aus den anderen beiden Phasen die Proteine isoliert werden. Dazu wurde zunächst die

DNA aus der Phenol – Chlorofom – Phase ausgefällt. Dafür wurde zu den beiden Phasen 150 µl

100 %iger Ethanol hinzu gegeben und alles gut durchmischt. Die Lösung wurde für 3 min bei RT

inkubiert und danach bei 1800 rpm und für 15 min bei 4 °C zentrifugiert, um die DNA zu

sedimentieren. Anschließend konnte der Überstand (enthält Proteine) entfernt werden und in ein

neues Tube überführt werden.

Als nächstes wurden die Proteine ausgefällt, gewaschen und gelöst. Für das Ausfällen der Proteine

wurde die überführte Lösung mit 1 ml Isoproponal versehen und für 10 min bei RT inkubiert. Danach

erfolgte ein Zentrifugationsschritt für 10 min bei 12 000 rpm und 4 °C. Der Überstand wurde

verworfen und das Pellet in 1 ml 0,3 M Guanidinhydrochlorid (in 95 % Ethanol) gewaschen. Während

jedes Waschzykluses wurde das Pellet für 20 min bei RT gelagert und anschließend für 5 min bei

7 300 rpm und 4 °C zentrifugiert. Das Pellet wurde insgesamt zweimal gewaschen. Nach dem letzten

Waschschritt wurde das Pellet in 1 ml 100 %igen Ethanol gevortext und ebenfalls für 20 min bei RT

inkubiert und anschließend für 5 min bei 5500 rpm und bei 4 °C zentrifugiert. Zur Trocknung des

Proteinpellets wurde nach dem Zentrifugationsschritt der Überstand verworfen und das Pellet bei

50 °C und für 5 min in einer Vakuumzentrifuge getrocknet. Um das Pellet aufzulösen wurde es in 1 %

Page 33: Inhaltsverzeichnis · Seneszenz und deren Einfluss auf die Multipotenz gezogen werden. 1.1 Mesenchymale Stammzellen, Adipozyten und Osteoblasten Als MSC´s werden die Zellen bezeichnet,

2 Material und Methoden 25

SDS resuspendiert und bei 50 °C für 5 min inkubiert. Die Entfernung von unlöslichen Bestandteilen

und extrazellulären Matrixbestandteilen erfolgte durch eine letzte Zentrifugation für 10 min bei

10 000 rpm und 4 °C. Danach wurde der Überstand in ein neues Tube überführt und konnte für die

Proteinkonzentrationsbestimmung verwendet werden.

Für die Bestimmung der Proteinkonzentration wurden das BCA Protein Assay Kit von Pierce

verwendet. Es wurden immer 2 Wells einer 96 Well - Platte mit der Probe eines Patienten gefüllt.

Anschließend wurden 200 µl der Nachweisreagenz (enthält Albumin) zu den Wells pipettiert und die

Platte für 30 min bei 37 °C inkubiert. Im Anschluss daran wurde die Platte in den Platten – Reader

gestellt und die OD bei 562 nm gemessen. Wie auch bei der ALP – Bestimmung wurde hier ein

Standard (wie im Handbuch beschrieben) mitgeführt, um anschließend die Konzentration des

Proteins zu bestimmen.

Die RNA wurde wie bei der adipogenen Differenzierung aus den Wells isoliert und mit dem RNeasy

Mini Kit von Qiagen aufgereinigt und gemessen.

2.2.4 cDNA – Synthese

Für die cDNA – Synthese wurden pro Patient 0,5 µg isolierte und aufgereinigte RNA mit 0,5 µl Oligo –

dT – Primern vermischt und mit Diethylpyrocarbonat (DEPC) – Wasser auf 13,5 µl aufgefüllt. Die

Lösungen wurden kurz herunter zentrifugiert und für 5 min bei 70 °C inkubiert, um die

Sekundärstrukturen zu zerstören. Danach erfolgte die Zugabe von 11,5 µl Mastermix zu jedem

Ansatz. Tabelle 8 zeigt die Zusammensetzung des cDNA – Mastermixes.

Tabelle 8: Volumina cDNA - Synthese

Ansatz zu pipettierende Volumen

cDNA – Synthese

Mastermix

5 x First Strand Buffer

dNTP – Mix

RNase Inhibitor

M – MLV – Reverse Transkriptase

Gesamtvolumen

5 µl

5 µl

0,5 µl

1 µl

11,5 µl

Die Proben wurden vorsichtig vermischt und herunter zentrifugiert. Der Gesamtansatz von 25 µl

wurde für 1 h bei 42 °C inkubiert. Danach wurden die Proben noch einmal kurz zentrifugiert und

anschließend bei 70 °C für 10 min inkubiert. Im Anschluss daran wurden die Proben, bis zum

Nachweis durch die qRT PCR, bei -20 °C eingefroren.

Page 34: Inhaltsverzeichnis · Seneszenz und deren Einfluss auf die Multipotenz gezogen werden. 1.1 Mesenchymale Stammzellen, Adipozyten und Osteoblasten Als MSC´s werden die Zellen bezeichnet,

2 Material und Methoden 26

2.2.5 Analyse der Expression von MSC´s – spezifischen Genen

Für den Nachweis der adipogen bzw. osteogen spezifischen Genen wurden die Patienten #12, #13,

#14 und #18 verwendet. Als Nachweisgen für alle adipogenen Proben diente das PPARγ und für die

die osteogenen Proben das Osteocalcin. Alle Proben wurden als Doppelbestimmung durchgeführt.

Desweiteren wurde jede osteogene bzw. adipogene Probe auf das GAPDH untersucht und pro Gen

wurde eine Wasserprobe als Negativkontrolle angelegt.

Für die qRT PCR wurde das Quantifast SYBR Green PCR Kit von Qiagen verwendet. Zunächst wurde

der Reaktionsmix für alle Proben hergestellt. Tabelle 9 zeigt die Zusammensetzung des Mastermixes.

Als Template diente die in 2.2.3 hergestellte cDNA.

Anschließend wurden alle Proben auf die PCR – Gefäße verteilt und sorgfältig durchmischt. Die

Tabelle 10 zeigt nach welchem Programm die qRT PCR durchgeführt wurde. Nach jedem

Elongationsschritt wurde die Fluoreszenz gemessen.

Tabelle 9: Zusammensetzung Mastermix qRT PCR

Komponente Volumen/Reaktion Finale Konzentration

2x QuantiFast SYBR Green 10µl 1x

Primer fwd (10µM) 1 1µM

Primer rev (10µM) 1 1µM

cDNA 2µl 50ng/Reaktion

RNase-freies Wasser 6µl

Gesamtreaktionsvolumen 20µl

Tabelle 10: Ablauf qRT PCR

Schritt Zeit Temperatur

1. Initiale Denaturierung 5 min 95 °C

2. Denaturierung 10 s 95 °C

3. Annealing und Datenaufnahme 30 s 60 °C

4. Extension und Datenaufnahme 20 s 80 °C

Die Schritte 2 bis 4 wurden in 40 Zyklen wiederholt

Nach dem Ende der qRT PCR wurde noch eine Schmelzkurvenanalyse durchgeführt, um die Spezifität

der Proben zu bestimmen. Dabei wurde die Temperatur der Proben immer um 5 °C erhöht von 70 °C

bis auf 95 °C. Nach jeder Erhöhung wurde die Fluoreszenz gemessen.

Page 35: Inhaltsverzeichnis · Seneszenz und deren Einfluss auf die Multipotenz gezogen werden. 1.1 Mesenchymale Stammzellen, Adipozyten und Osteoblasten Als MSC´s werden die Zellen bezeichnet,

2 Material und Methoden 27

2.2.6 Flow Cytometry

Für die Messung mittels Flow Cytometry wurden die Zellen mit Trypsin abgelöst, herunter

zentrifugiert (1800 rpm, 5 min), in 3 ml FACS – Puffer wieder aufgenommen und gezählt

(Neubauerzählkammer). Es wurden 100 000 – 150 000 Zellen pro Well einer 96 - Well – Platte

ausgesät. Die Platten wurden bei 1 800 rpm, RT und für 5 min zentrifugiert. Anschließend wurde der

Überstand verworfen und die Luftblasen mittels einer Kanüle zerstört. Danach erfolgte die Zugabe

von Intraglobulin (IG) direkt in die Wells. Die Primärantikörper, welche mit einem Fluoreszenz-

farbstoff gekoppelt waren, wurden direkt nach der Zugabe des IG´s dazu pipettiert und bei 4 °C und

350 rpm für 60 min im Dunkeln inkubiert. Es wurden immer insgesamt 10 µl (IG + Primärantikörper)

in die Wells pipettiert. Im Kapitel 6.6 Ergebnisse Durchflusszytometrie des Anhangs wird in der

Tabelle 22 die Konzentration der einzelnen Primärantikörper angegeben.

