Insecticide resistance in Bemisia tabaci Gennadius (Homoptera

G

A

IAcW

OMa

b

c

d

e

f

g

h

a

ARRAA

KWIBBAI

C

(

0h

ARTICLE IN PRESS Model

CTROP-3105; No. of Pages 11

Acta Tropica xxx (2013) xxx– xxx

Contents lists available at SciVerse ScienceDirect

Acta Tropica

journa l h om epa ge: www.elsev ier .com/ locate /ac ta t ropica

nsecticide resistance in Bemisia tabaci Gennadius (Homoptera:leyrodidae) and Anopheles gambiae Giles (Diptera: Culicidae) couldompromise the sustainability of malaria vector control strategies in

est Africa

livier Gnankinéa,∗, Imael H.N. Bassoléb, Fabrice Chandrec, Isabelle Glithod,artin Akogbetoe, Roch K. Dabiré f, Thibaud Marting,h

Laboratoire d’Entomologie Appliquée, Université de Ouagadougou, BP 7021 Ouagadougou, Burkina FasoLaboratoire BAEBIB, Université de Ouagadougou, Burkina FasoIRD-MIVEGEC (UM1-UM2-CNRS 5290-IRD 224), BP 64501, 911 Av Agropolis, 34394 Montpellier Cedex 5, FranceUniversité de Lomé, Faculté de Sciences et Techniques, Lomé, TogoCentre de Recherche Entomologique de Cotonou (CREC), 06 BP 2604. Cotonou, BeninIRSS/Centre Muraz, BP 390 Bobo-Dioulasso, Burkina FasoCirad – UR Hortsys, 34398 Montpellier Cedex 5, Franceicipe, PO Box 30772-00100 Nairobi, Kenya

r t i c l e i n f o

rticle history:eceived 9 March 2013eceived in revised form 29 May 2013ccepted 9 June 2013vailable online xxx

eywords:est Africa

nsecticide resistanceioassaysemisia tabacinopheles gambiae

ntegrated Pest Management (IPM)

a b s t r a c t

Insecticides from the organophosphate (OP) and pyrethroid (PY) chemical families, have respectively,been in use for 50 and 30 years in West Africa, mainly against agricultural pests, but also against vectorsof human disease. The selection pressure, with practically the same molecules year after year (mainly oncotton), has caused insecticide resistance in pest populations such as Bemisia tabaci, vector of harmful phy-toviruses on vegetables. The evolution toward insecticide resistance in malaria vectors such as Anophelesgambiae sensus lato (s.l.) is probably related to the current use of these insecticides in agriculture. Thus,successful pest and vector control in West Africa requires an investigation of insect susceptibility, in rela-tion to the identification of species and sub species, such as molecular forms or biotypes. Identification ofknock down resistance (kdr) and acetylcholinesterase gene (Ace1) mutations modifying insecticide tar-gets in individual insects and measure of enzymes activity typically involved in insecticide metabolism(oxidase, esterase and glutathion-S-transferase) are indispensable in understanding the mechanisms ofresistance. Insecticide resistance is a good example in which genotype–phenotype links have been madesuccessfully. Insecticides used in agriculture continue to select new resistant populations of B. tabaci thatcould be from different biotype vectors of plant viruses. As well, the evolution of insecticide resistance inAn. gambiae threatens the management of malaria vectors in West Africa. It raises the question of priorityin the use of insecticides in health and/or agriculture, and more generally, the question of sustainabilityof crop protection and vector control strategies in the region. Here, we review the susceptibility tests,
biochemical and molecular assays data for B. tabaci, a major pest in cotton and vegetable crops, and An.gambiae, main vector of malaria. The data reviewed was collected in Benin and Burkina Faso between2008 and 2010 under the Corus 6015 research program. This review aims to show: (i) the insecticideresistance in B. tabaci as well as in An. gambiae; and (ii) due to this, the impact of selection of resistant populations on malaria vector control strategies. Some measures that could be beneficial for cropprotection and vector control strategies in West Africa are proposed.
© 2013 Elsevier B.V. All rights reserved.

ontents

Please cite this article in press as: Gnankiné, O., et al., Insecticide resistance

gambiae Giles (Diptera: Culicidae) could compromise the sustainability ohttp://dx.doi.org/10.1016/j.actatropica.2013.06.004

1. Introduction . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . .

2. Insecticide resistance in B. tabaci populations . . . . . . . . . . . . . . . . . . . . . . . . . . . . .

∗ Corresponding author. Tel.: +226 78826245.E-mail addresses: [email protected], [email protected] (O. Gnan

F. Chandre), [email protected] (I. Glitho), [email protected] (M. Akogbeto), dabire roch

001-706X/$ – see front matter © 2013 Elsevier B.V. All rights reserved.ttp://dx.doi.org/10.1016/j.actatropica.2013.06.004

in Bemisia tabaci Gennadius (Homoptera: Aleyrodidae) and Anophelesf malaria vector control strategies in West Africa. Acta Trop. (2013),

. . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 00

. . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 00

kiné), [email protected] (I.H.N. Bassolé), [email protected]@hotmail.com (R.K. Dabiré), [email protected] (T. Martin).

dx.doi.org/10.1016/j.actatropica.2013.06.004


http://www.sciencedirect.com/science/journal/0001706X

http://www.elsevier.com/locate/actatropica

mailto:[email protected]









ARTICLE IN PRESSG Model

ACTROP-3105; No. of Pages 11

2 O. Gnankiné et al. / Acta Tropica xxx (2013) xxx– xxx

2.1. Susceptibility tests . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 002.2. Biochemical assays . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 002.3. Molecular assays . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 00

3. Insecticide resistance in Anopheles gambiae populations . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 003.1. Molecular forms . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 003.2. Insecticide susceptibility tests . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 003.3. Biochemical assays . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 003.4. Molecular analysis . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 00

4. Impact of selection of resistant insect populations on malaria vector control strategies . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 005. A selection of sustainable insect pest and vector management measures . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 00

5.1. Impact of transgenic cotton on resistance: The case of Burkina Faso . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 005.2. Bacteria in controlling pests and vectors . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 00

6. Conclusions . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 00Funding . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 00Conflicts of interest . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 00Authors’ contributions . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 00Acknowledgments . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 00Appendix A. Supplementary data. . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 00

. . . . . .

1

ctftcmiAcaBa(ciaBsCacoirda22opiefialt2eQ(bt

References . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . .

. Introduction

Most pesticides used in West Africa are for crop protection onotton, especially in Sudano-Sahelian countries. Six liters of insec-icide per hectare are distributed on credit each year to cottonarmers by ginning companies (Martin et al., 2005). But these insec-icides are also sold on the informal market, and used on otherrops such as vegetables (Ahouangninou et al., 2011). They belongainly to the pyrethroids (PY) and organophosphate (OP) chem-

cal families. The whitefly Bemisia tabaci Gennadius (Hemiptera:leyrodidae) is one of the major pests of cotton and vegetablerops worldwide. This pest causes damage both directly by feedingnd indirectly through the excretion of honeydew (Jones, 2003).. tabaci is also a vector of Tomato yellow leaf curl virus (TYLCV),

complex of geminiviruses infecting tomato cultures worldwideBerlinger, 1986). At present, invasions of virus-bearing B. tabaciontinues to be a critical barrier to establishment of tomato cropsn open fields (Berlinger, 1986). There is a considerable geneticnd biological variability of B. tabaci leading to the opinion that. tabaci is in fact a complex of morphologically indistinguishablepecies/biotypes (Perring, 2001; Simon et al., 2003; Pascual andallejas, 2004; Boykin et al., 2007; McKenzie et al., 2009; De Barrond Ahmed, 2011; De Barro et al., 2011). We have retained theommonly used term biotype here to link this study with previ-us studies. To date, approximately 30 B. tabaci biotypes have beendentified that differ with regard to various characteristics as hostange, fecundity, ability to transmit plant viruses, endosymbiontsiversity and insecticide resistance (Dittrich et al., 1990; Byrnend Toscano, 2002; Otoidobiga et al., 2002; Horowitz et al., 2003,005; Musa and Ren, 2005; Gnankiné et al., 2002, 2007; Xu et al.,010). PYs and OPs were introduced in agriculture for the controlf cotton pests about 30 years ago. They exerted a huge selectionressure on B. tabaci populations, which resulted to the selection of

nsecticide resistance in populations from West Africa (Houndétét al., 2010). In Burkina Faso indeed, B. tabaci populations in cottonelds were shown to be resistant to cypermethrin, methamidophosnd omethoate (Houndété et al., 2010). Sub-Saharan Africa Silver-eafing (ASL) and Q1 biotypes were identified on cotton plants,omatoes, and okra by Cytochrome Oxidase1 (CO1) (Gnankiné et al.,013a). Generally, Q1 biotypes are found predominantly and pref-rentially on cotton plants. ASL biotype is found in sympatry with

Please cite this article in press as: Gnankiné, O., et al., Insecticide resistancegambiae Giles (Diptera: Culicidae) could compromise the sustainability ohttp://dx.doi.org/10.1016/j.actatropica.2013.06.004

1 on vegetable crops. A recent report done by Gnankiné et al.2013b) showed the presence of the mutations that are responsi-le for the kdr and ace-1R resistance. These results clearly indicatehat different biotypes/genetic groups co-exist in West Africa and

. . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 00

exhibit variations in insecticide resistance. Regarding resistance,F331W mutation in the acetylcholinesterase gene (ace1) was closedto fixation in Q1 and ASL individuals, but all Q3 individuals weresusceptible. For kdr, the L925I mutation was observed only in Q1populations. Thus, insecticide treatments rapidly selected for resis-tant individuals of Q biotypes; for instance, B biotype is knownto be more susceptible to several chemical compounds than theQ biotype explaining why it sometimes displaces the B biotype(Horowitz et al., 2005; Chu et al., 2010).

