ORIGINAL ARTICLE

Insulin-Like Growth Factor-I Enhances Transforming GrowthFactor-b-Induced Extracellular Matrix Protein ProductionThrough the P38/Activating Transcription Factor-2 SignalingPathway in Keloid Fibroblasts

Takehiro Daian, Akira Ohtsuru,nTatiana Rogounovitch,n Hiroshi Ishihara, Akiyoshi Hirano,Yuri Akiyama-Uchida,nVladimir Saenko,nTohru Fujii, and Shunichi Yamashitan

Department of Plastic and Reconstructive Surgery, nDepartment of Molecular Medicine, Atomic Bomb Disease Institute, Nagasaki University GraduateSchool of Biomedical Sciences, 1-12-4, Sakamoto, Nagasaki 852-8523, Japan

Keloids are benign dermal tumors, characterized by in-vasive growth of ¢broblasts and concomitant increasedbiosynthesis of extracellular matrix components, withunclear etiology. We previously demonstrated thatkeloid ¢broblasts overexpress insulin-like growthfactor-I receptor. In investigating the role of insulin-likegrowth factor-I receptor overexpression, insulin-likegrowth factor-I and transforming growth factor-binteraction was examined in relation to extracellularmatrix protein production in cultured human andmouse ¢broblasts. Western blotting revealed that col-lagen type I was expressed in keloid and normal ¢bro-blasts, and its expression was increased by transforminggrowth factor-b stimulation more signi¢cantly in ke-loid rather than in normal ¢broblasts. Insulin-likegrowth factor-I and transforming growth factor-b1costimulation markedly increased extracellular matrixproteins (collagen type I, ¢bronectin, and plasminogenactivator inhibitor-1) compared with cultures withtransforming growth factor-b1 alone. Insulin-likegrowth factor-I treatment alone had no stimulatory ef-fect. Real-time reverse transcription^polymerase chainreaction con¢rmed parallel collagen type I messengerRNA level changes. Luciferase assays were conductedto investigate intracellular signaling pathways in this sy-

nergistic stimulation using a mouse ¢broblast cell line.Transforming growth factor-b1 (1 or 10 ng per ml) in-creased the speci¢c signaling activity approximately10-fold, whereas the increase with insulin-like growthfactor-I (100 ng per ml) was less than 2-fold comparedwith basal activity; however, the combination of trans-forming growth factor-b1 and insulin-like growthfactor-I resulted in an approximately 25-fold increase.Insulin-like growth factor-I markedly enhanced trans-forming growth factor-b-induced phosphorylation ofp38 mitogen-activated protein kinase and activatingtranscription factor-2. Luciferase assay showed that thissynergistic e¡ect was attenuated by the p38 mitogen-activated protein kinase speci¢c inhibitor SB203580 orphosphatidylinositol 3-kinase inhibitor wortmannin,but not by the mitogen-activated protein kinase/extra-cellular-signal-regulated protein kinase kinase inhibitorPD98059. These results indicate that insulin-like growthfactor-I enhances transforming growth factor-b-in-duced keloid formation through transforming growthfactor-b postreceptor signal cross-talk, mainly via thep38 mitogen-activated protein kinase/activating tran-scription factor-2 pathway. Key words: ¢brosis/mitogen-ac-tivated protein kinase/plasminogen activator inhibitor-1/colla-gen type I/¢bronectin. J Invest Dermatol 120:956 ^962, 2003

Keloids are classi¢ed as benign dermal tumors, char-acterized by the proliferation of dermal ¢broblasts,overproduction of extracellular matrix components(ECM), invasiveness beyond the original boundaryof the insult, and recurrence. Transforming growth

factor (TGF)- b1 has been implicated in several ¢brotic disorders,including glomerulonephritis, liver cirrhosis, and lung ¢brosis(Border and Noble, 1994). In dermal ¢broblasts,TGF-b1 is knownto play a crucial part in wound healing processes.TGF-b1 has alsobeen shown to markedly enhance the expression of ECM pro-teins by cultured ¢broblasts, and it has therefore been postulatedthat TGF-b1 plays a signi¢cant part in the development of keloids(Babu et al, 1992; Younai et al, 1994; Tuan and Nichter, 1998; Chinet al, 2001). Furthermore,TGF-b1 is involved in the anti-apoptoticproperty of keloid ¢broblasts (Chodon et al, 2000). TGF-b1 med-iates signaling through two transmembrane serine/threonine ki-nase receptors, type I and type II TGF-b receptors. Theconstitutively active type II receptor recruits the type I receptorupon ligand binding and then phosphorylates its serineand threonine residues in a glycine serine rich domain. Oncephosphorylated, the type I receptor activates downstream targets.

