Pesticide Biochemistry and Physiology 107 (2013) 377–384

Contents lists available at ScienceDirect

Pesticide Biochemistry and Physiology

journal homepage: www.elsevier .com/locate /pest

Insecticide resistance in house flies from the United States: Resistancelevels and frequency of pyrethroid resistance alleles

0048-3575/$ - see front matter � 2013 Elsevier Inc. All rights reserved.http://dx.doi.org/10.1016/j.pestbp.2013.10.006

⇑ Corresponding author. Fax: +1 (607) 255 0939.E-mail address: JGS5@CORNELL.EDU (J.G. Scott).

Jeffrey G. Scott a,⇑, Cheryl A. Leichter a, Frank D. Rinkevihc a, Sarah A. Harris a, Cathy Su a,Lauren C. Aberegg a, Roger Moon g, Christopher J. Geden b, Alec C. Gerry c, David B. Taylor d,Ronnie L. Byford e, Wes Watson f, Gregory Johnson h, David Boxler i, Ludek Zurek j

a Department of Entomology, Comstock Hall, Cornell University, Ithaca, NY 14853 USAb USDA-ARS, 1600 SW 23rd Dr., Gainesville, FL 32608, USAc Department of Entomology, University of California, Riverside, CA 92521, USAd USDA-ARS, 305 Entomology Hall, Lincoln, NE 68583, USAe Center for Animal Health & Food Safety, NMSU, Las Cruces, NM 88003, USAf Department of Entomology, NCSU, Raleigh, NC 27695, USAg University of Minnesota, 219 Hodson Hall, St. Paul, MN 55108, USAh Department of A&RS, Montana State University, Bozeman, MT 59717, USAi West Central Research and Extension Center, UNL, North Platte, NE 69101, USAj Department of Entomology, Kansas State University, Manhattan, KS 66506, USA

a r t i c l e i n f o

Article history:Received 4 September 2013Accepted 10 October 2013Available online 23 October 2013

Keywords:OrganophosphateCarbamateMusca domesticaNeonicotinoidkdr-type resistanceCYP6D1

a b s t r a c t

Although insecticide resistance is a widespread problem for most insect pests, frequently the assessmentof resistance occurs over a limited geographic range. Herein, we report the first widespread survey ofinsecticide resistance in the USA ever undertaken for the house fly, Musca domestica, a major pest in ani-mal production facilities. The levels of resistance to six different insecticides were determined (using dis-criminating concentration bioassays) in 10 collections of house flies from dairies in nine different states.In addition, the frequencies of Vssc and CYP6D1 alleles that confer resistance to pyrethroid insecticideswere determined for each fly population. Levels of resistance to the six insecticides varied among statesand insecticides. Resistance to permethrin was highest overall and most consistent across the states.Resistance to methomyl was relatively consistent, with 65–91% survival in nine of the ten collections.In contrast, resistance to cyfluthrin and pyrethrins + piperonyl butoxide varied considerably (2.9–76%survival). Resistance to imidacloprid was overall modest and showed no signs of increasing relative tocollections made in 2004, despite increasing use of this insecticide. The frequency of Vssc alleles that con-fer pyrethroid resistance was variable between locations. The highest frequencies of kdr, kdr-his andsuper-kdr were found in Minnesota, North Carolina and Kansas, respectively. In contrast, the New Mexicopopulation had the highest frequency (0.67) of the susceptible allele. The implications of these results toresistance management and to the understanding of the evolution of insecticide resistance are discussed.

� 2013 Elsevier Inc. All rights reserved.

1. Introduction

The house fly, Musca domestica, is a common pest that isnecessary to control due to its role as a disease vector in humans,livestock, and poultry. House flies have been identified as mechan-ical vectors of pathogens that cause a large number of diseases suchas salmonellosis, polio, coxsackie, hepatitis, bacillary dysentery,cholera, typhoid, paratyphoid and amoebic dysentery [1–5]. Houseflies are also an effective vector of Escherichia coli O157:H7 amongcattle and from cattle to humans, leading to possible outbreaks of

enterohemorrhagic colitis [6,7]. Exotic Newcastle virus that causesa particularly virulent disease affecting poultry and other birds, hasbeen isolated from field collected house flies that have been in con-tact with infected birds [8,9]. Losses due to house flies were esti-mated at $100 million in 1976 [10] which is equivalent to >$400million in 2013 (due to inflation), with most of those losses arisingfrom the costs of control. Just as important, but less easily quantifi-able are the losses from legal fees and disruptions in productionwhen relations with non-farm neighbors reach a flashpoint overfly outbreaks. Insecticide resistance is one of the greatest challengesin applied pest control [11]. Therefore, an understanding of themechanisms of insecticide resistance and the identification of thegenes involved is considered critical for resistance monitoring andmanagement [12].

378 J.G. Scott et al. / Pesticide Biochemistry and Physiology 107 (2013) 377–384

Pyrethroid insecticides are the most common class of insecti-cides used in house fly control due to their relatively high efficacy,low mammalian toxicity, low persistence in the environment andlow toxicity to many non-target organisms [13]. Pyrethroids areneurotoxins that act at the voltage-sensitive sodium channel(Vssc). Two major mechanisms of resistance to pyrethroid insecti-cides have evolved: mutations in Vssc leading to target site insen-sitivity [14–16], and cytochrome P450 monooxygenase-mediateddetoxification [17–19].

Three alleles of house fly Vssc confer resistance to pyrethroids inhouse flies: kdr, kdr-his, and super-kdr [20,21]. The kdr allele is dueto a single amino acid change from leucine to phenylalanine atamino acid 1014 (L1014F) [15]. The super-kdr allele is due to twomutations, M918T (methionine to threonine) + L1014F [15], andarises from individuals already having kdr [22,24]. The kdr-his al-lele is due to a single amino acid change from leucine to histidineat amino acid 1014 (L1014H) [23]. All three alleles are found glob-ally, although the frequency of alleles varies dramatically betweenlocations [20,21,24,25,36]. The role of these mutations in resis-tance has been confirmed by electrophysiological studies [15].The level of protection conferred by these alleles in vivo is highestfor super-kdr followed by kdr and lowest for kdr-his [21,26],although the information available about kdr-his is very limited.Heterologous expression of insect sodium channels in Xenopus oo-cytes suggested resistance factors of 259 and 13 for permethrin,and 49 and 66 for deltamethrin, for the 1014F and 1014H muta-tions, respectively [27].