The evolution toward insecticide resistance in malaria vec-tors such as Anopheles gambiae Giles (Diptera: Culicidae) is partlyrelated to the current use of these insecticides in agriculture (Corbelet al., 2007; Djogbénou et al., 2010; Yadouleton et al., 2011). Theresidues in plots are known to contaminate mosquito-breedingsites, resulting in delayed growth rates and development of resis-tance in larvae (Akogbeto et al., 2006). To date, malaria vectorcontrol has predominantly focused on targeting the adult mosquitothrough house spraying and long lasting insecticide net (LLIN) use(Kelly-Hope et al., 2008; Raghavendra et al., 2011). Unfortunately,OPs and PYs currently used in control of agricultural pests as B.tabaci are also the same ones used for vector control increasing thepotential for resistance selection in mosquitoes as An. gambiae.

An. gambiae is also a complex, with seven sibling species that areclosely related and morphologically indistinguishable from eachother by routine taxonomic methods (Gillies and Coetzee, 1987). Itincludes some of the most important malaria vector species of sub-Saharan Africa i.e. An. gambiae s.s. and An. arabiensis, Patton. Geneticdifferentiation also occurs within the highly polymorphic An. gam-biae s.s. species subdivided into five cytoforms: Forest, Savanna,Bamako, Mopti, and Bissau. They differ in their arrangement ofchromosomal inversion and appear more or less genetically iso-lated in the field (Coluzzi et al., 1985, 2002). In addition, studiesusing molecular markers such as X-linked ribosomal DNA revealedthe presence of two distinct molecular forms within An. gam-biae s.s: the M and S forms that co-exist in West Africa (DellaTorre et al., 2005). In the dry savannahs of West Africa, the Sform preferentially breeds in temporary aquatic habitats and isfound during the rainy seasons, whereas the M form is presentall year round, breeding in man-made permanent aquatic habitats(Simard et al., 2009). In Burkina Faso, genes conferring resistanceto insecticides display large frequency differences in M and S forms


and also within An. arabiensis (Dabiré et al., 2012). Resistance ofAn. gambiae s.l. to DDT and pyrethroids is especially conferred inWest Africa by mutation of the sodium channel target site, theL1014F kdr (Martinez-Torres et al., 1998; Diabaté et al., 2002a,b;


ING Model

A

Trop

AT(t(Ailit2g

triar

p2mtgctodral

ampbubttptu

2

2

cpCidUpafttoagLL

ARTICLECTROP-3105; No. of Pages 11

O. Gnankiné et al. / Acta

wolola et al., 2005; Fanello et al., 2000; Weill et al., 2000; Dellaorre et al., 2001; N’Guessan et al., 2007). But now both mutationsL1014F, L1014S) coexist in some countries and are widely dis-ributed throughout sub-Saharan Africa as well as in Burkina FasoDabiré et al., 2012; Verhaeghen et al., 2006; Etang et al., 2006).n insensitive acetylcholinesterase (ace-1R mutation) is involved

n organophosphate/carbamate (OP/CX) resistance in field popu-ations of An. gambiae s.l. from West Africa. Indeed, this mutations a single amino-acid substitution, from a glycine to a serine athe position 119, in the AChE1 catalytic site (G119S) (Weill et al.,004). To date, in Burkina Faso, especially in the west, we found An.ambiae exhibiting the double mutation (kdr and ace-1R).

Several years of intensive use of chemical insecticides to con-rol arthropod pests and disease vectors has led to the selection ofesistant populations in not only B. tabaci and An. gambiae, but alson other insect species. Integrated pest management has evolveds a favored approach to delay or reduce the impact of insecticideesistance.

In Burkina Faso, the introduction of genetically modified cottonlants expressing the Cry1Ac and Cry2Ab toxins (Greenplate et al.,003) which have a different mode of action to that of pyrethroids,ay be an interesting and effective alternative to chemical con-

rol. Pray et al. (2002), have shown that transgenic cotton use hasreatly reduced pesticide treatments while effectively controllingaterpillar pests. Supplementary treatments with neonicotonids athe boll opening stage against B. tabaci is thus not due to failuref Bt cotton. B. tabaci causes damages indirectly through honey-ew excretion leading to the sticky cotton. The neonicotinoids areecommended because of their systemic effect making them suit-ble against sucking insect while the Bt genes handle most of theepidopteran larvae.

Monitoring resistance and identifying mechanisms involvedre important steps in the management and setting up of betterethods for controlling the two insects. This review considers the

henotypical and genotypical data on B. tabaci and An. gambiae,ased on reliable methods currently used in West Africa. The datancovered the spread of insecticide resistance among the B. tabaciiotypes and An. gambiae molecular forms, and the addition of resis-ance mechanisms in West African populations. This led us to askhe question: Do selection of resistant insect populations may com-romise malaria vector control strategies used in West Africa? Inhis paper, we will answer this question and propose some meas-res on insect pest management (see Fig. 1).

. Insecticide resistance in B. tabaci populations

.1. Susceptibility tests

Most techniques exist and are used to assess insecticide sus-eptibility of B. tabaci populations. A leaf dip bioassay methoderformed on the basis of previous studies (Rowland et al., 1991;ahill et al., 1995), has been used to evaluate the resistance status

n western Africa (Houndété et al., 2010). A few insecticides fromifferent chemical families (OP, PY, neonicotinoids) were tested.sing this technique, Houndété et al. (2010) demonstrated thatopulations from Burkina Faso (BF) showed higher resistance toll insecticides tested than populations from Benin and frequentlyrom Togo. In the absence of a susceptible strain, the populationhat exhibits a low value was used as reference strain. For instance,he highest resistance to deltamethrin and bifenthrin (PY) wasbserved in the Tiara (BF) population, which exhibited respectively,



4.7- and 36-fold resistance. Soumousso (BF) populations showedreater resistance to dimethoate, (8.4-fold) than populations fromomé (Togo) (1.6-fold). The populations from Bohicon (Benin) andomé (Togo) have been used to calculate the resistance ratio (RR)

PRESSica xxx (2013) xxx– xxx 3

for other field populations. To follow the phenotypical resistanceduring the season and for a rapid survey of resistance, the glass vialtechnique is recommended. This technique was used to determinethe susceptibility of B. tabaci field populations to insecticides (OP,PY, carbamates) in the USA (Plapp et al., 1987; Sivasupramaniamet al., 1997). This technique is more suitable than the leaf-disk assaybecause it is less time consuming.

2.2. Biochemical assays

Biochemical assays permit to detect enzymes associated withmechanism of resistance like elevated esterases, P-450s andglutathione-S-transferases. These include electrophoretic gels. Theadvantages of biochemical testing include the ability to carry outmultiple assays on a single insect to look for multiple insecticideresistance rapidly (Brogdon, 1989). We have no data in Africa butin Greece, B. tabaci resistance to pyrethroids has been associatedwith both target-site modifications and enhanced detoxificationof insecticidal compounds (Roditakis et al., 2009). Oxidative andhydrolytic pathways associated with elevated carboxylesterases(COE) and cytochrome P450-dependent monoxygenase activitieshave been reported (Dittrich et al., 1990; Bloch and Wool, 1994;Shchukin and Wool, 1994). A significant correlation was observedbetween �-cypermethrin resistance levels and COE activity with�-naphthyl acetate (Roditakis et al., 2009).

The resistance to OPs and carbamates might involve enhanceddetoxification of the insecticides by non-specific COE andcytochrome P450-dependent monoxygenases (Bloch and Wool,1994), but also target site modifications (Byrne and Devonshire,1997; Anthony et al., 1998; Alon et al., 2006). Cytochrome P450activity was strongly correlated with resistance to imidacloprid(Karunker et al., 2008). It has been demonstrated that overex-pression of CYP6CM1 is associated with high levels of imidaclopridresistance in B. tabaci.