Reprint requests to: Akira Ohtsuru, MD, Department of MolecularMedicine, Atomic Bomb Disease Institute, Nagasaki University GraduateSchool of Biomedical Sciences, 1-12-4, Sakamoto, Nagasaki 852-8523,Japan. Email: ohtsuru@net.nagasaki-u.ac.jpAbbreviations: IGF-I, insulin-like growth factor-I; ECM, extracellular

matrix; PAI-1, Plasminogen activator inhibitor-1; MAPK, mitogen-acti-vated protein kinase; MEK, MAPK/extracellular-signal-regulated proteinkinase kinase; ATF-2, activating transcription factor-2; PI3K, phosphatidy-linositol 3-kinases; JNK, Jun N-terminal kinase.

Manuscript received August 19, 2002; revised November 27, 2002;accepted for publication January 6, 2003

0022-202X/03/$15.00 . Copyright r 2003 by The Society for Investigative Dermatology, Inc.

956

Recent evidence indicates that TGF-b1 transduces signals throughtwo di¡erent pathways, Smad and mitogen-activated proteinkinase (MAPK), including p38, Jun N-terminal kinase (JNK),and extracellular signal regulated kinase (ERK) (Zhou et al,1998; Hanafusa et al, 1999; Sato et al, 2002).Insulin-like growth factor-I receptor (IGF-IR) is composed of

two extracellular a-subunits and two transmembrane b-subunitsthat possess intrinsic tyrosine kinase activity (Ullrich and Schles-singer, 1990). Activated IGF-IR phosphorylates various substrateson tyrosine residues, including those of the Ras-Raf-MAPKpathway (Rozakis-Adcock et al, 1993; Skolnik et al, 1993) and thephosphatidylinositol 3-kinase (PI3K) pathway (Backer et al, 1992).In previous studies, we found that keloid ¢broblasts overex-pressed IGF-IR, IGF-I mediated invasiveness of keloid ¢broblasts(Yoshimoto et al, 1999; Ohtsuru et al, 2000), and keloid ¢broblastsare resistant to apoptosis due to IGF-I signaling (Ishihara et al,2000). Although IGF-I/IGF-IR signaling is involved in keloidformation, it is not clear whether IGF-I can modulate TGF-b-mediated e¡ect. In this study we examined how IGF-I a¡ectsTGF-b-induced ECM production, focusing on the postreceptorsignaling pathway of TGF-b action.

MATERIALS AND METHODS

Materials Keloid samples were obtained from three di¡erent Japanesepatients after surgical excision and the diagnosis con¢rmed by routinepathologic examination. In all cases, keloids had developed at sites ofunsuspected injury (trivial wounds and acne) and had not been subjectedto any kind of treatment. Three normal skin samples were obtained fromthree Japanese volunteers. Informed consent was obtained from eachindividual and the study approved by the ethical committee of NagasakiUniversity (no. 13020615). Patient pro¢les are listed inTable I.

Cell cultures Primary cultures of dermal ¢broblasts were established aspreviously described (Ishihara et al, 2000). Explants were maintained inDulbecco’s modi¢ed Eagle’s medium supplemented with 10% fetal bovineserum (Invitrogen, Burlington, Ontario, Canada), 100 U per ml penicillin,and 100 mg streptomycin per ml at 371C in a humidi¢ed incubator with5% CO2. Fibroblasts were treated with TGF-b1 (Invitrogen), IGF-I(Sigma, St Louis, MO) or both, at passages 3^8. A hepatoma cell line,HepG2, was cultured as previously described (Akiyama-Uchida et al, 2002).

Western blot analysis As the ECM proteins such as collagen type I,¢bronectin, and plasminogen activator inhibitor (PAI)-1 are produced andthen secreted into extracellular space, we used culture media but not celllysates as loading samples after the measurement of protein concentrationusing Bio-Rad assay (BIO-RAD, Richmond, CA). After stimulation for12 h, culture media was treated with sodium dodecyl sulfate lysis bu¡er(62.5 mM Tris^HCl, pH 6.8, 2% sodium dodecyl sulfate, 10% glycerol,50 mM dithiothreitol, and 0.1% bromophenol blue). The proteinswere resolved in 7.5% sodium dodecyl sulfate polyacrylamide gelsand transferred to nitrocellulose membranes (Hybond-P; Amersham,Arlington Height, IL). The membranes were preincubated with a block-ing bu¡er for 1 h at room temperature. They were then incubated withthe primary antibodies to collagen type I (Rockland Immunochemicals,Gilbertsville, PA), ¢bronectin (Calbiochem, San Diego, CA), PAI-1

(American Diagnostics Inc, Greenwich, CT), phospho-activating trans-cription factor (phospho-ATF)-2 and control-ATF-2 (Cell SignalingTechnology, Beverly, MA), p38 MAPK (New England Biolabs, Hercules,CA), and JNK antibody (Santa Cruz Biotechnology, Santa Cruz, CA).Thiswas followed by incubation with the secondary antibody, a horseradishperoxidase-conjugated goat anti-rabbit IgG (Santa Cruz Biotechnology).Proteins were visualized with a chemiluminescent detection system asproscribed by the manufacturer (ECL; Amersham).

