Interaction between UL12 and the MRN complex Physical

Interaction between UL12 and the MRN complex

1

1

Physical Interaction between the Herpes Simplex Virus Type 1 2

Exonuclease, UL12, and the DNA double strand break sensing MRN 3

complex 4

5

6

Running title: Interaction between UL12 and the MRN complex 7

8

Nandakumar Balasubramanian1, Ping Bai1, Gregory Buchek1, George Korza1 and 9

Sandra K Weller 1* 10

11

12

13

1 Department of Molecular, Microbial and Structural Biology and The Molecular Biology 14

and Biochemistry Graduate Program, The University of Connecticut Health Center, 15

Farmington CT-06030. 16

17

*Corresponding author: [email protected], tel (860) 679-2310, fax (860) 679-1239 18

Abstract: 237 words 19

Text: 5604 words20

Copyright © 2010, American Society for Microbiology and/or the Listed Authors/Institutions. All Rights Reserved.J. Virol. doi:10.1128/JVI.01506-10 JVI Accepts, published online ahead of print on 13 October 2010

on March 26, 2018 by guest

http://jvi.asm.org/

Dow

nloaded from

http://jvi.asm.org/


2

Abstract 1

The herpes simplex virus type 1 (HSV-1) alkaline nuclease, encoded by the UL12 gene, 2

plays an important role in HSV-1 replication, as a UL12 null mutant displays a severe 3

growth defect. The HSV-1 alkaline exonuclease UL12 interacts with the viral single-4

stranded DNA binding protein ICP8 and promotes strand exchange in vitro in 5

conjunction with ICP8. We have proposed that UL12 and ICP8 form a two subunit 6

recombinase reminiscent of the phage lambda Red α/β recombination system and that 7

the viral and cellular recombinases contribute to viral genome replication through a 8

homologous recombination-dependent DNA replication mechanism. To test this 9

hypothesis, we identified cellular interaction partners of UL12 using co-10

immunoprecipitation. We report for the first time a specific interaction between UL12 11

and components of the cellular MRN complex, an important factor in the ATM-mediated 12

homologous recombination repair pathway (HRR). This interaction is detected early 13

during infection and does not require viral DNA or other viral or cellular proteins. The 14

region of UL12 responsible for the interaction has been mapped to the first 125 15

residues, and co-immunoprecipitation can be abolished by deletion of residues between 16

100 and 126. In this paper we also show virus production is reduced in cells in which 17

levels of Rad50 (component of the MRN complex) are knocked down. These 18

observations support the hypothesis that HSV-1 utilizes both cellular and viral 19

recombination factors and suggest that these recombination proteins work together to 20

promote efficient viral growth. 21


http://jvi.asm.org/

Dow

nloaded from

http://jvi.asm.org/


3

1

Introduction 2

The herpes simplex virus genome replicates in the nucleus of the infected host cell 3

resulting in the production of longer-than-unit-length head-to-tail concatemers of viral 4

DNA. Production of infectious virus requires the processing of concatemeric DNA into 5

unit length genomes by the packaging machinery followed by encapsidation into pre-6

assembled capsids (63). Several lines of evidence, suggest that recombination plays a 7

role in concatemer formation (69). Genomic inversions, proposed to occur through 8

recombination can be detected very early during infection, and these inversions require 9

sequence homology (2,23,56). In addition, replication intermediates in HSV-1 infected 10

cells adopt a complex non-linear structure that does not migrate in a pulsed field gel, 11

even after digestion with an enzyme that cuts once per unit-length of the genome 12

(1,33,51,71). Electron micrographs reveal that replication intermediates are branched 13

containing Y- and X- shaped junctions (19,52). Furthermore, high levels of 14

recombination have been reported not only between co-infecting viral strains 15

(4,17,50,62,66), but also in plasmids containing repeated sequence elements (10,11). 16

These observations taken together are not consistent with a simple rolling circle 17

mechanism of replication and suggest that, reminiscent of the bacteriophages T4 and 18

lambda, HSV-1 utilizes a recombination-dependent replication mechanism to generate 19

concatemeric viral DNA. 20

We have previously reported that virus encoded proteins are capable of 21

participating in recombination events in vitro. The viral 5’� 3’ alkaline exonuclease 22

(UL12) and the single strand binding protein (ICP8) together mediate strand exchange 23


http://jvi.asm.org/

Dow

nloaded from

http://jvi.asm.org/


4

in vitro, and we have proposed that UL12 and ICP8 function as a two-component 1

recombinase similar to the well studied phage lambda Red α/β recombination system 2

(48). ICP8 and UL12 also interact in vivo during HSV-1 infection (61). The lambda 3

exonuclease (Red α) and the single strand binding protein (Red β) mediate strand 4

exchange and recombination (57). In the absence of host recombination proteins, Red 5

α/β is capable of generating head-to-tail concatemers by strand annealing, and in the 6

presence of host recombination factors, the viral recombinase participates in strand 7

invasion reactions (44,57). The phenotypes of AN-1, a UL12 null virus are complex (see 8

discussion for more detail), suggesting that UL12 plays a role either in the initiation of 9

recombination or processing of recombination intermediates (or both) (33,43,53,64). By 10

analogy with lambda, the viral recombinase may also function in conjunction with 11

components of the cellular DNA damage response machinery responsible for the 12

homologous recombination repair pathway (HRR). 13

During HSV-1 infection, the nucleus is dramatically reorganized, resulting in the 14

formation of globular replication compartments in which gene expression, DNA 15

replication and encapsidation occur (7,23,45). Several cellular proteins known to 16

participate in host damage responses are recruited to replication compartments 17

(15,30,55,60,65,68) and are required for efficient virus production (29,29,30,37,60). The 18

MRN complex, consisting of Mre11, Rad50 and Nbs1, is particularly important in the 19

normal cellular damage response as it acts as a sensor of DSBs and is recruited to the 20

site of DNA damage thereby signaling activation of at least one of the PI3 kinase-like 21

kinases (PIKKs), ATM (ataxia-telangiectasia mutated) (24,30,41,42,70). In 2004, we first 22

demonstrated that HSV-1 infection results in the phosphorylation of Nbs1 (68) and other 23


http://jvi.asm.org/

Dow

nloaded from

http://jvi.asm.org/


5

ATM targets were also identified including Chk2, P53, 53BP1 and phospho-ATM 1

(30,55,59). The activation of MRN and the ATM pathway in infected cells is consistent 2

with a role for HRR during HSV-1 infection. 3

To test the hypothesis that viral and cellular proteins participate in recombination-4

dependent DNA synthesis in HSV-1-infected cells, we examined interactions between 5

the viral recombinase and cellular HRR pathway proteins. It has been previously 6

reported that the viral single strand binding protein ICP8 interacts with various cellular 7

DNA repair proteins including Rad50, Mre11, DNA-PKcs, RPA, Ku86, BLM, BRG1 and 8

WRN (60); however, the question of whether some of these interactions are direct or 9

are mediated through other viral and cellular proteins has never been addressed. In this 10

study we focus on identification of cellular proteins that interact with UL12, the nuclease 11

component of the viral recombinase. We report a direct and specific interaction between 12

UL12 and components of the MRN complex. Furthermore we report for the first time 13

that Rad50, a component of the MRN complex, is important for efficient virus growth. 14

Materials and Methods 15

Cell Culture and Viruses 16

African green monkey kidney (Vero) cells were purchased from the American Type 17

Culture Collection and were maintained in Dulbecco’s modified Eagle’s medium 18

(Invitrogen, Carlsbad CA) supplemented with 5% FBS. Cells were grown in the 19

presence of 0.1 mg/ml of Streptomycin and 100 U/ml of Penicillin at 37°C and 5% CO2. 20

The KOS strain of HSV-1 was used as the wild type virus, and it produces both full 21

length UL12 (1-626 residues) and a subgenic protein UL12.5 (127-626 residues). The 22

UL12 null virus AN-1 does not express either UL12 or UL12.5 while the UL12 mutant 23


http://jvi.asm.org/

Dow

nloaded from

http://jvi.asm.org/


6

virus ANF-1 produces only UL12.5. These were propagated in UL12 complementing 6-5 1

cells (53). ICP8 mutant virus HD-2 was provided by Dr. David Knipe (Harvard Medical 2

School) (12). Baculoviruses expressing His-Mre11, His-Rad50 and GST-Nbs1 were 3

provided Dr. Tanya Paull (University of Texas at Austin) (27). 4

Antibodies 5

Anti-Rad50 (13B3) and anti-Mre11 (12D7) monoclonal antibodies were purchased from 6

Genetex. Anti-Nbs1 monoclonal antibody (1C3) was purchased from Novus Biologicals. 7

Anti-Tubulin antibody (T6557) was purchased from Sigma. Anti-UL12 antibody 8

(BWpUL12) that detects both UL12 and UL12.5 was a gift from Joel Bronstein and 9

Peter Weber (Parke-Davis Pharmaceutical Research). Anti-ICP8 monoclonal antibody 10

(39-S) was provided by Dr. David Knipe (Harvard Medical School) and the polyclonal 11

antibody (367) was provided by Dr. William Ruyechan (The State University of New 12