2.3. Molecular assays

The PCR procedure was performed to determine B. tabacibiotypes (Gnankiné, 2011) associated to the identification ofkdr and ace-1R mutations (Tsagkarakou et al., 2009). Thus,genomic DNA was extracted from each individual adult ofB. tabaci in 26 �l of Nonidet P-40 extraction buffer. Biotypeswere identified using a PCR-RFLP (restriction fragment lengthpolymorphism) based diagnostic assay. Briefly, in this method,a fragment of the mitochondrial marker CO1 (cytochromeoxidase 1 gene sequences, mtCOI) gene was amplified byPCR (Frohlich et al., 1999), using universal COI primers C1-J-2195 (5′-TTGATTTTTTGGTCATCCAGAAGT-3′) and TL2-N-3014(5′-TCCAATGCACTAATCTGCCATATTA-3′) (Khasdan et al., 2005).The PCR products were then digested by the restriction endonucle-ases XapI (Fermentas) and/or BfmI (Fermentas), which generatesa clear polymorphism between biotypes B, MS, Q and Q1, Q2 orQ3 genetic groups. The PCR products are incubated with 10 U/�LXapI (Fermentas) at 37 ◦C for 3 h before loading onto agarose gel(Gnankiné, 2011).

For identification of various kdr and ace-1R mutations, genomicDNA of samples was also used to amplify a ∼0.145 kb DNAfragment from the IIS4-6 region of the B. tabaci sodiumchannel, using primers Bt-kdr-F1 (5′-GCCAAATCCTGGCCAACT-3′)and Bt-kdr-RIntr1 (5′-GAGACAAAAGTCCTGTAGC-3′). For ace-1R,primers Bt-ace-F (5′-TAGGGATCTGCGACTTCCC-3′) and Bt-ace-R(5′-GTTCAGCCAGTCCGTGTACT-3′) were used to amplify a ∼0.25 kb


DNA fragment from AChE gene of B. tabaci.Tsagkarakou et al. (2009) developed a PCR-RFLP method to

detect mutations on Vgsc (Voltage-gated sodium channel) and ace-1R allele. This method checks the genotypes resistance for a high





B. tabaci from co�on and vegetable plants under insec�ci des pressure

Bioassay: Resistance ra�o

Molecular assay wit h PCR technique: species iden�fica�on

Biochemical a ssays: Metabol ic resistance

Molecular assays with micro-array s: Resistanc e genes

Highlight of B. tabaciresistanc e

Highlight of An. gambi ae resi stanc e

- Stop ping the us e of PYR and OP insec� cides and impl ementing the us e of Btco�on

- Eliminating bacteri a In Bemisia or intr oducing Wol bachia in mosquitoes

- Using al ter na�ve insec�cides with no cross -resi sta nce or w ith no nega�ve i mpact on mosquitoes (i.e. biopes�cides)

Phen

otyp

ical

and

gen

otyp

ical

ass

ays

Sust

aina

ble

man

agem

ent o

f pes

ts a

nd v

ecto

rs

An. gambiae in co�on and peri-urba n growing are as

Insec�cide residues contamin a�on

and An

nceisftrtaca

AAphwwcud

Fig. 1. Monitoring resistance in Bemisia tabaci

umber of samples from populations. It requires a two-step pro-edure PCR amplification and subsequent digestion by restrictionnzymes. PCR and gel electrophoresis-based detection methods,ncluding PCR-RFLP, are difficult to employ for high-throughputcreening. Recently, an oligonucleotide microarray was developedor the detection of the M918V, L925I and T929V mutations inhe voltage-gated sodium channel gene (vgsc) associated with PYesistance, and the F331W ace1 mutation associated with OP resis-ance (Chung et al., 2011). The oligonucleotide microarray was thenpplied to detect the resistance allele frequency in B. tabaci adultsollected in areas of Korea, Japan, China and Greece in which OPsnd PYs have been widely applied for pest control.

By means of these techniques, three biotypes AnSL (Sub-Saharanfrica Non-Silverleafing), ASL and Q have been detected in 3 Westfrican countries (Gnankiné et al., 2013a). These biotypes dis-lay a specific pattern of geographic distribution influenced by theost plant species. In Benin and Togo, the ASL and AnSL biotypesere predominant. In Burkina Faso the Q biotype was dominant,


ith two sub-groups, Q1 and Q3 (recorded to date only in thisountry), and ASL individuals found in sympatry with Q1 individ-als in some localities (Gnankiné et al., 2013b). In addition, theata indicated that the biotype seemed to be linked to the kind

opheles gambiae for improving IPM strategies.

of mutations detected in all samples. F331W mutation (ace1 gene)was closed to fixation in Q1 and ASL individuals tested (e.g. West-ern BF) (Fig. 2). In the para-type voltage gated sodium channel gene(kdr), the L925I mutation was observed only in Q1 populations withthe exception of Q1 individuals from Bittou (middle-East BF), whereno mutation was detected (Gnankiné, 2011) and no M918T andT929V mutations have been observed in all populations tested. Innorthern Benin, no kdr gene was detected but ace-1R gene has beenrecorded. In Q3 individuals none of F331W (ace1 gene) and L925I(kdr gene) mutations were found in all individuals.

3. Insecticide resistance in Anopheles gambiae populations

3.1. Molecular forms

PCR tests revealed two “molecular” forms (M and S), whichare morphologically identical and largely sympatric throughoutWest Africa (Della Torre et al., 2001, 2005, Touré et al., 1998), but


show molecular differences in the intergenic spacer (IGS) of theribosomal DNA (Favia et al., 2001). Although a strong deficit of M/Shybrids is observed in the field (Diabaté et al., 2003) the forms inter-breed in the laboratory and their offsprings are viable and fertile




O. Gnankiné et al. / Acta Tropica xxx (2013) xxx– xxx 5

R in B.

(s

3

nwcfvwte

Fig. 2. Distribution of the frequency of kdr and Ace1

Diabaté et al., 2007). That raises the question of their taxonomictatus.

.2. Insecticide susceptibility tests

Susceptibility tests involve the use of WHO (World Health Orga-ization) test kits, a specially designed plastic container linedith insecticide-impregnated papers (WHO, 1998, 2011). Sus-

eptibility tests were performed on 2–3 day-old An. gambiae s.l.emales provided by larval collection, using the WHO standard



ertical tube protocol. Bioassays with WHO diagnostic test kitsere carried out using PY, carbamate and OP insecticides. Mor-

ality control was carried out by exposing wild populations fromach site to non-insecticidal impregnated paper. After 1 h exposure,

tabaci populations in two countries of West Africa.

mosquitoes were transferred into insecticide-free tubes and main-tained on sucrose solution. Final mortality was recorded 24 hafter exposure. The threshold of susceptibility was fixed at 98%for the active molecules according to the WHO protocol (WHO,1998). The resistance/susceptibility status was evaluated accord-ing to WHO criteria (WHO, 2011) considering mortality above97% and below 90% representative of susceptibility and resis-tance, respectively. But between the two values, resistance wassuspected. Dead and surviving mosquitoes were grouped sepa-rately and stored on silica gel at −20 ◦C for further molecular


characterization.In Benin, WHO diagnostic tests showed high frequency of resis-

tance in both M and S forms of An. gambiae s.s. to permethrin,bendiocarb, fenitrothion and DDT (Corbel et al., 2007; Djègbè et al.,


ING Model

A

6 a Trop

2tud(tpaiot

filrets

too(

3

sa(aemftKameopPMsi

iO2pe

3

aqitetdebmC


O. Gnankiné et al. / Act

011). Yadouleton et al. (2011) investigated 3 cotton systems prac-ices in Benin: (1) A Biological Program (BP) where no chemical wassed but only organic products and natural fertilizers; (2) a Calen-ar Control Program (CCP) where 6 treatments were sprayed; and3) a Targeted Intermittent Control Program (TICP), where 3 to 6reatments were sprayed with chemical insecticides depending onest infestation. An. gambiae populations from areas using the CCPnd TICP Programs showed resistance to permethrin with mortal-ty of 50 and 58%, respectively. On the contrary, susceptibility testsn An. gambiae from BP areas showed a high level of susceptibilityo permethrin with an average mortality of 94%.

In Burkina Faso, recent studies done by Dabiré et al. (2012) con-rmed that resistance to DDT 4% is still prevailing with highest

evel (mortality rates <60%) in An. gambiae populations where alsoesistance to permethrin (PY) was increasingly reported (Diabatét al., 2004; Dabiré et al., 2009c, 2012). Among OPs and carbamatesested, only bendiocarb was recommended for indoor residualpraying to supplement the efficacy of ITNs (Dabiré et al., 2012).

WHO tests represent the first indicator of resistance and allowo confirm it by biochemical assays or molecular tests, dependingn the mechanism involved. The limitation reported for this typef assay is the availability of WHO test kits with impregnated paperBrogdon, 1989).