Im Anschluss daran wurden die Platten zweimal gewaschen. Die Waschschritte hatten folgenden

Ablauf. Zuerst wurden 150 µl FACS – Puffer in jedes Well pipettiert, die Zellen in diesem

resuspendiert und die Platten anschließend bei 1 800 rpm, RT und für 5 min zentrifugiert. Der

Überstand wurde verworfen und die Luftblasen wieder zerstört. Nach dem zweimaligen Waschen

wurden die Zellen in 250 µl FACS – Puffer aufgenommen und in die FACS – Röhrchen überführt. Die

Messungen fanden am Interdisziplinären Zentrum für Klinische Forschung (IZKF) Leipzig in der

Abteilung für Fluoreszenz - Technologien statt. Bei der Analyse wurden immer 10 000 Zellen

gemessen.

2.2.7 Nachweis der Seneszenz

Tabelle 11 zeigt welcher Patient, welche Passage, welches Alter und die Art der Biopsie für den

Nachweis der Alterung der MSC´s genutzt wurde. Alle Zentrifugationsschritte der DNA - Isolation

wurden, wenn nicht anders angegeben, bei 4 °C durchgeführt.

Tabelle 11: verwendete Patienten für den Nachweis der Seneszenz

Patient Alter des Patienten Art der Biopsie Passage

# 12 24 Jahre Schamlippe F1

# 13 10 Jahre Vorhaut F1

# 14 5 Jahre Vorhaut F1

# 18 40 Jahre Bauch F1

Page 36: Inhaltsverzeichnis · Seneszenz und deren Einfluss auf die Multipotenz gezogen werden. 1.1 Mesenchymale Stammzellen, Adipozyten und Osteoblasten Als MSC´s werden die Zellen bezeichnet,

2 Material und Methoden 28

2.2.7.1 Analyse der Proliferationsfähigkeit

Bei der Proliferationsfähigkeit handelt es sich um das in vitro Wachstum der Zellen. Dieses sollte über

mehrere Passagen untersucht und Rückschlüsse auf Effizienz der Proliferation und somit die

Seneszenz der MSC´s gezogen werden.

Dazu wurden die Patienten in Tabelle 11 als Passage 1 (F1) ausgesät und solange kultiviert, bis die

Zellkulturflaschen (ZKF, 175 cm²) konfluent gewachsen waren. Alle Ablösungsschritte wurden mit

Trypsin/EDTA durchgeführt. Dafür wurden die jeweiligen ZKF zuerst mit PBS gespült und danach mit

5 ml (175 cm²) oder 2 ml (25 cm²) für 5 min bei 37 °C inkubiert. Die Enzymwirkung wurden mit

10 %igem DMEM abgestoppt (dreifaches Volumen an Trypsin/EDTA) und anschließend die Zellen mit

Hilfe der Neubauerzählkammer gezählt.

Für den Vergleich der Proliferationsfähigkeit wurden die konfluent gewachsenen Zellen in den

175 cm² ZKF abgelöst, gezählt und pro Patient wurden 100 000 Zellen in je eine 25 cm² ZKF gegeben

und bei 37 °C und 5 % CO2 inkubiert. Aller 3 bis 4 Tage wurden die Zellen aus den 25 cm² ZKF

abgelöst, gezählt und als neue Passage mit 100 000 Zellen ausgesät. Diese Prozedur wurde bis zur

Passage 15 durchgeführt.

2.2.7.2 Nachweis der Telomerlängen

Für den Nachweis der Telomerlängen wurde aus der Passage 1, 10, und 15 die DNA isoliert. Dazu

wurden die Zellen mittels Trypsin/EDTA abgelöst und in 500 µl Trifast gelöst. Wie auch schon bei der

Extraktion der Proteine wurde zu der Suspension 100 µl Chloroform gegeben. Nach kurzem kräftigen

Schütteln und der Inkubation für 3 – 5 min bei RT, wurde die Lösung für 5 min bei 12 000 rpm

zentrifugiert. Die entstandene obere RNA – Phase wurde entfernt und zu den anderen beiden Phasen

wurde 500 µl 100 %iger Ethanol gegeben. Alles wurde gut durchmischt und bei RT für 3 min

inkubiert. Danach erfolgte ein Zentrifugationsschritt für 15 min bei 4 500 rpm. Nachdem sich die DNA

abgesetzt hatte, konnte der Überstand entfernt und das Pellet zweimal in 1 ml 0,1 M Natriumcitrat

(in 10 % Ethanol) gewaschen werden. Bei jedem Waschschritt wurde die DNA für 30 min bei RT in

0,1 M Natriumcitrat inkubiert und anschließend für 5 min bei 4 500 rpm zentrifugiert. Danach wurde

die DNA in 1 ml 75 %igen Ethanol aufgenommen und 15 min bei Raumtemperatur inkubiert. Die

Lösung wurde wiederholt geschüttelt und anschließend für 5 min bei 4 500 rpm zentrifugiert. Der

Überstand wurde entfernt und das DNA – Pellet wurde für 5 min bei 50 °C in einer Vakuumzentrifuge

getrocknet. Im Anschluss daran wurde das Pellet in 100 µl 8 mM Natriumhydroxid (NaOH) – Lösung

Page 37: Inhaltsverzeichnis · Seneszenz und deren Einfluss auf die Multipotenz gezogen werden. 1.1 Mesenchymale Stammzellen, Adipozyten und Osteoblasten Als MSC´s werden die Zellen bezeichnet,

2 Material und Methoden 29

gelöst, für 5 min bei 50 °C inkubiert und nochmals für 10 min bei 12 000 rpm zentrifugiert. Zum

Schluss wurde der DNA – Gehalt der einzelnen Proben mittels NanoDrop bestimmt.

Durch eine Probe – PCR wurde überprüft, ob die Primer an die jeweiligen Sequenzen der isolierten

DNA binden. Dazu wurde das Programm der qRT PCR (Tabelle 13) für eine normale PCR angewendet.

Für die PCR wurde das AmpliTag Gold 360 DNA Polymerase Kit von Applied Biosystems verwendet.

Tabelle 12 zeigt die Zusammensetzung des Mastermixes und die Konzentration der einzelnen

Komponenten. Nach dem Mischen der einzelnen Komponenten wurde die PCR nach dem Programm

in Tabelle 13 durchgeführt.

Tabelle 12: Zusammensetzung Mastermix PCR Telomerlängen

Komponente Volumen bzw. Konzentration

DNA 20 ng

SYBR Green I 0,75 x

AmpliTaq Gold Puffer 10 x

MgCl2 25 mM

dNTP´s 2 mM

GC – Enhancer 0,25 x

AmpliTaq Gold Polymerase 5 U/µl

Primer (rev. und fwd.) 10 µM von jedem Primer

Tabelle 13: PCR - Programm Telomerlängen

Schritt Temperatur Zyklenzahl

1. Initiale Denaturierung 15 min bei 95 °C 1

2. Denaturierung 15 s bei 94 °C,

15 s bei 49 °C 2

3. Annealing/Extension

15 s bei 94 °C,

10 s 62 °C,

15 s bei 74 °C

32

Page 38: Inhaltsverzeichnis · Seneszenz und deren Einfluss auf die Multipotenz gezogen werden. 1.1 Mesenchymale Stammzellen, Adipozyten und Osteoblasten Als MSC´s werden die Zellen bezeichnet,

3 Ergebnisse und Auswertung 30

3 Ergebnisse und Auswertung

3.1 Adipogene Differenzierung

Eine positive Differenzierung zu Adipozyten wurde bei jedem einzelnen Patienten erreicht. Die Bilder

(Abb. 31 – 42) der Differenzierungen befinden sich im Anhang (6.2 Bilder Oil Red O – Färbung). Man

erkennt, dass keine relevanten Unterschiede zwischen den einzelnen Patienten aufgetreten sind.

Qualitativ gesehen haben sich die Proben in etwa gleich differenziert.

Für die quantitative Auswertung der Daten wurden jeweils die Daten der OD – Messung jedes Wells

auf die gezählte Zellzahl des gleichen Wells bezogen. Für jede Differenzierungsplatte wurden die

Werte der 3 Wells zusammengefasst, zwischen juvenil und adult unterschieden und die Ergebnisse

anschließend graphisch dargestellt (Abb. 16).

