Upload
others
View
2
Download
0
Embed Size (px)
Citation preview
1
Interaction of p38 and Sp1 in a mechanical force-induced, β1-integrin-mediated
transcriptional circuit that regulates the actin binding protein filamin-A.
Mario D’Addario, Pamela D. Arora,
Richard P. Ellen and Christopher A.G. McCulloch
CIHR Group in Matrix Dynamics
University of Toronto, Toronto, Ontario, Canada
Institute of Dental Research
Faculty of Dentistry, University of Toronto.
Correspondence: Christopher A.G. McCulloch University of Toronto Room 244, Fitzgerald Building 150 College Street Toronto, Ontario CANADA M5S 3E2 Telephone: 416-978-1258 FAX: 416-978-5956 e-mail: [email protected] Running Title: Mechanical force induces filamin-A by p38 and Sp1. Key Words: actin, p38, MAP kinase, filamin A, Sp1, fibroblasts
Copyright 2002 by The American Society for Biochemistry and Molecular Biology, Inc.
JBC Papers in Press. Published on September 24, 2002 as Manuscript M207681200 by guest on N
ovember 14, 2020
http://ww
w.jbc.org/
Dow
nloaded from
2
ABSTRACT
Connective tissue cells in mechanically active environments survive applied physical forces by
modifying actin cytoskeletal structures that stabilize cell membranes. In fibroblasts, tensile forces
induce the expression of filamin-A, a mechanoprotective actin binding protein, but the mechanisms
and protein interactions by which force activates filamin-A transcription are not defined. We found
that in fibroblasts, application of tensile forces through collagen-coated magnetite beads to cell
surface β1-integrins induced filamin-A expression. This induction required actin filaments and
selective activation of the p38 MAP kinase. Force promoted the redistribution of p38 to the
integrin/bead locus and the nucleus as well as enhanced binding of the transcription factor Sp1 to
proximal, regulatory domains of the filamin-A promoter. Force application increased association of
Sp1 with p38 and phosphorylation of Sp1. Transcriptional activation of filamin-A in force-treated
fibroblasts was subsequently mediated by Sp1 binding sites on the filamin-A promoter. These
results provide evidence for a mechanically coupled transcriptional circuit that originates at the
magnetite bead/integrin locus, activates p38, tethers p38 to actin filaments, promotes binding of
p38 to Sp1 in the nucleus and induces filamin A expression.
by guest on Novem
ber 14, 2020http://w
ww
.jbc.org/D
ownloaded from
3
INTRODUCTION
Connective tissue cells are subjected to high-amplitude mechanical forces that in part are directed
through cell surface integrins to the cell interior (1). Some of the cellular responses to extracellular
forces include reorganization of subcortical actin and alteration of gene expression (reviewed in
2,3), suggesting that integrin-mediated signals can mediate adaptations to force that extend from
the plasma membrane to the nucleus. We have shown previously that mechanical forces directed
through β1-integrins promote redistribution of filamin-A to the integrin/bead locus (4) and enhance
filamin-A expression (5). While these findings support a role for integrin-based cell signaling in
response to physical forces, the protein interactions and transcriptional regulation involved in this
pathway have not been examined in detail.
Integrin-mediated forces activate several signaling pathways including phosphorylation of
focal adhesion structural proteins such as α-actinin, vinculin, talin, tensin, filamin and paxillin as
well as the focal adhesion kinase and Src family protein tyrosine kinases (rev. 2,3,6). Filamins are
actin-binding proteins originally isolated from chicken gizzard that organize actin filaments into
orthogonal networks and enhance the rigidity of the actin cytoskeleton (rev. 7). Filamins bind a
large number of membrane-associated and cytoplasmic proteins at their carboxy and amino
terminal-ends and help tether the actin cytoskeleton to numerous cytoplasmic structures (7). The
enhanced transcription and expression of filamin-A in response to mechanical force directed
through cell surface integrins is dependent on de novo protein synthesis, an intact actin
cytoskeleton and Sp1 transcription factor binding sites in the filamin-A promoter (5). These studies
suggested the outline of a mechanism in which extracellular mechanical forces can regulate the
expression of filamin-A.
The ability of cells to respond to exogenous and endogenously generated mechanical forces
has prompted the examination of integrin-matrix interactions and the organization of the actin
by guest on Novem
ber 14, 2020http://w
ww
.jbc.org/D
ownloaded from
4
cytoskeleton. In this context, fibroblasts grown on fibronectin but not poly-L-lysine exhibit basal
ERK 1/2 activation (8), a response that requires intact filaments. Similarly, ERK 1/2 activation
occurs at focal adhesions in fibroblasts grown on laminin or fibronectin but not poly-L-lysine (9).
Mechanical force-induced DNA synthesis and down-regulation of the platelet derived growth
factor (PDGF) promoter also requires integrin ligation (10,11), processes which are mediated in
part by NF-κB and Sp1 binding sequences in the PDGF promoter (11). Force-induced filamin-A
expression is found in cells plated on collagen or fibronectin but not poly-L-lysine (5).
Collectively, these studies suggest that cellular adhesion to extracellular matrices affects the
organization of the actin cytoskeleton and accordingly regulates force-induced gene expression
through specific transcription factors and distinct signaling pathways.
While these studies indicate the existence of force-induced activation pathways that
originate at the cell membrane, the protein interactions that mediate downstream transcriptional
regulation of cytoskeletal genes have not been defined. In this report we examined the regulation of
the actin binding protein filamin-A in response to tensile forces applied through integrin receptors
(1,4). We describe a functional pathway that is initiated at the extracellular matrix-β1-integrin
locus, drives bi-directional migration of p38 and pp38 to integrins and to the nucleus and promotes
the interaction of p38 with actin filaments. The activation of this pathway enhances Sp1
phosphorylation and mediates the interaction of Sp1 with the p38 MAP kinase, processes that are
essential for force-induced filamin expression.
by guest on Novem
ber 14, 2020http://w
ww
.jbc.org/D
ownloaded from
5
EXPERIMENTAL PROCEDURES
Cell culture and reagents
Human gingival fibroblasts were derived from primary explant cultures as described (12). Cells
from passages 6-15 were grown as monolayer cultures in T-25 flasks (Falcon, Becton Dickinson,
Mississauga, ON) in α-MEM containing 10% fetal bovine serum (FBS) and antibiotics. Twenty-
four hours prior to each experiment, cells were harvested and plated at 75% confluence. The
experiments involving promoter analyses utilized Rat-2 fibroblasts as surrogates for gingival
fibroblasts as described previously (13). Cells were maintained in DMEM with 5% FBS and
antibiotics. Prior to transfection, the cells were cultured in OPTI-MEM (GIBCO/Invitrogen Corp.,
Mississauga, ON) at 75% confluence and then transfected as described below.
Mouse anti-filamin-A monoclonal antibody was obtained from Serotec (Cedarlane
Laboratories, Hornby, ON). Mouse monoclonal antibodies to β-actin, pp38, p38, Sp1 and
phosphoserine/threonine were obtained from Cell Signaling Technologies (New England Bioloabs,
Mississauga, ON). For immunoprecipitation of p38, a second monoclonal antibody to p38 was
obtained from BD Biosciences (Mississauga, ON). The anti-β1 integrin mAb 4B4 was obtained
from Beckman-Coulter (Burlington, ON). Latrunculin-B, SB203580 and PD98059 were obtained
from Calbiochem (VWR International, Mississauga, ON). Monoclonal antibodies to FLAG and
talin were obtained from Sigma-Aldrich (Mississauga, ON).