York) (54). 13

Plasmids 14

15

pSAKUL12/12.5 expresses both full length UL12 and UL12.5, pSAKUL12.5 expresses 16

only UL12.5, pSAK N-terminal expresses only the first 126 amino acids of UL12 and 17

pSAK was used as the empty vector (47). The N-terminal truncations of UL12 were a 18

gift from Dr. James Smiley (6). The C-terminal truncations of UL12 were constructed by 19

cloning PCR amplified fragments of UL12 using pSAKUL12/12.5 as the template into 20

EcoR1 and BamH1 double digested pSAK vector to derive pBN104, pBN271, pBN390, 21

pBN421 and pBN490. Table 1 lists the oligonucleotides used in the construction of 22

various constructs in this report. FP1 was used as the forward primer along with the 23

following reverse primers RP104, RP271, RP330, RP421 and RP490 to PCR amplify 24


http://jvi.asm.org/

Dow

nloaded from

http://jvi.asm.org/


7

the corresponding UL12 fragments. To construct the internal deletions of UL12, the 1

fragments corresponding to 127-626 residues of UL12 were PCR amplified using FP2 2

as the forward primer and RP2 as the reverse primer. The PCR product was digested 3

with EcoR1 and BamH1 and cloned into pSAK to derive pBNUL12.5. The fragments 4

corresponding to the first 50, 75 and 100 residues of UL12 were PCR amplified using 5

the forward primer FP3 and the respective reverse primers RP50, RP75 and RP100. 6

The PCR fragments were digested with HindIII and EcoR1 and cloned into a 7

pBNUL12.5 to yield pBN(∆50-125)UL12, pBN(∆75-125)UL12 and pBN(∆100-125) 8

UL12. This method generated the desired truncations and also introduced an EcoR1 9

restriction site to GAATTC between the two fragments resulting in an in frame addition 10

of amino acids E and F to the sequence between the fragments. The UL12.5 fragment 11

with a nuclear localization signal (NLS) was constructed by PCR amplification of 12

pBNUL12.5 using the forward primer FP4 that encodes a SV40 large T antigen NLS 13

PKKKRKV (20), after the start site of UL12.5 and the reverse primer RP2. The PCR 14

amplified constructs were double digested with EcoR1 and BamH1 and cloned in to 15

pSAK creating pBN-NLS-UL12.5. The restriction sites in the primers are highlighted in 16

bold. 17

Transfection and Infection 18

Vero cells at 70-80% confluency plated the previous day were transfected with plasmids 19

expressing the indicated proteins using Lipofectamine Plus reagent (Invitrogen) 20

according to the manufacturer’s instruction. For immunoprecipitation, cells in 100mm2 21

dishes were transfected with 4µg of DNA and for immunofluorescence; cells in 12 well 22

dishes were transfected with 0.5µg DNA. 20 hrs post transfection the cell monolayer 23


http://jvi.asm.org/

Dow

nloaded from

http://jvi.asm.org/


8

was washed three times in PBS (Phosphate buffered saline with 1mM MgCl2 and 1

0.1mM CaCl2) and processed either for immunofluorescence or immunoprecipitation as 2

described below. Infections and viral growth analysis were carried out as described in 3

(53) with minor modifications. 4

Immunofluorescence 5

Infected or transfected cells grown on glass cover slips were washed three times in PBS 6

and fixed in 4% paraformaldehyde in PBS for 10 mins. Fixed cells were washed three 7

times in PBS and were permeabilized for 10 mins in 1% Triton X-100 in PBS. Fixed and 8

permeabilized cells were washed three times in PBS and blocked overnight at 4°C 9

using 3% normal goat serum (NGS) in PBS. Soluble proteins were removed with cold 10

Cytoskeleton (CSK) buffer (10mM Hepes/KOH pH7.4, 100mM NaCl, 300mM sucrose, 3 11

mM MgCl2 and protease inhibitors) containing 0.5% Triton X-100 as described in (9). 12

Pre-extracted cells were washed with PBS and then fixed with 4% paraformaldehyde. 13

The fixed cells were processed for immunofluorescence as described in (32) using the 14

primary antibodies diluted (anti-ICP8 antibody 39-S 1:300, anti-UL12 antibody 15

BWpUL12 1:300, anti-Rad50 antibody 13B3 1:100) in 3%NGS for 2 hour to overnight. 16

Alexafluor anti-mouse and anti-rabbit antibodies (Molecular probes) conjugated to 17

fluorophores that are excited at wavelengths 488 and 647) diluted in 3% NGS were 18

used as the secondary antibodies. TO-PRO-3 (Molecular probes) was used as a 19

nuclear marker at 1:500 dilution, along with the secondary antibody mix. Mounting of the 20

cover slips, imaging on a Zeiss LSM 510 Meta confocal microscope and processing of 21

images were performed as described in (32). 22

Immunoprecipitation 23


http://jvi.asm.org/

Dow

nloaded from

http://jvi.asm.org/


9

Infected or transfected cells were washed twice with cold PBS at the indicated times. 1

The cells were scraped into cold PBS containing protease inhibitors and transferred into 2

15ml tubes. Scraped cells were pelleted for 10 mins at 1500 RPM in 4°C and frozen at -3

80°C. Frozen cells were thawed on ice and resuspended in 450µl of the 4

immunoprecipitation (IP) buffer (1x PBS with 1% NP-40, 0.5% Sodium Deoxycholate 5

(SOC) and 0.1% SDS) with protease inhibitors and transferred to 1.5 ml tubes. The cells 6

were further disrupted using a 1ml syringe with a 25G5/8 needle and incubated on ice 7

for 1.5 hrs for complete lysis. Cell extracts were clarified by centrifugation at 10000 8

RPM for 10 mins at 4°C, and the supernatant was collected as the cell lysate. The 9

following steps were carried out at 4°C with constant agitation in the presence of 10

protease inhibitors. Cell lysates were pre-cleared with 5µl normal rabbit IgG (Santa Cruz 11

Biotechnology) for 1.5 hrs followed by the addition of 40µl protein A agarose beads 12

(Santa Cruz Biotechnology) for 1.5 hrs. Pre-cleared lysates were collected after 13

centrifugation at 2500 RPM for 10 mins. A small portion of the pre-cleared lysates (10µl) 14

was mixed with SDS-sample loading buffer and saved as the input sample. The 15

remaining pre-cleared lysate was immunoprecipitated with 5µl of UL12 antibody 16

(BWpUL12) overnight followed by the addition of 40µl protein A agarose beads. After 24 17

hours beads were collected by centrifugation at 2500 RPM for 10 mins and washed in 18

PBS with protease inhibitors. For samples that were subjected to DNase treatment, the 19

beads were incubated in a 50µl buffer containing 5U of DNase (Invitrogen) and 10mM 20

MgCl2 in PBS with protease inhibitors for 15 mins at room temperature. The DNase 21

activity was tested on an identical preparation to that used in the IP experiment to verify 22

that the DNase was active (data not shown). The beads were washed 5 times with 23


http://jvi.asm.org/

Dow

nloaded from

http://jvi.asm.org/


10

500µl IP buffer for 15 mins followed by centrifugation for 8 mins at 2500 RPM. After 1

washing the beads were resuspended in 40µl SDS sample buffer and stored at -20°C 2

until SDS-PAGE separation and immunoblotting. 3

Immunoblotting 4

Cell monolayers washed in PBS were lysed in buffer containing 0.5% (w/v) SDS and 5

0.05M Tris.Cl, pH 8.0. Lysates were freeze thawed once, sonicated and the cell debris 6

was removed by centrifugation before adding SDS sample buffer and processing for 7

immunoblotting. Samples boiled in SDS sample buffer were separated on a 4-20% 8

SDS-PAGE gel and transferred to a PVDF membrane. Membranes were cut into 9

horizontal strips according to the molecular weight of the protein of interest before 10

probing with primary antibody. The membranes were immunoblotted and developed as 11

described in (46). The membranes were probed with primary antibodies (anti-ICP8 12

antibody (367) 1:1000, anti-UL12 antibody (BWpUL12) 1:5000, anti-Tubulin antibody 13

(BWpUL12) 1:5000, anti-Mre11 antibody (12D7) 1:500, anti-Rad50 (13B3) and anti-14

Nbs1 antibodies (1:800)) diluted in TBST. Appropriate horseradish peroxidase-15

conjugated secondary antibodies were used and Super Signal West Pico 16

chemiluminescence (Pierce) was used to detect the antigen-antibody complexes. For 17

probing proteins of similar molecular weights, membranes were either stripped (25mM 18

glycine, 1%SDS pH 2.0 with HCL) or quenched (10mM Sodium azide in TBST) prior to 19

probing with a different antibody. 20

Protein Purification 21

UL12 was expressed in insect cells infected with recombinant baculovirus and purified 22

to over 90% purity as described in (47). The MRN complex was expressed in insect 23


http://jvi.asm.org/

Dow

nloaded from

http://jvi.asm.org/


11

cells infected with recombinant baculoviruses encoding His-Mre11, GST-Nbs1 and His-1