.3. Biochemical assays

Resistance may occur by other physiological mechanismsuch as metabolic detoxification through increased enzymectivities (monooxygenase, esterase or glutathione S-transferase)Hemingway, 1998). In Benin, Corbel et al. (2007) have carried out

study using biochemical assays suggesting that detoxificationnzymes could be involved in the resistance of An. gambiae to per-ethrin, DDT, dieldrin and carbosulfan. An. gambiae s.l. mosquitoes

rom Malanville and Ladji showed significantly higher mixed func-ion oxidase (MFO) content than the susceptible reference strainisumu. The level of esterase activity (using �-naphthyl acetate as

substrate) in Ladji population was significantly higher than thateasured for Kisumu strain and other field populations (Corbel

t al., 2007). Differences in the levels of GST activity were alsobserved in populations collected in Malanville and Asecna com-ared with Kisumu strain and populations collected in Ladji andarakou. However, An. gambiae s.l. mosquitoes from Cotonou andalanville showed higher oxidase activity compared to the Kisumu

usceptible strain in 2009, whereas the esterase activity was highern Bohicon mosquitoes in both 2008 and 2009 (Djègbè et al., 2011).

In western Burkina Faso, a higher level of esterases was observedn the predominant molecular S form of An. gambiae from Banfora,rodara and in M and S forms from Tiéfora (Namountougou et al.,012). A significantly high level of GSTs was observed in An. gambiaeopulations from all sample sites compared with Kisumu strain,xcept from those collected in Dédougou.

.4. Molecular analysis

Genomic DNA was extracted from individual mosquitoesccording to a procedure described by Collins et al. (1987). Afteruantification of the extracted DNA, adults of An. gambiae tested

n the bioassay were processed by PCR for molecular identifica-ion of species complex and molecular forms according to Scottt al. (1993) and Favia et al. (2001), respectively. For kdr detectionhe frequency of the L1014F mutation in the same samples wasetermined by allele-specific PCR as described by Martinez-Torres


t al. (1998). Ace-1R mutation was detected using the procedureased on the PCR-RFLP assay described by Weill et al. (2004) withinor modification. Specific primers, Ex3AGdir (GATCGTGGACAC-

GTGTTCG) and Ex3AGrev (AGGATGGCCCGCTGGAACAG) were used

PRESSica xxx (2013) xxx– xxx

in PCR reactions. Fifteen microliter of PCR product was digestedwith 5 U of AluI restriction enzyme (Promega, France) in a finalvolume of 25 �l at 37 ◦C for 3 h. Products were then analyzed byelectrophoresis on a 2% agarose gel stained with ethidium bromideand visualized under UV light. By means of these techniques, manyauthors could detect the prevalence of target site mutations molec-ular M and S forms of An. gambiae in several geographical areas,either alone or in sympatry (Fig. 3).

The establishment of frequencies of kdr and ace-1R mutationson a map in connection with the molecular forms represents anoverview of the resistance situation in Burkina Faso (Dabiré et al.,2012). An. gambiae form S was predominant in the west, whichis also the cotton belt area, except in VK5 and VK7 localities nearrice-growing areas. This form was also found in majority of easternareas. In the middle part of Burkina Faso (Yamtenga and Koubri),M-forms were found with a moderate prevalence. The frequencyof L1014F kdr allele implied in pyrethroid-resistance in cotton-growing areas was highest and ranged between 0.79 and 0.99and was assumed to be selected by the intensive use of insecti-cides in agriculture (Chandre et al., 1999; Diabaté et al., 2002a).It was far more frequent in the S form than in the sympatric Mform (Djogbénou et al., 2008a,b). Even though the ace-1R muta-tion was spread across two climatic zones, it was recorded mostlyin the cotton growing areas (Dabiré et al., 2009b). Ace-1R muta-tion was less spread than kdr mutation within the An. gambiae s.s(Fig. 3).

In Benin, M and S forms were also detected either alone or insympatry (Yadouleton et al., 2011; Djègbè et al., 2011). A higherfrequency of L1014F kdr allele was also detected in An. gambiaemosquitoes collected in urban areas compared to those collectedin cotton growing areas (Yadouleton et al., 2011). The expansionof vegetable growing within urban and cotton treated areas proba-bly contributed to selection pressure on mosquitoes (Corbel et al.,2007; Yadouleton et al., 2011; Djogbenou et al., 2011). AnotherL1014S kdr mutation was found recently in An. arabiensis in Benin(Djègbè et al., 2011). Up to now, the situation of OP and carbamatesis not worrying. Nevertheless, less than 1% of An. gambiae showedthe presence of the ace-1R mutation (Yadouleton et al., 2011).

4. Impact of selection of resistant insect populations onmalaria vector control strategies

Although it is known that selection for resistance in mosquitoesoccurs at the adult stage as a consequence of household insecti-cide use, or public health including treated bed nets it cannot beignored that the indirect selection pressure from the agriculturaluse of insecticides on breeding sites is a noteworthy consideration(Mouchet, 1988).

The highest frequencies of L1014F mutation in An. gambiae arefound in cotton growing regions of Burkina Faso, including the oldand the new cotton belts (Namountougou et al., 2013; Dabiré et al.,2009c). The expansion of vegetable growing within urban areas inBenin probably contributed to selection pressure on mosquitoes(Corbel et al., 2007). In old cotton areas, insecticides, may haveselected resistance in S form and not M form. Indeed, the S formoccurred in relative important proportion toward the end of therainy season with a maximum peak in October (Diabaté et al.,2002a; Dabiré et al., 2009a). Then, L1014F mutation may have beentransferred from S form to M form by introgression in sympatricpopulations (Diabaté et al., 2002b).

Recently in Cameroon, Fossog et al. (2012) showed phenotypic


resistance in An. gambiae larvae to deltamethrin. Highest resis-tance ratio (RR = 325) was observed in larvae from cultivated areasas compared to polluted (RR = 195) by wastes or organic productsin decomposition or non-polluted areas (RR = 205). According to




O. Gnankiné et al. / Acta Tropica xxx (2013) xxx– xxx 7

An.g

Npma

paovtnuri

Fig. 3. Distribution of the frequency of kdr and Ace1R in

azni et al. (2005) resistance at larval stages is extremely high com-ared to adult stages. Mosquitoes may develop different resistanceechanisms through different metabolic pathways in the larval

nd adult stages (Kawada et al., 2011).In Burkina Faso and Benin, there is some evidence that the

rocess of insecticide selection begins in fields, in treated areas,s most of the criteria listed by Georghiou (1982) were alreadybserved. Among these criteria, one can retain: (i) Appearance ofector resistance prior to application of chemicals against the vec-or; (ii) higher resistance of vectors in agricultural areas than in



on-agricultural; (iii) correlation between intensity of insecticidese on crops and degree of resistance vectors; (iv) fluctuations inesistance of vectors in parallel with periods of agricultural spray-ng; (v) correspondence between the spectrum of resistance of

ambiae s.l.populations in two countries of West Africa.

vectors and types of insecticides applied to crops; (vi) temporarysuppression of mosquito population densities following applica-tion of agricultural sprays.

At the same time, use of PY and OP in agriculture has causedresistance in the tomato bollworm Helicoverpa armigera to PYs(Martin et al., 2000, 2002), the whitefly B. tabaci to PYs, OPs andneonicotinoids (Houndété et al., 2010) and the aphid Aphis gossypiito PYs and OPs (Carletto et al., 2010). To manage these resistantpopulations, the cotton protection strategy has been modified,reducing the use of PY and OP and re-introducing (Martin et al.,


2005). PY and OP are still used, not only for cotton protection, butalso in protection of vegetables in peri-urban areas (Ahouangninouet al., 2011) despite the resistance of these same pestspecies.





oplasm

ipmtelbuslt

tmwtt

tiaspccr2

5m

5B

pOcapotb(d

Fig. 4. Wolbachia-induced cyt

We have detected the presence of high frequency of ace-1R allelen ASL biotypes of B. tabaci in northern Benin (Fig. 2). This shows theermanent selection pressure of OP on B. tabaci and other pests, anday selected rapidly individual mosquitoes in the breeding sites in

he future. In western Burkina Faso, Q1 and ASL biotypes of B. tabacixhibit a higher level of ace-1R (Fig. 2).The ace-1R mutation preva-ence is fixed in some western cotton and vegetable areas (rangeetween 0.9 and 1). This also indicates that the farmers currentlyse OPs against B. tabaci. In the same areas, Dabiré et al. (2012)howed a rather high level of ace-1R frequency in An. gambiae popu-ations (<0.4). This level could increase more if farmers do not stophe OP treatments against agricultural pests.

In some areas, the level of adult resistance may be higherhan larvae. A similar case was previously reported regarding the

alathion resistance of An. arabiensis in Sudan (Hemingway, 1983)here the authors attributed the absence of larval resistance to

he house spraying as the major source of selection pressure ratherhan agricultural spraying.

Nevertheless, alternatives to PYs and OPs are registered on cot-on in most West African countries and some of them are alreadyn use. Spinosad and indoxacarb have been tested with successgainst H. armigera (Ochou and Martin, 2003). Low quantities ofpinosad are regularly used on cotton and growers appreciate thisroduct because of its effectiveness in protecting vegetables againstaterpillars. Neonicotinoids are used on cotton in Burkina Faso toontrol the sucking pests, B. tabaci and A. gossypii. But the resistanceecently detected in B. tabaci field populations (Houndété et al.,010), raises concerns of their impact on the selection of Q biotype.