Force generation
Force generation through integrins was produced using a previously described model system (14).
Briefly, magnetite microparticles (Fe3O4, Sigma-Aldrich, St. Louis, MO) were incubated with
purified collagen (Vitrogen 100, Cohesion Technologies, Palo Alto, CA; 1 mg/ml), neutralized to
pH 7.4, rinsed with PBS and incubated with fibroblasts. Following 30 min incubation, excess non-
adherent microparticles were removed by vigorous washing and the cells were supplemented with
by guest on Novem
ber 14, 2020http://w
ww
.jbc.org/D
ownloaded from
6
fresh α-MEM. A ceramic permanent magnet (Jobmaster, Mississauga, ON) was placed on top of
the dish to generate a perpendicular mechanical force of ~0.48 pN/µm2 cell area, a force that is
comparable to that which may be experienced by cells in vivo during normal function (14). The
incubation times were specific for each individual experiment as indicated.
RNA isolation, northern blot, reverse transcription (RT) and polymerase chain reaction (PCR)
analysis
RNA isolation was performed with RNeasy reagents (Qiagen, Mississauga, ON). All RNA
preparations were treated with RQ1 DNAse (Promega Corp., Madison, WI) for 30 min. The RT-
PCR protocol was performed as described in detail elsewhere (15). RT was conducted on total
RNA (1 µg) using 5 U of H-/Moloney Murine Leukemia Virus Reverse Transcriptase (Mo-MuLV-
RT, MBI Fermentas, Mississauga, ON) and 10 pmoles of oligo-(dT) primer. The cDNA product
was subjected to 30 cycles of amplification in a PTC 100 MJ Research Minicycler (Watertown,
MA). PCR amplified products were resolved via agarose gel electrophoresis. Quantification of
PCR products was performed using the Ofoto 1 system (Light Source Computer Images, Ferguson,
MO) and IP Lab Gel (Signal Analytics, Vienna, VA). The density of individual lanes was
normalized to the density of the PCR-amplified housekeeping gene glyceraldehyde-3-phosphate
dehydrogenase (GAPDH). Sequences of the oligonucleotides used in the RT-PCR analysis were:
Filamin-A forward primer: 5’-GAGTTCACTGTGGAGACCAGAAGT-3’;
Filamin-A reverse primer 5’-CTGTGACTTATCCACGTACACCTC-3’;
GAPDH forward primer 5'-CCATGGAGAAGGCTGGGG-3';
GAPDH reverse primer 5'-CAAAGTTGTCATGGAGCC-3'.
The semi-quantitative nature of the RT-PCR protocol, the precautions taken to avoid spurious
reaction products and the controls used have been described previously (15). In each experiment, a
by guest on Novem
ber 14, 2020http://w
ww
.jbc.org/D
ownloaded from
7
non-RT control demonstrated the lack of DNA contamination. Northern blot analysis of filamin-A
and GAPDH has been previously described (5).
Western blotting, immunofluorescence, and immunoprecipitation
Cells were lysed and cellular proteins were separated by SDS-PAGE (8% gels were used for
filamin-A and β-actin westerns while 12% gels were used for pp38 and p38 blots) and transferred
to nitrocellulose (Schleicher and Schuell, Keene, NH) as previously described (4). Protein
concentrations were determined using the Bradford assay and bovine serum albumin as a standard.
Equal amounts of protein were loaded on individual lanes and nitrocellulose membranes were
analyzed as described previously (4,5). Chemiluminescent detection was performed according to
the manufacturer’s instructions (Amersham, Baie D’Urfe, QC). The radiographic films were
exposed for standardized lengths of time using conventional protocols.
For immunofluorescence, gingival fibroblasts were grown on glass cover slips, incubated
with collagen-coated microbeads and subjected to magnetic force application as described above.
Samples were collected at standardized time points and stained as previously described (5).
The protocol for the immunoprecipitation of p38, pp38 and Sp1 has been described
previously (16). Briefly, samples were treated with RIPA buffer containing sodium vanadate (1
mM) and a protease inhibitor cocktail (Sigma-Aldrich). Isolated proteins were incubated with
protein-G Sepharose (Zymed, Mississauga, ON) beads that had been pre-incubated with mAb’s to
pp38, p38 or Sp1 overnight at 4ºC. The precipitate was washed 6 times and proteins were separated
from beads by heating at 65ºC for 10 min in 2X sample buffer. Samples were run on a 5-20%
gradient SDS-PAGE and transferred to nitrocellulose. Blots were then probed with the specific
antibody indicated in each section of figure 6, and ECL was carried out according to the
manufacturer’s instructions (Amersham-Pharmacia).
by guest on Novem
ber 14, 2020http://w
ww
.jbc.org/D
ownloaded from
8
Genomic DNA isolation, filamin-A promoter construction and transfection of Rat-2 fibroblasts
To generate the 3224 bp filamin-A luciferase promoter construct, we isolated intact fibroblast
genomic DNA using the protocol of Goelz et al. (17). Briefly, whole cell lysates were treated for
48 hr at 50°C with proteinase -K in buffer. Following verification of intact DNA on a 1% agarose
gel, 320 ng of DNA was incubated with PCR buffer containing oligonucleotide A1 (5’-
GTCGCTCTCAGGAACAGCAGGTGAGGT-3’) and oligonucleotide B1 (5’-
GGAGCTACTCATTTTGAGGCGCGAGAA-3’). The PCR reaction was performed in a MJ
Research PTC 100 Minicycler using 150 nM each of oligonucleotides A and B, 5% DMSO (v/v),
1.5 mM MgCl2, 200 µM of each dNTP and 1 U Expand High Fidelity PCR Enzyme System
(Roche Diagnostics, Laval, QC). The thermo-cycling procedure involved an initial 5 min
incubation at 95 °C, followed by 35 cycles of 0.5 min at 94 °C, 0.5 min at 64.5 °C and 3 min at 68
°C with a final extension at 68 °C for 7 min. The amplified fragment was used to generate a nested
PCR product that contained Bgl-II and Hind-III restriction sites for directional cloning into the
pGL2 Basic Vector (Promega). The nested PCR product used the same components with the
substitution of nested oligonucleotide A2 (5’-CGCTCTCAGGAACAGCAGGTGAGATCT-3’)
and B2 (5’-GCTGAAGCTTCGGCGAGGGGACGGCCCTTT-3’). The correctly amplified
product was verified through diagnostic restriction enzyme cleavage, ligated into the pGL2 basic
vector between Hind-III and Bgl-II and the correct orientation of the insert was verified through
diagnostic restriction enzyme digestion and sequencing performed at the DNA Sequencing Facility,
Center for Applied Genomics (Hospital for Sick Children, Toronto, ON).