Expression of collagen type I mRNA Total RNAwas extracted fromeach sample stimulated in various ways for 6 h. This time point wasdetermined as optimal by the time course study by Luciferase assay (datanot shown). One microgram of total RNA reverse transcribed for 1 h at411C using random hexamers in a 25 ml reaction. Then 1 ml was used as atemplate for real-time polymerase chain reaction (PCR), which was carriedout in an ABI PRISMs 7700 Sequence Detection System (PE AppliedBiosystems, Warrington, U.K.) using the SYBR Green kit (PE AppliedBiosystems) according to the manufacturer’s guidelines. For each sample,the relative mRNA level of collagen type I was expressed in arbitraryunits after normalization against a-tubulin. Standard curves for each real-time PCR run were generated from serial dilutions of a reversetranscription reaction with high content of both collagen I and tubulinmRNA. For each type of real-time PCR assay, 40 biphasic cycles ofdenaturation at 951C for 15 s followed by annealing/extension at 601Cfor 1 min were performed. Samples were analyzed in triplicates.The primer sequences were as follows: collagen type I (COL1A1) senseACGCACGGCCAAGAGGAA and anti-sense CGTTGTCGCAGACGC-AGATC; a-tubulin sense AGATCATTGACCTCGTGTTGGA and anti-sense ACCAGTTCCCCCACCAAAG; their concentration in the reactionmixture was 200 nM.

Luciferase assay Plasmid p3TP-Lux contains the luciferase reportergene, under the control of a portion of the PAI-1 promoter region, andthree consecutive phorbol ester 12-O-tetradecanoyl phorbol-13-acetate(TPA) response elements. Human FAST-1 (human forkhead activin signaltransducer-1) (hFAST-1) possesses the ability to bind human Smad2 andactivates an activin response element (ARE). Thus the ARE-Lux fusionluciferase vector was used for transcriptional activity determination withFAST-1, to detect Smad signals (Akiyama-Uchida et al, 2002). pRL-CMVRenilla luciferase was cotransfected as a control reporter vector. Culturednormal and keloid ¢broblasts and HepG2 cells at 70% con£uence weretransiently transfected using the Lipofectamine procedure. The media waschanged to serum-free Dulbecco’s modi¢ed Eagle’s medium, and theculture continued for 24 h at 371C. Cells were incubated for a further 12 hwith IGF-I or TGF-b1, or a combination of the two. Cell extracts wereprepared and subjected to dual-luciferase assay (Promega, Madison,WI) asproscribed by the manufacturer. To investigate the involvement of p38 andthe ERK pathway in the induction of 3TP-Lux, we used the speci¢cinhibitor of p38, SB203580 (5 or 10 mM) (Calbiochem), the MEK1inhibitor, PD98059 (5 or 10 mM) (New England Biolabs. Inc., Beverly,MA) and the PI3K inhibitor, wortmannin (10 or 100 nM) (WakoChemical, Osaka, Japan).

RESULTS

Expression of ECM proteins on dermal ¢broblasts Figure1(A,B) shows representative western blots for collagen type Iexpression in primary cultures of normal and keloid human¢broblasts. Basal expression of collagen type I is observed inkeloid and normal ¢broblasts. TGF-b1 treatment enhanced itsexpression in both ¢broblast cultures (Fig 1A). IGF-I causedsome changes in levels of collagen type I and ¢bronectinexpression, and treatment with TGF-b1 and IGF-I incombination markedly upregulated the expression of bothproteins compared with either IGF-I or TGF-b1 treatment alone(Fig 1B,C). We then examined the expression of PAI-1 asa marker of ¢brosis through TGF-b1 signaling. As shown inFig 1(D), treatment of keloid ¢broblasts with TGF-b1 and IGF-Iin combination also markedly upregulated PAI-1 expressioncompared with control, IGF-I, or TGF-b1 treatment alone.Similar results were obtained in normal ¢broblasts, but thecombination e¡ects were not as strong.