Rad50 and purified as described in (27). The MRN protein complex purified by Nickel 2

chromatography was subjected to SDS_PAGE. All three subunits were detected by 3

Comassie staining (data not shown). 4

Surface Plasmon Resonance 5

Protein-protein interactions were monitored in real time using the Biacore T100 optical 6

biosensor (GE HealthCare). Purified UL12 was covalently immobilized on a CM5 sensor 7

chip. Protein analytes in HSB buffer (10mM Hepes, pH 7.4, containing 3mM EDTA, 8

0.15M NaCl, and 0. 05% Surfactant P20) were injected over the sensor surface at a 9

flow rate of 30 µl/min for 180 sec followed by HSB buffer without analyte. The surface 10

was regenerated between injections using 10mM NaOH at a flow rate of 50ul/min for 30 11

sec. Purified Bovine serum albumin (BSA) from SIGMA was used as a negative control. 12

Sensorgrams were analyzed using the Biacore T100 Evaluation software and the data 13

was fitted on to the 1:1 Langmuir binding model. 14

Results 15

A subpopulation of UL12 is detergent-resistant and colocalizes with ICP8 in viral 16

replication compartments. 17

UL12 and ICP8 have been shown to function as a two-subunit recombinase in vitro (48). 18

Interaction between ICP8 and UL12 was first reported in 1992 (61) and confirmed by 19

co-immunoprecipitation in lysates of insect cells co-infected with baculoviruses 20

expressing ICP8 and UL12 (47). It has long been recognized that ICP8 localizes to 21

replication compartments in infected cells; however, initial immunofluorescence (IF) 22


http://jvi.asm.org/

Dow

nloaded from

http://jvi.asm.org/


12

studies indicated that UL12 localizes diffusely in the infected cell nucleus (47,61). In 1

these experiments, the diffuse staining makes it difficult to determine whether some 2

UL12 colocalizes with ICP8. In order to more easily visualize UL12 in replication 3

compartments, we pre-extracted infected cells with detergent prior to fixation as 4

described (9,67). Detergent extraction has been reported to remove soluble proteins 5

and proteins that are tethered by protein-protein interactions while leaving chromatin-6

associated or matrix-associated proteins insoluble (9,67). It has been reported that 7

UL12 binds to viral DNA (5), and we hypothesized that a sub-population of UL12 would 8

be resistant to detergent extraction. In the top panel of Figure1 (unextracted), infected 9

cells were fixed and permeabilized, and we observed that UL12 localizes diffusely 10

throughout the nucleus although some staining could be detected in replication 11

compartments (RCs) stained with ICP8 antibodies. In the bottom panel, infected cells 12

were pre-extracted with a cytoskeletal buffer prior to fixation, and we observed that most 13

of the pan-nuclear UL12 staining was removed, leaving behind a sub-population of 14

UL12 that localizes in replication compartments stained with ICP8 antibodies. 15

HSV-1 alkaline nuclease UL12 interacts with components of the cellular MRN 16

complex during infection. 17

Several HRR (homologous recombination repair) proteins including Rad51, RPA, Ku86, 18

ATM and MRN, have been reported to localize to RCs (15,60,65,68); however, their 19

precise roles in the virus life cycle have not been defined, nor is it clear how they are 20

recruited. To address these questions, we sought to identify cellular interaction partners 21

of UL12. UL12 was immunoprecipitated from mock, wild-type and mutant HSV-1 22

infected Vero cells, and co-precipitating proteins were analyzed by immunoblotting for 23


http://jvi.asm.org/

Dow

nloaded from

http://jvi.asm.org/


13

DNA repair and recombination factors. In Figure 2A, the panel labeled “input” 1

demonstrates that approximately equal levels of cellular proteins were present in all the 2

infected cell lysates. In lane 4, co-immunoprecipitation with anti-UL12 antibody shows 3

that MRN components, Mre11, Rad50 and Nbs1, associate with UL12 in KOS-infected 4

cell extracts. Immunoblots were incubated with antisera specific for other cellular factors 5

involved in HRR such as Brca2, Rad51, ATM and RPA32; however, these proteins did 6

not appear to co-immunoprecipitate with UL12 under these conditions (data not shown) 7

and are not considered further in this paper. 8

ICP8 has been reported to interact with Rad50 and Mre11 during HSV-1 infection 9

(60). In order to determine whether the interaction between the MRN components and 10

UL12 seen in Figure 2 reflect direct association with UL12 or are mediated by ICP8, 11

cells were infected with the ICP8 null virus (HD-2). Figure 2A, lane 6, shows that Mre11, 12

Rad50 and Nbs1 still precipitate with UL12 even in lysates from cells infected with the 13

ICP8 null virus (HD-2) indicating that the interaction between UL12 and MRN is 14

independent of ICP8. MRN components are not precipitated from cell lysates of mock-15

infected or UL12 null virus (AN-1) infected control samples (Figure 2A, lanes 2 and 3). 16

Furthermore, lysates from cells infected with the wild type virus incubated with a non 17

specific rabbit IgG antibody was used to rule out non-specific precipitation of the MRN 18

components (Figure 2A, lane 5). Under these conditions a small amount of Rad50 was 19

detected in all samples indicating some non-specific background precipitation. However, 20

the amount of Rad50 co-immunoprecipitated in lanes 4 and 6 where UL12 is present, is 21

significantly higher suggesting that Rad50 is specifically precipitated when antibody to 22

UL12 is used. Figure 2B shows that MRN components are co-immunoprecipated with 23


http://jvi.asm.org/

Dow

nloaded from

http://jvi.asm.org/


14

UL12 as early as two hours post infection, as soon as UL12 is detected and maintained 1

as late as 10hpi (data not shown). 2

The UL12 gene is encoded by a 2.3-kb mRNA, and embedded within this RNA is 3

a subgenic 1.9-kb mRNA encoding an N-terminally truncated version of UL12, 4

designated UL12.5 (34). In order to map the MRN interaction domain within UL12, we 5

first asked whether MRN proteins could be precipitated by full length UL12 and UL12.5. 6

We have previously reported the isolation of a mutant virus, ANF-1, which produces 7

only UL12.5 (34). Immunoprecipitation of lysates from ANF-1-infected cells indicate that 8

UL12.5 alone does not appear to interact with MRN (Figure 2A, lane 1). It is possible 9

that UL12.5 does not interact with MRN because of its cytoplasmic localization; 10

however, experiments presented below indicate that UL12.5 which has been directed to 11

the nucleus is also unable to interact with MRN components. 12

HSV-1 infection results in the activation of the ATM kinase and its downstream 13

targets such as Nbs1 and Chk2 (30,55,68). In Figure 2A and 3A, Nbs1 mobility is 14

shifted (indicating phosphorylation) only in cells infected with wild type and UL12 mutant 15

viruses but not in mock- or HD-2-infected cells. The Nbs1 mobility shift in cells infected 16

with wild type or UL12 mutant virus can be more clearly seen in Figure 2C, in which cell 17

lysates were resolved longer by SDS-PAGE. These results are consistent with the 18

observation that Nbs1 is not phosphorylated in cells infected with viruses that fail to 19

synthesize viral DNA such as the viral polymerase null virus (HP66) (15,68). Viral DNA 20

synthesis would be expected in cells infected with wild type and UL12 mutant viruses 21

but not in mock- or HD-2-infected cells. 22


http://jvi.asm.org/

Dow

nloaded from

http://jvi.asm.org/


15

UL12 - MRN complex interaction is independent of DNA and does not require 1

other viral proteins. 2

Both UL12 and the MRN complex are known to interact with DNA, and we next asked 3

whether the observed interaction is mediated through protein-protein interactions or 4

indirectly through DNA. In Figure 3A, UL12 was precipitated from KOS-infected cell 5

lysates as described above except that the sample shown in lane 3 was subjected to 6

DNase treatment as described in Materials and Methods. Beads containing the 7

immunoprecipitates were incubated in the presence of DNase prior to the final washes. 8

If MRN components are precipitated with the UL12 antibody by virtue of their ability to 9

interact with DNA, they would be removed during the washing steps. The results shown 10

in Figure 3A confirm that MRN proteins do not precipitate in the absence of UL12 as 11

MRN components are not present in immunoprecipitates from mock- (lane 1) and AN-1 12

infected (lane 2) cell lysates. Figure 3A, lane 3 demonstrates that the interaction 13

between UL12 and components of the MRN complex are not affected by DNase 14

treatment, indicating that this interaction is not mediated by DNA. UL12 has also been 15

reported to interact with ICP8 (47,60,61); however, the question of whether this 16

interaction is dependent on DNA has never been addressed. Figure 3A, lane 3 17

demonstrates that UL12 interacts with ICP8 in a DNA independent fashion. 18

Next we asked whether ICP8 or any other viral protein is required for UL12 to 19

interact with the components of the MRN complex. Vero cells were transfected with 20

plasmids that express full length UL12 and UL12.5 (pSAK UL12/UL12.5). Transfected 21

cell lysates were immunoprecipitated with anti-UL12 antibody. Figure 3B (lane 1) 22

demonstrates that expression of UL12 and UL12.5 is sufficient to co-immunoprecipitate 23


http://jvi.asm.org/

Dow

nloaded from

http://jvi.asm.org/


16

the components of the MRN complex. MRN proteins were not observed in the 1

precipitates from cells transfected with an empty vector (Figure 3B, lane2). Taken 2

together, these observations indicate that the interaction between UL12 and MRN is not 3

mediated by other viral proteins or DNA. 4

UL12 directly interacts with the MRN complex in vitro. 5

The experiments described above indicate that the UL12-MRN interaction is 6

independent of DNA and viral proteins but did not address whether it could be mediated 7

through other cellular proteins. We next asked if this interaction could be demonstrated 8

in vitro with purified recombinant proteins using Surface Plasmon Resonance (SPR) 9

assays. In Figure 4, purified UL12 was immobilized on a biosensor chip and protein 10

analytes of known concentrations were injected over the sensor as described in 11