To generate the final wild type 75bp filamin-A luciferase construct [pFil75(wt)luc], the
original 3.2kbp filamin-A luciferase vector was digested with Xho1-Pst1 (which effectively
removed 3.15kbp of upstream promoter). The fragments were blunt-ended, isolated from an
agarose gel and the portion containing the 75bp fragment fused to the luciferase reporter construct
by guest on Novem
ber 14, 2020http://w
ww
.jbc.org/D
ownloaded from
9
was re-ligated. To fabricate the final 75bp promoter construct containing mutations at the Sp1
binding sites [pFil75(mut)luc], two complementary oligonucleotides (described below and made by
MWG Biotech) were boiled independently and allowed to slowly cool to room temperature in
equimolar amounts. Promoter scanning was used to determine the location of potentially important
transcription factor binding sites (18). The Sp1 mutations are indicated in bold lettering: (-75; 5’-
TGCAGCATTCGCAGAGACTGCAATTCTCGCGCCTCAAAATGAGTAGCTCCCACTTTTG
CCGAGACAGAGCGCAGCAGG-3’). The hybridized oligonucleotides were ligated into the
pGL2Basic luciferase vector (Promega) and the correctly ligated vector was verified through
restriction enzyme digestion.
Nuclear extract preparation and electrophoretic mobility shift assay (EMSA)
Nuclear extracts were isolated to determine Sp1 binding activity in force treated and control
fibroblasts according to a previously established isolation protocol (19). Briefly, cells were treated
as indicated for each individual experiment, rinsed and scraped off the dish with a rubber
policeman. The cell pellet was lysed in buffer containing 10 mM Hepes (pH 8.0), 1.5 mM MgCl2,
10 mM KCl, 0.5 mM DTT, 0.5 mM PMSF, 200 mM sucrose, 0.5% NP-40 and 1 mg/ml of both
aprotinin and leupeptin (both from Sigma-Aldrich). Nuclei were lysed in buffer containing 20 mM
Hepes pH 8.0, 1.5 mM MgCl2, 420 mM NaCl, 0.2 mM EDTA, 0.5 mM PMSF, and 1 mg/ml of
both aprotinin and leupeptin. The refined nuclear proteins were diluted in equal volume of buffer
containing 20 mM Hepes pH 8.0, 100 mM KCl, 0.2 mM EDTA, 20% glycerol, 1 mM DTT, 0.5
mM PMSF, and aprotinin/leupeptin. The concentrations of the diluted extracts were determined
using the BioRad Protein Assay (BioRad, Mississauga, ON).
For EMSA analysis, double-stranded DNA oligonucleotides corresponding to the Sp1
binding site (at position –15) in the filamin-A promoter were used (5’-
CTCTCTCGGGCGGGGAGCTCAG-3’) and were synthesized by MWG Biotech (High Point,
by guest on Novem
ber 14, 2020http://w
ww
.jbc.org/D
ownloaded from
10
NC). Control experiments using NF-κB/c-Rel, wild type Sp1, mutant Sp1, CREB, AP-1 and p53
oligonucleotides were all obtained from Santa Cruz Biotech (Santa Cruz, CA). EMSA binding has
been previously described (19). In competition assays, molar excess of the unlabelled
oligonucleotides was used. For supershift assays, 1 µg of anti-Sp1, anti-NF-κB p50 or anti-CREB
monoclonal antibodies (all from Santa Cruz Biotech) were used. After incubation, the samples
were separated on a 6% native Tris-glycine PAGE, electrophoresed at 125 V for 5 hours, dried and
exposed to X-ray films for different lengths of time.
Cell transfections
Rat 2 fibroblast cells were transfected using the Effectene transfection reagent (Qiagen). Briefly,
following titration experiments to determine the optimum concentration of vector needed, cells
were transfected, left for 36-48 hr and then subjected to various treatments (described for each
individual experiment). Following each treatment, cells were processed for luciferase activity using
the manufacturer’s instructions (Luciferase Assay System, Promega Corp). The vectors used in the
transfection are the following and their source is indicated in brackets; pCMV-MKK6+
(constitutively active) and pCMV-MKK6AL (pCMV-MKK6AL-dominant repressor; both from
Dr. J. Woodgett, U. of Toronto), pCMV-p38FLAG (constitutively active; Dr. R.J. Davis, U. of
Massachusetts); pCMV-Sp1, pCMV-Sp1(SA21) (positive and negative Sp1 controls, respectively;
both from Dr. R. Tjian, U. of California), pCMV-NF-κBp50 and pCMV-NF-κBp65 (both from Dr.
N. Rice, National Cancer Institute, Frederick, MD). All vectors have been described elsewhere (20-
22) and a dominant negative MKK6 (pCMV-MKK6AL) has been described (23). The luciferase
vectors pFil3.2luc, pFil75(wt)luc and pFil75(mut)luc are described above. To establish transfection
efficiency and as a control, a green fluorescent protein vector (pEGFPluc) was used (Clontech).
by guest on Novem
ber 14, 2020http://w
ww
.jbc.org/D
ownloaded from
11
Statistical analysis
For continuous variable data, means and standard errors of the means were computed. Unpaired
Student’s t-tests were used for statistical testing and significance was set at p<0.05. In each assay
n=3.
by guest on Novem
ber 14, 2020http://w
ww
.jbc.org/D
ownloaded from
12
RESULTS
Induction of filamin-A expression by force application
We assessed the requirement of cell surface β1-integrins in force-mediated filamin-A gene
regulation. Fibroblasts were incubated with either collagen- or BSA-coated magnetite beads and
were pretreated with either integrin blocking antibodies (mAb 4B4) or vehicle prior to force
application (Figure 1A). Densitometric analysis of the RT-PCR products showed a 5-6-fold
induction of filamin-A gene expression following 6 hr of force application. This response was not
detected when cells were pretreated with the mAb 4B4 or subjected to force through BSA-coated
beads (Fig. 1A) or beads coated with poly-L-lysine (5). We found a comparable, 5-7-fold induction
of filamin-A gene by northern blot analysis (Fig. 1A). Consequently, we were confident that with
these RT-PCR conditions, we could detect experimentally induced alterations in filamin-A mRNA
content.
Actin filaments are important for transmission of extracellular signals to the nucleus
required for transcriptional activation (24). Accordingly, we assessed if force-induced filamin-A
induction required intact filaments. Fibroblasts were pretreated for 20 min with latrunculin-B (an
actin monomer-sequestering toxin that depolymerizes actin filaments, 1 µM) prior to force
application. RT-PCR analysis of RNA isolated from these cells showed that disruption of the actin
cytoskeleton inhibited the force-induced stimulation of filamin-A (Fig. 1A).
Mechanical stretching activates the p38 MAP kinase in rat ventricular myocytes (25). In
contrast to other MAP kinases which are not affected by tensile forces, p38 is also selectively
activated in force-treated cardiac fibroblasts (24). Accordingly we examined the role of p38 in
force-induced activation of filamin-A. Inhibition of the p38 kinase pathway by SB203580 (2 µM)
suppressed the transcriptional activation of filamin-A while the ERK-specific inhibitor PD98059 (5
µM) had no effect (Fig. 1A). Within 15 min of force, there was a 3-4-fold increase in pp38 when
by guest on Novem
ber 14, 2020http://w
ww
.jbc.org/D
ownloaded from
13
lysates were analyzed by immunoblotting. Similar increases of pp38 were also found in cells
pretreated with PD98059 but not in cells pre-incubated with SB203580 (Fig. 1B). To assess the
involvement of other MAP kinase pathways in this force model system, we analyzed lysates for
force-induced phosphorylation of ERK and JNK but found no increases following force application
(data not shown).