The second major mechanism of resistance to pyrethroids inhouse flies is the increased metabolism of xenobiotics by cyto-chrome P450s [17,28]. Overexpression of house fly CYP6D1v1 isresponsible for resistance to phenoxybenzyl pyrethroids [29–34]and is found throughout the world [21,35–37], although otherP450s may be responsible for pyrethroid resistance in house fliesin Japan [25,28] (and perhaps other areas as well [38,39]).

The role of Vssc and CYP6D1 resistance alleles varies betweeninsecticides. Resistance to permethrin is conferred by three Vssc al-leles (super-kdr, kdr and kdr-his) [26,39] as well as CYP6D1v1 [19].Piperonyl butoxide (PBO) is a synergist that inhibits P450 monoox-ygenases, effectively eliminating the contribution of CYP6D1v1 toresistance to pyrethrins + PBO [25]. Cyfluthrin has a substitutedphenoxybenzyl group which limits the metabolism by CYP6D1[40]. The level of resistance conferred by the three Vssc alleles topyrethrins + PBO and to cyfluthrin has not been reported.

Previous studies have found that both Vssc and CYP6D1 resis-tance alleles occur in high frequencies in field collected flies fromFlorida, North Carolina, New York and Maine, although the pat-terns vary between locations [21,39]. However, very little is knownabout the relative change of these allele frequencies over time. Themost recent work has been done on the seasonal fluctuations of thefrequencies of the resistance alleles in field populations in NewYork and Florida. In New York there was a change in the Vssc andCYP6D1 allele frequencies throughout the season coincident withselection by permethrin, whereas the change in allele frequenciesin Florida did not follow the same pattern [39]. It is currently notknown whether the difference in resistance frequencies is basedon differences in climate, selection by insecticides or some otherfactor, such as a putative new resistance allele [39]. It is also un-known if the super-kdr allele will increase in frequency due to con-tinued permethrin and cyfluthrin use, or decrease due to a possiblehigh fitness cost in the absence of insecticide [39]. Previous studieshave found super-kdr only in New York and at low levels [39].Knowledge of whether super-kdr has increased in frequency inNew York and if it can be found in other states is of interest.

The levels of resistance in house flies at dairies within a stateare very similar, independent of insecticide use at the diary[41,42]. However, resistance levels do vary between states [43].

The goal of this study was to determine the levels of resistanceto the six most widely used insecticides for house fly control acrossthe USA, and to determine the frequency of Vssc and CYP6D1 al-leles. Flies were collected from dairies in nine states across theUSA. The allelic frequencies of Vssc and CYP6D1 alleles were iden-tified and compared to bioassay results to determine if the resultscorrelate. A comparison of these results to previous studies pro-vides information on the relative stability of pyrethroid resistancealleles over time. A strain having only kdr-his was isolated andfound to have 4.9 – 7.8-fold resistance to four pyrethroids.

2. Materials and methods

2.1. House Flies

Cornell Susceptible (CS), an insecticide-susceptible strain ofhouse fly, was reared without exposure to insecticides for decades[43] and was used as the reference susceptible strain for these stud-ies. House flies were collected from July to October in 2008 fromdairy facilities in New Mexico (Dona Ana County, July), Minnesota(Ramsey County, July), Nebraska (Saunders County, September),Montana (Gallatin County, August), and California (RiversideCounty, October). In 2009, collections were made from Junethrough October in Florida (Gilchrist County, June), North Carolina(Wake County, July), New York (Chemung County, August), Nebras-ka (Lincoln County, September 2009) and Kansas (Riley County,October). To assure a diverse representation of house flies fromeach site, adult house flies were collected from a minimum of threedifferent locations at participating dairies. Eggs were obtained fromthe collected flies on two separate days (batch 1 and batch 2) andreared through pupation. Pupae from each batch were then sentto Cornell University. For each strain, separate laboratory coloniesof each batch were established. Adult house flies were maintainedon powdered milk + granulated sugar (1:1 by volume) and waterad libitum. House fly larvae were reared on medium containing2.3 L of water, 0.5 kg calf manna (Manna Pro Corp., St. Louis, MO),90 g bird and reptile litter wood chips (Northeastern Products Corp.,Warnersberg, NY), 50 g dried active baker’s yeast (ICN Biomedicals,Costa Mesa, CA), and 0.8 kg wheat bran (Agway, Ithaca, NY).

2.2. Insecticides

Six insecticides were used to evaluate resistance in the field col-lected populations: pyrethrins (58.9%, Whitmire Micro-Gen ResearchLabs, St. Louis, MO) with the addition of PBO (90%, Sigma Aldrich, Mil-waukee, WI), imidacloprid (98%, Bayer Crop Science AG, Germany),cyfluthrin (98%), permethrin (99.3%), tetrachlorvinphos (99.4%), andmethomyl (99.5%) (Chem Service Inc., Westchester, PA). These sixinsecticides were selected to represent those that are most commonlyused across the USA (2000–2007), based upon responses to a surveycompleted by authors in each of the participating states. Responsesto the surveys indicated numerous insecticides used for house fly con-trol in the USA (chlorpyrifos, cyfluthrin, cyhalothrin, cypermethrin,dichlorvos, diflubenzuron, fenvalerate, imidacloprid, methomyl,naled, permethrin (some formulations contain PBO), pyrethrins +PBO, spinosad, and tetrachlorvinphos (some formulations containdichlorvos)), although there was significant variability in each state.Reliable use statistics for each insecticide at dairies in each state werenot available. Permethrin, deltamethrin (99.5%), resmethrin (98.2%)and cypermethrin (99.0%) (Chem Service) were used to evaluate resis-tance conferred by the kdr-his allele (see below) relative to the suscep-tible aabys [43] strain.

Table 1Sequences of primers used in this study.