Expression of collagen type I mRNA Figure 2 shows theexpression of collagen type I mRNA in primary cultures ofnormal and keloid human ¢broblasts estimated by real-time

Table I. Characteristics of individuals included in the study

(age, years) (sex) (biopsy site) (duration)n

KeloidK^1 77 female Chest 10 yearsK^2 36 female Shoulder 3 yearsK^3 64 male Chest 45 years

NormalN^1 6 male Footnn

N^2 43 female BackN^3 17 male Thigh

Controls are not site matched.nKeloid persistence befor the surgerynnSurplus skin of graft for syndactly was used in this subject

IGF-I ENHANCES TGF-b-INDUCED KELOID FIBROSIS 957VOL. 120, NO. 6 JUNE 2003

reverse transcription^PCR. The combination treatment withTGF-b1 and IGF-I upregulated the expression of collagen type ImRNA in keloid ¢broblasts nearly 2.2-fold compared with 1.5-fold in cells treated with TGF-b alone. In normal ¢broblasts, this

synergistic e¡ect was not signi¢cant. IGF-I treatment alone,however, slightly downregulated the expression of collagen typeI mRNA in both normal and keloid ¢broblasts.

TGF-b signaling in mouse ¢broblasts We treated BALB/C3T3 mouse ¢broblasts with TGF-b1 or IGF-I alone or incombination to assess whether Smad or p38 MAPKwere actingdominantly downstream of the TGF-b1 receptor. Figure 3(A)shows that 10 ng IGF-I per ml treatment did not increase 3TP-Lux activity, whereas 100 ng IGF-I per ml treatment resulted ina small increase. TGF-b1 treatment (1 ng per ml or 10 ng per ml)produced an approximately 10-fold increase in activation. At thesame time, the combination of the two factors increased 3TP-Luxactivity approximately 25 times. 3TP-Lux activity was notincreased by the combination treatment compared with TGF-balone in HepG2 cells, indicating that the synergistic e¡ect ofTGF-b1 and IGF-I is cell-type speci¢c.We then determined whether the Smad cascades of TGF-b1

signaling were activated by IGF-I alone, or TGF-b1 and IGF-I incombination (Fig 3B). TGF-b1 treatment (10 ng per ml) aloneincreased ARE activity in the presence of FAST-1, but TGF-b1and IGF-I in combination did not further enhance the activityof ARE-Lux. ARE-Lux activity without FAST-1 cotransfectionwas unchanged by various combination treatments. In HepG2cells, ARE-Lux activity was markedly induced by TGF-b1treatment with FAST-1 cotransfection, but no synergistic e¡ectwas produced byTGF-b1/IGF-I combination.

3TP-Lux activity in human ¢broblasts To con¢rmsynergistic signal transduction in normal and keloid ¢broblasts,we used the 3TP-Lux assay in normal and keloid ¢broblasts. Asshown in Fig 4, treatment with 100 ng per ml IGF-I did notenhance 3TP-Lux activity signi¢cantly, whereas 10 ng per mlTGF-b1 produced an increased activation of approximately 3-or 4-fold in normal and keloid ¢broblasts, respectively.Furthermore, combination treatment produced a rise in activityof approximately 4-fold in normal ¢broblasts, and an 8-foldincrease in keloid ¢broblasts.

Downstream signaling of TGF-b-induced MAPK cascadesin human ¢broblasts To examine the e¡ect of intervention atvarious stages of the MAPK cascade on TGF-b1 and IGF-Isignaling in human ¢broblasts, we used SB203580 (a p38-speci¢c inhibitor) and PD98059 (a MEK speci¢c inhibitor). As

Figure1.Western blotting of ECM proteins in culture media fromdermal ¢broblasts. (A) Concentration-dependent e¡ect of TGF-b1 sti-mulation on collagen type I secretion by cultured human ¢broblasts. Lanes1^3: normal ¢broblasts (N-1^3); lanes 4^6: keloid ¢broblasts (K-1^3).Equivalent protein load was controlled by Bio-Rad protein assay kit. (B)Collagen type I expression after treatment withTGF-b1 (1 or 10 ng per ml)and IGF-I (10 or 100 ng per ml) separately, or in combination in normal(N-1) and keloid ¢broblasts (K-1, 2). (C) Fibronectin expression after treat-ment withTGF-b1 (1 or 10 ng per ml), IGF-I (10 or 100 ng per ml), or bothin combination in normal (N-3) and keloid ¢broblasts (K-2, 3). (D) PAI-1expression after treatment withTGF-b1 (1 or 10 ng per ml), IGF-I (10 or 100ng per ml), or both in combination in normal (N-1) and keloid ¢broblasts(K-1, 3).