We determined if force would also increase filamin-A protein content. Whole cell extracts
were prepared from fibroblasts treated with force for increasing lengths of time and examined by
western blot. There was a 5-7-fold increase in filamin-A protein content (Fig. 1B). Similar to our
findings for filamin-A mRNA, the force-induced increase of filamin-A was eliminated by
pretreatment with SB203580 but not by PD98059. We also evaluated the role of other, non-
collagen receptors in force-mediated activation of filamin-A. Magnetite beads were coated with
bone sialoprotein (1 mg/ml) which binds αvβ3 integrin subunits. After several hours, force
application did not appreciably increase protein levels of filamin A (data not shown). As these
results indicated that force-mediated increases of filamin were not obtained when force was
delivered through ? v? 3 integrins, there is an apparent requirement for ? 1 integrins in this
process.
Force induces p38 and pp38 redistribution within the cell
As activated ERK translocates to newly-established focal adhesions in freshly plated fibroblasts
(9), we assessed pp38 and p38 MAP kinase localization by immunofluorescence in bead-loaded
cells that were bead-loaded with or without force (Figure 2). In cells fixed with methanol to permit
nuclear access for antibodies, immunostaining for pp38 in UV-irradiated fibroblasts showed
redistribution of pp38 to the nucleus (Fig. 2Ai). Equivalent nuclear aggregation of Flag-tagged p38
has been detected in UV-irradiated COS cells (20). In untreated cells, p38 and pp38 were diffusely
distributed throughout the cytoplasm (Fig. 2Aii-b), but after 1 hr of force, both p38 and pp38
by guest on Novem
ber 14, 2020http://w
ww
.jbc.org/D
ownloaded from
14
aggregated to the nucleus (Fig. 2Aii-e,h). When we fixed cells with paraformaldehyde (i.e. without
nuclear permeabilization), immunostaining showed that force caused selective recruitment of pp38
and p38 to the integrin/magnetite bead locus (Fig. 2B). These results demonstrate force-induced
migration of p38 and its active phosphorylated form (pp38) to cell nuclei and the
integrin/magnetite bead locus in a manner analogous to the localization of activated ERK at newly
formed focal adhesions (9). We also assessed the relative enrichment of p38 and pp38 to focal
adhesions after force application using isolated, bead-associated proteins. With the use of a
previously established protocol (4,26) followed by immunoblotting, we found that pp38, talin,
filamin A were increased by force while β-actin was relatively constant (Fig. 2B), results which
were consistent with the immunofluorescence data.
We assessed the role of actin filaments in the localization of filamin-A and the activation of
p38 by treatment of cells with latrunculin-B prior to application of force. In view of the apparent
migration of pp38 and p38 in force-treated cells, we examined pp38 and p38 localization by
immunofluoresence. Rhodamine phalloidin staining of control cells demonstrated characteristic
actin stress fibers that were disrupted by pre-treatment with latrunculin-B (Fig. 3A). Latrunculin-B-
treated cells also showed diffuse pp38 and p38 staining patterns, a distribution that did not change
appreciably following force application (compare with Fig. 1C). Quantitative evaluation of filamin-
A protein content after force application showed a 5-fold increase after 12 hours (p<0.01) that was
consistent with data from figure 1B. After treatment with latrunculin-B followed by force, filamin-
A protein content was not increased significantly above baseline, demonstrating a requirement for
intact actin filaments (Fig. 3B). The restricted movement of pp38 and p38 with latrunculin-B
pretreatment after force parallels the results of Aplin et al. (27) in cytochalasin-D pretreated
fibroblasts in which nuclear localization of ERK and phosphorylation of Elk-1 was suppressed by
actin filament depolymerization.
by guest on Novem
ber 14, 2020http://w
ww
.jbc.org/D
ownloaded from
15
Activation of filamin-A transcription by the MKK6-p38 kinase pathway
Functional, Sp1 transcription factor binding sites in the filamin-A promoter are necessary for force-
mediated activation of a filamin-A reporter vector (5). However, the signaling mechanisms
required for transmitting a tensile force-mediated signal from cell surface integrins to the nucleus
have not been defined. In view of previous studies describing a role for the MKK6 (MAP kinase
kinase 6)/p38 MAP kinase in force-induced gene regulation (28), we assessed the involvement of
this pathway using MKK6 or p38 expression vectors. The introduction of pCMV-MKK6+ and
pCMV-p38+ expression vectors by transfection increased endogenous filamin-A mRNA (Figure 4)
while transfection of the dominant negative pCMV-MKK6AL had no effect. Further, application of
force following transfection with either MKK6+ or p38+ did not significantly (p>0.2) increase the
levels of filamin-A mRNA and did not abrogate the inhibitory effects of the dominant negative
MKK6AL (Fig. 4).
To determine the effects of these expression vectors on protein expression, we assessed the
cellular content of filamin-A, Sp1 and pp38 in transfectants and force-treated transfectants (Fig.
5A-C). Notably, in CHO cells, introduction of pCMV-MKK6+ causes specific phosphorylation of
p38 without any effect on JNK or ERK (20). We found that transfection with pCMV-MKK6+
augmented the production of filamin-A, Sp1 and pp38; there were further increases when cells
were subsequently treated with force (Fig. 5A). A similar pattern was observed when the
constitutively active p38+ vector was introduced into fibroblasts (Fig. 5C). In both experiments,
pretreatment with SB203580 significantly decreased production of filamin-A and Sp1 while
treatment with PD98059 had no effect (data not shown). We are aware that the effects of
SB203580 on pCMV-MKK6+ driven expression of filamin, Sp1 and pp38 may be due to over-
expression and auto-regulatory feedback mechanisms involving kinase activation downstream of
MKK6 and p38 since several downstream kinases are stimulated (29-32). Our assays required 24-
by guest on Novem
ber 14, 2020http://w
ww
.jbc.org/D
ownloaded from
16
36 hrs for full expression following transfection, as determined by the production of FLAG from
pCMV-p38FLAG. Accordingly, the over-expression of MKK6 may lead to the subsequent
activation or suppression of downstream kinases that stimulate p38 indirectly leading to the results
observed in our experiments. Further, as the efficiency of transfection was ~50-60%, we also
detected endogenous filamin, Sp1 or p38 in the untransfected cell populations. Notably,
transfection with the dominant negative MKK6AL vector reduced filamin-A, Sp1 and pp38 content
in those cells that were subsequently treated with force (Fig. 5B). Collectively, these data
demonstrate that constitutive activation of the MKK6/p38 MAP kinase pathway enhances the basal
levels of filamin-A, pp38 and Sp1.
Regulation of the filamin-A promoter by MKK6 and p38 MAP kinase
The data from figures 1 and 5 suggested that the MKK6/p38 MAP kinase pathway regulates
filamin-A expression in response to tensile force. Further, previous results (5) indicated that a
reporter vector containing 3.2kbp of the filamin-A upstream sequence is regulated by Sp1
transcription factor binding sites. Accordingly, MKK6+, MKK6AL or p38+ expression vectors
were transiently transfected into Rat-2 fibroblasts in conjunction with reporter vectors specific for
the filamin-A promoter. Using the full-length 3.2kbp filamin-A reporter vector (pFil3.2luc), we
assessed baseline levels of luciferase activity and found a 4-6-fold induction by force application
that was inhibited by SB203580 but not by PD98059 (Figure 6A). When MKK6+ and p38+
expression vectors were co-transfected with pFil3.2luc, we noted a reproducible 6-8-fold induction
that was further augmented following force application. A control assay using the dominant
negative MKK6 (MKK6AL) suppressed basal luciferase activity and decreased force-induced
activation of pFil3.2luc. Control co-transfection experiments with expression vectors for wild-type
Sp1 (pCMV-Sp1- 24-fold increase of pFil3.2luc activity) and a Sp1 DNA binding mutant pCMV-
Sp1 (SA21-no induction of pFil3.2luc) showed the specificity of Sp1-dependent activation.
by guest on Novem
ber 14, 2020http://w
ww
.jbc.org/D
ownloaded from
17
Notably, SA21 dimerizes, but is unable to bind DNA and is therefore an ideal Sp1 negative control
(from Dr. R. Tjian).