. A selection of sustainable insect pest and vectoranagement measures

.1. Impact of transgenic cotton on resistance: The case ofurkina Faso

Implementation of transgenic cotton gave rise to hope, becauseesticides belonging to OP and PY are not used in fields of Bt-cotton.nly, neonicotinoids are used at the end of the cotton phenologi-al stages. It is probable that this technology allows homozygousnd heterozygous ace-1R pests and vectors, which survive in theresence of insecticide, to be rapidly outcompeted in the absencef insecticide. In Culex pipiens, there is direct and indirect evidence


hat the resistance allele (ace-1R) entails a large fitness cost, proba-ly due to the mutated AChE1 having a much lower level of activityBerticat et al., 2008). However, the recent observation of Ace1uplicated alleles (i.e. the presence of a resistant and a susceptible

ic incompatibility in insects.

allele on the same chromosome) in An. gambiae populations fromWest Africa should reduce the fitness cost associated with resis-tance and slow its regression (Djogbénou et al., 2008a, 2010).

5.2. Bacteria in controlling pests and vectors

B. tabaci, like most phloem-feeding insects, hosts an obliga-tory primary endosymbiont, the bacterium Portiera aleyrodidarum,required for providing essential nutrients for its survival anddevelopment. B. tabaci is also infected by several faculta-tive vertically-transmitted symbiotic bacteria called secondaryendosymbionts (Gueguen et al., 2010). Interestingly, a specific sym-biotic community infects each biotype or genetic group (Gnankinéet al., 2013b). The symbiotic Rickettsia function as both mutual-ist and reproductive manipulators (Himler et al., 2011). In thelaboratory, elimination of symbionts by the use of antibiotics isrecommended.

Population transformation using the intracellular bacteriumWolbachia is particularly attractive because this maternally inher-ited agent provides a powerful mechanism to invade naturalpopulations, through cytoplasmic incompatibility (CI) (Fig. 4).Trans-infected Wolbachia strains from Drosophila melanogasterintroduced into the dengue vector Ae. aegypti successfully invadedtwo natural Ae. aegypti populations in Australia, reaching near-fixation in a few months following releases of male-infected Ae.aegypti adults (Hoffmann et al., 2011). Maternal transmission ofWolbachia to resulting progeny is dependent on establishing infec-tions in the ovaries of adult females. Ultimately this barrier togermline infection must be overcome to establish stably infectedlines that could be deployed for malaria vector control strategies. Arecent study shows that Plasmodium falciparum development in An.gambiae is suppressed by transient somatic infections of wMelPop-CLA (Hughes et al., 2011). However, Anopheles species are naturallynot infected by Wolbachia and then the control of malaria usingWolbachia-based methods is likely not achievable before a longterm.

6. Conclusions

IPM strategies adopted against cotton pests lead to a reductionin the level of pest populations and could influence positively themanagement of mosquitoes. For conventional cotton adopted in


all West African countries, two to four treatments with PY plus OPcontribute to the selection of resistant B. tabaci ASL and Q biotypes,increasing ineffectiveness of the treatments and enhancing pestinfestations. This is due to the increasing dosages and application


ING Model

A

Trop

fn

mrcbmsrOmtm

i“rtrpaa

vlipombp

F

fiUt

C

A

Iam

A

m

A

fjt



requencies, which have a reverse effect of gradually reducing theatural enemy populations.

The Bt cotton strategy in Burkina Faso with one or two treat-ents of neonicotinoids, leads to the selection of B. tabaci Q biotype

esistance. This technology have the same effects as conventionalotton, except the replacement of the local biotype (ASL) by Qiotype which could have a strong rate of recurrence in the trans-ission of viral diseases, particularly in solanaceous crops. In this

trategy, suppression of PY and OP applications should result ineduction of selection pressure in An. gambiae, decreasing mainlyP resistance, thus increasing sensitivity of pyrethroids againstosquitoes (dominance and fixation of kdr mutation), in particular,

heir repulsive effects before the addition of enzymatic resistanceechanisms lead to their inefficiency.Management of resistance can slow resistance spread in all

nsect populations, and perhaps cause a resistant population torevert” to a more susceptible level. Tactics for management ofesistance can include the following counter measures: (i) respec-ing the dose and frequency of pesticide application; (ii) using localather than area wide application; (iii) spraying locally only whenests are present; (iv) using targeted and less persistent pesticides;nd (v) using, as far as possible, non-chemical control methods,lone or in combination with chemical measures.

Meanwhile, with the development of durable tools such asaccines, vector control has also been enhanced by the use ofong lasting impregnated bed nets (LLINs) that are expected tomprove the efficacy of classic impregnated nets. Globally, malariarevention remains a long-term challenge and we must changeur multidisciplinary concepts. The use of genetically modifiedosquitoes and the perspective of the use of bacteria can now

e properly envisioned, not exclusively but as part of a completeackage in the current successful strategies used in the field.

unding

Authors are grateful to the project Corus 6015 from AIRD, whichnancially supported the study on resistance monitoring. Thank toniversity of Ouagadougou, University of Lomé, IRSS, IRD and CREC

hat contributed to fund this project.

onflicts of interest

The authors declare that they have no competing interests

uthors’ contributions

OG and MT conceived and designed the study. OG, MT andNHB drafted the manuscript. MT, FC, MA, IG, RKD supervisednd reviewed this manuscript. Each author approved the finalanuscript.

cknowledgments

Authors also thank Dr. Dolorosa Osogo from Icipe for editing thisanuscript.

ppendix A. Supplementary data



Supplementary data associated with this article can beound, in the online version, at http://dx.doi.org/10.1016/.actatropica.2013.06.004. These data include Google maps ofhe most important areas described in this article.


References

Ahouangninou, C., Fayomi, B.E., Martin, T., 2011. Évaluation des risques sanitaires etenvironnementaux des pratiques phytosanitaires des producteurs maraîchersdans la commune rurale de Tori-Bossito (Sud-Bénin). Cah. Agric. 20, 216–222.

Akogbeto, M., Djouaka, R., Kinde-Gazard, D.A., 2006. Screening of pesticide residuesin soil and water samples from agricultural settings. Malaria J. 5, 22.

Alon, M., Alon, F., Morin, S., Benting, J., Lueke, B., Ponge, T., 2006. Multiple originsof pyrethroid resistance in sympatric biotypes of Bemisia tabaci (Hemiptera:Aleyrodidae). Insect. Biochem. Mol. Biol. 36, 71–79.

Anthony, N.M., Brown, J.K., Feyereisen, R., French-Constant, R.H., 1998. Diagnosis andcharacterization of insecticide-insensitive acetylcholinesterase in 3 populationsof the sweet-potato whitefly Bemisia tabaci. Pestic. Sci. 52, 39–46.

Awolola, T.S., Oyewole, I.O., Amajoh, C.N., Idowu, E.T., Ajayi, M.B., Oduola, A., Manafa,O.U., Ibrahim, K., Koekemoer, L.L., Coetzee, M., 2005. Distribution of the molec-ular forms of Anopheles gambiae and pyrethroid knock down resistance gene inNigeria. Acta Trop. 95, 204–209.

Berlinger, M.J., 1986. Host plant resistance to Bemisia tabaci. Agric. Ecosyst. Environ.17, 69–82.

Berticat, C., Bonnet, J., Duchon, S., Agnew, P., Weill, M., Corbel, V., 2008. Costs and ben-efits of multiple resistance to insecticides for Culex quinquefasciatus mosquitoes.BMC Evol. Biol. 8, 104.

Bloch, G., Wool, D., 1994. Methidathion resistance in the sweetpotato whitefly (Aley-rodidae, Homoptera) in Israel: selection, heritability and correlated changes inesterase activity. J. Econ. Entomol. 87, 1147–1156.

Boykin, L.M., Shatters, R.G., Rosell, R.C., Mckenzie, C.L., Bagnall, R.A., De Barro, P.,Frohlich, D.R., 2007. Global relationships of Bemisia tabaci (Hemiptera Aleyro-didae) revealed using Bayesian analysis of mitochondrial COI DNA sequences.Mol. Phylogenet. Evol. 44, 1306–1319.

Brogdon, W.G., 1989. Biochemical resistance detection: an alternative to bioassay.Parasitol. Today 5, 56–60.

Byrne, F.J., Devonshire, A.L., 1997. Kinetics of insensitive acetylcholinesterasesin organophosphate-resistant tobacco whitefly, Bemisia tabaci (Gennadius)(Homoptera Aleyrodidae). Pestic. Biochem. Physiol. 58, 119–124.

Byrne, F.J., Toscano, N.C., 2002. Evaluation of peracid activated organophosphates instudies of insecticide resistance conferred by insensitive acetylcholinesterases.J. Econ. Entomol. 95, 425–429.

Cahill, M., Byrne, F.J., Denholm, I., Devonshire, A.I., Gorman, K.J., 1995. Pyrethroid andorganophosphate resistance in the tobacco whitefly Bemisia tabaci (Gennadius)(Homoptera Aleyrodidae). Bull. Entomol. Res. 84, 181–187.