Figure 2. Expression of collagen type I mRNA after treatment withTGF-b1 (1 or 10 ng per ml), IGF-I (10 or 100 ng per ml) separately,or in combination in cultured ¢broblasts. RNA was extracted fromcultures, reverse transcribed, and analyzed by quantitative reverse transcrip-tion^PCR using real-time PCR. Results are expressed as fold increases ofcollagen I mRNA after normalization to a-tubulin. npo0.05.

958 DAIAN ETAL THE JOURNAL OF INVESTIGATIVE DERMATOLOGY

shown in Fig 5, the synergistic e¡ect was almost completelyblocked by SB203580, but not by PD98059, in both normal andkeloid ¢broblasts. Furthermore, to examine whether PI3Kcorrelates with the enhancement of TGF-b signaling, we usedwortmannin, a PI3K inhibitor. As shown in Fig 6, wortmanninalmost abrogated the synergistic e¡ect of IGF-I. We nextexamined whether phosphorylation of p38 and ATF-2 isenhanced by combination treatment with IGF-I and TGF-b1, asATF-2 has been reported to be a common nuclear target of p38MAPK pathways in TGF-b signaling (Gupta et al, 1995). TGF-b1(10 ng per ml) doubled the level of phospho-ATF-2, andtreatment with IGF-I and TGF-b1 enhanced it by approximately3-fold (Fig 7A). In contrast, treatment with IGF-I alone resultedin little change from control levels. Western blot analysis ofphospho-p38 MAPK gave similar results: combination treatmentmarkedly increased phosphorylation of p38 compared with eitherIGF-I or TGF-b1 treatment alone (Fig 7B). Finally, we examinedwhether JNK activation correlates with synergistic e¡ect of TGF-b and IGF-I; however, the phosphorylation level of JNKwas notchanged by various treatments (Fig 7C).

DISCUSSION

In this study, the expression of collagen type I and ¢bronectinrevealed that keloid ¢broblasts are more responsive to synergistic

Figure 3. (A) 3TP-lux activity in BALB/C 3T3 mouse ¢broblasts and HepG2 cells after treatment with TGF-b1 (1 or 10 ng per ml), IGF-I (10or 100 ng per ml), or with both in combination. 3T3 ¢broblasts and HepG2 cells transfected with 3TP-Lux were incubated for 12 hwith various stimulants. (B) ARE-lux activity in BALB/C 3T3 mouse ¢broblasts and HepG2 cells after treatment with TGF-b1 (1 or 10 ngper ml), IGF-I (10 or 100 ng per ml) separately, or both in combination. 3T3 ¢broblasts and HepG2 cells were cotransfected with ARE-Lux inthe presence or absence of FAST-1 before stimulation. Results are expressed as fold increases above the values for untreated controls (mean 7 SE, n¼ 6).npo0.03, N.S., nonsigni¢cant.

Figure 4. 3TP-lux activity in normal and keloid human ¢bro-blasts treated with TGF-b1 (10 ng per ml), IGF-I (100 ng per ml)separately, or with both in combination. Normal and keloid ¢bro-blasts transfected with 3TP-Lux were incubated 12 h with the sti-mulants. Results are expressed as fold increases above the values foruntreated controls (mean 7 SE, n¼ 6) in normal ¢broblasts. npo0.01;nnpo0.03.

IGF-I ENHANCES TGF-b-INDUCED KELOID FIBROSIS 959VOL. 120, NO. 6 JUNE 2003

stimulation induced by the combination of TGF-b1 and IGF-Ithan normal ¢broblasts. Even on an mRNA level, real-time re-verse transcription^PCR con¢rmed parallel collagen type Ichanges. Although the expression of collagen type I was slightlydownregulated by IGF-I treatment alone on protein and mRNAlevels, the combination of TGF-b and IGF-I enhanced its expres-sion, suggesting that IGF-I plays a modulating role in TGF-b1-stimulated ECM protein secretion. Immunoblot analysis forPAI-1 demonstrated a synergistic e¡ect of IGF-I with TGF-b1,suggesting that ¢brosis may be accelerated as a result of suppres-

sion of ¢brinolysis in keloids. To clarify the signaling mechan-isms of this synergism, we employed the TGF-b trans-actingreporter system. 3TP-Lux activity was increased approximately8-fold when keloid ¢broblasts were treated with TGF-b1 andIGF-I, but not following treatment with IGF-I alone. Ghaharyet al (2000) previously reported that IGF-I induces the expressionof latent TGF-b1 through activation of c-fos and c-jun oncogenes;however, our data show that IGF-I stimulation alone did not in-crease the level of 3TP-Lux activity in time along with ECMprotein production in keloid ¢broblasts.Smad are a family of proteins that operate downstream of var-