Primer Name Sequence (50–30)

kdrDIGLongF TCGCTTCAAGGACCATGAACTACCGCGCTGkdrDIGLongR CCGAAGTTGGACAAAAGCAAAGCTAAGAAAAGSuperkdrLongF CTCTGCTGGAATTGGGCCTGGAGGGTGTCCSuperkdrLongR AGTTGCATTCCCATCACGCGAAAGATCAAGSkdrUSInternal GCCACCAGTTTTCCTTAAATATGCCS23 TATGGCATGACGTTGATGCGAS6 CAGTTTTGTGTCGGGTACTTG

J.G. Scott et al. / Pesticide Biochemistry and Physiology 107 (2013) 377–384 379

2.3. Bioassays

To evaluate resistance in the field collected flies, insecticideswere evaluated using either a residual contact assay (pyrethrins+ PBO, permethrin, tetrachlorvinphos, and cyfluthrin) or a feedingassay (methomyl and imidacloprid) at diagnostic concentrationsused for resistance monitoring [41,44]: pyrethrins (39 ng/cm2) +PBO (2.2 lg/cm2), permethrin (234 ng/cm2), tetrachlorvinphos(670 ng/cm2), cyfluthrin (249 ng/cm2), methomyl (42 lg/mL) andimidacloprid (0.3 mg/mL).

Flies from the first through the third generation were bioas-sayed. Batch 1 and batch 2 flies were bioassayed separately (exceptKansas where batches were combined to obtain enough animalsfor the assays). The CS strain was routinely used to confirm thatthe diagnostic concentrations were killing 100% of the susceptiblestrain as expected. Residual contact bioassays were conducted asfollows: glass jars (230 mL, internal surface area is 180 cm2) weretreated with 1 mL of the insecticide (in acetone), the acetone wasallowed to evaporate for at least 30 min, and 25 3–5-d old femaleswere transferred to each treated jar. Two dental wicks (2.5 cm) sat-urated with 15% sugar-water were supplied in each jar. Methomyland imidacloprid are commercially available as bait formulations;therefore, they were evaluated via a feeding assay in which flieswere exposed to dental wicks which were saturated in a 15% su-gar-water solution containing the desired concentration of eachcompound. For all insecticides, a minimum of 225 flies were tested.Bioassays were kept at 25 �C with a 12:12 (L:D) photo period. Mor-tality was assessed after 48 h (72 h for imidacloprid). Ataxic flieswere considered dead. There was no significant difference betweenbatch 1 and batch 2 results observed for any of the collection sites,so the data for both batches were combined for each location. Mea-sures of percent survival for populations from the different stateswere arcsine transformed and differences were compared using a1-way ANOVA followed by Tukey’s HSD to test for significant dif-ferences between collections.

2.4. Isolation of genomic DNA

Extraction of genomic DNA from the 2008 collections was con-ducted as follows. Individual adult males were placed in 1.5 mLtubes and frozen in liquid nitrogen. Animals were quickly and com-pletely pulverized with disposable pestles (Kontes Glassware,Vineland, NJ) and resuspended in 0.5 ml of lysis buffer (100 mMTris–HCl pH 8.0, 50 mM NaCl, 10 mM EDTA, with 1% (w/v) SDS,0.5 mM spermidine, 0.15 mM spermine, and 0.1 mg/mL (20 U/mg) proteinase K). Samples were incubated at 60 �C for 20 min.After incubation, 75 lL of 8 M potassium acetate was added, andthe samples were mixed and set in an ice bath for 10 min. The sam-ples were spun at 14,000g for 5 min, and the supernatant wastransferred to a new tube. One mL of absolute ethanol was added,and the samples were kept at room temperature for 10 min. Thesamples were spun at 14,000g for 10 min. Pellets were washed in0.5 mL of 70% ethanol and spun at 14,000g for 5 min. The final pel-lets were dried in a vacuum for 10 min and then resuspended in50 ll of H2O.

Extraction of genomic DNA from the 2009 collections was con-ducted as follows. Abdomens were removed from frozen femalehouse flies. Individual fly bodies were placed in 1.5 mL tubes con-taining 200 lL of lysis buffer (100 mM Tris–HCl pH 7.5, 100 mMNaCl, 100 mM EDTA, with 0.5% SDS) and homogenized with dis-posable pestles (Laboratory Product Sales Inc., Rochester, NY) inan overhead stirrer (Caframo Ltd., Wiarton, Ontario) until the flieswere completely pulverized. An additional 200 lL of lysis bufferwas added, and the samples were incubated at 65 �C for 30 min.After incubation, 800 lL of a 2:1 6 M LiCl/5 M KAc solution wasadded, and the samples were incubated on ice for 10 min. The sam-

ples were then spun at14,000g for 15 min, and 950 lL of superna-tant was transferred to new 1.5 mL tubes containing 570 lL ofisopropanol. The samples were mixed completely with gentle vor-texing, then centrifuged at 14,000g for 15 min. The supernatantwas drawn off and discarded. The pellets were rinsed with 70% eth-anol and spun at 14,000g at room temperature for 5 min. Thesupernatant was discarded, and the final pellets were left to dryat room temperature for 30 min. The extracted DNA was resus-pended in 30 lL EB Buffer (Qiagen) and stored at �20 �C.

2.5. Genotyping of Vssc

A �335 bp fragment of Vssc was amplified in a 25 lL reactioncontaining 12 lL 2� GoTaq Green Master Mix (Promega Corp.,Madison, WI), 10 lL distilled water, 10 pmol of the primerskdrDIGLongF and kdrDIGLongR (Table 1), and 1 lL of the DNA tem-plate. Reactions were carried out in a BioRad iCycler thermal cycler(Hercules, CA) under the following conditions: 94 �C for 1 min, fol-lowed by 32 cycles of PCR (94 �C for 30 s, 55 �C for 30 s, and 72 �Cfor 30 s), and a final extension at 72 �C for 10 min.

Amplification reactions were carried out for the super-kdr re-gion as well in flies that contained the L1014F or L1014H mutation(as a heterozygote or homozygote). The fragment was amplifiedunder the same 25 lL reaction conditions as described above, ex-cept that the primers used were SuperkdrLONGF and Super-kdrLONGR [21]. Reactions were carried out under the followingconditions: 95 �C for 2 min, followed by 35 cycles of PCR (94 �Cfor 30 s, 58 �C for 30 s, and 72 �C for 1 min 30 s), and a final exten-sion at 72 �C for 10 min.