The specificity of the MKK6/p38 MAP kinase pathway was assessed using SB203580. This
agent specifically inhibited MKK6+ and p38+ dependent activation of the pFil3.2luc reporter
vector while the ERK-specific inhibitor PD98059 produced no similar inhibition (Fig. 6). We have
previously reported that a truncated version of the filamin-A promoter containing 75bp of upstream
sequence contains several transcription factor-binding sites based on a promoter scan analysis (18).
This 75bp filamin-A reporter vector (pFil75(wt)luc) was regulated by force in a manner similar to
the 3.2kbp sequence: mutation of Sp1 binding sites in pFil75(wt)luc abolished force induction (5).
To assess the involvement of the p38 MAP kinase pathway in the force-induced regulation of
pFil75(wt)luc, co-transfection experiments were performed with MKK6AL, MKK6+ and p38+
expression vectors (Fig. 6B). The pFil75(wt)luc was equally responsive to constitutively active
MKK6+ and p38+ expression vectors and was similarly enhanced by force application. The use of
SB203580 strongly suppressed all basal and force-induced activation of pFil75(wt)luc alone and in
co-transfection assays while PD98059 had little effect. Similar to pFil3.2luc, the use of pCMV-
MKK6AL alone or with force strongly reduced all luciferase activity to minimal levels (Fig. 6B).
Control co-transfection experiments with pCMV-Sp1 or pCMV-Sp1(SA21) (described above)
demonstrated the specificity of Sp1-dependent activation in pFil75(wt)luc (i.e. <30% induction
above background; data not shown). Further, co-transfection of pFil75(wt)luc with expression
vectors for NF-κB subunit p50 (pCMV-NF-κBp50) and NF-κB subunit p65 (pCMV-NF-κBp65,
both provided by Dr. N. Rice) demonstrated minimal luciferase activity with or without force
application (data not shown). These findings indicated a specific requirement of pFil(wt)luc for
Sp1-dependent activation.
by guest on Novem
ber 14, 2020http://w
ww
.jbc.org/D
ownloaded from
18
To establish the importance of the Sp1 sites at position –15 and –25, we generated a 75bp
filamin-A reporter vector with mutations at these sites (described in the materials and methods as
pFil75(mut)luc). The Sp1 sites mutated in pFil75(mut)luc were chosen based on their predicted
impact on transcriptional regulation according to methods described by Prestridge (18). This
mutated 75 bp filamin reporter vector however still possesses several heterologous upstream
transcription factor binding sites when examined with a promoter scan analysis (18) and hence
could potentially be regulated by other transcription factors. When pFil75(mut)luc was transfected
into Rat-2 cells either alone or co-transfected with MKK6/p38 expression vectors, a decrease in
luciferase activity was detected (Fig. 6C). pFil75(mut)luc demonstrated a basal level of activity
that was inducible by force application or after co-transfection with pCMV-MKK6 and pCMV-p38
expression vectors. However, the relative levels of induction were significantly lower than the
luciferase levels obtained with pFil75(wt)luc (compare the relative levels of induction along each
X-axis). The residual inducibility of pFil75(mut)luc by force, pCMV-MKK6 or pCMV-p38 may be
explained by the presence of other transcription factor binding elements upstream of the mutated
Sp1 sites at positions –15 and –25.
Force induces binding of Sp1 to the filamin-A promoter
Our previous results demonstrated that force-induced filamin-A expression is mediated through
Sp1 sites on the filamin-A promoter (5). While the pFil75luc vector contains several potential
transcription factor binding sites (18), we specifically examined the role of Sp1 since up to six
binding sites for this factor exist and are located immediately upstream of the transcription start site
of filamin A. Nuclear extracts (NE, 5 µg) were isolated from bead-loaded controls and force-
treated cells and analyzed by EMSA (Figure 7). The migration patterns of Sp1/DNA complexes in
show that while control cells exhibited basal Sp1 binding levels, force application for increasing
lengths of time induced a 4-6-fold increase in Sp1 binding within 2 hr (Fig. 7A). To determine the
by guest on Novem
ber 14, 2020http://w
ww
.jbc.org/D
ownloaded from
19
specificity of the interaction of Sp1 with the filamin-A oligonucleotide, competition assays were
performed. These experiments established that authentic wild -type Sp1 and not sequences
corresponding to NF-κB or CREB, could diminish or eliminate Sp1 binding to the –15 filamin-A
oligonucleotide (Fig. 7B). To determine if the enhanced Sp1 binding following force application
was a generalized phenomenon for other transcription factors; CREB and AP-1 binding assays
were performed. The results showed <5% increase in binding of either CREB or AP-1 following 8
hr of force application. To confirm the authenticity of Sp1 in the binding complex, supershift
analyses were performed. The addition of mAb’s specific to Sp1 (75 ng and 1 µg) was sufficient to
create a protein-DNA complex that migrated more slowly; these complexes were not detected
when antibodies to NF-κB or CREB were used (Fig. 7C).
Tensile force induces p38 association with Sp1 and β-actin and Sp1 phosphorylation
The data above suggested that the p38 MAP kinase pathway is involved in the transcriptional
activation of filamin-A. Further, tensile forces evidently induce the migration of both pp38 and p38
to the integrin/magnetite bead locus and the nucleus (Fig. 2) through as yet an undefined
mechanism. To provide information on potentially important protein associations involved in this
signal transduction pathway, we immunoprecipitated proteins interacting with p38 or pp38. Force
application caused a 3-4-fold increase in the association of p38 and pp38 with β-actin (Figure 8), a
cytoskeletal protein enriched in focal adhesions (Fig. 2Bii). Control immunoblotting for p38
confirmed that equivalent amounts of p38 were immunoprecipitated in the force and no-force
samples. Other controls using an irrelevant immunoprecipitating antibody (anti-nebulin) showed no
immunoprecipitation of actin (data not shown) thereby establishing the specificity of the
association. To confirm the physical association between actin and p38/pp38, we transfected
pCMV-p38FLAG into fibroblasts, immunoprecipitated lysates with anti-β-actin mAb and
immunoblotted these extracts with an antibody to FLAG. The results confirmed that extracts from
by guest on Novem
ber 14, 2020http://w
ww
.jbc.org/D
ownloaded from
20
force-treated cells showed much more abundant association of p38 with actin than cells without
force (Fig. 8).
To assess whether Sp1 is activated following force application, we analyzed total Sp1
protein content and the level of serine/threonine phosphorylated residues on Sp1, a modification
which has been shown to be indicative of Sp1 transcription factor activation (33-35). We found that
in response to force, there was increased phosphorylation of Sp1 in cell lysates that were initially
immunoprecipitated with anti-Sp1 antibody and then immunoblotted with antibody to
phosphoserine/threonine (Fig. 9). Immunoblotting of the immunoprecipitates with a different Sp1
antibody showed equal amounts of immunoprecipitated protein in force-treated and untreated cells
(Fig. 9). These results show that force application induces an increase in phosphorylation of Sp1 at
serine/threonine residues.