ious members of the TGF-b superfamily (Heldin et al, 1997) withSmad2 and Smad3 being downstream e¡ectors of theTGF-b sig-naling pathway. Upon ligand binding, they are phosphorylatedby the TGF-b1 type I receptor kinase and translocate to the nu-cleus in a complex with Smad4 (Huang et al, 1995). This hetero-meric complex may either bind directly to the promoters of itstarget genes, or associate with other transcription factors to in-duce gene transcription (Derynck et al, 1998). Recent work hasidenti¢ed a potential consensus Smad3^Smad4 DNA bindingsite, GTCTAGAC (Zawel et al, 1998), which is observed withinthe 3TP-Lux promoter and ARE-Lux promoter (Yingling et al,1997; Dennler et al, 1998). This suggests that Smad pathways in£u-ence the activation of 3TP-Lux as do MAPK pathways. Recentstudies revealed that Smad pathways are activated in the woundhealing process, and may play some part in ¢brosis (Verrecchiaand Mauviel, 2002). To elucidate whether the synergistic e¡ectof IGF-I on TGF-b1 signaling is mediated by Smad, we exam-ined the ARE-Lux reporter system, both in the presence and ab-sence of FAST-1. As FAST-1 speci¢cally binds to Smad2, theFAST-1-dependent activation of the ARE-Lux promoter ismediated by endogenous Smad4 (Frey and Mulder, 1997). In thisstudy, the ARE-Lux activity in the presence of FAST-1 increasedapproximately 80-fold over the control level in HepG2 cells, butonly by approximately 2.5-fold in 3T3 ¢broblasts, treated withTGF-b1. In addition, IGF-I did not enhance ARE-Lux activityin either HepG2 or 3T3 ¢broblasts. Based on these results, it isplausible that MAPK predominantly in£uence ECM productionby cultured ¢broblasts treated with TGF-b and IGF-I, but Smaddo not; however, Smad3 itself has been demonstrated to be in-volved in various ¢brogenesis models, including keloids (Robertset al, 2001; Chin et al, 2001). Further study is required to clarifythe role of Smad3 in keloid formation.Recently, we and other groups have reported that TGF-b1 can

activate MAPK, ERK, and p38 protein kinase (Hanafusa et al,

Figure 5. 3TP-lux activity in normal and keloid ¢broblasts. The ef-fect on MAPK pathways was examined by pretreatment with eitherPD98059 or SB203580 before administration of IGF-I (100 ng per ml),TGF-b1 (10 ng per ml) separately, or both in combination. PD98059 is aspeci¢c inhibitor of MEK1, and SB203580 is a speci¢c inhibitor of p38.npo0.03

Figure 6. 3TP-lux activity in normal and keloid ¢broblasts. The ef-fect on PI3K pathways was examined by pretreatment with wortmannin(10 nM or 100 nM) before administration of IGF-I (100 ng per ml),TGF-b1(10 ng per ml) or both in combination. Results are expressed as fold in-creases above the values for untreated controls (mean7SE, n¼ 6).npo0.03.

Figure 7.Western blotting showing phosphorylation of ATF-2, p38, andJNK after treatment with TGF-1 (1 or 10 ng per ml), IGF-I (10 or 100 ngper ml) separately, or both in combination in keloid ¢broblasts.

960 DAIAN ETAL THE JOURNAL OF INVESTIGATIVE DERMATOLOGY

1999; Finlay et al, 2000; Ravanti et al, 2001; Akiyama-Uchida et al2002; Sato et al, 2002). AsTAK1 can activate the p38 MAPK path-way, we examined whether speci¢c inhibitors of this signalingpathway can block 3TP-Lux activity. As shown in Fig 5, thesynergistic e¡ect of IGF-I and TGF-b1 was almost completelyabrogated by the p38 inhibitor, SB203580, but not by the MEKinhibitor, PD98059, suggesting that p38 MAPK pathways arepredominantly responsible for the regulation of induction ofgene expression byTGF-b1. Alternatively, IGF-I activates MAPKpathways (ERK1/2) and PI3K pathways (Backer et al, 1992;Rozakis-Adcock et al, 1993; Skolnik et al, 1993). MEK inhibitordid not change the 3TP-Lux activity, indicating that the synergis-tic e¡ect is independent on IGF-I/MEK/ERK pathway. As shownin Fig 6, the modulating e¡ect of IGF-I was almost completelyblocked by the PI3K speci¢c inhibitor, wortmannin. Therefore,the speci¢c inhibition of TGF-b1 signaling pathways suggeststhat PI3K pathways could be prevalent in the regulation ofECM production downstream of the IGF-I receptor. ATF-2, amember of the ATF/cyclic adenosine monophosphate responseelement binding protein (CREB) family of transcription factors,can form dimers through its leucine zipper structure and bindto CRE (Kara et al, 1990). p38 phosphorylates ATF-2 at Thr-69,Thr-71, and Ser-90 (Gupta et al, 1995). Our western blottinganalysis demonstrated that phospho-ATF-2 was markedlyincreased by treatment with IGF-I and TGF-b1.Although the precise cause of overexpression of IGF-IR in ke-