PCR products of the kdr (L1014F) and super-kdr (M918T andL1014F) regions were purified and sequenced. The PCR productswere purified by incubating 10 lL of the product with 2.25 lL ofan enzyme mix containing 5 U Exonuclease I and 2 U shrimp alka-line phosphatase (Fermentas Inc., Burlington, Ontario) at 37 �C for30 min and then at 80 �C for 20 min. The kdrDIGLongF primer wasused to sequence kdr fragments. SuperkdrLongF, SuperkdrLongR,and skdrUSInternal were used to sequence super-kdr fragments.Sequencing was performed at Cornell’s Biotechnology ResourceCenter. Sequences were visually inspected with Chromas 1.45(Technelysium Pty Ltd., Tewantin, Queensland) and the Vssc al-leles were scored as either susceptible (M918 + L1014), kdr(M918 + F1014), kdr-his (M918 + H1014), or super-kdr (T918 +F1014). A minimum of 30 flies were genotyped from eachcollection.

2.6. Genotyping and sequencing of CYP6D1

Genotyping of CYP6D1 was conducted by PCR followed bysequencing. A 368 bp fragment was amplified in a 25 lL reactioncontaining 12 lL 2� GoTaq Green Master Mix (Promega), 10 lLdistilled water, 10 pmol of the primers S23 and AS6, and 1 lL ofthe DNA template. Reactions were carried out in a thermal cyclerunder the following conditions: 95 �C for 2 min, followed by 35 cy-cles of PCR (95 �C for 30 s, 58 �C for 30 s, and 72 �C for 1 min 30 s),

380 J.G. Scott et al. / Pesticide Biochemistry and Physiology 107 (2013) 377–384

and a final extension at 72 �C for 10 min. PCR products were puri-fied by incubating 10 lL of the product with 2.25 lL of an enzymemix containing 5 U Exonuclease I and 2 U shrimp alkaline phos-phatase (Fermentas) at 37 �C for 30 min and then at 80 �C for20 min. The purified PCR products were sequenced with the S23primer. Sequencing was performed at the Cornell University LifeSciences Core Laboratories facility. CYP6D1v1 contains a S165Tmutation (in addition to 4 other unique non-synonymous SNPSand a unique15-bp insertion near the transcription initiation site)in that is specific to this allele [32]. Sequences were inspected withChromas 1.45 and individuals were scored as being homozygousfor the CYP6D1v1 (165T) allele, being homozygous for the a suscep-tible allele (165S) or being a heterozygote. A minimum of 30 flieswere genotyped from each collection.

2.7. Isolation and testing of the NChis strain

A strain (NChis) homozygous for the kdr-his mutation in thebackground of a susceptible house fly (aabys strain) was obtainedby isolating autosome 3 from the NC19 strain [21] which has thekdr-his allele and replacing the Vssc locus on the third chromosomeof the susceptible aabys strain as follows. The parental cross con-sisted of 300 unmated $ aabys crossed with 100 # NC19. 208 #

F1 house flies were backcrossed to 531 unmated $ aabys. As thereis little to no crossing over in male house flies [43], the resistanceallele for the CYP6D1 gene, located on autosome 1 and its trans-reg-ulatory factors located on autosome 2 are not present in house fliesof the aa+ys phenotype and are therefore not present in the finalstrain [45,46]. 90 unmated $ aa+ys and 105 # aa+ys from the back-cross were mated en masse (mass cross 1). Second and third masscrosses were performed with aa+ys progeny from the previouscross while progeny with bwb were discarded. The G11 progenyof the third mass cross (unmated) were selected with permethrin(5 ng/fly) resulting in 40% mortality. Single pair crosses were setup with F1 progeny of the survivors of the permethrin selection.Parents from lines that produced good numbers of offspring weregenotyped as described above. Four lines in which both parentswere homozygous for the kdr-his mutation (and homozygous forthe CYP6D1 susceptible allele) were combined to establish theNChis (North Carolina kdr-his) strain.

Topical application was performed by delivery of a 0.5-ll dropof insecticide (in acetone) to the thoracic notum of 3- to 5-day oldfemale flies using an Arnold Hand Microapplicator (Burkard, Rick-mansworth Herts, England) fitted with a Hamilton syringe (FisherScientific). Flies were provided with 5 cm dental cotton wickssoaked in 15% sugar water and were held in a bioassay chamberat 25 �C, 12:12 L:D cycle. Mortality was recorded after 24 h forall insecticides except deltamethrin where mortality was recordedafter 48 h. Flies were considered dead if they were ataxic. Each bio-assay consisted of 20 flies per dose and 3–5 doses at different con-centrations of insecticide that gave >0 and <100% mortality.Control groups received acetone alone. A minimum of 3 replica-tions were used over a minimum of 2 days.

3. Results

3.1. Bioassays of field collected flies

Levels of resistance to the six insecticides varied between statesand insecticides. Resistance to permethrin was overall the highest,with >80% survival at the diagnostic concentration in collectionsfrom all states except for NM. There was >95% survival in the NY,NC and NE09 populations (Fig. 1). Resistance to methomyl was rel-atively consistent, with 64–91% survival in nine of the ten collec-tions, with highest survival (97%) for KS and lowest (64%) for

NE09. Resistance to cyfluthrin and pyrethrins + PBO varied consid-erably. Percent survival to cyfluthrin ranged from 3.4% (NM) to 75%(NC), and survival to pyrethrins + PBO ranged from 2.9% (CA) to76% (MN). The percent survival using tetrachlorvinphos variedfrom a low of 31% (NM and NY) to a high of 76% (KS). Resistanceto imidacloprid was overall modest with percent survival rangingfrom 16% (FL) to 61% (NE09).

The methods used herein have been used previously to examineresistance in house flies from NY, NC and FL. Thus, we were able toexamine changes in percent survival over time (SupplementaryFigs. 1 and 2) in these states. We have the longest record of resis-tance monitoring for permethrin and have observed a major in-crease in resistance following the widespread use of thisinsecticide starting in the mid-1980s (Supplementary Fig 1). Per-methrin resistance in FL, NC and NY has been stable at high ratesfrom 2002–2009. Methomyl resistance in NC has been stable(2002–2009), has declined slightly in NY (1999–2009) and hasshown a large increase in FL from 2002 to 2009 (SupplementaryFig. 2A). Tetrachlorvinphos resistance has remained relative stablein all three states (Supplementary Fig. 2B). The patterns for cyfluth-rin (Supplementary Fig. 2C) and for pyrethrins + PBO Supplemen-tary (Fig. 2D) showed a decrease in FL, an increase in NC andfluctuations in NY.