As force application enhanced the movement of p38 and pp38 into the nucleus (Fig. 2Ai),
we assessed the ability of p38 to interact with Sp1 since p38 can activate other transcription factors
including ATF-2, NF-κB, Elk-1 and MEF-2C (2,3,22,25). To examine the involvement of p38 in
Sp1 activation, we assessed Sp1 protein interactions with p38 and pp38. We immunoprecipitated
p38 and pp38-bound material, divided these materials into two sets of blots and immunoblotted
with either anti-Sp1 or anti-phosphoserine/threonine antibodies. There was a 2-3-fold increase in
the association of p38 and pp38 with Sp1 in force-treated cells (Fig. 10i). Force treatment also
increased the amount of phosphoserine/threonine phosphorylated protein that co-migrated with Sp1
in the immunoprecipitates obtained with p38 and pp38 antibodies (Fig. 10ii). These results confirm
that p38 and pp38 associated at greater levels with Sp1 and its activated phosphoserine/threonine
form in fibroblasts stimulated with mechanical force.
by guest on Novem
ber 14, 2020http://w
ww
.jbc.org/D
ownloaded from
21
DISCUSSION
We have previously shown that application of mechanical force through cell surface β1-integrins
increases filamin-A production (5) and that the expression of this protein protects cells against
force-induced apoptosis (36). Here we demonstrate that force-mediated filamin-A expression
involves activation of p38 and its localization to nuclei and integrin/magnetite beads at the plasma
membrane. Further, we show that activation of filamin-A is dependent on Sp1 transcription factor
binding elements in the filamin-A promoter and that the p38 MAP kinase-signaling pathway
mediates this activation through interactions with Sp1. These data provide evidence for a novel,
force-induced transcriptional response that promotes cell survival by elaboration of a
mechanoprotective protein, filamin-A. This response involves the association of the actin
cytoskeleton with force-sensitive signaling molecules of which the p38 MAP kinase is apparently a
critical element.
Many signaling proteins involved in responses to extracellular stimuli are sequestered into
discrete macromolecular complexes. The spatiotemporal organization of these aggregates can
determine the specificity and the intensity of responses to a wide range of extracellular stimuli
including force (37). The MAP kinases are a group of serine/threonine kinases that transduce
signals from cell membrane receptors into intracellular regulatory signals that control gene
expression. Our present analysis showed that intact actin filaments were required for force-induced
activation of p38 and the migration of p38 to nuclei and integrin/magnetite bead loci. In addition,
tensile forces promoted interactions of p38 and pp38 with actin, suggesting that the cytoskeleton
may tether signaling molecules into protein complexes that participate in mechanically induced
signaling. These complexes can increase the efficiency of signaling by decreasing the distance over
which intermediates must interact to exert their effects. Thus ERK is activated at actin filament-
enriched focal adhesions in response to spreading (9,27) while disruption of actin filaments
by guest on Novem
ber 14, 2020http://w
ww
.jbc.org/D
ownloaded from
22
abrogates ERK activation (8) and blocks nuclear translocation/phosphorylation of the transcription
factor Elk-1 (27). Notably, as filamin-A cross-links actin filaments and is recruited to the
submembrane cortex after mechanical stimulation (4), filamin-A may also provide a scaffolding
role in p38 signaling as has been shown for MKK4 and TRAF2 (38). Although we have not
determined the mechanisms underlying the migration of p38 to the nucleus, the Ran GTPases may
be involved based on their contribution to nuclear localization of ERK (39,40). Further, Whitehurst
et al. (41) recently demonstrated that GFP-ERK2 enters the nucleus in a saturable, time and
temperature-dependent manner through its interaction with nucleoporin.
Activation and nuclear localization of MAP kinases can regulate gene expression by
phosphorylation of a number of transcription factors including SAP-1, Elk-1, c-Jun, ATF-2,
MEF2C, CHOP and NF-κB (22,42,43). The p38 MAP kinase is particularly responsive to cellular
stressors and can specifically phosphorylate Elk-1, ATF2 and MEF2C (38). Our data show that
application of tensile force promotes a 3-5-fold increase in Sp1 serine/threonine -phosphorylation
and concomitant association with p38, the first demonstration of a mechanically induced signaling
system involving this transcription factor and activation by p38. Sp1 is a zinc-finger DNA-binding
protein that binds a putative GC rich element; originally thought to be ubiquitously present in core
promoter elements (rev in 35,44). Following phosphorylation by protein kinases including DNA-
dependent protein kinase, casein kinase II, protein kinase A and the cell cycle-regulated Sp1-
associated protein kinase (34), Sp1 binds DNA and regulates transcription. Here we show that Sp1
can regulate an important mechanoprotective gene after stimulation by tensile forces. We have
previously identified several binding sites for Sp1 on the filamin-A promoter (5) and we show here
that these binding sites contribute to regulation of force-induced filamin-A expression. Ablation of
critical Sp1 binding sites in the filamin-A promoter strongly decreased the tensile-force- and p38-
mediated activation of a filamin-A reporter vector. Further, we demonstrate that both CREB and
by guest on Novem
ber 14, 2020http://w
ww
.jbc.org/D
ownloaded from
23
AP-1 are not equally activated by force application demonstrating the specific activation of Sp1.
Notably, Sp1 may not regulate filamin-A transcription alone. Sp1 may interact with other
transcription factors including the insulin-responsive binding protein (IRBP), NF-κB and c-Jun
(45-48) to regulate a multitude of genes. Further, Sp1 shares DNA binding elements with NF-κB,
NF-1 and p53 proteins, indicating that co-operative or obstructive binding to specific promoter
sequences may confer additional transcriptional regulation (49-52).
In the tensile force model system described here, we demonstrate the activation of filamin-
A gene expression through phosphoserine/threonine-mediated stimulation of Sp1. Our proposed
model therefore describes a mechanistic circuit that originates at the integrin-magnetite bead locus
and induces the activation of p38 and pp38 (Fig. 7). The activation of p38/pp38 enhances its
interaction with the actin cytoskeleton and promotes their localization to the nucleus and the
integrin-magnetite bead locus. In the nucleus, we propose that p38/pp38 phosphorylate Sp1 and
enhance its interaction with the filamin-A promoter to augment gene transcription. In this manner,
filamin-A production in our mechanical stress model protects the cells against lethal applied forces
by promoting the re-distribution of the actin cytoskeleton through a cytoprotective mechanism.
Depending on the target gene, activation of Sp1 could occur through either phosphorylation
or dephosphorylation. For example, serine/threonine phosphorylation of the amino terminus of Sp1
enhances the CDK activity of cyclin A by 3-4 fold (34). Phosphorylation also increases Sp1-
mediated activation of the platelet derived growth factor B-chain and tissue factor genes by shear
stress (11,19). However, terminal liver cell differentiation is downregulated by Sp1
phosphorylation (53) while glucose-mediated activation of the acetyl-CoA carboxylase gene is
enhanced after Sp1 dephosphorylation (54), demonstrating that cell and gene-specific mechanisms
are involved in Sp1-mediated gene regulation. Our data clearly indicate however that for force-
induced regulation of filamin A, p38-mediated phosphorylation of Sp1 is a crucial regulatory step.
by guest on Novem
ber 14, 2020http://w
ww
.jbc.org/D
ownloaded from
24
Indirect confirmation of our results was recently produced in other cell systems in which Sp1 was
found to be directly phosphorylated on threonine residues 453 and 739 by p42/44 MAP kinase in
the regulation of vascular endothelial growth factor (55). Moreover, p38 phosphorylates NFATc4
(nuclear factor of activated T cells, subunit c4) on serine residues at position 168 and 170 (56).