loid ¢broblasts is as yet unknown, it is highly possible that IGF-I/IGF-IR signaling could lead to characteristic keloid activities,such as proliferation, invasion, anti-apoptosis, and excess ECMproduction. Figure 8 shows a proposed molecular mechanismof keloid formation mediated by TGF-b and IGF-I cross-talk.TGF-b stimulates cell proliferation via the ERK pathway(Pena et al, 2000). In previous studies, IGF-I has been associatedwith anti-apoptosis and invasive potential of keloid ¢broblasts(Yoshimoto et al, 1999; Ishihara et al 2000). In this study, wehave described a novel mechanism for keloid formation, inparticular for the excess ECM production. IGF-I enhances¢brosis during keloid formation through TGF-b1 postreceptorsignaling, predominantly via the p38 MAPK/ATF-2 pathway.The exact nature of this complex interaction between TGF-band IGF-I involving cross-talk comprises a focus for further studyon keloid formation.

This work was supported in part by a grant to DrYamashita from the Japanese Min-istry of Education, Science and Culture (no.12877286).We thank DrJe¡rey L.Wranafor the kind donation of 3TP-Lux, ARE-Lux, and hFAST-1.

REFERENCES

Akiyama-Uchida Y, Ashizawa N, Ohtsuru A, et al: Norepinephrine enhances¢brosis mediated by TGF-b in cardiac ¢broblasts. Hypertension 40:148^154,2002

Babu M, Diegelmann RF, Oliver N: Keloid ¢broblasts exhibit an altered response toTGF-b. J Invest Dermatol 99:650^655, 1992

Backer JM, Myers MG, Shoelson SE, et al: Phosphatidylinositol 3-kinase is activatedby association with IRS-1 during insulin stimulation. EMBO J 11:3469^3479,1992

BorderWA, Noble NA: Transforming growth factor beta in tissue ¢brosis. N Engl JMed 331:1286^1292, 1994

Chin GS, LiuW, Peled Z, et al: Di¡erential expression of transforming growth fac-tor-beta receptors I and II and activation of Smad 3 in keloid ¢broblasts. PlastReconstr Surg 108:423^429, 2001

Chodon T, Sugihara T, Igawa HH, et al: Keloid-derived ¢broblasts are refractoryto Fas-mediated apoptosis and neutralization of autocrine transforminggrowth factor-beta1 can abrogate this resistance. Am J Pathol 157:1661^1669,2000

Dennler S, Itoh S, Vivien D, Dijke Part Huet S, Gauthier JM: Direct binding ofSmad3 and Smad4 to critical TGF-b -inducible elements in the promoter ofhuman plasminogen activator inhibitor-type 1 gene. EMBO J 17:3091^3100,1998

Derynck R, Zhang Y, Feng XH: Smad: Transcriptional activators of TGF-bresponses. Cell 95:737^740, 1998

Finlay GA, Thannickal VJ, Fanburg BL, et al: Transforming growth factor-beta 1-induced activation of the ERK pathway/activator protein-1 in human lung¢broblasts requires the autocrine induction of basic ¢broblast growth factor.J Biol Chem 275:27650^27656, 2000

Frey RS, Mulder KM: Involvement of extracellular signal-regulated kinase 2 andstress-activated protein kinase/jun N-terminal kinase activation by transform-ing growth factor beta in the negative growth control of breast cancer cells.Cancer Res 57:628^633, 1997

GhaharyA,Tredget EE, Shen Q, et al: Mannose-6-phosphate/IGF-II receptors med-iate the e¡ects of IGF-1-induced latent transforming growth factor beta 1 onexpression of type I collagen and collagenase in dermal ¢broblasts. Growth Fac-tors 17:167^176, 2000

Gupta S, Campbell D, Derijard B, Davis RJ: Transcription factor ATF-2 regulationby the JNK signal transduction pathway. Science 267:389^393, 1995

Hanafusa HE, Ninomiya TJ, Masuyama N, et al: Involvement of the p38 mitogen-activated protein kinase pathway in transforming growth factor-beta-inducedgene expression. J Biol Chem 274:27161^27167, 1999

Heldin CH, Miyazono K, Dijke P: TGF-b signaling from cell membrane to nucleusthrough Smad proteins. Nature 390:465^471, 1997