Abbildung 16: Vergleich juvenil - adult (adipogen)

Dabei ist zu erkennen, dass mit zunehmendem Alter der Patienten die Menge an aufgenommenen

Oil Red O stark abnimmt. Dies ist auf die geringere Proliferationseffizienz der adulten Zellen bzw. auf

die Effizienz der Multipotenz zurückzuführen. Durch das RS wird im Allgemeinen eine schnelle

Induktion der Adipozytenbildungen hervorgerufen, jedoch erfolgt bei den adulten Zellen eine sehr

langsame Bildung dieser Fettzellen. Die Messungen der OD ergaben desweiteren, dass bei den

juvenilen MSC´s viel mehr Farbstoff eingelagert wurde und somit auch die Bildung der Adipozyten

viel effizienter und ergiebiger ausfällt. Daraus lässt sich schließen, dass die Multipotenz, speziell die

0

0,005

0,01

0,015

0,02

0,025

0,03

0,035

0,04

RS juvenil Kontrolle juvenil RS adult Kontrolle adult

c(O

RO

) /

Ze

llza

hl

in m

M

Differenzierung

Vergleich juvenil - adult

Page 39: Inhaltsverzeichnis · Seneszenz und deren Einfluss auf die Multipotenz gezogen werden. 1.1 Mesenchymale Stammzellen, Adipozyten und Osteoblasten Als MSC´s werden die Zellen bezeichnet,

3 Ergebnisse und Auswertung 31

Bildung der Fettzellen, im Alter wahrscheinlich nachlässt. Durch Alterungsprozesse der Zellen nimmt

die Fähigkeit der Multipotenz stetig ab, da die Zellen zunehmend ihre Vitalität verlieren.

Einzige Abweichung lieferten die Ergebnisse der beiden Kontrollansätze. Zu erwarten wäre gewesen,

dass beide Kontrollansätze annähernd gleiche Werte zeigen, da bei der OD – Messung nur das wieder

eluierte Oil Red O gemessen wird und beide Ansätze keine Adipozyten bilden. Jedoch können bei der

Färbung einige Farbreste unspezifisch an den Zellen gebunden haben oder wurden nicht richtig

ausgewaschen. Da nun die juvenilen Proben schneller proliferieren und somit mehr Zellen als bei den

adulten Proben vorhanden sind, kann auch mehr Farbstoff unspezifisch binden. Daraus folgt, dass bei

der OD – Messung auch ein höherer Wert bei den juvenilen Proben als bei den adulten Proben

gemessen wurde.

Ein weiterer Nachteil dieser Methode ist die Subjektivität des Zählens. Durch das Trypanblau werden

lebende Zellen hellblau und tote dunkelblau gefärbt. Jedoch erscheinen manche Zellen als Mischung

aus beiden. Diese werden dann manchmal als lebend oder tot mitgezählt. Bezogen auf die OD

können da beträchtliche Unterschiede entstehen.

3.2 Osteogene Differenzierung

Alle Differenzierungen zu den Osteoblasten sind positiv verlaufen. Die Abbildungen 44 – 51 im

Kapitel 6.3 Bilder von Kossa - Färbung des Anhangs zeigen die mikroskopischen Aufnahmen der

gefärbten Wells. Diese erlauben eine qualitative Auswertung der Färbungen. Zu sehen ist, dass

deutliche Unterschiede jeweils zwischen den juvenilen und adulten Zellen aufgetreten sind. Patient

#13 zeigt eine deutlich geringere Bildung von Osteoblasten als Patient #14. Qualitativ gesehen ist

auch Patient #12 effektiver gewesen als #13. Wie auch schon bei den adipogenen Differenzierungen

zeigt Patient #18 die geringste Effektivität.

Um die gemessen ALP – und Proteindaten quantitativ zu erfassen, wurden die ALP – Werte durch die

jeweiligen Proteinkonzentrations – Werte geteilt. Somit konnte die Aktivität des Enzym (ALP)

bestimmt werden. Die Ergebnisse dieser Aktivität wurde in Abbildung 17 graphisch dargestellt. Alle

für die Auswertung verwendeten Werte sind im Kapitel 6.4 Ergebnisse osteogene Differenzierung

dargestellt.

Page 40: Inhaltsverzeichnis · Seneszenz und deren Einfluss auf die Multipotenz gezogen werden. 1.1 Mesenchymale Stammzellen, Adipozyten und Osteoblasten Als MSC´s werden die Zellen bezeichnet,

3 Ergebnisse und Auswertung 32

Abbildung 17: Vergleich juvenil - adult (osteogen)

Wie in Abbildung 17 zu erkennen ist, ist die Aktivität des Enzyms ALP bei den juvenilen Proben höher

als bei den adulten Proben. Jedoch ist der Unterschied nicht so deutlich wie bei den adipogenen

Differenzierungen. Da Patient #14 mehr als viermal so viel Substrat umgesetzt hat wie Patient #13, ist

nach dem Zusammenfassen der Werte der Wert der juvenilen Proben niedriger. Dies könnte zum

einen an einer schlechten Homogenisierung der Knochenhäutchen liegen oder zum anderen, dass bei

Patient #13 in seinem Alter weniger ALP produziert wird. Jedoch kann der erste Punkt

ausgeschlossen werden, da die qualitative Auswertung (Abb. 46) auch eine geringe Färbung aufweist.

Das weist generell auf eine geringere Aktivität der ALP hin.

Zusammenfassend ist zu sagen, dass die juvenilen Proben mehr Substrat umgesetzt haben als die

adulten Proben. Dies könnte wahrscheinlich am Alter der Patienten liegen. Da im Alter von 5 bzw. 10

Jahren die Knochen der Kinder noch wachsen, wird bei Ihnen wahrscheinlich die Aktivität der ALP

höher sein. Jedoch unterscheiden sich die Werte des Patienten #12 (24 Jahre) und #14 (5 Jahre) nicht

sehr von einander (Tabelle 19, Kapitel 6.4). Dies könnte auf eine Verschleppung der ALP während der

Homogenisierung zurückzuführen sein. Nach jedem Homogenisierungsvorgang wurden die

Homogenisierungswerkzeuge mit Wasser und Ethanol gereinigt. Jedoch könnten Reste der ALP noch

vorhanden gewesen sein und auf den Patienten #12 übertragen worden sein.

Da die Kontrollproben kein ALP enthalten, sind diese auch negativ.

-0,2

-0,1

0

0,1

0,2

0,3

0,4

juvenil juvenil Kontrolle adult adult kontrolle

c(A

LP)/

c(P

rote

in)

in m

mo

l/g

Patient

Vergleich juvenil - adult

Page 41: Inhaltsverzeichnis · Seneszenz und deren Einfluss auf die Multipotenz gezogen werden. 1.1 Mesenchymale Stammzellen, Adipozyten und Osteoblasten Als MSC´s werden die Zellen bezeichnet,

3 Ergebnisse und Auswertung 33

3.3 Durchflusszytometrie

Die Färbung der Oberflächenantigene erbrachte die erwarteten Ergebnisse der positiven (CD29,

CD73, CD90, CD105, CD166) und negativen Färbungen (CD31, CD34, CD45). Die Werte der einzelnen

Ergebnisse sind im Kapitel 6.5 Durchflusszytometrie des Anhangs dargestellt.

Tabelle 14 zeigt den prozentualen Anteil der gefärbten CD´s der einzelnen Zellen und die dazu

gehörigen Standardabweichungen (in Prozent).

Tabelle 14: Anteil der gefärbten Zellen + Standardabweichung in Prozent

CD juvenil adult

CD29 (pos.) 98,2 ± 1,9924 97,5 ± 1,9052

CD31 (neg.) 0,0333 ± 0,2309 0,2333 ± 0,20816

CD34 (neg.) 0,1333 ± 0,3214 0,5667 ± 1,1590

CD45 (neg.) 0,0667 ± 0,1154 0,0333 ± 0,2081

CD73 (pos.) 99,2667 ± 0,1527 97,8667 ± 1,4742

CD90 (pos.) 97,9333 ± 0,3214 91,6333 ± 1,8009

CD105 (pos.) 95,9667 ± 2,4006 97,1 ± 1,2767

CD166 (pos.) 99,4667 ± 0,2516 97,5333 ± 2,0599

Zu erkennen ist, dass die Ergebnisse der Färbungen der juvenilen Zellen ein besseres Ergebnis

lieferten als die adulten Zellen. Jedoch sind die Unterschiede sehr gering. Ursache dafür könnte das

Alter der juvenilen Proben sein und somit die Antikörper besser an die CD´s der juvenilen Proben

binden konnten.

Im Vergleich zu den anderen Methoden ist diese Methode weniger aussagekräftig und geeignet für

den Vergleich der Multipotenz. Da diese Methode auf dem Antigen – Antikörper – Bindungs – Prinzip

beruht und jede MSC´ s, ungeachtet deren Alters, solche Oberflächenantigene ausbildet, ist ein

Vergleich zwischen jung und alt kaum möglich. Da nachdem der Sekundärantikörper gebunden hat,

die Zellen im gleichem Maße fluoreszieren und von den Messgeräten auch nur als fluoreszierende

Zelle erfasst werden, können Unterschiede kaum erfasst werden. Die Oberflächenantigene bleiben

bis zum Zelltod erhalten und sind, wie bei den juvenilen, auch bei den adulten Zellen vorhanden.