Materials and Methods and, the binding of MRN at multiple concentrations (6, 12.5, 25, 12

50 and 100nM) to immobilized UL12 is shown. Purified BSA at 100nM did not bind to 13

the MRN complex (data not shown) suggesting that the MRN-UL12 interaction is 14

specific. These observations show that UL12 can bind directly to the MRN components 15

even in the absence of other viral and cellular factors. The kinetics of MRN-UL12 16

interaction at various concentrations was analyzed and the rate of association 17

(Ka=4.266E+4 (1/Ms)) and the rate of dissociation (Kd=0.001323 (1/s)) was determined. 18

Based on these values the apparent equilibrium dissociation constant (KD) for the 19

UL12-MRN interaction was determined to be 31.1 nM which represents a fairly high 20

affinity interaction. To put this number in perspective, it is similar to other reported 21

interactions between cellular DNA repair factors MutSβ and the WRN complex (8.8 nM) 22

and between MutSα and the WRN complex (35 nM) (49). In yeast, the interaction 23


http://jvi.asm.org/

Dow

nloaded from

http://jvi.asm.org/


17

between MutSα and the yeast ortholog of WRN, Sgs1, is required for Sgs1 function 1

during DNA repair in vivo (13)(58). 2

Residues in the N-terminus of UL12 are responsible for the interaction with the 3

MRN complex. 4

In order to more finely map the region of UL12 responsible for the MRN interaction, cells 5

were transfected with a series of C-terminal truncation mutants of UL12 generated as 6

described in Materials and Methods. To minimize problems associated with expression 7

of globally misfolded proteins from truncation mutants, the end points of the truncations 8

were selected based on secondary structure predictions and were chosen at positions 9

predicted to be either unstructured or in loop regions between domains predicted to 10

have structure. Figure 5A shows a diagram of the full length UL12, UL12.5 and the 11

series of truncations used in this experiment. In figure 5B, the truncations were tested 12

for their expression and localization by immunofluorescence (IF). The fragment 1-104 13

was localized primarily to the nucleus with some diffuse cytoplasmic localization. All 14

other C-terminal truncations including 1-126 showed predominantly nuclear localization 15

confirming the presence of an NLS within the first 126 residues of UL12 (47). 16

In Figure 5C, an immunoblot analysis of whole cell lysates of Vero cells 17

transfected with the various C-terminal truncations created in this study indicates that 18

UL12 fragments of the expected size were synthesized from the respective truncation 19

plasmids. The shortest fragment of 1-104 is detected around the expected size of 11.5 20

KDa (lane 2) and the full length UL12 is detected around 75 KDa (lane 1). The other C-21

terminal truncations also produced fragments of expected sizes (lanes 3-6). Vero cells 22

were transfected with the various constructs described above and lysates were 23


http://jvi.asm.org/

Dow

nloaded from

http://jvi.asm.org/


18

immunoprecipitated using anti-UL12 antibody and probed with antibodies for each of the 1

components of the MRN complex. The input panel shows the presence of equal levels 2

of the cellular MRN components in all lysates. Figure 5D confirms that proteins of the 3

expected sizes were expressed by each of the truncations. A band of around 50 KDa 4

was detected in all the lanes, likely due to non specific cross reactions between IgG and 5

the secondary antibody. The three bottom panels of Figure 5D demonstrate that all 6

constructs, with the exception of fragment 1-104, UL12.5 and the empty vector (lanes 2, 7

7 and 9) produced a fragment that could interact with components of the MRN complex. 8

The observation that fragments 1-126 and larger, but not fragment 1-104 interacts with 9

MRN components, indicates that the interaction domain resides within the first 125 aa of 10

UL12. 11

To map the interaction more finely, we used a series of N-terminal truncations 12

provided by Dr. James Smiley (Figure 6A) (6). In Figure 6B, cell lysates of Vero cells 13

transfected with the full length and mutant constructs were precipitated using the anti-14

UL12 antibody. The input panel shows the presence of equal levels of the cellular MRN 15

components in all lanes. The IP panel shows that the truncation mutants expressed 16

proteins of the expected sizes (Figure 6B, lanes 1-6) (6). As seen in Figure 5D, a non 17

specific band resulting from cross reaction of the secondary antibody with the IgG was 18

observed in all lanes. MRN components are not precipitated from lysates of cells 19

transfected with the empty vector or plasmids expressing UL12.5, ∆ 100, ∆125 or M185 20

(Figure 6B, lanes 3-6 and 8). On the other hand, full length UL12 or fragments lacking 21

the first 25 and first 50 residues of UL12 were able to precipitate similar levels of MRN 22

(Figure 6B, lanes 1, 2 and 7), indicating that the first 50 residues of UL12 are 23


http://jvi.asm.org/

Dow

nloaded from

http://jvi.asm.org/


19

dispensable for MRN interaction. The lack of apparent interaction between MRN and 1

UL12.5 (lane 8) could be due to the fact that UL12.5 resides primarily in the cytoplasm 2

and therefore may not be in direct contact with the nuclear MRN complex (47). A 3

UL12.5 fragment fused with the SV40 nuclear localization signal (NLS) still failed to 4

interact with the MRN complex (Figure 7C) confirming that specific residues required for 5

interaction reside within the first 126 residues of UL12. 6

The UL12-MRN interaction domain thus appears to reside between residues 50 7

and 125 of UL12. To more finely map the required residues, three UL12 constructs with 8

internal deletions in the region between 50-125 residues (Figure 7A) were constructed 9

which all localize efficiently to the nucleus (Figure 7B) indicating that residues 1-50 of 10

UL12 are sufficient for nuclear localization. Vero cell lysates transfected with the 11

indicated constructs were immunoprecipitated using anti-UL12 antibody, and the 12

precipitates were immunoblotted with antibodies to each of the MRN components. The 13

input panels demonstrate that equal amounts of the cellular MRN components are 14

present in all lanes. The IP panel shows that equal levels of UL12 of the various 15

fragments of UL12 are precipitated, and the bottom three panels indicate that the MRN 16

complex can only be precipitated from cells transfected with full length UL12 (lane 5). 17

These results indicate that the region between residues 50-126 of UL12 contains the 18

interaction domain for MRN and even a relatively small deletion of 25 residues between 19

100-126 is sufficient to disrupt this interaction. 20

Discussion 21

In this paper we report a direct interaction between UL12 and the components of the 22

MRN complex as early as 2hpi, and we have identified the region between 50-125 23


http://jvi.asm.org/

Dow

nloaded from

http://jvi.asm.org/


20

residues of UL12 to be necessary for this interaction. This observation suggests that 1

viral and cellular recombination factors may act together during HSV-1 replication. 2

Furthermore, we show that this interaction is not dependent on the presence of ICP8 or 3

any other viral or cellular proteins, nor is it mediated by DNA, suggesting that this is a 4

direct protein-protein interaction. Using SPR analysis we have determined the apparent 5

equilibrium dissociation constant (KD) as 31.1 nM. 6

Potential role of UL12 in the HSV-1 life cycle. 7

The precise role of UL12 in viral infection is not known, and the analysis of UL12 8

mutant viruses has revealed a complex phenotype. UL12 null virus (AN-1) yield is 9

decreased significantly (100-1000 fold) in Vero cells, but viral DNA synthesis is only 10

moderately affected (64). In AN-1 infected cells, some DNA is encapsidated; however, 11

these capsids show a tendency to disgorge their contents forming “A or empty capsids” 12

and are defective in nuclear egress (33,53). DNA packaged in cells infected with UL12 13

mutant viruses is not infectious (43). One model that is consistent with this complex 14

phenotype is that UL12 is essential for the production of viral DNA that can be 15

packaged productively into virions. Thus, accumulation of fragile genomes and capsids 16

that fail to leave the nucleus in AN-1-infected cells could result from improperly initiated 17

or improperly processed viral replication products (14,33,53). Interestingly, baculovirus 18

encodes a related exonuclease, and null mutants in this gene display similar defects to 19

those of AN-1 in DNA processing resulting in aberrant nuclear egress and 20

encapsidation (39). Thus the role of viral exonucleases in DNA replication may be 21

evolutionarily conserved among different dsDNA viruses. In addition, UL12 has been 22


http://jvi.asm.org/

Dow

nloaded from

http://jvi.asm.org/


21

reported to play a role in resolving adeno-associated virus (AAV) replication 1

intermediates generated when HSV-1 is used as a helper virus (38). 2

Viral and cellular recombination factors may collaborate to mediate viral 3

recombination -dependent replication. 4

The overall mechanism of HSV-1 DNA replication and the formation of larger-5

than-unit length concatemers are poorly understood. Although it was previously 6

proposed that linear virion DNA circularizes in infected cells and that concatemers are 7

generated by rolling circle replication (3,18), several lines of evidence suggest that the 8

fate of the viral genome in the infected cell and the mechanism of DNA replication is 9

more complex than predicted by this model. It has been recognized for some time that 10

the packaged HSV-1 genome contains nicks and gaps (69). If these nicks and gaps are 11

left unrepaired, the passing of a replication fork would be expected to produce a double 12

stranded break (DSB). Since DSBs are known to be highly recombinogenic in all other 13

systems studied (21), it is possible that DSBs generated during HSV-1 replication would 14

stimulate recombination. 15

The two major kinases that sense DSBs are ATM and DNA-PKcs, stimulating the 16

HRR and NHEJ pathways, respectively. DSBs are sensed by the MRN complex to 17

signal ATM activation or by Ku70/Ku86 to activate DNA-PKcs. As mentioned above, 18