Huang HC, Murtaugh LC,Vizw PD,Whitman M: Identi¢cation of a potential reg-ulator of early transcriptional responses to mesoderm inducers in the frog em-bryo. EMBO J 14:5965^5973, 1995

Ishihara H,Yoshimoto H, Fujioka M, et al: Keloid ¢broblasts resist ceramide-inducedapoptosis by overexpression of insulin-like growth factor I receptor. J InvestDermatol 115:1065^1071, 2000

Kara CJ, Liou HC, Ivashkiv LB, Glimcher LH: A cDNA for a human cyclic AMPresponse element-binding protein is distinct from CREB and expressed pre-ferentially in brain. Mol Cell Biol 10:1347^1357, 1990

Ohtsuru A,Yoshimoto H, Ishihara H, et al: Insulin-like growth factor-I (IGF-I)/IGF-Ireceptor axis and increased invasion activity of ¢broblasts in keloid. Endocr J 47(Suppl.):S41^S44, 2000

Pena TL, Chen SH, Konieczny SF, Rane SG: Ras/MEK/ERK up-regulation of the¢broblast KCa channel FIK is a common mechanism for basic ¢broblastgrowth factor and transforming growth factor-beta suppression of myogenesis.J Biol Chem 275 (18):13677^13682, 2000

Ravanti L, Toriseva M, Penttinen R, et al: Expression of human collagenase-3(MMP-13) by fetal skin ¢broblasts is induced by transforming growthfactor beta via p38 mitogen-activated protein kinase. FASEB J 15:1098^1100,2001

Roberts AB, Piek E, Bottinger EP, et al: Is Smad3 a major player in signaltransduction pathways leading to ¢brogenesis? Chest 120 (Suppl.1):43S^47S,2001

Rogounovitch TI, Saenko VA, Shimizu-Yoshida Y, et al: Large deletions inmitochondrial DNA in radiation-associated human thyroid tumors. CancerRes 62:7031^7041, 2002

Rozakis-Adcock M, Fernley R,Wade J, Pawson T, Bowtell D: The SH2 and SH3domains of mammalian Grb2 couple the EGF receptor to the Ras activatormSos1. Nature 363:83^85, 1993

Sato M, Shegogue D, Gore EA, et al: Role of p38 MAPK in transforming growthfactor beta stimulation of collagen production by scleroderma and healthy der-mal ¢broblasts. J Invest Dermatol 118:704^711, 2002

Skolnik EY, Lee CH, Batzer A, et al: The SH2/SH3 domain-containing proteinGRB2 interacts with IRS1 and Shc: implications for insulin control of Ras-signaling. EMBO J 12:1929^1936, 1993

TuanTL, Nichter LS:The molecular basis of keloid and hypertrophic scar formation.Mol MedToday 4:19^24, 1998

Ullrich A, Schlessinger J: Signal transduction by receptors with tyrosine kinase ac-tivity. Cell 61:203^212, 1990

Figure 8. A possible molecular mechanism of keloid formationmediated byTGF-b1 and IGF-I cross-talk.

IGF-I ENHANCES TGF-b-INDUCED KELOID FIBROSIS 961VOL. 120, NO. 6 JUNE 2003

Verrecchia F, Mauviel A: Transforming growth factor-beta signaling through theSmad pathway: role in extracellular matrix gene expression and regulation.J Invest Dermatol 118:211^215, 2002

Yingling JM, Datto MB,Wong C, Frederick JP, Liberati NT,Wang XF: Tumor sup-pressor Smad4 is a transforming growth factor beta-inducible DNA bindingprotein. Mol Cell Biol 17:7019^7028, 1997

Yoshimoto H, Ishihara H, Ohtsuru A, et al: Overexpression of insulin-like growthfactor-1 (IGF-I) receptor and the invasiveness of cultured keloid ¢broblasts. AmJ Pathol 154:883^889, 1999

Younai S, Nichter LS,WelliszT, et al: Modulation of collagen synthesis by transform-ing growth factor-beta in keloid and hypertrophic scar ¢broblasts. Ann PlastSurg 33:148^151, 1994

Zawel L, Dai JL, Buckhaults P, Zhou S, Kinzlwe KW,Vogelstein B, Kern SE: HumanSmad3 and Smad4 are sequence-speci¢c transcription activators. Mol Cell1:611^617, 1998

Zhou S, Zawel L, Lengauer C, Kinzler KW, Vogelstein B: Characterizationof human FAST-1, a TGF beta and activin signal transducer. Mol Cell 2:121^127, 1998

962 DAIAN ETAL THE JOURNAL OF INVESTIGATIVE DERMATOLOGY