Page 42: Inhaltsverzeichnis · Seneszenz und deren Einfluss auf die Multipotenz gezogen werden. 1.1 Mesenchymale Stammzellen, Adipozyten und Osteoblasten Als MSC´s werden die Zellen bezeichnet,

3 Ergebnisse und Auswertung 34

3.4 Quantitative realtime PCR

Die qRT PCR lieferte nur Ergebnisse der osteogen Proben #13, #14 und #18 und aller GAPDH –

Proben. Alle adipogenen Ansätze bzw. der osteogene Ansatz des Patienten #12 lieferten keine

relevanten Ergebnisse. Der Grund für die negativen Ergebnisse der adipogenen Ansätze liegt

vermutlich in der nicht gebildeten PPARγ – mRNA oder an den PPARγ - Primern. Durch das RS wird

relativ schnell eine Induktion der Adipozyten hervorgerufen. Es könnte sein, dass die Bildung der

Fettvakuolen innerhalb der 8 Tage erfolgte, jedoch die Zellen nicht die endgültigen Charakteristika

eines Adipozyten ausgebildet haben. Für das fehlende Ergebnis des osteogenen Patienten #12 ist

vermutlich eine zu geringe Menge an Ausgangs – DNA verantwortlich, da die restlichen Bedingungen

bei den anderen osteogenen Proben die gleichen waren.

Bei der Quantifizierung durch die qRT PCR handelt es sich genauer um eine relative Quantifizierung,

da die Werte der PCR mit denen des Housekeeping – Gens normalisiert werden. Dies erbringt

mehrere Vorteile (z.B. eine Verringerung der Varianz der Expressionsergebnisse), da das GAPDH in

jeder Zelle homogen exprimiert wird. [41]

Für die Berechnung der Werte wurde die ∆CT – Methode eingesetzt. Der CT – Wert gibt an, bei

welcher Zyklenzahl die Hälfte der maximal erreichten Fluoreszenz eintritt. Für die Berechnung

werden die Mittelwerte (MW) CT – Werte der Kontrollgene (GAPDH) von den Mittelwerten der

Zielgene (Osteocalcin) abgezogen und somit normalisiert. [41] Tabelle 15 zeigt die CT – Werte der

einzelnen Patienten und zusammengefasst die ∆CT – Werte für die juvenilen und adulten Proben. Da

leider nur die osteogenen Ansätze ein Ergebnis erbrachten, kann ein Vergleich zwischen juvenil und

adult auch nur auf die osteogene Differenzierung gezogen werden.

Tabelle 15: Ergebnisse qRT PCR

Patient CT – Wert (MW) GAPDH – Wert (MW) ∆CT - Wert

#12 Ost. kein Ergebnis 28,525 kein Ergebnis

#13 Ost. 25,84 22,135 3,705

#14 Ost. 21,945 20,295 1,65

#18 Ost. 31,43 27,795 3,635

juvenil osteogen adult osteogen

∆CT - Wert 2,6775 3,635

Page 43: Inhaltsverzeichnis · Seneszenz und deren Einfluss auf die Multipotenz gezogen werden. 1.1 Mesenchymale Stammzellen, Adipozyten und Osteoblasten Als MSC´s werden die Zellen bezeichnet,

3 Ergebnisse und Auswertung 35

Abbildung 18 zeigt die Zyklusanalyse der gesamten Ansätze. Dabei wurde die Zyklenzahl gegenüber

der Fluoreszenz aufgetragen. Je weiter vorne eine Kurve ist, desto schneller wurde ein Produkt

gebildet und umso mehr Target – DNA war vorhanden. Leider ist die Abbildung sehr unübersichtlich,

da zu wenig Zeit zur Verfügung stand, um die Proben einzeln nach adipogen oder osteogen und

deren Kontrollgenen zu analysieren und darzustellen.

Abbildung 18: Schmelzkurvenanalyse aller Ansätze

Zu erkennen ist, dass die CT – Werte der juvenilen Proben kleiner sind als die der adulten (Tabelle

15). Dies weist auf eine schnellere Bildung des Produkts hin. Daraus lässt sich schließen, dass die

juvenilen Proben effektiver waren als die adulten. Grund dafür könnte wahrscheinlich das Alter der

Patienten sein. Da diese aufgrund ihres jungen Alters vitaler sind, konnten vermutlich mehr

Osteocalcin – Gene gebildet werden.

Eine qRT PCR ist eine sehr sensible Methode, bei der vorher viele Optimierungsversuche gemacht

werden müssen. Zum Einen könnte man über eine Gradienten – PCR die Spezifität der Primer

überprüfen. Die Primer für das Osteocalcin und PPARγ besitzen unterschiedliche Annealing-

temperaturen, jedoch wurde bei der qRT – PCR nach dem Fast – Protokoll (QuantiFast von Qiagen)

nur eine Annealingtemperatur bei 60°C verwendet, um die PCR mit dem gleichen Programm laufen

lassen zu können. Zum Anderen könnte man über eine Verdünnungsreihe der cDNA, die Spezifität

der Produkte erhöhen und die Effizienz der Primer bestimmen und damit weitere quantitaive

Berechnungen durchführen.

Da die Zeit für diese Tests nicht mehr ausreichte, wurde in dieser Arbeit nur eine einzige qRT PCR

durchgeführt.

Page 44: Inhaltsverzeichnis · Seneszenz und deren Einfluss auf die Multipotenz gezogen werden. 1.1 Mesenchymale Stammzellen, Adipozyten und Osteoblasten Als MSC´s werden die Zellen bezeichnet,

3 Ergebnisse und Auswertung 36

3.5 Seneszenz

Alle hier gezeigten Diagramme beziehen sich auf die Ergebnisse, die im Kapitel 6.6 Ergebnisse der

Zellzählung (Passagierung) des Anhangs aufgelistet sind.

3.5.1 Passagierung

Nach achttägiger Kultivierung konnten die Zellen das erste Mal subkultiviert werden. Zu diesem

Zeitpunkt waren ausreichend Zellen vorhanden, um diese weiter zu passagieren und die DNA zu

isolieren.

Zwischen den Primärkulturen der einzelnen Patienten konnte bereits mikroskopisch ein teilweise

deutlicher Unterschied in der Zelldichte zwischen der 10. und 15. Passage festgestellt werden. Die

Abbildungen 19 - 26 zeigen deutlich, dass in der 10. Passage mehr Zellen als in der 15. Passage

vorhanden sind (jeweils am 3. Tag der Kultivierung). Eine Ausnahme bildet hier der Patient #18.

Zwischen den beiden Passagen sind keine großen Unterschiede in der Zelldichte zu erkennen.

Abbildung 19: F10 #12 Tag 3

Abbildung 20: F15 #12 Tag 3

Abbildung 21: F10 #13 Tag 3

Abbildung 22: F15 #13 Tag 3

Page 45: Inhaltsverzeichnis · Seneszenz und deren Einfluss auf die Multipotenz gezogen werden. 1.1 Mesenchymale Stammzellen, Adipozyten und Osteoblasten Als MSC´s werden die Zellen bezeichnet,

3 Ergebnisse und Auswertung 37

Abbildung 23: F10 #14 Tag 3

Abbildung 24: F15 #14 Tag 3

Abbildung 25: F10 #18 Tag 3

Abbildung 26: F15 #18 Tag 3

Wie schon angesprochen verkürzen sich mit jeder Zellteilung die Telomere, was die Zellen altern

lässt. Dadurch nimmt mit zunehmender Passage die Proliferation (Zellwachstum) ab und die Zellen

sind nicht mehr so vital, wie am Anfang der Kultivierung. Auch durch den „Stress“ der Passagierung

(Ablösen, Zählen und Aussäen) werden die Zellen beeinflusst, was wiederum Auswirkung auf das

Wachstum der Zellen hat. Die juvenilen Patienten (#13 und #14) weisen in Passage 10 eine noch

höhere Zelldichte auf als Patient #12 oder #18 (adult). Dies ist wahrscheinlich auf das Alter der

Patienten und auf die längeren Telomere zurückzuführen. Jede Zelle besitzt einen programmierten

Zelltod (Apoptose), der nach einer bestimmten Verkürzung der Telomere eintritt. Da die juvenilen

Patienten noch längere Telomere besitzen, ist das Zellwachstum hier auch noch höher als bspw. bei

Patient #18.

Auch zwischen den adulten Proben können Unterschiede in der Zelldichte festgestellt werden.