Carletto, J., Martin, T., Vanlerberghe-Masutti, F., Brévault, T., 2010. Insecticide resis-tance traits differ among genotypes from different host races in the aphid Aphisgossypii. Pest. Manage. Sci. 66, 301–307.

Chandre, F., Manguin, S., Brengues, C., Dossou-Yovo, J., Darriet, F., Diabaté, A., Faye,O., Mouchet, J., Guillet, P., 1999. Status of pyrethroid resistance in Anophelesgambiae sensu lato. Bull. WHO 77, 230–234.

Chu, D., Wan, F.H., Zhang, Y.J., Brown, J.K., 2010. Change in the biotype compositionof Bemisia tabaci in Shandong Province of China from 2005 to 2008. Environ.Entomol. 39, 1028–1036.

Chung, I.H., Kang, S., Kim, Y.R., Kim, J.H., Jung, J.W., Lee, S., Lee, S.H., Hwang, S.Y.,2011. Development of a low-density DNA microarray for diagnosis of target-site mutations of pyrethroid and organophosphate resistance mutations in thewhitefly Bemisia tabaci. Pestic. Manage. Sci. 67, 1541–1548.

Collins, F.H., Mendez, M.A., Rasmussen, M.O., Mehaffey, P.C., Besansky, N.J., Finnerty,V., 1987. A ribosomal RNA gene probe differentiates member species of theAnopheles gambiae complex. Am. J. Trop. Med. Hyg. 37, 37–41.

Coluzzi, M., Petrarca, V., Di Deco, M.A., 1985. Chromosomal inversion intergradationand incipient speciation in Anopheles gambiae. Boll. Zool. 52, 45–63.

Coluzzi, M., Sabatini, A., Della Torre, A., Di Deco, M.A., Petrarca, V., 2002. A polytenechromosome analysis of the Anopheles gambiae species complex. Science 298,1415–1418.

Corbel, V., N’guessan, R., Brengues, C., Chandre, F., Djogbenou, L., Martin, T., Akogbéto,M., Houghard, J.M., Rowland, M., 2007. Multiple insecticide resistance mecha-nisms in Anopheles gambiae and Culex quinquefasciatus from Benin. West Africa.Acta. Trop. 101, 207–216.

Dabiré, K.R., Diabaté, A., Djogbenou, L., Ouari, A., N‘guessan, R., Ouédraogo, J.B.,Hougard, J.M., Chandre, F., Baldet, T., 2009a. Dynamics of multiple insecticideresistance in the malaria vector Anopheles gambiae in a rice growing area inSouth-Western Burkina Faso. Malaria J. 7, 188.

Dabiré, K.R., Diabaté, A., Namountougou, M., Djogbenou, L., Kengne, P., Ouédraogo,J.B., Simard, F., Bass, C., Baldet, T., 2009b. The distribution of insensitive acetyl-cholinesterase (ace-1R) in Anopheles gambiae s.l. populations from Burkina Faso(West Africa). Trop. Med. Int. Health 14, 396–403.

Dabiré, K.R., Diabaté, A., Namountougou, M., Toé, K.H., Ouari, A., Kengne, P., Bass, C.,Baldet, T., 2009c. Distribution of pyrethroid and DDT resistance and the L1014Fkdr mutation in Anopheles gambiae s l. from Burkina Faso (West Africa). Trans. R.Soc. Trop. Med. Hyg. 103, 1113–1120.

Dabiré, K.R., Diabaté, A., Namountougou, M., Djogbenou, L., Wondji, C., Chandre, F.,Simard, F., Ouédraogo, J-B., Martin, T., Weill, M., Baldet, T., 2012. Trends in insec-ticide resistance in natural populations of malaria vectors in Burkina Faso, WestAfrica: 10 years’ surveys. In Insecticides—Pest Engineering. Edited by Perveen F.


ISBN: 978-953-307-895-3. Rijeka and Shanghai: InTech., 479–502.De Barro, P., Ahmed, M., 2011. Genetic networking of the Bemisia tabaci cryptic

species complex reveals pattern of biological invasions. PLoS ONE 6, e25579.De Barro, P.J., Liu, S.S., Boykin, L.M., Dinsdale, B., 2011. Bemisia tabaci: a statement

of species status. Annu. Rev. Entomol. 56, 1–19.


http://dx.doi.org/10.1016/j.actatropica.2013.06.004

http://dx.doi.org/10.1016/j.actatropica.2013.06.004

http://refhub.elsevier.com/S0001-706X(13)00151-4/sbref0005





































































































































































































































































































































































































































































































































































ING Model

A

1 a Trop

D

D

D

D

D

D

D

D

D

D

D

D

D

E

F

F

F

F

G

G

G

G

G

G

G


0 O. Gnankiné et al. / Act

ella Torre, A., Fanello, C., Akogbeto, M.J., Dossou-Yovo, G., Favia, V., Petrarca, M.,Coluzzi, M., 2001. Molecular evidence of incipient speciation within Anophelesgambiae s.s. in West Africa. Insect. Mol. Biol. 10, 9–18.

ella Torre, A., Tu, Z., Petrarca, V., 2005. On the distribution and genetic differenti-ation of Anopheles gambiae s.s. molecular forms. Insect. Biochem. Mol. Biol. 35,7055–7069.

iabaté, A., Baldet, T., Chandre, F., Akogbeto, M., Darriet, F., Brengues, C., Guillet,P., Hemingway, J., Small, G.J., Hougard, J.M., 2002a. The role of agricultural useof insecticides in resistance to pyrethroids in Anopheles gambiae s.l. in BurkinaFaso. Am. J. Trop. Med. Hyg. 67, 617–622.

iabaté, A., Baldet, T., Chandre, F., Guiguemde, R.T., Brengues, C., Guillet, P., Hem-ingway, J., Hougard, J.M., 2002b. First report of the kdr mutation in Anophelesgambiae M form from Burkina Faso, West Africa. Parassitologia 44, 157–158.

iabaté, A., Baldet, T., Chandre, C., Dabire, K.R., Kengne, P., Guiguemde, T.R., Simard,F., Guillet, P., Hemingway, J., Hougard, J.M., 2003. Kdr mutation, a genetic markerto assess events of introgression between the molecular M and S forms ofAnopheles gambiae (Diptera: Culicidae) in the tropical savannah area of WestAfrica. J. Med. Entomol. 40, 195–198.

iabaté, A., Baldet, T., Chandre, F., Dabiré, K.R., Simard, F., Ouédraogo, J.B., Guillet,P., Hougard, J.M., 2004. First report of kdr mutation in Anopheles arabiensis fromBurkina Faso, West Africa. J. Am. Mosq. Control Assoc. 20, 195–196.

iabaté, A., Dabire, R.K., Millogo, N., Lehmann, T., 2007. Evaluating the effect ofpostmating isolation between molecular forms of Anopheles gambiae (Diptera:Culicidae). J. Med. Entomol. 44, 60–64.

ittrich, V., Ernst, G.H., Ruesh, O., Solang, U.K., 1990. Resistance mechanismsin sweet-potato whitefly (Homoptera: Aleyrodidae) populations from Sudan,Turkey, Guatemala, and Nicaragua. J. Econ. Entomol. 83, 1665–1670.

jègbè, I., Boussari, O., Sidick, A., Martin, T., Ranson, H., Chandre, F., Akogbéto, M.,Corbel, V., 2011. Dynamics of insecticide resistance in malaria vectors in Benin:first evidence of the presence of L1014S kdr mutation in Anopheles gambiae fromWest Africa. Malaria J. 10, 261.

jogbenou, L., Chandre, F., Berthomieu, A., Dabiré, R., Koffi, A., Haoues, A., Weill,M., 2008a. Evidence of introgression of the ace-1(R) mutation and of the ace-1duplication in West African Anopheles gambiae s. s. PLoS ONE 3 (5), e2172.

jogbénou, L., Dabiré, R., Diabaté, A., Kengne, P., Akogbéto, M., Hougard, J.M., Chan-dre, F., 2008b. Identification and geographic distribution of the Ace-1R mutationin the malaria vector Anopheles gambiae in south-western Burkina Faso, WestAfrica. Am. J. Trop. Med. Hyg. 78, 298–302.

jogbénou, L., Labbé, P., Chandre, F., Pasteur, N., Weill, M., 2010. Ace-1 duplicationin Anopheles gambiae: a challenge for malaria control. Malaria J. 8, 70.

jogbenou, L., Pasteur, N., Akogbéto, M., Weill, M., Chandre, F., 2011. Insecticideresistance in the Anopheles gambiae complex in Benin: a nationwide survey.Med. Vet. Entomol. 25, 256–267.

tang, J., Fonjo, E., Chandre, F., Morlais, I., Brengues, C., Nwane, P., Chouaibou, M.,Ndjemai, H., Simard, F., 2006. Short report First report of knockdown mutationsin the malaria vector Anopheles gambiae from Cameroon. Am. J. Trop. Med. Hyg.74, 795–797.