In conclusion, we have demonstrated that tensile force applied to fibroblasts through
collagen receptors activates filamin-A transcription through the p38 MAP kinase and that this
regulatory pathway involves phosphorylation of the transcription factor Sp1 and its interaction with
p38. These results provide a mechanotranscriptional circuit by which cells from physically loaded
environments can couple extracellular mechanical stimuli into signals that induce cytoprotective
proteins.
by guest on Novem
ber 14, 2020http://w
ww
.jbc.org/D
ownloaded from
25
ACKNOWLEDGMENTS
This work was supported by a CIHR Group grant to Dr. R. Ellen and to Dr. C. McCulloch
(Operating Grant, [CIHR MOP-37783] and a Major Equipment Maintenance Grant). The Heart and
Stroke Foundation also supported this work (CM). Mario D’Addario is supported by a CIHR
Fellowship. The vectors pCMV-MKK6+ and pCMV-MKK6AL were generously provided by Dr.
J. Woodgett and pCMV-p38FLAG was provided by Dr. R.J. Davis. Control vectors pCMV-Sp1
and pCMV-Sp1(SA21) were provided by Dr. R. Tjian. Additional NF-κB control vectors were
provided by Dr. N. Rice.
by guest on Novem
ber 14, 2020http://w
ww
.jbc.org/D
ownloaded from
26
REFERENCES.