Although imidacloprid use has been increasing since it wasintroduced for house fly control in 2003 as a bait (and in 2007 asa spray), there was no increase observed in the % survival of houseflies from this study in comparison to previous results using houseflies from CA, FL and NY [44]. Percent survival at the diagnosticconcentration was 32%, 19% and 20% in NY in 2004, 2005 and2009, respectively; 24% and 25% in NC in 2004 and 2009, respec-tively; 17% and 16% in FL in 2004 and 2009, respectively; and45% and 43% in CA in 2006 and 2008, respectively.

3.2. Genotyping

The frequencies of pyrethroid resistance alleles from house fliesare summarized in Figs. 2 and 3. There was a high variability in thefrequencies of the Vssc alleles between states (Fig 2). The super-kdrallele was most common in KS (0.41) and NE09 (0.32), and theseare the highest frequencies of super-kdr ever detected in the USA.There was no super-kdr detected in CA, MN or FL and these resultsare similar to those from 2002 and 2003 where the frequency ofsuper-kdr was 0 in FL and very low (0–0.09) in NY [39]. The kdr al-lele was most abundant in MN (0.59) and was undetectable in NM.The kdr-his allele was found in each state, with frequencies rangingfrom a high of 0.81 (NC) to a low of 0.12 (KS). The susceptible allelewas found in all states, with frequencies ranging from a low of 0.01(NC) to a high of 0.67 (NM). There was no discernible geographicpattern for the Vssc alleles (e.g. East to West or North to South).We did not detect any individuals that were 918T + 1014H, consis-tent with the idea the super-kdr evolves from individuals alreadyhaving the kdr mutation [24].

By comparing our results with previous research [39] it is clearthat there have been fluctuations in the frequency of the Vssc al-leles over time, notably an increase in frequency of the susceptibleallele from 2002 to 2003, that had diminished in frequency by2009 in NY and FL (Fig. 4). However, in NC the frequencies of kdr,kdr-his and susceptible alleles remained relatively unchanged from2002 [39] through 2009 (Fig. 2).

In contrast to the results with the Vssc alleles, there was far lessvariation in the frequencies of the pyrethroid resistance alleleCYP6D1v1 (Fig. 3), which ranged from a low of 0.58 (FL) to a highof 0.92 (CA). The frequencies of CYP6D1v1 in NY, NC and FL foundin this study were similar to what was found in 2002 and 2003 [39](Supplementary Fig. 4).

Fig. 1. Levels of resistance to six insecticides in house flies collected from nine states across the USA. Bars represent the mean% survival at the diagnostic concentration anderror bars represent the S.D. of the mean (n P 11). Bars with different letters are significantly different (p 6 0.05) within each insecticide (1-way ANOVA followed by Tukey’sHSD test).

MT

KS

NM

CA

MN

FL

NY

NC

NE

Fig. 2. Frequencies of Vssc alleles in house flies collected from nine states across theUSA. Vssc alleles are susceptible ( ), kdr-his ( ), kdr ( ) and super-kdr ( ). Aminimum of 30 flies were genotyped from each collection.

J.G. Scott et al. / Pesticide Biochemistry and Physiology 107 (2013) 377–384 381

Having determined both levels of resistance to permethrin,pyrethrins + PBO and cyfluthrin as well as the frequencies of Vsscand CYP6D1 resistance alleles provided an opportunity to evaluatethe role of these alleles in pyrethroid resistance over a large geo-graphical region. The relatively widespread permethrin resistanceobserved is consistent with the levels of Vssc and CYP6D1 resis-tance alleles observed (Figs. 1–3). The four states having the lowestlevels of resistance to permethrin were also the states with thehighest frequencies of Vssc susceptible alleles (NM, MT, NE08 andCA). Overall, there was an inverse correlation (r2 = 0.59) betweenpercent survival to pyrethrins + PBO and frequency of the suscep-tible Vssc allele (Supplementary Fig. 3a); a perfect correlationwould not be expected due to the incompletely recessive inheri-tance of kdr, kdr-his and super-kdr. There was also an inverse corre-lation for percent survival to cyfluthrin and frequency ofsusceptible alleles (r2 = 0.75) (Supplementary Fig. 3b), suggestinga strong link between Vssc mutations and cyfluthrin resistance.

3.3. Resistance conferred by kdr-his

The toxicity of five pyrethroids to the aabys and NChis strains isshown in Table 2. The LD50 values for aabys to these insecticidesare consistent with previous reports [26]. The NChis stain was4.8–7.8-fold resistant to these pyrethroids (Table 3), independentof whether they were type I (resmethrin), type 2 (deltamethrin,cypermethrin, cyfluthrin) or intermediate (permethrin) [47].

4. Discussion

Isolation of a strain (NChis) with only the kdr-his allele allowedus to compare resistance conferred by this allele to published re-sults for kdr and super-kdr (Table 3) for four pyrethroids. The onlyprevious study of kdr-his was undertaken using a multi-resistantstrain and using permethrin + PBO to minimize resistance con-ferred by CYP6D1 [21]. Results with the NChis strain show thatthe level of resistance to pyrethroids is least for kdr-his, moderatefor kdr and highest for super-kdr across the four pyrethroids tested,although the magnitude of the differences varied for the four insec-ticides. Unfortunately there was no published value for cyfluthrinfor the kdr and super-kdr strains (and these strains no longer exist)so no comparison could be made. These results present an interest-ing dichotomy between the levels of resistance that each alleleconfers (Table 3) and their relative frequency in each population(Fig. 2). The resistance ratios we observed for kdr and kdr-his donot agree with those proposed based on in vitro studies whereL1014F/H mutations in para were studied [27].