Patient #12 ist mit seinen 24 Jahren 16 Jahre jünger als Patient #18. Aus diesem Grund sind die

Telomere vermutlich noch nicht so verkürzt und die Zellen sind in ihrer Proliferation noch durchaus

effektiver und vitaler.

Da mikroskopische Aussagen aber sehr ungenau und subjektiv sind, wurde nach jeder Passage die

Generationszeit, Vitalität und der Anteil der lebenden bzw. toten Zellen erfasst. In den Abbildungen

27 – 29 werden genau diese Kriterien zusammengefasst und verglichen.

Page 46: Inhaltsverzeichnis · Seneszenz und deren Einfluss auf die Multipotenz gezogen werden. 1.1 Mesenchymale Stammzellen, Adipozyten und Osteoblasten Als MSC´s werden die Zellen bezeichnet,

3 Ergebnisse und Auswertung 38

Abbildung 27: Vergleich Lebend - Tod

In Abb. 27 ist der Vergleich der Durchschnittswerte der lebenden und toten Zellen zu sehen. Es ist zu

erkennen, dass mit zunehmendem Alter auch die Zahl der lebenden Zellen abnimmt. Durch die

Verkürzung der Telomerlängen bei jeder Zellteilung wird auch die Proliferation beeinflusst.

Abbildung 28: Durchschnitt Vitalität

Die Vitalität der Patienten (Abb. 28) nimmt mit zunehmendem Alter auch ab. Dies ist wahrscheinlich

auf die höhere Apoptoserate der adulten Zellen zurückzuführen. Je höher das Alter, desto kürzer die

Telomere und desto mehr Zellen sterben ab. Da die Zellen auch in einer geringeren Intensität

wachsen und mehr Zellen absterben, ist die Vitalität bezogen auf die Gesamtzellzahl geringer als bei

den juvenilen Proben.

0

100000

200000

300000

400000

500000

600000

#14 (5 Jahre) #13 (10 Jahre) #12 (24 Jahre) #18 (40 Jahre)

Ze

llza

hl

Patient

Vergleich Lebend - Tod

Tod

Lebend

82

84

86

88

90

92

94

96

#14 (5 Jahre) #13 (10 Jahre) #12 (24 Jahre) #18 (40 Jahre)

Vit

ali

tät

in %

Patient

Vitalität

Page 47: Inhaltsverzeichnis · Seneszenz und deren Einfluss auf die Multipotenz gezogen werden. 1.1 Mesenchymale Stammzellen, Adipozyten und Osteoblasten Als MSC´s werden die Zellen bezeichnet,

3 Ergebnisse und Auswertung 39

Abbildung 29: Durchschnitt Generationszeiten

Abbildung 29 zeigt die Durchschnittswerte der Generationszeiten. Zu sehen ist, dass mit

zunehmendem Alter auch die Generationszeit zunimmt. Somit braucht Patient #18 mehr als doppelt

so lange wie Patient #14, um eine Verdopplung der Zellzahl zu erreichen. Vermutlich liegt auch hier

der Grund in der Vitalität der Zellen, die wiederum auf die Verkürzung der Telomere zurück zu führen

ist. Je kürzer die Telomere sind, desto langsamer wachsen die Zellen und sie brauchen viel länger um

die doppelte Zellzahl zu erreichen.

3.5.2 Nachweis der Telomerlängen

Der Nachweis der Seneszenz über die Telomerlängen verlief leider negativ. Eine durchgeführte Test –

PCR (normale PCR), die den Bedingungen des verwendeten Kits entsprach, erbrachte kein positives

Ergebnis. Verwendet wurden die Patienten #13 (5 Jahre) und #18 (40 Jahre). Aufgrund der großen

Altersdifferenz zwischen den beiden, wurde diese ausgewählt, um einen ersichtlichen Unterschied

zwischen den PCR – Produkten zu bekommen. Da sich die Telomere pro Zellteilung um 50 – 100 bp

verkürzen, hätte diese Altersdifferenz ausgereicht, um genaue Aussagen über die Effektivität dieser

Methode zu machen.

Anstelle der spezifischen Amplifikate bildeten sich nur Primerdimere (Abb. 30). Gründe dafür

könnten sein, das die gewählten Primer oder PCR – Merkmale nicht passend für die Proben waren, zu

wenig Ausgangsmaterial für die Primer bzw. Polymerase vorhanden waren oder die

Homogenisierung der Proben nicht effektiv genug war.

Ein weiterer Grund könnte der hohe Guanin/Cytosin (GC) – Gehalt der Primer darstellen. Dies hat

vermutlich zu einer Selbsthybridisierung der Primer geführt, was der mitgelieferte GC – Enhancer

0

1

2

3

4

5

6

#14 (5 Jahre) #13 (10 Jahre) #12 (24 Jahre) #18 (40 Jahre)

Ge

ne

rati

on

sze

it i

n d

Patient

Generationszeiten

Page 48: Inhaltsverzeichnis · Seneszenz und deren Einfluss auf die Multipotenz gezogen werden. 1.1 Mesenchymale Stammzellen, Adipozyten und Osteoblasten Als MSC´s werden die Zellen bezeichnet,

3 Ergebnisse und Auswertung 40

auch nicht ausgleichen konnte. In weiterführenden Tests könnte man die Konzentration des GC-

Enhancers erhöhen und optimieren, so dass das Problem der Primerselbsthybridisierung beseitigt

werden kann.

Zum Anderen kann man noch die einzelnen Abschnitte der Zyklen verändern, d.h. die Temperaturen

und Zeitintervalle für Denaturierung, Annealing, Elongation und weiterhin die Gesamtzyklenzahl

können variiert werden. Dabei ist darauf zu achten, dass nicht zu viele Zyklen gewählt werden, da es

sonst zum Verlust des PCR – Produktes kommen kann (Depurinierung).

Desweiteren könnte das TriFast – Protokoll für die Isolierung der DNA ungeeignet sein, da bei den

Isolationen nur sehr geringe und unreine DNA-Konzentrationen (z.B. Phenolverunreinigungen)

erreicht wurden. Besser wäre es, spezielle Kits zur DNA-Isolation zu verwenden, die ohne Phenol

funktionieren. Die humane DNA – Isolierung ist eine sehr sensible Methode, die viel Erfahrung,

Übung und genaue Schritte der Aufreinigung voraussetzt. Es benötigt viel Zeit diese Methode zu

perfektionieren, jedoch war die Zeit für diese Arbeit nicht ausreichend.

Abbildung 30: Primerdimer

Page 49: Inhaltsverzeichnis · Seneszenz und deren Einfluss auf die Multipotenz gezogen werden. 1.1 Mesenchymale Stammzellen, Adipozyten und Osteoblasten Als MSC´s werden die Zellen bezeichnet,

4 Zusammenfassung und Ausblick 41

4 Zusammenfassung und Ausblick

Zusammenfassend ist zu sagen, dass der Nachweis der Multipotenz von humanen dermalen

Fibroblasten zur vollsten Zufriedenheit erreicht wurde und somit gezeigt werden konnte, dass die

isolierten Fibroblasten sich wie MSC’s verhalten. Alle Multipotenznachweise über die

Differenzierungsvorgänge (adipogen und osteogen) erbrachten die Ergebnisse, dass die juvenilen

Proben effektiver bzw. besser differenzierten als die adulten Proben. Lediglich der Nachweis der

Oberflächenantigene mittels Durchflusszytometrie zeigte keine Unterschiede im Expressionsprofil

der juvenilen bzw. adulten MSC’s.

Dies lässt eine Verallgemeinerung zu, dass die juvenilen MSC´s ein größeres Multipotenzpotential

besitzen als adulte MSC´s. Um signifikante Daten bei allen Tests zu erhalten, wird empfohlen die

Patientenanzahl für die adipogene und osteogene Differenzierung zu vergrößern.

Um bessere Ergebnisse durch eine qRT PCR zu erhalten, wären die angesprochenen Tests von großer

Wichtigkeit. Es muss sichergestellt werden, dass die Primer spezifisch binden, denn erst so lassen sich

eindeutige Schlüsse aus den Ergebnissen ziehen. Auch der Nachweis der Telomerlängen durch eine

qRT PCR sollte durch erneute Tests etabliert werden können. Jedoch sollte das Augenmerk zunächst

auf die korrekte Isolierung der DNA aus den Zellen geworfen werden. Danach könnten die einzelnen

Komponenten des Mastermixes bzw. die Schritte des PCR – Programmes perfektioniert werden. Erst

dann können auch hier publizierbare Aussagen über die Alterung der MSC´s gezogen werden.