ATM targets are phosphorylated in infected cells (30,55,55,68) and virus yields are 19

decreased in cells deficient in ATM, WRN, Chk2, Mre11 and Rad51 (29,30,37,60) 20

suggesting that these proteins may play a positive role in HSV infection. On the other 21

hand, HSV-1 infection results in the degradation of DNA-PKcs in many cell types 22

(28,40), and viral yields increase several-fold in cells deficient for DNA-PKcs and Ku70 23


http://jvi.asm.org/

Dow

nloaded from

http://jvi.asm.org/


22

(40,60) indicating that at least some components of NHEJ may be inhibitory for viral 1

growth. Interestingly cellular ubiquitin ligases RNF8 and RNF168 (components of the 2

ATM pathway) are degraded during infection (31). Thus, HSV has apparently evolved a 3

very complex interaction with the host DNA damage response pathways, activating 4

some components and inactivating others. 5

The MRN complex, acts as a sensor of double strand breaks (DSB) by binding to 6

the sites of DNA damage and acting to recruit and activate the ATM kinase and its 7

downstream targets (25,26). Rad50 unwinds the DNA ends (36), enabling the 8

recruitment of cellular nucleases such as Exo1 and Sae2 that play a role in resecting 9

the broken ends (35). The 3’ single strand tail arising after resection serves as a 10

substrate for the sequential recruitment RPA and Brca2, ultimately resulting in the 11

formation of Rad51 nucleofilaments on the 3’ single strand tails. Rad51 nucleofilaments 12

are capable of detecting homology in duplex DNA and participating in strand invasion to 13

initiate HRR. It is interesting to note that, in addition to its role in the ATM mediated 14

HRR pathways, MRN has also been shown to participate in end resection in the 15

classical NHEJ (16) and the alternative or A-NHEJ(8). MRN also associates with 16

telomeres and participates in the maintenance of normal telomere length (22,72). 17

In summary, this paper provides evidence that the viral exonuclease UL12 can 18

interact directly with the MRN components, important players in the DNA damage 19

response of the cell. Taken together with our previous observation that UL12 and ICP8 20

can function as a two subunit recombinase in vitro (48), these results, may indicate that 21

UL12 and ICP8 along with host recombination factors act to promote concatemer 22

formation by stimulating homologous recombination. According to this scenario, UL12 in 23


http://jvi.asm.org/

Dow

nloaded from

http://jvi.asm.org/


23

collaboration with ICP8 may steer the MRN complex towards the viral genome resulting 1

in end resection and the generation of 3’ tails that can participate in strand invasion or 2

strand annealing. Alternatively, since the MRN complex is known to play roles in 3

multiple repair pathways, it is possible that the UL12-MRN interaction acts to regulate 4

MRN, perhaps by influencing repair pathway choice most beneficial for HSV. The 5

pathway activated by HSV may influence the production of viral DNA concatemers that 6

can be accurately processed and packaged to produce infectious virus. Current efforts 7

are underway to prove the biological consequences of the UL12-MRN interaction. 8

Acknowledgements 9

We thank Dr. John Carson for his help and comments with the SPR experiment, Drs. 10

Betty Eipper and Richard Mains for the use of instruments and Dr. Tanya Paull for 11

providing the MRN constructs. We also thank the members of our laboratory for their 12

helpful comments and suggestions. This work was supported by Public Health Service 13

grant AI069136. 14

15


http://jvi.asm.org/

Dow

nloaded from

http://jvi.asm.org/


24

Table 1. Sequence of oligonucleotides used in the construction of various truncation 1

mutants of UL12. 2

3

4

5

6

7

8

9

10

11

12

13

14

15

16

17

18

19

Oligonucleotide Name

Sequence (5’-3’)

FP1 AAGCTTCGAATTCCGCCACCATGGAGT

RP104 GCAGATGGATCCTCACGGAATGTCCGGGGTCGGAGGC

RP271 GCAGATGGATCCTCACGAAGACTGTACATCCGGCCG

RP330 GCAGATGGATCCTCAACCGTCCATGAGGACCCCACA

RP421 GCAGATGGATCCTCACGGGCCGGGGACGCGCCCGGGCG

RP490 GCAGATGGATCCTCAGGGCTCGCGGCGGACCAGATCC

FP2 TAAGAATTCATGTGGTCGGCGTCGGTGATCCCCAACGCGCT

RP2 ATTGGATCCTCAGCGAGACGACCTCCCCGT

FP3 ATAAGCTTATGGAGTCCACGGGAGGCCCAGCA

RP50 ATTGAATTCGGGACGGAAGGTGGTTGTCAGCGG

RP75 ATTGAATTCCTGATCACGTGGGGGGTTAACGGG

RP100 ATTGAATTCGGTCGGAGGCCCGGAGGCGTCAGA


http://jvi.asm.org/

Dow

nloaded from

http://jvi.asm.org/


25

Reference List 1

2

1. Bataille, D. and A. Epstein. 1994. Herpes simplex virus replicative concatemers 3

contain L components in inverted orientation. Virology 203:384-388. 4

2. Bataille, D. and A. L. Epstein. 1997. Equimolar generation of the four possible 5

arrangements of adjacent L components in herpes simplex virus type 1 6

replicative intermediates. J. Virol. 71:7736-7743. 7

3. Boehmer, P. E. and I. R. Lehman. 1997. Herpes simplex virus DNA replication. 8

Annu. Rev. Biochem. 66:347-384. 9

4. Brown, S. M., J. H. Subak-Sharpe, J. Harland, and A. R. MacLean. 1992. 10

Analysis of intrastrain recombination in herpes simplex virus type 1 strain 17 and 11

herpes simplex virus type 2 strain HG52 using restriction endonuclease sites as 12

unselected markers and temperature-sensitive lesions as selected markers. J. 13

Gen. Virol. 73 ( Pt 2):293-301. 14

5. Chou, J. and B. Roizman. 1989. Characterization of DNA sequence-common 15

and sequence-specific proteins binding to cis-acting sites for cleavage of the 16

terminal a sequence of the herpes simplex virus 1 genome. J. Virol. 63:1059-17

1068. 18

6. Corcoran, J. A., H. A. Saffran, B. A. Duguay, and J. R. Smiley. 2009. Herpes 19

simplex virus UL12.5 targets mitochondria through a mitochondrial localization 20

sequence proximal to the N terminus. J. Virol. 83:2601-2610. 21


http://jvi.asm.org/

Dow

nloaded from

http://jvi.asm.org/


26

7. de Bruyn, K. A. and D. M. Knipe. 1988. Formation of DNA replication structures 1

in herpes virus-infected cells requires a viral DNA binding protein. Cell 55:857-2