anello, C., Akogbeto, M., Della-Torre, A., 2000. Distribution of the knockdown resis-tance gene (kdr) in Anopheles gambiae s.l. from Benin. Trans. R. Soc. Trop. Med.Hyg. 94, 132.

avia, G., Lanfrancotti, A., Spanos, L., Siden-Kiamos, I., Louis, C., 2001. Molecularcharacterization of ribosomal DNA polymorphisms discriminating among chro-mosomal forms of Anopheles gambiae s.s. Insect. Mol. Biol. 10, 19–23.

ossog, B.T., Kopya, E., Ndo, C., Menze-Djantio, B., Costantini, C., Njiokou, F., Awono-Ambene, P., Antonio-Nkondjio, C., 2012. Water quality and Anopheles gambiaelarval tolerance to pyrethroids in the cities of Douala and Yaoundé (Cameroon).J. Trop. Med., 10, Article ID 429817, doi:10.1155/2012/429817.

rohlich, D.R., Torres-Jerez, I.I., Bedford, I.D., Markham, P.G., Brown, J.K.A., 1999.Phylogeographical analysis of the Bemisia tabaci species complex based onmitochondrial DNA markers. Mol. Ecol. 8, 1683–1691.

eorghiou, G.P., 1982. The implication of agricultural insecticides in the develop-ment of resistance by mosquitoes with emphasis on Central America. In: InProceedings of an International Workshop on Resistance to Insecticides Usedin Public Health and Agriculture, 22–26 February. Sri Lanka: National ScienceCouncil, pp. 95–121.

illies, M.T., Coetzee, M., 1987. A supplement to the Anophelinae of Africa south ofthe Sahara (Afrotropical Region). In: Publications of the South African Institutefor Medical Research (SAIMR), vol. 55., pp. 1–143.

nankiné, O., Traoré, D., Dakouo, D., Sanon, A., Ouedraogo A.P., 2002. Evolution de lasensibilité des adultes de Bemisia tabaci (Homoptera: Aleyrodidae) vis-à-vis dequelques insecticides dans l’ouest du Burkina Faso. Rev. Science et technique,Série Sciences Naturelles et Agronomie 26, 157-170.

nankiné, O., Traore, D., Sanon, A., Traore, N.S., Ouedraogo, A.P., 2007. Traitementsinsecticides et dynamique des populations de Bemisia tabaci en culture coton-nière au Burkina Faso. Cah. Agric. 16, 101–109.

nankiné, O., 2011. Caracterisation moleculaire des populations de Bemisia tabaci(Homoptera: Aleyrodidae) et diffusion de la résistance aux insecticides enAfrique de l’ouest. In: Rapport de stage Nov 2010–Mars 2011. Université ClaudeBernard de Lyon 1, UMR-CNRS, pp. 22.

nankiné, O., Mouton, L., Henri, H., Terraz, G., Houndeté, T., Martin, T., Vavre, F.,Fleury, F., 2013a. Distribution of Bemisia tabaci (Homoptera: Aleyrodidae) bio-


types and their associated symbiotic bacteria on host plants in West Africa.Insect. Conserv. Diver. 6, 411–421.

nankiné, O., Ketoh, G., Martin, T., 2013b. Dynamics of the invasive Bemisia tabaci(Homoptera: Aleyrodidae) Mediterranean (MED) species in two West Africancountries. Int. J. Trop. Insect. Sci. 33, 99–106.

PRESSica xxx (2013) xxx– xxx

Greenplate, J.T., Mullins, J.W., Penn, S.R., Dahhm, A., Reich, B.J., Osborn, J.A., Rahn,P.R., Ruschke, L., Shappley, Z.W., 2003. Partial characterization of cotton plantsexpressing two toxin proteins from Bacillus thuringiensis: relative toxin con-tribution, toxin interaction, and resistance management. J. Appl. Entomol. 127,340–347.

Gueguen, G., Vavre, F., Gnankine, O., Peterschmitt, M., Charif, D., Chiel, E., Gottlieb, Y.,Ghanim, M., Zchori-Fein, E., Fleury, F., 2010. Endosymbiont metacommunities,mtDNA diversity and the evolution of the Bemisia tabaci (Hemiptera Aleyrodi-dae) species complex. Mol. Ecol. 19, 4365–4378.

Hemingway, J., 1983. Biochemical studies on malathion resistance in Anopheles ara-biensis from Sudan. Trans. R. Soc. Trop. Med. Hyg. 77, 477–480.

Hemingway, J., 1998. Techniques to Detect Insecticide Resistance Mechanisms (Fieldand Laboratory Manual), Document WHO/CDS/CPC/MAL/98. 6. World HealthOrganization, Geneva, Switzerland, pp. 42.

Himler, A.G., Adachi-Hagimori, T., Bergen, J.E., Kozuch, A., Kelly, S.E., Tabashnik, B.E.,Chiel, E., Duckwort, V.E., Dennehy, T.J., Zchori-Fein, E., Hunter, M.S., 2011. Rapidspread of a bacterial symbiont in an invasive whitefly is driven by fitness benefitsand female bias. Science 272, 254–256.

Hoffmann, A.A., Montgomery, B.L., Popovici, J., Iturbe-Ormaetxe, I., Johnson,P.H., Muzzi, F., Greenfield, M., Durkan, M., Leong, Y.S., Dong, Y., Cook, H.,Axford, J., Callahan, A.G., Kenny, N., Omodei, C., Mcgraw, E.A., Ryan, P.A.,Ritchie, S.A., Turelli, M., O’Neill, S.L., 2011. Successful establishment of Wol-bachia in Aedes populations to suppress dengue transmission. Nature 476,454–457.

Horowitz, A.R., Denholm, I., Gorman, K., Cenis, J.L., Kontsedalov, S., Ishaaya, I.,2003. Biotype Q of Bemisia tabaci identified in Israel. Phytoparasitica 31,94–98.

Horowitz, A.R., Kontsedalov, S., Khasdan, V., Ishaaya, I., 2005. Biotypes B and Q ofBemisia tabaci and their relevance to neonicotinoid and pyriproxyfen resistance.Arch. Insect. Biochem. Physiol. 58, 216–225.

Houndété, T.A., Kétoh, G.K., Hema, O.S.A., Brévault, T., Glitho, I.A., Martin, T., 2010.Insecticide resistance in field populations of Bemisia tabaci (Hemiptera Aleyro-didae) in West Africa. Pest. Manage Sci. 66, 1181–1185.

Hughes, G.L., Koga, R., Xue, P., Fukatsu, T., Rasgon, J., 2011. Wolbachia infectionsare virulent and inhibit the human malaria parasite Plasmodium falciparum inAnopheles gambiae. PLoS Pathogen 7, e1002043.

Jones, D.R., 2003. Plant viruses transmitted by whiteflies. Eur. J. Plant Pathol. 109,195–219.

Karunker, I., Benting, J., Lueke, B., Ponge, T., Nauen, R., Roditakis, E., Vontas, J., Gor-man, K., Ian Denholm, I., Morin, S., 2008. Overexpression of cytochrome P450CYP6CM1 is associated with high resistance to imidacloprid in the B and Q bio-types of Bemisia tabaci (Hemiptera: Aleyrodidae). Insect. Biochem. Mol. Biol. 38,634–644.

Kawada, H., Dida, G.O., Ohashi, K., Komagata, O., Kasai, S., Tomita, T., Sonye, G.,Maekawa, Y., Mwatele, C., Njenga, S.M., Mwandawiro, C., Minakawa, N., Tak-agi, M., 2011. Multimodal pyrethroid resistance in malaria vectors, Anophelesgambiae s.s., Anopheles arabiensis, and Anopheles funestus s.s. in Western Kenya.PLoS ONE 6 (8), e22574, doi:10.1371/journal.pone.0022574.

Kelly-Hope, L., Ranson, H., Hemingway, J., 2008. Lessons from the past: manag-ing insecticide resistance in malaria control and eradication programs. Lancet.Infect. Dis. 8, 387–389.

Khasdan, V., Levin, I., Rosner, A., Morin, S., Kontsedalov, S., Maslenin, L., Horowitz,A.R., 2005. DNA markers for identifying biotypes B and Q of Bemisia tabaci(Hemiptera Aleyrodidae) and studying population dynamics. Bull. Entomol. Res.95, 605–613.

Martin, T., Chandre, F., Ochou Ochou, G., Vaissayre, M., Fournier, D., 2002. Pyrethroidresistance mechanisms in the cotton bollworn Helicoverpa armigera (Lepi-doptera Noctuidae) from West Africa. Pestic. Biochem. Physiol. 74, 17–26.

Martin, T., Ochou Ochou, G., Hala N‘klo, F., Vassal, J.M., Vaissayre, M., 2000. Pyrethroidresistance in the cotton bollworm Helicoverpa armigera (Hübner), in West Africa.Pestic. Manage. Sci. 56, 549–554.