In den nächsten Jahren wird die Forschung an Stammzellen, die aus der Haut isoliert wurden,

deutlich zu nehmen. Zum einen ist die gute Zugänglichkeit der Hautbiopsien ein Grund für die

Forschung an dermalen MSC´s. [42] Zum anderen könnten womöglich Untersuchungen gemacht

werden, die belegen, dass Stammzellen aus der Haut nicht nur multipotent sondern auch pluripotent

sind. Das heißt, dass aus diesen Zellen sich alle Zellen des humanen Mesenchyms bilden könnten,

was ein erheblicher Fortschritt im Bereich des Tissue Engineering wäre.

Page 50: Inhaltsverzeichnis · Seneszenz und deren Einfluss auf die Multipotenz gezogen werden. 1.1 Mesenchymale Stammzellen, Adipozyten und Osteoblasten Als MSC´s werden die Zellen bezeichnet,

5 Quellen 42

5 Quellen [1] Pittenger, M. F.; Mackay, A. M.; Beck, S. C.; et al.: multilineage potential of adult human

mesenchymal. In: Stem Cells Science - 284 (1999) – S. 143 – 147

[2] Kern, S.; Eichler, H.; Stoeve, J.; et al.: Comparative Analysis of Mesenchymal Stem Cells from Bone

Marrow, Umbilical Cord Blood, or Adipose Tissue. In: Stem Cells – 24 (2006) – S. 1294 – 1301

[3] Sadler, T. W.: Medizinische Embryologie. Thieme, Baltimore USA, 2003

[4] Mediatech: Insulin-Transferrin-Selenium (ITS). URL: <www.cellgro.com>, verfügbar am 05.05.2011

[5] Ringe, J.: Differenzierungs- und Migrationspotential mesenchymaler Stamm- und Progenitorzellen

für das in situ Tissue Engineering. Dissertation, Technische Universität Berlin, 2006

[6] Austrup, B.: Nachweis von Telomeraseaktivität und Telomerlängen in humanen mesenchymalen

Stammzellen. Dissertation, Ludwig – Maximilians Universität München, 2006

[7] Prawitt, J.: Entwicklung eines Adipozytenmodells aus einer humanen mesenchymalen

Stammzelllinie und dessen molekulare und funktionale Charakterisierung. Dissertation, Universität

Hamburg, 2006

[8] Holtz, K.: Expansion von humanen, mesenchymalen Stammzellen in autologem Serum unter

besonderer Berücksichtigung der osteogenen Differenzierung. Dissertation, Universität Hamburg,

2005

[9] Freyschmidt, J.: Skeletterkrankungen: Klinisch-radiologische Diagnose und Differentialdiagnose.

Springer, Berlin, 2008

[10] Lang, Gudrun: Praxislehrbuch für die biomedizinische Analytik. Springer, Wien, 2006

[11] Verfasser unbekannt: Alkalische Phosphatase. URL: <http://www.chemie-schule.de/KnowHow/

Alkalische_Phosphatase>, verfügbar am 09.06.2011

[12] Neumeister, B.; Besenthal, I.; Liebich, H., et al.: Klinikleitfaden Labordiagnostik, Urban&Fischer,

München 2003, ISBN 3-437-22231-7

[13] Verfasser unbekannt: Enzyme. URL: <http://online-media.uni-marburg.de/physiolchem/prakt

ikum/Enzyme.pdf>, verfügbar am 09.06.2011

[14] Verfasser unbekannt: Zellkulturmethoden. URL: <http://miami.uni-muenster.de/servlets/

DerivateServlet/Derivate-1550/11_Methoden.pdf>, verfügbar am 09.06.2011

[15] Müller, S.; Harms, H.; Bley, T.: origin and analysis of microbial population heterogeneity in

bioprocesses. In: Current Opinion in Biotechnology – 21 (2010) – S. 100 – 113

[16] Wiacek, C: Cytomics: Strategien von Cupriavidus necator JMP134 beim Umgang mit dem

toxischen Substrat Phenol. Dissertation, Martin-Luther-Universität Halle-Wittenberg, 2007

Page 51: Inhaltsverzeichnis · Seneszenz und deren Einfluss auf die Multipotenz gezogen werden. 1.1 Mesenchymale Stammzellen, Adipozyten und Osteoblasten Als MSC´s werden die Zellen bezeichnet,

5 Quellen 43

[17] Müller, S.; Nebe von Caron, G.: functional single – cell analyses: flow cytometry and cell sorting

of microbial populations and communities. In: FEMS Microbiology Reviews – 34 (2010) – S. 554 – 587

[18] Diaz, M.; Herrero, M.; Garcia, L. A., et al.: Application of flow cytometry to industrial microbial

bioprocesses. In: Biochemical Engineering Journal – 48 (2010) – S. 385 – 407

[19] Shapiro, H. M.: Practical Flow Cytometry. Wiley, Hoboken, New Jersey, 2003, 4. Auflage

[20] Invitrogen: Fluorescenc Tutorials. URL: <http://probes.invitrogen.com/resources/education/

tutorials/4Intro_Flow/player.html>, verfügbar am 25.07.2011

[21] Brehm - Stecher, B. F.; Johnson, E. A.: Single - Cell Microbiology: Tools, Technologies, and

Applications. In: Microbiology and Molecular Biology Reviews – 68 (2004) – S. 538 – 559

[22] Leske, Katharina: Charakterisierung von humanen mesenchymalen Stammzellen durch

immunzytochemische Vierfachfärbung. Dissertation, Ludwig – Maximilians Universität München,

2007

[23] Griesinger, A.: Untersuchungen zur Aktivität Natürlicher Killerzellen gegenüber Zytomegalievirus

infizierten Targetzellen: Zytotoxizität in Hinblick auf die Expression von Oberflächenmolekülen.

Dissertation, Eberhard Karls Universität Tübingen, 2009

[24] Ghodsizad, A.; Voelkel, T.; Moebius, J. M.; et al.: Biological Similarities Between Mesenchymal

Stem Cells (Mscs) and Fibroblasts. In: Journal of Cytology & Histology Accepted – 18 (2010) – S. 3 – 7

[25] Kern, S.; Eichler, H.; Stoeve, J.; et al.: Comparative Analysis of Mesenchymal Stem Cells from

Bone Marrow, Umbilical Cord Blood, or Adipose Tissue. In: Stem Cells – 24 (2006) – S. 1294 – 1301

[26] Griesinger, A.: Untersuchungen zur Aktivität Natürlicher Killerzellen gegenüber Zytomegalievirus

- infizierten Targetzellen: Zytotoxizität in Hinblick auf die Expression von Oberflächenmolekülen.

Dissertation, Eberhard Karls Universität Tübingen, 2009

[27] Biorad: Biotechnology ExplorerTM Chromosom 16: PV92 PCR Informatics Kit. URL:

<http://www.bio-rad.com/webroot/web/pdf/lsr/literature/4110052DE.pdf>, verfügbar am

25.07.2011

[28] Calles, C.: Untersuchungen zum Einfluss von Infrarot-A Strahlung auf die Genexpression in

humanen dermalen Fibroblasten. Dissertation, Heinrich Heine Universität Düsseldorf, 2009

[29] Thannhäuser, M.: Promotorhypermethylierung und Expression des DNA – Reparaturgens MGMT

in oligodendroglialen Tumoren. Dissertation, Heinrich Heine Universität Düsseldorf, 2005

[30] Baumann, H.: Vergleich der Nachweisverfahren von Candida – DNA mittels PCR – ELISA, einer

gattungsspezifischen Candida – Sonde im LightCycler™, Gelelektrophorese, Sequenzierung und der

Mikrobiologischen Untersuchung bei intensivmedizinisch betreuten Patienten. Dissertation, Eberhard

Karls Universität Tübingen, 2005

Page 52: Inhaltsverzeichnis · Seneszenz und deren Einfluss auf die Multipotenz gezogen werden. 1.1 Mesenchymale Stammzellen, Adipozyten und Osteoblasten Als MSC´s werden die Zellen bezeichnet,

5 Quellen 44

[31] Croy, R.: Molecular Genetics II - Genetic Engineering Course. URL:

<http://dwb4.unl.edu/Chem/CHEM869N/CHEM869NLinks/www.dur.ac.uk/~dbl0www/Staff/Croy/cD

NAfigs.htm>, verfügbar am 03.07.2011

[32] Ilmer, M.: Osteoblasten-induzierte frühe Osteogenese in humanen mesenchymalen

Stammzellen durch Aktivierung des Wnt-Signalweges. Dissertation, Ludwig – Maximilians Universität

München, 2009

[33] Qiagen: FastLane Cell cDNA Handbook. URL: <http://www.qiagen.com/selectlocation.aspx?re

direct=%2fliterature%2frender.aspx%3fid%3d280>, verfügbar am 03.07.2011

[34] Müller, S.: Genexpressionsanalyse von humanen Gehirntumoren mittels cDNA Array Analyse.