There was no distinct trend in the Vssc resistance allele frequen-cies over time for either FL or NY, with the exception of the super-kdr allele. The frequency of super-kdr has remained constant (low)since it was first detected in NY in mid-2003 [39], which is surpris-ing given the strong selection with pyrethroid insecticides and thehigh levels of pyrethroid resistance conferred by super-kdr (Ta-ble 3). This suggests that the super-kdr allele must have a strong fit-ness disadvantage in the absence of insecticide use in NY. Thesignificant frequencies of super-kdr found in NE and KS suggestthe fitness cost in the absence of insecticide use for this allele isnot manifest equally in all locations, consistent with the idea thatthe fitness costs of resistance alleles is dictated by the environment[48,49]. It would be valuable to monitor the changes in allele fre-

0

0.2

0.4

0.6

0.8

1

Fre

quen

cy o

f Cyp6D1v1

State

FL NYMNKS NMNE09CA MT NE08NC0

0.2

0.4

0.6

0.8

1

Fre

quen

cy o

f Cyp6D1v1

State

FL NYMNKS NMNE09CA MT NE08NC

Fig. 3. Frequency of the pyrethroid resistance allele CYP6D1v1 in house flies collected from nine states across the USA. A minimum of 30 flies were genotyped from eachcollection.

0

0.1

0.2

0.3

0.4

0.5

0.6

0.7

2002 2004 2006 2008 2010

Alle

le F

requ

ency

Year

Susceptible

kdr

kdr-his

super-kdr

0 0.10.20.30.40.50.60.70.80.9

2002 2004 2006 2008 2010

Alle

le F

requ

ency

Year

Susceptible

kdr

kdr-his

FL

NY

Fig. 4. Changes in the frequency of Vssc alleles over time in house flies collectedfrom dairies in two states.

Table 3Resistance ratiosa of strains containing kdr-his, kdr, or super-kdr to four pyrethroids.

Insecticide NChis kdrb super-kdrb

Cypermethrin 7.8 6.7–16 130–150Deltamethrin 4.8 12–34 220–400Permethrin 5.1 19–21 48–59Resmethrin 4.9 11–13 37

a Resistance ratios (RRs = LD50 resistant strain/LD50 susceptible strain) for kdr-hisare calculated from Table 2.

b RRs for kdr and super-kdr were previously published [26] and are given as arange relative to the two susceptible strains used in that study.

382 J.G. Scott et al. / Pesticide Biochemistry and Physiology 107 (2013) 377–384

quencies at these dairies to improve our understanding of the evo-lution of pyrethroid resistance. There was no statistical differencein the frequency of each Vssc allele between 2002 [21] and 2009(Fig. 2) in the NC populations (p > 0.05).

The frequency of CYP6D1v1 remained relatively constant from2002–2009 with a small increase noted in NC and a slight decreasefound in FL (Supplementary Fig. 4). The decrease seen in Florida

Table 2Toxicity of five pyrethroid insecticides via topical application to susceptible (aabys) and r

Insecticide aabys

n LD50a (95% CI) Slope

Resmethrin 600 6.48 (5.94–7.10) 4.8 (0Permethrin 740 5.57 (5.00–6.18) 3.4 (0Cyfluthrin 720 0.96 (0.87–1.07) 3.1 (0Cypermethrin 620 1.38 (1.24–1.53) 3.4 (0Deltamethrin 600 0.29 (0.22–0.39) 3.5 (1

a LD50 values are in ng/fly.

may be due to an influx of susceptible flies from untreated areas,or a general decline in the allele due to a higher fitness cost,whereas the slight increase in NC could be due to continued selec-tion for pyrethroid resistant flies. To more completely understandthe population genetics of P450-mediated resistance it will beimportant to identify the factor on chromosome 2 that contributesto increased transcription of CYP6D1v1 [31], identify the factor onchromosome 5 that can confer PBO suppressible permethrin resis-tance (i.e. in house flies from Yumenoshima, Japan [25] and Grant,Alabama, USA [38]) and identify which other P450s are involved inresistance (i.e. PBO suppressible permethrin resistance in the YPERstrain is not entirely due to overexpression of CYP6D1 [25]).

Our results suggest that the tools available for house fly controlvary between states. Percent mortality to cyfluthrin at the diagnos-tic concentration was relatively low in four states, suggesting thatcyfluthrin remains at least partially effective. However, resistancein some states is relatively high to all of the insecticides we tested,suggesting that resistance is reducing the effectiveness of theremaining insecticides that are available for house fly control, withthe possible exception of imidacloprid. However, behavioral resis-

esistant (NChis) strains of house flies.

NChis

(SE) n LD50a (95% CI) Slope (SE)

.5) 480 31.5 (26.9–38.6) 2.8 (0.4)

.3) 420 28.5 (25.2–31.9) 5.3 (0.7)

.2) 560 5.08 (4.27–5.91) 2.6 (0.3)

.3) 560 10.7 (9.46–12.1) 3.6 (0.4)

.0) 600 1.40 (1.23–1.60) 2.6 (0.2)

J.G. Scott et al. / Pesticide Biochemistry and Physiology 107 (2013) 377–384 383

tance to imidacloprid has been documented [50] and such resis-tance would not be detected in our no-choice bioassays. Further-more, following the introduction of spray formulationsimidacloprid in 2007 non-behavioral resistance has also beenfound [51].

The biology of the house fly in different climates likely plays arole in the patterns of resistance we observed. In the northern lat-itudes, house fly populations collapse in the winter and new pop-ulations start from the relatively small number of flies thatoverwinter inside animal confinement facilities [52,53], effectivelybottlenecking the population and presenting an environmentwhere fitness costs are likely to be magnified. In contrast, in sub-tropical latitudes, house flies persist throughout the year. It istempting to speculate that in the northern United States, houseflies at dairies and swine facilities (which are commonly exposedto insecticide treatments) could represent the majority of the pop-ulation, while in southern states house flies at dairies and swinefacilities do not represent such a majority of the population (dueto more abundant food sources and because populations do notneed to ‘‘restart’’ each year after the winter). Although we do nothave quantitative data for insecticide use at the dairies we studied,there are at least two cases that offer support for this concept.Insecticide use in NM is seasonally intense (R. Byford, unpub-lished), yet NM had low to moderate levels of resistance to mostof the insecticides. Similarly, there is widespread use of insecti-cides in FL, which also has lower levels of resistance to most insec-ticides. Further work is needed to clarify if the effective populationsizes are different between states.

Acknowledgment

This research was supported by multistate Projects S-1030 andS-1060.

Appendix A. Supplementary data

Supplementary data associated with this article can be found, inthe online version, at http://dx.doi.org/10.1016/j.pestbp.2013.10.006.