868. 3

8. Deriano, L., T. H. Stracker, A. Baker, J. H. Petrini, and D. B. Roth. 2009. 4

Roles for NBS1 in alternative nonhomologous end-joining of V(D)J recombination 5

intermediates. Mol. Cell 34:13-25. 6

9. Dimitrova, D. S. and D. M. Gilbert. 2000. Stability and nuclear distribution of 7

mammalian replication protein A heterotrimeric complex. Exp. Cell Res. 254:321-8

327. 9

10. Dutch, R. E., V. Bianchi, and I. R. Lehman. 1995. Herpes simplex virus type 1 10

DNA replication is specifically required for high-frequency homologous 11

recombination between repeated sequences. J. Virol. 69:3084-3089. 12

11. Dutch, R. E., R. C. Bruckner, E. S. Mocarski, and I. R. Lehman. 1992. Herpes 13

simplex virus type 1 recombination: role of DNA replication and viral a 14

sequences. J. Virol. 66:277-285. 15

12. Gao, M. and D. M. Knipe. 1989. Genetic evidence for multiple nuclear functions 16

of the herpes simplex virus ICP8 DNA-binding protein. J. Virol. 63:5258-5267. 17

13. Goldfarb, T. and E. Alani. 2005. Distinct roles for the Saccharomyces cerevisiae 18

mismatch repair proteins in heteroduplex rejection, mismatch repair and 19

nonhomologous tail removal. Genetics 169:563-574. 20


http://jvi.asm.org/

Dow

nloaded from

http://jvi.asm.org/


27

14. Goldstein, J. N. and S. K. Weller. 1998. The exonuclease activity of HSV-1 1

UL12 is required for in vivo function. Virology 244:442-457. 2

15. Gregory, D. A. and S. L. Bachenheimer. 2008. Characterization of mre11 loss 3

following HSV-1 infection. Virology 373:124-136. 4

16. Helmink, B. A., A. L. Bredemeyer, B. S. Lee, C. Y. Huang, G. G. Sharma, L. 5

M. Walker, J. J. Bednarski, W. L. Lee, T. K. Pandita, C. H. Bassing, and B. P. 6

Sleckman. 2009. MRN complex function in the repair of chromosomal Rag-7

mediated DNA double-strand breaks. J. Exp. Med. 206:669-679. 8

17. Honess, R. W., A. Buchan, I. W. Halliburton, and D. H. Watson. 1980. 9

Recombination and linkage between structural and regulatory genes of herpes 10

simplex virus type 1: study of the functional organization of the genome. J. Virol. 11

34:716-742. 12

18. Jacob, R. J., L. S. Morse, and B. Roizman. 1979. Anatomy of herpes simplex 13

virus DNA. XII. Accumulation of head-to-tail concatemers in nuclei of infected 14

cells and their role in the generation of the four isomeric arrangements of viral 15

DNA. J. Virol. 29:448-457. 16

19. Jacob, R. J. and B. Roizman. 1977. Anatomy of herpes simplex virus DNA VIII. 17

Properties of the replicating DNA. J. Virol. 23:394-411. 18

20. Kalderon, D., B. L. Roberts, W. D. Richardson, and A. E. Smith. 1984. A short 19

amino acid sequence able to specify nuclear location. Cell 39:499-509. 20


http://jvi.asm.org/

Dow

nloaded from

http://jvi.asm.org/


28

21. Kowalczykowski, S. C. 2000. Initiation of genetic recombination and 1

recombination-dependent replication. Trends Biochem. Sci. 25:156-165. 2

22. Lamarche, B. J., N. I. Orazio, and M. D. Weitzman. 2010. The MRN complex in 3

double-strand break repair and telomere maintenance. FEBS Lett. 584:3682-4

3695. 5

23. Lamberti, C. and S. K. Weller. 1996. The herpes simplex virus type 1 UL6 6

protein is essential for cleavage and packaging but not for genomic inversion. 7

Virology 226:403-407. 8

24. Lavin, M. F. and S. Kozlov. 2007. ATM activation and DNA damage response. 9

Cell Cycle 6:931-942. 10

25. Lee, J. H. and T. T. Paull. 2007. Activation and regulation of ATM kinase activity 11

in response to DNA double-strand breaks. Oncogene 26:7741-7748. 12

26. Lee, J. H. and T. T. Paull. 2005. ATM activation by DNA double-strand breaks 13

through the Mre11-Rad50-Nbs1 complex. Science 308:551-554. 14

27. Lee, J. H. and T. T. Paull. 2006. Purification and biochemical characterization of 15

ataxia-telangiectasia mutated and Mre11/Rad50/Nbs1. Methods Enzymol. 16

408:529-539. 17

28. Lees-Miller, S. P., M. C. Long, M. A. Kilvert, V. Lam, S. A. Rice, and C. A. 18

Spencer. 1996. Attenuation of DNA-dependent protein kinase activity and its 19


http://jvi.asm.org/

Dow

nloaded from

http://jvi.asm.org/


29

catalytic subunit by the herpes simplex virus type 1 transactivator ICP0. J. Virol. 1

70:7471-7477. 2

29. Li, H., R. Baskaran, D. M. Krisky, K. Bein, P. Grandi, J. B. Cohen, and J. C. 3

Glorioso. 2008. Chk2 is required for HSV-1 ICP0-mediated G2/M arrest and 4

enhancement of virus growth. Virology 375:13-23. 5

30. Lilley, C. E., C. T. Carson, A. R. Muotri, F. H. Gage, and M. D. Weitzman. 6

2005. DNA repair proteins affect the lifecycle of herpes simplex virus 1. Proc. 7

Natl. Acad. Sci. U. S. A 102:5844-5849. 8

31. Lilley, C. E., M. S. Chaurushiya, C. Boutell, S. Landry, J. Suh, S. Panier, R. 9

D. Everett, G. S. Stewart, D. Durocher, and M. D. Weitzman. 2010. A viral E3 10

ligase targets RNF8 and RNF168 to control histone ubiquitination and DNA 11

damage responses. EMBO J. 29:943-955. 12

32. Livingston, C. M., N. A. DeLuca, D. E. Wilkinson, and S. K. Weller. 2008. 13

Oligomerization of ICP4 and rearrangement of heat shock proteins may be 14

important for herpes simplex virus type 1 prereplicative site formation. J. Virol. 15

82:6324-6336. 16

33. Martinez, R., R. T. Sarisky, P. C. Weber, and S. K. Weller. 1996. Herpes 17

simplex virus type 1 alkaline nuclease is required for efficient processing of viral 18

DNA replication intermediates. J. Virol. 70:2075-2085. 19


http://jvi.asm.org/

Dow

nloaded from

http://jvi.asm.org/


30

34. Martinez, R., L. Shao, J. C. Bronstein, P. C. Weber, and S. K. Weller. 1996. 1

The product of a 1.9-kb mRNA which overlaps the HSV-1 alkaline nuclease gene 2

(UL12) cannot relieve the growth defects of a null mutant. Virology 215:152-164. 3

35. Mimitou, E. P. and L. S. Symington. 2009. DNA end resection: many nucleases 4

make light work. DNA Repair (Amst) 8:983-995. 5

36. Moncalian, G., B. Lengsfeld, V. Bhaskara, K. P. Hopfner, A. Karcher, E. 6

Alden, J. A. Tainer, and T. T. Paull. 2004. The rad50 signature motif: essential 7

to ATP binding and biological function. J. Mol. Biol 335:937-951. 8

37. Muylaert, I. and P. Elias. 2010. Contributions of nucleotide-excision repair, DNA 9

polymerase {eta} and homologous recombination to replication of UV-irradiated 10

Herpes simplex virus type I. J. Biol Chem. 285:13761-8 11

38. Nicolas, A., N. azard-Dany, C. Biollay, L. Arata, N. Jolinon, L. Kuhn, M. 12

Ferro, S. K. Weller, A. L. Epstein, A. Salvetti, and A. Greco. 2010. 13

Identification of rep-associated factors in herpes simplex virus type 1-induced 14

adeno-associated virus type 2 replication compartments. J. Virol. 84: 8871-87. 15

39. Okano, K., A. L. Vanarsdall, and G. F. Rohrmann. 2007. A baculovirus alkaline 16

nuclease knockout construct produces fragmented DNA and aberrant capsids. 17

Virology 359:46-54. 18

40. Parkinson, J., S. P. Lees-Miller, and R. D. Everett. 1999. Herpes simplex virus 19

type 1 immediate-early protein vmw110 induces the proteasome-dependent 20


http://jvi.asm.org/

Dow

nloaded from

http://jvi.asm.org/


31

degradation of the catalytic subunit of DNA-dependent protein kinase. J. Virol. 1

73:650-657. 2

41. Paull, T. T. and J. H. Lee. 2005. The Mre11/Rad50/Nbs1 complex and its role as 3

a DNA double-strand break sensor for ATM. Cell Cycle 4:737-740. 4

42. Petrini, J. H. and T. H. Stracker. 2003. The cellular response to DNA double-5

strand breaks: defining the sensors and mediators. Trends Cell Biol 13:458-462. 6

43. Porter, I. M. and N. D. Stow. 2004. Virus particles produced by the herpes 7

simplex virus type 1 alkaline nuclease null mutant ambUL12 contain abnormal 8

genomes. J. Gen. Virol. 85:583-591. 9

44. Poteete, A. R. 2001. What makes the bacteriophage lambda Red system useful 10

for genetic engineering: molecular mechanism and biological function. FEMS 11

Microbiol. Lett. 201:9-14. 12

45. Quinlan, M. P., L. B. Chen, and D. M. Knipe. 1984. The intranuclear location of 13

a herpes simplex virus DNA-binding protein is determined by the status of viral 14