Dissertation, Universität Hamburg, 2005

[35] Kirkland, J.: The biochemistry of mammalian senescence. In: Clin Biochem. - 25 (1992) - S. 61-75

[36] Schieker, M.; Gülkan, H.; Austrup, B. et al.: Telomeraseaktivität und Telomerlänge humaner

mesenchymaler Stammzellen. In: Der Orthopäde - 33 (1999) - S. 1373 – 1377

[37] Streit, S.: Die Untersuchung der replikativen Seneszenz kaniner dermaler Fibroblasten als Beitrag

zur Alternsforschung. Dissertation, Universität Leipzig, 2006

[38] Levy, M.; Allsopp, R.; Futcher, A. et al.: Telomere end-replication problem and cell aging. In: J

Mol Biol - 225 (1992) - S. 951-960

[39] Allsopp, R.; Vaziri, H.; Patterson, C. et al.: Telomere length predicts replicative capacity of human

fibroblasts. In: Proc Natl Acad Sci - 89 (1992) - S. 10114-10118

[40] Steinbüchel, A.; Oppermann – Sanio, B.: Mikrobiologisches Praktikum. Springer, Berlin, 2003, 3.

Auflage

[41] Pfaffl, M. W.: Real-time RT-PCR: Neue Ansätze zur exakten mRNA Quantifizierung.

In: Biospektrum – 1 (2004) – S. 92 – 95

[42] Sellheyer K., Krahl D.: Mesenchymale Stammzellen der Haut. In: Der Hautarzt – 61 (2010) –

S. 429 – 434

[43] Chen, F.G.; Zhang, W.J.; Bi, D. et al.: Clonal analysis of nestin(−) vimentin(+) multipotent fibro-

blasts isolated from human dermis. In: J Cell Sci – 120 (2007) – S. 2883

[44] Kroeze, K.L.; Jürgens, W.J.; Doulabi, B.Z. et al.: Chemokine-mediated migration of skin-derived

stem cells: predominant role for CCL5. In: Invest Dermatol – 129 (2009) – S. 1569–1581

Page 53: Inhaltsverzeichnis · Seneszenz und deren Einfluss auf die Multipotenz gezogen werden. 1.1 Mesenchymale Stammzellen, Adipozyten und Osteoblasten Als MSC´s werden die Zellen bezeichnet,

6 Anhang 45

6 Anhang 6.1 RNA - Aufreinigung .................................................................................................................. A - 1

6.2 Bilder Oil Red O - Färbung ........................................................................................................ A - 2

6.2 Ergebnisse der adipogenen Differenzierung ............................................................................ A - 4

6.3 Bilder von Kossa – Färbung ...................................................................................................... A - 5

6.4 Ergebnisse der osteogenen Differenzierung ............................................................................ A - 6

6.4.1 Proteinkonzentrationsbestimmung .................................................................................. A - 6

6.5 Ergebnisse Durchflusszytometrie ............................................................................................. A - 8

6.6 Ergebnisse der Zellzählung (Passagierung) ............................................................................ A - 10

Page 54: Inhaltsverzeichnis · Seneszenz und deren Einfluss auf die Multipotenz gezogen werden. 1.1 Mesenchymale Stammzellen, Adipozyten und Osteoblasten Als MSC´s werden die Zellen bezeichnet,

6 Anhang 1

6.1 RNA - Aufreinigung Die Aufreinigung erfolgte nach dem Protokoll des RNeasy® Micro Kit von Qiagen:

1. Add 1 volume of 70% ethanol to the lysate, and mix well by pipetting. Do not centrifuge. Proceed

immediately to step 2.

Note: The volume of 70% ethanol to add may be less than 350 μl if some lysate was lost during

homogenization.

Note: Precipitates may be visible after addition of ethanol, but this does not affect the procedure.

2. Transfer the sample, including any precipitate that may have formed, to an RNeasy spin column

placed in a 2 ml collection tube (supplied). Close the lid gently, and centrifuge for 15 s at 8000 x g

(10,000 rpm). Discard the flowthrough. Reuse the collection tube in step 3.

3. Add 700 μl Buffer RW1 to the RNeasy spin column. Close the lid gently, and centrifuge for 15 s at

8000 x g (10,000 rpm) to wash the spin column membrane. Discard the flow-through.

Reuse the collection tube in step 4.

4. Add 500 μl Buffer RPE to the spin column. Close the lid gently, and centrifuge for 15 s at 8000 x g

(10,000 rpm) to wash the spin column membrane. Discard the flow-through. Reuse the collection

tube in step 5.

Note: Buffer RPE is supplied as a concentrate. Ensure that ethanol is added to Buffer RPE before use.

5. Add 500 μl Buffer RPE to the spin column. Close the lid gently, and centrifuge for 2 min at 8000 x g

(10,000 rpm) to wash the spin column membrane. Discard the flow-through. Reuse the collection

tube in step 5.

Note: After centrifugation, carefully remove the RNeasy spin column from the collection tube so that

the column does not contact the flow-through. Otherwise, carryover of ethanol will occur.

6. Place the RNeasy spin column in a new 2 ml collection tube (supplied). Open the lid of the spin

column, and centrifuge at full speed for 5 min. Discard the flow-through and collection tube.

13. Place the RNeasy spin column in a new 1.5 ml collection tube (supplied). Add 15 μl RNase-free

water directly to the center of the spin column membrane. Close the lid gently, and centrifuge for 1

min at full speed to elute the RNA.

7. Store the RNA – Samples at -80 °C.

Page 55: Inhaltsverzeichnis · Seneszenz und deren Einfluss auf die Multipotenz gezogen werden. 1.1 Mesenchymale Stammzellen, Adipozyten und Osteoblasten Als MSC´s werden die Zellen bezeichnet,

6 Anhang 2

6.2 Bilder Oil Red O - Färbung

Abbildung 31: : #9 Oil Red O - Färbung d8 400x

Abbildung 32: Kontrolle #9 Oil Red O - Färbung d8 400x

Abbildung 33: #12 Oil Red O - Färbung d8 400x

Abbildung 34: Kontrolle #12 Orl Red O - Färbung d8 400x

Abbildung 35: #13 Oil Red O - Färbung d8 400x

Abbildung 36: Kontrolle #13 Oil Red O - Färbung d8 400x

Page 56: Inhaltsverzeichnis · Seneszenz und deren Einfluss auf die Multipotenz gezogen werden. 1.1 Mesenchymale Stammzellen, Adipozyten und Osteoblasten Als MSC´s werden die Zellen bezeichnet,

6 Anhang 3

Abbildung 37: #14 Oil Red O - Färbung d8 400x

Abbildung 38: Kontrolle #14 Oil Red O - Färbung d8 400x

Abbildung 39: #17 Oil Red O - Färbung d8 400x

Abbildung 40: Kontrolle #17 Oil Red O - Färbung d8 400x

Abbildung 41: #18 Oil Red O - Färbung d8 400x

Abbildung 42: Kontrolle #18 Oil Red O - Färbung d8 400x

Page 57: Inhaltsverzeichnis · Seneszenz und deren Einfluss auf die Multipotenz gezogen werden. 1.1 Mesenchymale Stammzellen, Adipozyten und Osteoblasten Als MSC´s werden die Zellen bezeichnet,

6 Anhang 4

6.2 Ergebnisse der adipogenen Differenzierung

Tabelle 16: Werte adipogene Differenzierung

Patient #9 RS #12 RS #13 RS #14 RS #17 RS #18 RS

Mittelwert OD 0,127 0,308666667 0,148666667 0,306666667 0,204666667 0,071866667

Mittelwert Zellzahl 5,958333333 9,625 2,666666667 4,875 3,75 1,925

c(ORO) in mM 0,07070819 0,133176852 0,082714544 0,170268573 0,113746352 0,028501664

c(ORO)/Zellz. in

mM 0,011867109 0,013805387 0,031017954 0,034926887 0,030332361 0,014860591

Tabelle 17: Werte Kontrolle adipogene Differenzierung

Patient #9 Kontrolle #12 Kontrolle #13 Kontrolle #14 Kontrolle #17 Kontrolle #18 Kontrolle

Mittelwert OD 0,039666667 0,077333333 0,035 0,086 0,059 0,028666667

Mittelwert Zellzahl 1,729166667 2,183333333 1,25 2,116666667 1,9875 0,708333333

c(ORO) in mM 0,018903347 0,025185932 0,019727363 0,047988474 0,03302671 0,006957894

c(ORO)/Zellz. in mM 0,010904105 0,011529816 0,015781891 0,02267172 0,016617212 0,009895737