Martin, T., Ochou, O.G., Djihinto, A., Traore, D., Togola, M., Vassal, J.M., Vaissayre, M.,Fournier, D., 2005. Controlling an insecticide-resistant bollworm in West Africa.Agric. Ecosyst. Environ. 107, 409–411.

Martinez-Torres, D., Chandre, F., Williamson, M.S., Darriet, F., Bergé, J.B., Devon-shire, A.L., Guillet, P., Pasteur, N., Pauron, D., 1998. Molecular characterization ofpyrethroid knockdown resistance (kdr) in the major malaria vector Anophelesgambiae s.s. Insect. Mol. Biol. 7, 179–184.

McKenzie, Hodges, C.L., Osborne, G., Byrne, L.S., Shatters, F.J., R.G.Jr., 2009.Distribution of Bemisia tabaci (Hemiptera: Aleyrodidae) biotypes inFlorida—investigating the Q invasion. J. Econ. Entomol. 102, 670–676.

Mouchet, J., 1988. Mini-review agriculture and vector resistance. Insect. Sci. Appl. 9,291–302.

Musa, D.P., Ren, S.X., 2005. Development and reproduction of Bemisia tabaci(Homoptera: Aleyrodidae) on three bean species. Insect Sci. 12, 25–30.

N’Guessan, R., Corbel, V., Akogbeto, M., Rowlands, M., 2007. Reduced efficacy ofinsecticide-treated nets and indoor residual spraying for malaria control inpyrethroid resistance area, Benin. Emerg. Infect. Dis. 13, 199–206.

Namountougou, M., Diabaté, A., Etang, J., Bass, C., Sawadogo, S.P., Gnankine, O.,Baldet, T., Martin, T., Chandre, F., Simard, F., Dabire, R.K., 2013. First report ofthe L1014S kdr mutation in wild populations of Anopheles gambiae M and S


molecular forms in Burkina Faso (West Africa). Acta. Trop. 125, 123–127.Namountougou, M., Simard, F., Baldet, T., Diabaté, A., Ouédraogo, J.B., Martin,

T., Dabire, K.R., 2012. Multiple Insecticide Resistance in Anopheles gam-biae s.l. populations from Burkina Faso, West Africa. PLoS ONE 7, e48412,doi:10.1371/journal.pone.0048412.



















































































































































































































































































































































































































































































































































































































































































































































































































































































































































































































































































































































































ING Model

A

Trop

N

O

O

P

PP

P

R

R

R

S

S

S



azni, W.A., Lee, H.L., Azahari, A.H., 2005. Adult and larval insecticide susceptibilitystatus of Culex quinquefasciatus (Say) mosquitoes in Kuala Lumpur, Malaysia.Trop. Biomed. 22, 63–68.

chou, O.G., Martin, T., 2003. Activity spectrum of Spinosad and Indoxacarb rationalefor a differential resistance management strategy in West Africa. Resistance Pest.Manage. Newslett. 12, 75–81.

toidobiga, L.C., Vincent, C., Stewart, K.R., 2002. Susceptibility of field populationsof adult Bemisa tabaci Gennadius (Homoptera Aleyrodidae) and Eretmocerussp. (Hymenoptera: Aphelinidae) to cotton insecticides in Burkina Faso (WestAfrica). Pest. Manage Sci. 59, 97–106.

ascual, S., Callejas, C., 2004. Intra- and interspecific competition between biotypesB and Q of Bemisia tabaci (Hemiptera Aleyrodidae) from Spain. Bull. Entomol.Res. 94, 369–375.

erring, T.M., 2001. The Bemisia tabaci species complex. Crop Prot. 20, 725–737.lapp, F.W., Mcwhorter, G.M., Vance, W.H., 1987. Monitoring for pyrethroid resis-

tance in the tobacco budworm in Texas. In Proceedings, Beltwide CottonProduction Research Conferences. Memphis, TN: National Cotton Council ofAmerica, 324–326.

ray, C.E., Huang, J., Hu, R., Rozelle, S., 2002. Five years of Bt cotton in China – thebenefits continue. Plant J. 31, 423–430.

aghavendra, R., Barik, T.K., Reddy, B.P.N., Sharma, P., Dash, A.P., 2011. Malaria vectorcontrol: from past to future. Parasitol. Res. 108, 757–779.

oditakis, E., Grispou, M., Morou, E., Kristoffersen, J., Roditakis, N., Nauen, R., Vontas,J., Tsagkarakou, A., 2009. Current status of insecticide resistance in Q biotypeBemisia tabaci populations from Crete. Pest. Manage. Sci 65, 313–322.

owland, M., Hackete, B., Stribley, M., 1991. Evaluation of insecticides in field controlsimulators and standard laboratory bioassays against resistant and suscepti-ble Bemisia tabaci (Homoptera Aleyrodidae) from Sudan. Bull. Entomol. Res. 81,189–199.

cott, J.A., Brogdon, W.G., Collins, F.H., 1993. Identification of single specimens ofAnopheles gambiae complex by polymerase chain reaction. Am. J. Trop. Med.Hyg. 49, 520–529.

hchukin, A., Wool, D., 1994. Pyrethroid resistance and esterase activity in selectedlaboratory populations of sweetpotato whitefly Bemisia tabaci (Homoptera Aley-



rodidae). Eur. J. Entomol. 91, 285–295.imard, F., Ayala, D., Kamdem, G., Pombi, M., Etouna, J., Ose, K., Fotsing, J-M.,

Fontenille, D., Besansky, N.J., Costantini, C., 2009. Ecological niche partitioningbetween Anopheles gambiae molecular forms in Cameroon: the ecological sideof speciation. BMC Ecol. 9, 17.


Simon, B., Cenis, J.L., Demichelis, S., Rapisarda, C., Caciagli, P., Bosco, D., 2003. Surveyof Bemisia tabaci (Hemiptera Aleyrodidae) biotypes in Italy with the descrip-tion of a new biotype (T) from Euphorbia characias. Bull. Entomol. Res. 93,259–264.

Sivasupramaniam, S., Johnson, S., Watson, T.F., Osman, A.A., Jassim, R., 1997. A glass-vial technique for monitoring resistance of the silverleaf whitefly (Homoptera:Aleyrodidae) to selected insecticides in Arizona. J. Econ. Entomol. 90,66–74.

Touré, Y.T., Petrarca, V., Traore, S.F., Coulibaly, A., Maiga, H.M., Sankare, O., Sow, M.,Di Deco, M.A., Coluzzi, M., 1998. The distribution and inversion polymorphismof chromosomally recognized taxa of the Anopheles gambiae complex in Mali,West Africa. Parassitologia 40, 477–511.

Tsagkarakou, A., Nikou, D., Roditakis, E., Sharvit, M., Morin, S., Vontas, J., 2009.Molecular diagnostics for detecting pyrethroid and organophosphate resistancemutations in the Q biotype of the whitefly Bemisia tabaci (Hemiptera Aleyrodi-dae). Pestic. Biochem. Physiol. 94, 49–54.

Verhaeghen, K., Van-Bortel, W., Roelants, P., Backeljau, T., Coosemans, M., 2006.Detection of the East and West African kdr mutation in Anopheles gambiae andAnopheles arabiensis from Uganda using a new assay based on FRET/Melt curveanalysis. Malaria J. 5, 16.

Weill, M., Chandre, F., Brengues, C., Manguin, S., Akogbeto, M., Pasteur, N., Guillet,P., Raymond, M., 2000. The kdr mutation occurs in the Mopti form of Anophelesgambiae s.s. through introgression. Insect. Mol. Biol. 9, 451–455.

Weill, M., Malcolm, C., Chandre, F., Mogensen, K., Berthomieu, A., Marquin, M., Ray-mond, M., 2004. The unique mutation in ace-1 giving high insecticide resistanceis easily detectable in mosquito vectors. Insect. Mol. Biol. 13, 1–7.

WHO, 1998. Test procedures for insecticides resistance monitoring in malariavectors, bioefficacy and persistence of insecticides treated surfaces, No.WHO/CDS/MAL. Geneva: World Health Organization, 46 pp.

WHO, 2011. The technical basis for coordinated action against insecticide resistance:preserving the effectiveness of modern malaria vector control, meeting report.Geneva, World Health Organization, 36 pp.

Xu, J., De Barro, P.J., Liu, S.S., 2010. Reproductive incompatibility among geneticgroups of Bemisia tabaci supports the proposition that the whitefly is a cryptic


species complex. Bull. Entomol. Res. 100, 359–366.Yadouleton, A.W., Martin, T., Padonou, G., Chandre, F., Asidi, A., Djogbenou, L., Dabiré,

R., Aïkpon, R., Boko, M., Glitho, I., Akogbeto, M., 2011. Cotton pest manage-ment practices and the selection of pyrethroid resistance in Anopheles gambiaepopulation in Northern Benin. Parasit. Vectors 4, 60.


































































































































































































































































































































































































































































































Documents

Insecticide resistance in Bemisia tabaci Gennadius (Homoptera