DNA replication. Cell 36:857-868. 15

46. Rajagopal, C., K. L. Stone, V. P. Francone, R. E. Mains, and B. A. Eipper. 16

2009. Secretory granule to the nucleus: role of a multiply phosphorylated 17

intrinsically unstructured domain. J. Biol Chem 284:25723-25734. 18


http://jvi.asm.org/

Dow

nloaded from

http://jvi.asm.org/


32

47. Reuven, N. B., S. Antoku, and S. K. Weller. 2004. The UL12.5 gene product of 1

herpes simplex virus type 1 exhibits nuclease and strand exchange activities but 2

does not localize to the nucleus. J. Virol. 78:4599-4608. 3

48. Reuven, N. B., A. E. Staire, R. S. Myers, and S. K. Weller. 2003. The herpes 4

simplex virus type 1 alkaline nuclease and single-stranded DNA binding protein 5

mediate strand exchange in vitro. J. Virol. 77:7425-7433. 6

49. Saydam, N., R. Kanagaraj, T. Dietschy, P. L. Garcia, J. Pena-Diaz, I. 7

Shevelev, I. Stagljar, and P. Janscak. 2007. Physical and functional 8

interactions between Werner syndrome helicase and mismatch-repair initiation 9

factors. Nucleic Acids Res. 35:5706-5716. 10

50. Schaffer, P. A., M. J. Tevethia, and M. yesh-Melnick. 1974. Recombination 11

between temperature-sensitive mutants of herpes simplex virus type 1. Virology 12

58:219-228. 13

51. Severini, A., A. R. Morgan, D. R. Tovell, and D. L. Tyrrell. 1994. Study of the 14

structure of replicative intermediates of HSV-1 DNA by pulsed-field gel 15

electrophoresis. Virology 200:428-435. 16

52. Severini, A., D. G. Scraba, and D. L. Tyrrell. 1996. Branched structures in the 17

intracellular DNA of herpes simplex virus type 1. J. Virol. 70:3169-3175. 18

53. Shao, L., L. M. Rapp, and S. K. Weller. 1993. Herpes simplex virus 1 alkaline 19

nuclease is required for efficient egress of capsids from the nucleus. Virology 20

196:146-162. 21


http://jvi.asm.org/

Dow

nloaded from

http://jvi.asm.org/


33

54. Shelton, L. S., A. G. Albright, W. T. Ruyechan, and F. J. Jenkins. 1994. 1

Retention of the herpes simplex virus type 1 (HSV-1) UL37 protein on single-2

stranded DNA columns requires the HSV-1 ICP8 protein. J. Virol. 68:521-525. 3

55. Shirata, N., A. Kudoh, T. Daikoku, Y. Tatsumi, M. Fujita, T. Kiyono, Y. 4

Sugaya, H. Isomura, K. Ishizaki, and T. Tsurumi. 2005. Activation of ataxia 5

telangiectasia-mutated DNA damage checkpoint signal transduction elicited by 6

herpes simplex virus infection. J. Biol Chem 280:30336-30341. 7

56. Smiley, J. R., J. Duncan, and M. Howes. 1990. Sequence requirements for 8

DNA rearrangements induced by the terminal repeat of herpes simplex virus type 9

1 KOS DNA. J. Virol. 64:5036-5050. 10

57. Stahl, M. M., L. Thomason, A. R. Poteete, T. Tarkowski, A. Kuzminov, and F. 11

W. Stahl. 1997. Annealing vs. invasion in phage lambda recombination. Genetics 12

147:961-977. 13

58. Sugawara, N., T. Goldfarb, B. Studamire, E. Alani, and J. E. Haber. 2004. 14

Heteroduplex rejection during single-strand annealing requires Sgs1 helicase 15

and mismatch repair proteins Msh2 and Msh6 but not Pms1. Proc. Natl. Acad. 16

Sci. U. S. A 101:9315-9320. 17

59. Takaoka, A., S. Hayakawa, H. Yanai, D. Stoiber, H. Negishi, H. Kikuchi, S. 18

Sasaki, K. Imai, T. Shibue, K. Honda, and T. Taniguchi. 2003. Integration of 19

interferon-alpha/beta signalling to p53 responses in tumour suppression and 20

antiviral defence. Nature 424:516-523. 21


http://jvi.asm.org/

Dow

nloaded from

http://jvi.asm.org/


34

60. Taylor, T. J. and D. M. Knipe. 2004. Proteomics of herpes simplex virus 1

replication compartments: association of cellular DNA replication, repair, 2

recombination, and chromatin remodeling proteins with ICP8. J. Virol. 78:5856-3

5866. 4

61. Thomas, M. S., M. Gao, D. M. Knipe, and K. L. Powell. 1992. Association 5

between the herpes simplex virus major DNA-binding protein and alkaline 6

nuclease. J. Virol. 66:1152-1161. 7

62. Umene, K. 1985. Intermolecular recombination of the herpes simplex virus type 8

1 genome analysed using two strains differing in restriction enzyme cleavage 9

sites. J. Gen. Virol. 66:2659-2670. 10

63. Vlazny, D. A., A. Kwong, and N. Frenkel. 1982. Site-specific 11

cleavage/packaging of herpes simplex virus DNA and the selective maturation of 12

nucleocapsids containing full-length viral DNA. Proc. Natl. Acad. Sci. U. S. A 13

79:1423-1427. 14

64. Weller, S. K., M. R. Seghatoleslami, L. Shao, D. Rowse, and E. P. 15

Carmichael. 1990. The herpes simplex virus type 1 alkaline nuclease is not 16

essential for viral DNA synthesis: isolation and characterization of a lacZ 17

insertion mutant. J. Gen. Virol. 71 ( Pt 12):2941-2952. 18

65. Wilcock, D. and D. P. Lane. 1991. Localization of p53, retinoblastoma and host 19

replication proteins at sites of viral replication in herpes-infected cells. Nature 20

349:429-431. 21


http://jvi.asm.org/

Dow

nloaded from

http://jvi.asm.org/


35

66. Wildy P. 1955. Recombination with herpes simplex virus. J. Gen. Microbiol. 1

13:346-360. 2

67. Wilkinson, D. E. and S. K. Weller. 2006. Herpes simplex virus type I disrupts 3

the ATR-dependent DNA-damage response during lytic infection. J. Cell Sci. 4

119:2695-2703. 5

68. Wilkinson, D. E. and S. K. Weller. 2004. Recruitment of cellular recombination 6

and repair proteins to sites of herpes simplex virus type 1 DNA replication is 7

dependent on the composition of viral proteins within prereplicative sites and 8

correlates with the induction of the DNA damage response. J. Virol. 78:4783-9

4796. 10

69. Wilkinson, D. E. and S. K. Weller. 2003. The role of DNA recombination in 11

herpes simplex virus DNA replication. IUBMB. Life 55:451-458. 12

70. Williams, R. S., J. S. Williams, and J. A. Tainer. 2007. Mre11-Rad50-Nbs1 is a 13

keystone complex connecting DNA repair machinery, double-strand break 14

signaling, and the chromatin template. Biochem. Cell Biol 85:509-520. 15

71. Zhang, X., S. Efstathiou, and A. Simmons. 1994. Identification of novel herpes 16

simplex virus replicative intermediates by field inversion gel electrophoresis: 17

implications for viral DNA amplification strategies. Virology 202:530-539. 18

72. Zhu, X. D., B. Kuster, M. Mann, J. H. Petrini, and L. T. de. 2000. Cell-cycle-19

regulated association of RAD50/MRE11/NBS1 with TRF2 and human telomeres. 20

Nat. Genet. 25:347-352. 21


http://jvi.asm.org/

Dow

nloaded from

http://jvi.asm.org/


36

1

2

Figure Legends 3

Figure 1. A subpopulation of UL12 is detergent resistant and localizes to replication 4

compartments. In the top panel, KOS infected Vero cells were fixed and permeabilized 5

as described in Materials and Methods. In the bottom panel, KOS infected Vero cells 6

were extracted with the CSK buffer containing Triton X-100 prior to fixation to remove 7

nucleosolic and cytosolic fractions followed by fixation and permeabilization. The cells 8

were labeled with the polyclonal anti-UL12 antibody BWpUL12 (green) and the 9

monoclonal anti-ICP8 antibody 39S (red) was used as the marker for viral replication 10

compartments. Merged pixels are shown in yellow. In this experiment the majority of 11

cells (34 out of 38) showed that UL12 localized in replication compartments in pre-12

extracted cells. Arrows indicate replication compartments within a single nucleus. 13

Figure 2. UL12 interacts with components of the cellular MRN complex in HSV-1 14

infected cell lysates. A) Vero cells were either mock infected (lane 2) or infected with 15

UL12.5 virus ANF-1 (lane 1), UL12 null virus AN-1 (lane 3), WT virus KOS (lanes 4 and 16

5) or ICP8 null virusHD-2 (lane 6). Anti-UL12 antibody was used to immunoprecipitate 17

cell lysates of infected cells collected 6 hours post infection (hpi) as described in 18

Materials and Methods except for lane 5, in which normal rabbit IgG was used as a 19

control (indicated by an *). Input samples contain 3% of the pre-cleared cell lysates 20

collected prior to immunoprecipitation. UL12 fragments that are immunoprecipitated with 21

anti-UL12 antibody are shown in the panel labeled IP. Proteins that co-22

immunoprecipitated with UL12 are shown in the panels labeled Co-IP. The arrow 23

indicates the position of the band corresponding to full length Mre11. B) Vero cells were 24


http://jvi.asm.org/

Dow

nloaded from

http://jvi.asm.org/


37

infected with KOS and collected at the indicated time points post infection. 1

Immunoprecipitation was performed and displayed as described for Panel A. C) Vero 2

cells were mock-infected (lane 1) or infected with WT virus KOS (lane 2), UL12 null 3

virus AN-1 (lane 3) or ICP8 null virus HD-2 (lane 4). Infected cells were collected 6 hpi, 4

and cell lysates were prepared for immunoblotting as described under Materials and 5