Tabelle 18: Werte für Standardkurve

c(ORO) in mM 1. Messung 2. Messung 3. Messung Mittelwert

0,75 1,35 1,359 1,35 1,353

0,1 0,178 0,178 0,177 0,177666667

0,05 0,091 0,092 0,092 0,091666667

Abbildung 43: Standardkurve Oil Red O

y = 1,8046x - 0,0006

R² = 1

0

0,5

1

1,5

0 0,2 0,4 0,6 0,8

OD

Konzentration in mM

Standardkurve Oil Red O

Standardkurve

Linear

(Standardkurve)

Page 58: Inhaltsverzeichnis · Seneszenz und deren Einfluss auf die Multipotenz gezogen werden. 1.1 Mesenchymale Stammzellen, Adipozyten und Osteoblasten Als MSC´s werden die Zellen bezeichnet,

6 Anhang 5

6.3 Bilder von Kossa – Färbung

Abbildung 44: #12 von Kossa - Färbung d27 100x

Abbildung 45: Kontrolle #12 von Kossa - Färbung d27 100x

Abbildung 46: #13 von Kossa - Färbung d27 100x

Abbildung 47: Kontrolle #13 von Kossa - Färbung d27 100x

Abbildung 48: #14 von Kossa - Färbung d27 100x

Abbildung 49: Kontrolle #14 von Kossa - Färbung d27 100x

Page 59: Inhaltsverzeichnis · Seneszenz und deren Einfluss auf die Multipotenz gezogen werden. 1.1 Mesenchymale Stammzellen, Adipozyten und Osteoblasten Als MSC´s werden die Zellen bezeichnet,

6 Anhang 6

Abbildung 50: #18 von Kossa - Färbung d27 100x

Abbildung 51: Kontrolle #18 von Kossa - Färbung d27 100x

6.4 Ergebnisse der osteogenen Differenzierung

Tabelle 19: Mittelwerte der ALP - Messungen bezogen auf die Proteinkonzentration (mmol/g)

Patient Osteogen Osteogen Kontrolle

#12 0,416947827 -0,091565911

#13 0,111684177 -0,095772955

#14 0,487802794 -0,078234165

#18 0,00778051 -0,09943061

juvenil 0,29974349 -0,08700356

adult 0,21236417 -0,09549826

6.4.1 Proteinkonzentrationsbestimmung

Tabelle 20: Werte der Proteinmessung

Patient Osteogen Osteogen Kontrolle

#12 1,078175 0,853245

#13 0,7671125 0,9525675

#14 1,041625 0,95987

#18 1,04787 0,89697

Tabelle 21: Standard Proteinkonzentrationsbestimmung

c(Standard) in g/l OD 1. Messung OD 2. Messung Mittelwert OD

2 2,1826 2,2482 2,2154

1,5 1,7842 1,7565 1,77035

1 1,3888 1,4273 1,40805

Page 60: Inhaltsverzeichnis · Seneszenz und deren Einfluss auf die Multipotenz gezogen werden. 1.1 Mesenchymale Stammzellen, Adipozyten und Osteoblasten Als MSC´s werden die Zellen bezeichnet,

6 Anhang 7

0,75 1,174 1,3534 1,2637

0,5 1,0614 1,0445 1,05295

0,25 0,81143 0,87253 0,84198

0,125 0,71523 0,7545 0,734865

0,025 0,63388 0,62339 0,628635

0 0,5479 0,54099 0,544445

Abbildung 52: Standard Proteinkonzentrationsbestimmung

y = 0,198x + 0,1725

R² = 0,9355

0

0,5

1

1,5

2

2,5

0 2 4 6 8 10

OD

c(Standard) in g/l

Standardkurve

Standardkurve

Linear (Standardkurve)

Page 61: Inhaltsverzeichnis · Seneszenz und deren Einfluss auf die Multipotenz gezogen werden. 1.1 Mesenchymale Stammzellen, Adipozyten und Osteoblasten Als MSC´s werden die Zellen bezeichnet,

6 Anhang 8

6.5 Ergebnisse Durchflusszytometrie

Tabelle 22: Konzentration AK #9 - #18

Konzentration AK

IgG1 (Fitc) 7,5µl für 1x106 Zellen

CD105 (Fitc) 7,5µl für 1x106 Zellen

IgG1 (PE) 7,5µl für 1x106 Zellen

CD29 (PE) 7,5µl für 1x106 Zellen

CD31 (PE) 7,5µl für 1x106 Zellen

CD45 (PE) 7,5µl für 1x106 Zellen

CD73 (PE) 7,5µl für 1x106 Zellen

CD166 (PE) 7,5µl für 1x106 Zellen

IgG1 (Alexa 700) 5µl für 1x106 Zellen

CD90 (Alexa 700) 5µl für 1x106 Zellen

IgG1 (PerCP) 3,75µl für 1x106 Zellen

CD34 (PerCP) 3,75µl für 1x106 Zellen

Page 62: Inhaltsverzeichnis · Seneszenz und deren Einfluss auf die Multipotenz gezogen werden. 1.1 Mesenchymale Stammzellen, Adipozyten und Osteoblasten Als MSC´s werden die Zellen bezeichnet,

6 Anhang 9

Tabelle 23: Ergebnisse Flow Cytometry

Antigen #9 #12 #13 #14 #17 #18

CD29 PE 96,4 99,7 99,3 95,9 99,4 96,4

CD31 PE -0,4 0 -0,1 0,3 -0,1 -0,3

CD34 PerCp 0,2 0 -0,1 0 0,5 -1,9

CD45 PE -0,2 0,2 0 0,2 0 0,1

CD73 PE 96,2 99 99,3 99,1 99,4 98,4

CD90 Alexa 91,7 89,8 98,3 97,7 97,8 93,4

CD105 FITC 96 98,5 98,7 95 94,2 96,8

CD166 PE 95,6 99,7 99,2 99,5 99,7 97,3

juvenil adult

Mittelwert Stabw Mittelwert Stabw

CD29 (pos.) 98,2 1,99248588 97,5 1,90525589

CD31 (neg.) 0,03333333 0,23094011 -0,23333333 0,2081666

CD34 (neg.) 0,13333333 0,32145503 -0,56666667 1,15902258

CD45 (neg.) 0,06666667 0,11547005 0,03333333 0,2081666

CD73 (pos.) 99,2666667 0,15275252 97,8666667 1,47422296

CD90 (pos.) 97,9333333 0,32145503 91,6333333 1,80092569

CD105 (pos.) 95,9666667 2,40069434 97,1 1,27671453

CD166 (pos.) 99,4666667 0,25166115 97,5333333 2,05993527

Positiv juvenil 98,1666667 1,39602611

Negativ juvenil 0,07777778 0,05091751

Positiv adult 96,3266667 2,63769681

Negativ adult -0,25555556 0,30061665

Page 63: Inhaltsverzeichnis · Seneszenz und deren Einfluss auf die Multipotenz gezogen werden. 1.1 Mesenchymale Stammzellen, Adipozyten und Osteoblasten Als MSC´s werden die Zellen bezeichnet,

6 Anhang 10

6.6 Ergebnisse der Zellzählung (Passagierung)

Tabelle 24: Werte der Zellzählungen der Seneszenz

Passage #12 #13 #14 #18

F2 206250 243750 213750 117500

18750 56250 22500 37500

F3 450000 356250 325000 131250

37500 18750 37500 75000

F4 375000 412500 262500 168750

37500 37500 75000 37500

F5 500000 543750 712500 225000

18750 18750 18750 0

F6 450000 450000 412500 225000

18750 37500 18750 0

F7 581250 618750 806250 300000

37500 18750 0 18750

F8 562500 450000 450000 225000

56250 37500 37500 18750

F9 562500 825000 656250 431250

18750 56250 18750 18750

F10 337500 562500 450000 375000

75000 18750 0 37500

F11 387500 993750 562500 225000

37500 18750 0 18750

F12 318750 412500 318750 168750

37500 18750 18750 18750

F13 375000 712500 588750 225000

37500 18750 37500 18750

F14 225000 356250 281250 158750

56250 0 37500 56250

F15 232500 528750 431250 171250

75000 75000 11250 18750

lebend

tot

Page 64: Inhaltsverzeichnis · Seneszenz und deren Einfluss auf die Multipotenz gezogen werden. 1.1 Mesenchymale Stammzellen, Adipozyten und Osteoblasten Als MSC´s werden die Zellen bezeichnet,

Selbstständigkeitserklärung 11

Selbstständigkeitserklärung

Hiermit erkläre ich, dass ich die vorliegende Arbeit selbstständig und nur unter Verwendung der

angegebenen Literatur und Hilfsmittel angefertigt habe.

Stellen, die wörtlich oder sinngemäß aus Quellen entnommen wurden, sind als solche kenntlich

gemacht.

Diese Arbeit wurde in gleicher oder ähnlicher Form noch keiner anderen Prüfungsbehörde vorgelegt.

Leipzig, den 11.09.2011

Eric Sonntag