References

[1] O.C. Ugbogu, N.C. Nwachukwu, U.N. Obguagu, Isolation of Salmonella andShigella species from house flies (Musca domestica L.) in Uturu, Nigeria, Afr. J.Biotechnol. 5 (2006) 1090–1091.

[2] T.K. Graczyk, R. Knight, R.H. Gilman, M.R. Cranfield, The role of non-biting fliesin the epidemiology of human infectious diseases, Microbes Infect. 3 (2001)231–235.

[3] B. Greenberg, Files and Disease, Princeton University Press, Princeton, NJ,1971.pp.

[4] W. Kasprzak, A. Majewska, Transmission of Giardia cysts. I. Role of flies andcockroaches, Parasitol. News, 27 (1981) 555–563.

[5] B. Greenberg, J.A. Kowalski, M.J. Klowden, Factors affecting the transmission ofSalmonella by flies: Natural resistance to colonization and bacterialinterference, Infect. Immun. 2 (1970) 800–809.

[6] A. Ahmad, T.G. Nagaraja, L. Zurek, Transmission of Escherichia coli O157:H7 tocattle by house flies, Prev. Vet. Med. 80 (2007) 74–81.

[7] T. Sasaki, M. Kobayashi, N. Agui, Epidemiological potential of excretion andregurgitation by Musca domestica (Diptera: Muscidae) in the dissemination ofEscherichia coli O157: H7 to food, J. Med. Entomol. 37 (2000) 945–949.

[8] A. Barin, F. Arabkhazaeli, S. Rahbarai, S.A. Madani, The housefly, Muscadomestica, as a possible mechanical vector of Newcastle disease virus in thelaboratory and field, Med. Vet. Entomol. 24 (2010) 88–90.

[9] S. Chakrabarti, D.J. King, C. Afonso, D. Swayne, C.J. Carona, D.R. Kuney, A.C.Gerry, Detection and isolation of exotic Newcastle disease virus from field-collected flies, J. Med. Entomol. 44 (2007) 840–844.

[10] C.J. Geden, J.A. Hogsette, Research and extension needs for integratedmanagement programs for livestock and poultry, 2013 (2001) http://www.ars.usda.gov/sp2userfiles/place/66151020/downloads/lincoln.pdf.

[11] R.L. Metcalf, Insect resistance to insecticides, Pestic. Sci. 26 (1989) 333–358.[12] NRC, Executive summary, pesticide resistance strategies and tactics for

management, in: NRC (Ed.) Pesticide Resistance Strategies and Tactics forManagement, National Academy Press, Washington, D.C., 1986, pp. 1–9.

[13] M. Elliott, Established pyrethroid insecticides, Pestic. Sci. 11 (1980) 119–128.[14] T. Shono, Pyrethroid resistance: importance of the kdr-type mechanism, J.

Pestic. Sci. 10 (1985) 141–146.[15] F.D. Rinkevich, Y. Du, K. Dong, Diversity and convergence of sodium channel

mutations involved in resistance to pyrethroids, Pestic. Biochem. Physiol. 106(2013) 93–100.

[16] J. Huang, M. Kristensen, C. Qiao, J.B. Jespersen, Frequency of kdr gene in housefly field populations: correlation of pyrethroid resistance and kdr frequency, J.Econ. Entomol. 97 (2004) 1036–1041.

[17] J.G. Scott, Cytochromes P450 and insecticide resistance, Insect Biochem. Mol.Biol. 29 (1999) 757–777.

[18] J.-P. David, H. Ismail, A. Chandor-Proust, M. Paine, Role of cytochrome P450s ininsecticide resistance: impact on the control of mosquito-borne diseases anduse of insecticides on Earth, Phil. Trans. Royal Soc. London B Biol. Sci., 368(2013).

[19] J.G. Scott, Cytochrome P450 monooxygenases and insecticide resistance:lessons from CYP6D1, in: I. Ishaaya (Ed.), Biochemical Sites of InsecticideAction and Resistance, Springer-Verlag, New York, 2001, pp. 255–267.

[20] M.S. Williamson, I. Denholm, C.A. Bell, A.L. Devonshire, Knockdown resistance(kdr) to DDT and pyrethroid insecticides maps to a sodium channel gene locusin the housefly (Musca domestica), Molec. Gen. Genet. 240 (1993) 17–22.

[21] F.D. Rinkevich, L. Zhang, R.L. Hamm, S.G. Brady, B.P. Lazzaro, J.G. Scott,Frequencies of the pyrethroid resistance alleles of Vssc1 and CYP6D1 in houseflies from the eastern United States, Insect Mol. Biol. 15 (2006) 157–167.

[22] F.D. Rinkevich, C. Su, T.A. Lazo, D.J. Hawthorne, W.M. Tingey, S. Naimov, J.G.Scott, Multiple evolutionary origins of knockdown resistance (kdr) inpyrethroid-resistant Colorado potato beetle, Leptinotarsa decemlineata, Pestic.Biochem. Physiol. 104 (2012) 192–200.

[23] N. Liu, J.W. Pridgeon, Metabolic detoxication and the kdr mutation inpyrethroid resistant house flies, Musca domestica (L.), Pestic. Biochem.Physiol. 73 (2002) 157–163.

[24] F.D. Rinkevich, S.M. Hedtke, C.A. Leichter, S.A. Harris, C. Su, B.S. G, V. Taskin, X.Qiu, J.G. Scott, Multiple origins of kdr-type resistance in the house fly, Muscadomestica, PLoS ONE 7 (2012) e52761.

[25] T. Shono, S. Kasai, E. Kamiya, Y. Kono, J.G. Scott, Genetics and mechanisms ofpermethrin resistance in the YPER strain of house fly, Pestic. Biochem. Physiol.73 (2002) 27–36.

[26] A.W. Farnham, A.W.A. Murray, R.M. Sawicki, I. Denholm, J.C. White,Characterization of the structure-activity relationship of kdr and twovariants of super-kdr to pyrethroids in the housefly (Musca domestica L.),Pestic. Sci. 19 (1987) 209–220.

[27] M.J. Burton, I.R. Mellor, I.R. Duce, T.G.E. Davies, L.M. Field, M.S. Williamson,Differential resistance of insect sodium channels with kdr mutations todeltamethrin, permethrin and DDT, Insect Biochem. Mol. Biol. 41 (2011) 723–732.