Methods. In this panel, the proteins were resolved for a longer period of time to highlight 6

the mobility shift of Nbs1 upon HSV-1 infection. Tubulin was used as the loading 7

control. 8

Figure 3. The UL12-MRN interaction does not require DNA or other viral proteins. A) 9

Vero cells mock-infected or infected with UL12 null virus AN-1 or the wild type virus 10

KOS as indicated were collected 6 hpi. Cell lysates were immunoprecipitated with anti-11

UL12 antibody. In lane 3 marked as (+) the sample was subjected to DNase treatment 12

during immunoprecipitation while in lanes 1,2 and 4 marked as ( _ ) immunoprecipitation 13

was carried out in the absence of DNase. B) Vero cells were transfected with either 14

pSAK UL12/12.5 expressing the wild type UL12 under the CMV promoter (lane1) or with 15

pSAK empty vector (lane 2). Cells were collected 20 hours post transfection, and cell 16

lysates were immunoprecipitated using anti-UL12 antibody and were subjected to 17

DNase treatment as described in Materials and Methods. 18

Figure 4. UL12 directly binds to the MRN complex. SPR sensorgrams of UL12 19

interaction with the MRN complex at increasing concentrations of 6.25, 12.5, 25, 50 and 20

100nM were performed using a Biacore T100 at room temperature. The black lines 21

represent the binding curve of the analytes at specific concentrations, and the grey lines 22


http://jvi.asm.org/

Dow

nloaded from

http://jvi.asm.org/


38

represent the 1:1 binding model curve which was used to fit the data and calculate the 1

kinetics of the interaction. 2

Figure 5. UL12 interacts with components of the MRN complex through the N-terminal 3

region of UL12. A) Schematic representation of the UL12 constructs used in panels B 4

and C. B) Vero cells were transfected with plasmids expressing C-terminal truncations 5

of UL12, WT UL12 and UL12.5 as indicated. Transfected cells were fixed 20 hours post 6

transfection and tested for expression and localization of the UL12 fragments by 7

immunofluorescence. C) Whole cell lysates of Vero cells transfected with full length 8

UL12 (lane 1), C-terminal truncations (lanes 2-6) or empty vector (lane 7) were 9

immunoblotted and probed with UL12 antibody. Full length and truncations were able to 10

express UL12 fragments of the expected sizes. D) Vero cells transfected with plasmids 11

expressing C-terminal truncations of UL12 as indicated (lanes 1-6), empty vector (lane 12

7), wild type UL12 (lane 8) or UL12.5 (lane 9) were collected at 20 hours post 13

transfection. Cell lysates were immunoprecipitated using anti-UL12 antibody and probed 14

for the indicated proteins to detect interactions. The immunoprecipitation reaction was 15

subjected to DNase treatment as described in Materials and Methods. The asterisk 16

marks non specific bands arising due to the cross reaction between the secondary 17

antibody and IgG. 18

Figure 6. The N-terminal 50 amino acids of UL12 are not required for the UL12-MRN 19

interaction. A) Schematic representation of the N-terminal deletion constructs used in 20

panel B. B) Vero cells were transfected with plasmids expressing N-terminal truncations 21

of UL12 as indicated (lanes 1-5), empty vector (lane 6) full length UL12 (lane 7) or 22

UL12.5 (lane 8). Cells were collected at 20 hours post transfection and cell lysates were 23


http://jvi.asm.org/

Dow

nloaded from

http://jvi.asm.org/


39

immunoprecipitated using anti-UL12 antibody as described in the legend to Figure 5. 1

The asterisk mark non specific bands arising due to the cross reaction between the 2

secondary antibody and IgG. 3

Figure 7. N-terminal 100-126 amino acids of UL12 are essential for the UL12 4

interaction with the components of the MRN complex. A) Schematic representation of 5

UL12 constructs used in panel B and C. B) Vero cells were transfected with plasmids 6

expressing the N-terminal internal deletions of UL12 as indicated. Cells were fixed at 20 7

hours post transfection and tested for UL12 expression and localization by 8

immunofluorescence. C) Vero cells were transfected with plasmids expressing the 9

indicated constructs described in B (lanes 1-4) or full length UL12 (lane 5). Cells were 10

collected at 20 hours post transfection and immunoprecipitated as described in the 11

legend to Figure 5. 12

13 on March 26, 2018 by guest

http://jvi.asm.org/

Dow

nloaded from

http://jvi.asm.org/

U n e x t r a c t e dE x t r a c t e d

U L 1 2 I C P 8 M e r g e


http://jvi.asm.org/

Dow

nloaded from

http://jvi.asm.org/

B )

C o � I PI n p u t R a d 5 0M r e 1 1N b s 1U L 1 2U L 1 2 . 5

64320 h p iR a d 5 0M r e 1 1N b s 1U L 1 2I P U L 1 2 . 5

A ) R a d 5 0M r e 1 1N b s 1C o � I P U L 1 2U L 1 2 . 5R a d 5 0M r e 1 1N b s 1

I n p u tI P1 2 3 4 5 6R a d 5 0N b s 1T u b u l i n1 2 3 4

C ) on March 26, 2018 by guest

http://jvi.asm.org/

Dow

nloaded from

http://jvi.asm.org/

B )

C o � I PI n p u t R a d 5 0M r e 1 1N b s 1U L 1 2R a d 5 0M r e 1 1N b s 1U L 1 2I P U L 1 2 . 5

1 2U L 1 2 . 5

A )

C o � I PI n p u t R a d 5 0M r e 1 1N b s 1U L 1 2U L 1 2 . 5

I C P 8D N a s e+ _R a d 5 0M r e 1 1N b s 1U L 1 2I C P 8

_ _I P U L 1 2 . 5

1 2 3 4


http://jvi.asm.org/

Dow

nloaded from

http://jvi.asm.org/

6 . 2 5 n M1 2 . 5 n M2 5 n M5 0 n M1 0 0 n M


http://jvi.asm.org/

Dow

nloaded from

http://jvi.asm.org/

1 2 3 4 5 6 7 98

I n p u tC o � I P

R a d 5 0N b s 1M r e 1 1R a d 5 0N b s 1M r e 1 1

I P U L 1 2F r a g m e n t s**D )1 1 4 9 0 a a1 7 4 2 1 a a1 7 3 3 0 a a1 7 2 7 1 a a1 7 1 0 4 W i l d t y p e U L 1 2 ( 6 2 6 a a )U L 1 2 . 5 ( 1 2 7 7 6 2 6 a a )1 7 1 2 6 I n t e r a c t i o nw i t h M R N++_++++_B ) 1 � 1 0 4 1 � 1 2 61 � 3 3 0W T U L 1 2 1 � 4 2 1U L 1 2 . 5 1 � 4 9 01 � 2 7 1

2 5 K D a5 0 K D a7 5 K D a1 2 3 4 5 6 7

A )

C ) on March 26, 2018 by guest

http://jvi.asm.org/

Dow

nloaded from

http://jvi.asm.org/

A ) W i l d t y p e U L 1 2 ( 1 � 6 2 6 a a )U L 1 2 . 5 ( 1 2 7 � 6 2 6 a a )� 1 2 5 ( 1 2 6 � 6 2 6 a a )� 1 0 0 ( 1 0 1 � 6 2 6 a a )M 1 8 5 ( 1 8 5 � 6 2 6 a a )� 5 0 ( 5 1 � 6 2 6 a a )� 2 5 ( 2 6 $ 6 2 6 a a ) I n t e r a c t i o n w i t hM R N+_ ++___

R a d 5 0N b s 1M r e 1 1I n p u tC o E I P R a d 5 0N b s 1M r e 1 1

I P U L 1 2F r a g m e n t sB )

1 2 3 4 5 6 7 8* on M

arch 26, 2018 by guesthttp://jvi.asm

.org/D

ownloaded from

http://jvi.asm.org/

C )B )

� 5 0 � 1 2 6 U L 1 2� 7 5 � 1 2 6 U L 1 2 � 1 0 0 � 1 2 6 U L 1 2N L S � U L 1 2 . 5A ) N L S � U L 1 2 . 5N L S � 5 0 � 1 2 6 U L 1 2� 1 0 0 � 1 2 6 U L 1 2� 7 5 � 1 2 6 U L 1 2W i l d t y p e U L 1 2 ( 1 � 6 2 6 a a )

M r e 1 1N b s 1R a d 5 0M r e 1 1N b s 1R a d 5 0U L 1 2I n p u t

C o � I P 1 2 3 4 5 on March 26, 2018 by guest

http://jvi.asm.org/

Dow

nloaded from

http://jvi.asm.org/

Documents

Interaction between UL12 and the MRN complex Physical