[28] J.G. Scott, S. Kasai, Evolutionary plasticity of monooxygenase-mediatedresistance, Pestic. Biochem. Physiol. 78 (2004) 171–178.

[29] S. Kasai, J.G. Scott, Overexpression of cytochrome P450 CYP6D1 is associatedwith monooxygenase-mediated pyrethroid resistance in house flies fromGeorgia, Pestic. Biochem. Physiol. 68 (2000) 34–41.

[30] N. Liu, J.G. Scott, Increased transcription of CYP6D1 causes cytochrome P450-mediated insecticide resistance in house fly, Insect Biochem. Molec. Biol. 28(1998) 531–535.

[31] N. Liu, J.G. Scott, Genetic analysis of factors controlling elevated cytochromeP450, CYP6D1, cytochrome b5, P450 reductase and monooxygenase activitiesin LPR house flies, Musca domestica, Biochem. Genet. 34 (1996) 133–148.

[32] J.G. Scott, N. Liu, Z. Wen, F.F. Smith, S. Kasai, C.E. Horak, House fly cytochromeP450 CYP6D1: 5 prime flanking sequences and comparison of alleles, Gene 226(1999) 347–353.

[33] J. Seifert, J.G. Scott, The CYP6D1v1 allele is associated with pyrethroidresistance in the house fly, Musca domestica, Pestic. Biochem. Physiol. 72(2002) 40–44.

[34] T. Tomita, N. Liu, F.F. Smith, P. Sridhar, J.G. Scott, Molecular mechanismsinvolved in increased expression of a cytochrome P450 responsible forpyrethroid resistance in the housefly, Musca domestica, Insect Mol. Biol. 4(1995) 135–140.

[35] V. Taskin, S. Baskurt, E. Dogac, B.G. Taskin, Frequencies of pyrethroidresistance-associated mutations of Vssc1 and CYP6D1 in field populations ofMusca domestica L. in Turkey, J. Vector Ecol. 36 (2011) 239–247.

[36] Q. Wang, M. Li, J. Pan, M. Di, Q. Liu, F. Meng, J.G. Scott, X. Qiu, Diversity andfrequencies of genetic mutations involved in insecticide resistance in fieldpopulations of the house fly (Musca domestica L.) from China, Pestic. Biochem.Physiol. 102 (2012) 153–159.

[37] M.D.K. Markussen, M. Kristensen, Cytochrome P450 monooxygenase-mediated neonicotinoid resistance in the house fly Musca domestica L, Pestic.Biochem. Physiol. 98 (2010) 50–58.

[38] N. Liu, X. Yue, Genetics of pyrethroid resistance in a strain (ALHF) of house flies(Diptera: Muscidae), Pestic. Biochem. Physiol. 70 (2001) 151–158.

[39] F.D. Rinkevich, R.L. Hamm, C.J. Geden, J.G. Scott, Dynamics of insecticideresistance alleles in two different climates over an entire field season, InsectBiochem. Mol. Biol. 37 (2007) 550–558.

[40] J.G. Scott, G.P. Georghiou, Mechanisms responsible for high levels ofpermethrin resistance in the house fly, Pestic. Sci. 17 (1986) 195–206.

[41] P.E. Kaufman, J.G. Scott, D.A. Rutz, Monitoring insecticide resistance in houseflies (Diptera: Muscidae) from New York dairies, Pest Manag. Sci. 57 (2001)514–521.

384 J.G. Scott et al. / Pesticide Biochemistry and Physiology 107 (2013) 377–384

[42] J.G. Scott, R.T. Roush, D.A. Rutz, Insecticide resistance of house flies from NewYork dairies (Diptera: Muscidae), J. Agric. Entomol. 6 (1989) 53–64.

[43] R. Hamm, T. Shono, J.G. Scott, A cline in frequency of autosomal males is notassociated with insecticide resistance in house fly (Diptera: Muscidae), J. Econ.Entomol. 98 (2005) 171–176.

[44] P.E. Kaufman, A.C. Gerry, D.A. Rutz, J.G. Scott, Monitoring susceptibility ofhouse flies (Musca domestica L.) in the United States to imidacloprid, J. Agric.Urban Entomol. 23 (2006) 195–200.

[45] R.L. Hamm, J.G. Scott, Changes in the frequency of YM versus IIIM in the housefly, Musca domestica L., under field and laboratory conditions, Genet. Res.Camb., 90 (2008) 1–6.

[46] T. Hiroyoshi, The linkage map of the house fly, Musca domestica L, Genetics 46(1961) 1373–1380.

[47] J.G. Scott, Pyrethroid insecticides, ISI Atlas Sci. Pharmacol. 2 (1988) 125–128.[48] M.C. Hardstone, B.P. Lazzaro, J.G. Scott, The effect of three environmental

conditions on the fitness of cytochrome P450 monooxygenase-mediatedpermethrin resistance in Culex pipiens quinquefasciatus, BMC Evol. Biol. 9(2009) 42.

[49] F.D. Rinkevich, C.A. Leichter, T.A. Lazo, M.C. Hardstone, J.G. Scott, Variablefitness costs for pyrethroid resistance alleles in the house fly, Musca domestica,in the absence of insecticide pressure, Pestic. Biochem. Physiol. 105 (2013)161–168.

[50] A.C. Gerry, D. Zhang, Behavioral resistance of house flies, Musca domestica(Diptera: Muscidae) to imidacloprid, United States Army Med. Depart. J. (2009)54–59.

[51] P.E. Kaufman, S.C. Nunez, C.J. Geden, M.E. Scharf, Selection for resistance toimidacloprid in the house fly (Diptera: Muscidae), J. Econ. Entomol. 103 (2010)1937–1942.

[52] I. Denholm, R.M. Sawicki, A.W. Farnham, Factors affecting resistance toinsecticides in house-flies, Musca domestica L. (Diptera: Muscidae). IV. Thepopulation biology of flies on animal farms in south-eastern England and itsimplications for the management of resistance, Bull. Entomol. Res. 75 (1985)143–158.

[53] W.C. Black, E.S. Krafsur, Population biology and genetics of winter house fly(Diptera: Muscidae) populations, Ann. Entomol. Soc. Am. 79 (1986) 636–644.