1. Critchley, D. R. (2000) Curr. Opin. Cell Biol., 12, 133-139
2. Chien, S., Li, S. and Shyy, J. Y. (1997) Hypertension, 31, 162-169
3. Shyy, J. Y. and Chien, S. (1997) Curr. Opin. Cell Biol., 9, 707-713
4. Glogauer, M., Arora, P. D., Chou, D., Janmey, P. A., Downey, G. P. and McCulloch, C. A. G.
(1998) J. Biol. Chem., 273, 1689-1698
5. D’Addario, M., Arora, P. D., Fan, J., Ganss, B., Ellen, R. P. and McCulloch, C. A. G. (2001) J.
Biol. Chem., 276, 31969-31977
6. Aplin, A. E., Howe, A. K. and Juliano, R. L. (1999) Curr. Opin Cell Biol., 11, 737-744
7. Stossel, T. P., Condeelis, J., Cooley, L., Hartwig, J. H., Noegel, A., Schleicher, M. and Shapiro,
S. (2001) Nature Revs. Mol. Cell Biol., 2, 138-145
8. Takahashi, M. and Berk, B. C. (1996) J. Clin. Invest. 11, 2623-2631
9. Fincham, V. J., James, M., Frame, M. and Winder, S. J. (2000) EMBO J., 19, 2911-2923
10. Wilson, E., Sudhir, K. and Ives, H. E. (1995) J. Clin. Invest., 96, 2364-2372
11. Khachigian, L. M., Santiago, F. S., Rafty, L. A., Chan, O. L., Delbridge, G. J., Bobik, A.,
Collins, T. and Johnson, A. C. (1999) Circ. Res., 84, 1258-1267
12. Pender, N. and McCulloch, C. A. G. (1991) J. Cell Sci., 100, 187-193
13. Hui, M. Z., Tenenbaum, H. C. and McCulloch, C. A. G. (1997) J. Cell. Physiol., 172, 323-333
14. Glogauer, M., Arora, P .D., Yao, G., Sokholov, I., Ferrier, J. and McCulloch, C. A. G. (1997) J.
Cell Sci., 110, 11-21
15. D’Addario, M., Ahmad, A., Xu, J. W. and Menezes, J. (1999) FASEB J., 13, 2203-2213
16. Arora, P. D. and McCulloch, C. A. G. (1996). J. Biol. Chem., 271, 20516-20523
17. Goelz, S., Hamilton, S. and Vogelstein, B. (1985) Biochem. Biophys. Res. Comm., 130, 118-
126
by guest on Novem
ber 14, 2020http://w
ww
.jbc.org/D
ownloaded from
27
18. Prestridge, D. S. (1995) J. Mol. Biol., 249, 923-932
19. Rafty, L. A. and Khachigian, L. M. (2001) Nucleic Acid Res., 29, 1027-1033
20. Raingeaud, J., Gupta, S., Rogers, J. S., Dickens, M., Han, J., Ulevitch, R. J. and Davis, R. J.
(1995) J. Biol. Chem., 270, 7420-7426
21. Raingeaud, J., Whitmarsh, A. J., Barrett, T., Derijard, B. and Davis, R. J. (1996) Mol. Cell.
Biol., 16, 1247-1255
22. Enslen, H., Raingeaud, J. and Davis, R. J. (1998) J. Biol. Chem., 273, 1741-1748
23. Zanke, B., Rubie, E., Winnett, E., Chan, J., Randall, S., Parsons, M., McInnis, M., Yan, M.,
Templeton, D. and Woodgett, J.R. (1996) J. Biol. Chem. 271, 29876-29881
24. Wang, J., Seth, A. and McCulloch, C. A. G. (2000) Am. J. Physiol. Heart Circ. Physiol., 279,
H2776-H2785
25. Liang, F. and Gardner, D. G. (1999) J. Clin. Invest., 104, 1603-1612
26. Plopper, G. and Ingber, D. E. (1993) Biochem. Biophys. Res. Comm., 193, 571-578.
27. Aplin, A., Stewart, S. A., Assoian, R. K. and Juliano, R. L. (2001) J. Cell Biol., 153, 273-281.
28. Chang, L. and Karin, M. (2001) Nature, 410, 37-40
29. McLauglin, M., Kumar, S., McDonnell, P. C., Van Horn, S., Lee, J. C., Livi, G. and Young, P.
R. (1996) J. Biol. Chem., 271, 8488-8492
30. Tan, Y., Rouse, J., Cariati, S., Cohen, P. and Comb, M. (1996) EMBO J., 15, 4629-4642
31. Waskiewicz, A. J., Flynn, A., Proud, C. G. and Cooper, J. (1997). EMBO J., 16, 1909-1920
32. New, L., Jiang, Y., Zhao, M., Liu, K., Zhu, W., Kato, Y., Parry, G. and Han, J. (1998) EMBO
J., 17, 3372-3384
33. Jackson, S. P., MacDonald, J. J., Miller, S. L. and Tjian, R. (1990) Cell, 63, 155-165
34. Fojas de Borja, P., Collins, N., Clifford, J. A. and Mudryi, M. (2001) EMBO J., 20, 5737-5747
35. Brivanlou, A. H. and Darnell, Jr., J. E. (2002) Science, 295, 813-818
by guest on Novem
ber 14, 2020http://w
ww
.jbc.org/D
ownloaded from
28
36. Kainulainen, T., Pender, N., D'Addario, M., Feng, Y., Lekic, P. and McCulloch, C. A. G.
(2002) J. Biol. Chem., 277, 21998-22009
37. Dimitratos, S. D., Woods, D., Stathakis, D. and Bryant, P. J. (1999) Bioessays, 21, 912-921
38. Weston, C. R. and Davis, R. J. (2002) Curr. Opin. Gen. Dev., 12, 14-21
39. Gorlich, D. and Kutay, U. (1999) Ann. Rev. Cell Dev. Biol., 15, 607-660
40. Cyert, M. (2001) J. Biol. Chem., 276, 20805-20808
41. Whitehurst, A.W., Wilsbacher, J., You, Y., Phelps, K. L., Moore, M. S., and Cobb, M. (2002)
Proc. Natl. Acad. Sci. USA, 99, 7496-7501
42. Brent-Carter, A., Knudtson, K. L., Monick, M. M. and Hunninghake, G. W. (1999) J. Biol.
Chem., 274, 30858-30863
43. Craig, R., Larkin, A., Mingo, A. M., Thuerauf, J., Andrews, C., McDonough, P. and
Glembotski, C. (2000) J. Biol. Chem., 275, 23814-23824
44. Lemon, B. and Tjian, R. (2000) Genes & Dev., 14: 2551-2569
45. McDonough, P., Hanford, D., Sprenkle, A. B., Mellon, N. R. and Glembotski, C. (1997) J.
Biol. Chem., 272, 24046-24053.
46. Kardassis, D., Papakosta, P., and Moustakas, A. (1999) J. Biol. Chem., 274, 29572-29581
47. Kaytor, E. N., Zhu, J., Pao, I. and Phillips, L. S. (2001) J. Biol. Chem., 276, 36896-36901
48. Melnikova, I. N. and Gardner, P. D. (2001) J. Biol. Chem., 276, 19040-19045
49. Hirano, F., Tanaka, H., Hirano, Y., Hiramoto, M., Handa, H., Makino, I. and Scheidereit, C.
(1998) Mol. Cell Biol., 18, 1266-1274
50. Koutsodontis, G., Tentis, I., Papakosta, P., Moustakas, A. and Kardassis, D. (2001) J. Biol.
Chem., 276, 29116-29125
51. Laniel, A. M., Poirier, G. G. and Guerin, S. L. (2001) J. Biol. Chem., 276, 20766-20773
by guest on Novem
ber 14, 2020http://w
ww
.jbc.org/D
ownloaded from
29
52. Saito, T., Takahashi, Y., Hashimoto, H. and Kamataki, T. (2001) J. Biol. Chem., 276, 38010-
38022
53. Leggett, R., Armstrong, S., Barry, D. and Mueller, C. (1995) J. Biol. Chem., 270, 25879-25884
54. Daniel, S., Zhang, S., Roach, A. D. and Kim, K. H. (1996) J. Biol. Chem., 271, 14692-14697
55. Mongiat, J., M., Pouyssegur, J., and Pages, G. (2002) J. Biol. Chem., 277, 20631-20639
56. Yang, T., Xiong, Q., Enslen, H., Davis, R. J., and Chow, C. W. (2002) Mol. Cell Biol. 22,
3892-3904
by guest on Novem
ber 14, 2020http://w
ww
.jbc.org/D
ownloaded from
30
Figure Legends
Figure 1: Mechanical force-induced activation of filamin-A. A) Adherent fibroblasts were
cultured in normal serum-containing medium, incubated with collagen coated magnetite
beads at a ratio of ~10 beads/cell and subjected to vertically directed tensile forces (0.48
pN/µm2). Total RNA was isolated after 6 hr of force and 1 µg was subjected to RT-PCR
analysis for filamin-A and GADPH. Lane 1: indicates bead loading without force; lane 2:
cells were subjected to force application; lane 3: same as lane 2 but cells were pretreated
with mAb 4B4 (anti-β1 integrin); lane 4: cells were incubated with BSA covered beads (1
mg/ml) and force applied; lane 5: same as lane 2 but cells were pretreated with
latrunculin-B (1.0 µM) prior to force application; lane 6: same as lane 2 but cells were
pretreated with SB203580 (2.0 µM) and lane 7: same as lane 2 but cells were pretreated
with PD98059 (5 µM). Histograms show data from n=3 independent experiments and are
densitometric analyses relative to the levels of GAPDH in each lane. For the northern blot
analysis shown below; lane 1 indicates bead-loaded cells without force application and
lane 2 demonstrates RNA from force treated cells. On the graph, the northern blot data is
shown in solid black bars. B) Western blot analysis of filamin-A, β-actin, pp38, and p38
protein content in untreated (-) and force-treated fibroblasts. In samples treated with
force, cells were untreated (force alone) or pre-incubated with SB203580 or PD98059
prior to force application for the times indicated below each blot. Equal amounts of total
cellular protein were loaded in each lane, separated on denaturing polyacrylamide gels
that were subsequently scanned, quantified and shown on the graphs below each section.
Data are means and standard errors from n=3 experiments.
by guest on Novem
ber 14, 2020http://w
ww
.jbc.org/D
ownloaded from
31
Figure 2: Force application causes pp38 and p38 localization to the nucleus and magnetite
bead/integrin locus. Cells were grown on glass slides and in section A were fixed with
methanol and in B cells were fixed with paraformaldehyde and permeabilized with
Triton-X. Ai) Cells were untreated or UV-irradiated for 30 min and stained for pp38. Aii,
B Cells were incubated with collagen-coated magnetite beads and treated with force (d-i
in Aii and c-f in B) or without force (a-c in Aii and a, b in B) and then stained for pp38 (e
in Aii and d in B) or p38 (h in Aii and f in B). Nuclei were localized with DAPI staining
(Aii-c, f, i). B) Force application increases the levels of pp38 and filamin at the focal
adhesion/magnetite beads. Magnetite beads with the associated focal adhesion complexes
were isolated from untreated and force-treated cells and were immunoblotted for pp38,
talin, filamin and actin. Mechanical force induced pp38/p38 migration to focal adhesion
complexes and increased filamin content at these sites.
Figure 3: Mechanical force induction of filamin-A is dependent on an intact actin cytoskeleton.
A) Fibroblasts were grown on glass slides, pre-incubated with latrunculin-B for 20 min
and then either untreated or subjected to force. Cells were fixed with paraformaldehyde
and stained for pp38 or p38. Rhodamine phalloidin was used to stain actin filaments.
Note that disruption of the actin cytoskeleton by latrunculin-B blocked mobilization of
p38 and pp38 to the integrin/magnetite bead locus (compare these results with those of
Fig. 2B). Note that beads shown in right panel correspond to cells treated with force
shown in middle panel. Control cell at top was not treated with latrunculin B and was
stained with rhodamine actin. B) Filamin-A and pp38 western blot analysis of untreated
and force-treated fibroblasts. Equal amounts of total cellular protein were isolated from
force treated cells pre-incubated for 20 min with latrunculin-B (1 µM) and analyzed for
by guest on Novem
ber 14, 2020http://w
ww
.jbc.org/D
ownloaded from
32
filamin-A, β-actin, pp38 and p38 protein. The relative levels of each protein were
determined by densitometry and plotted as means and standard errors of ratios relative to
the levels of β-actin. The data were derived from 3 independent experiments. Note the
difference in time scale between the right side and left side histograms in B. Disruption of
the actin cytoskeleton abrogated the induction of filamin-A protein by force (p<0.05).
Figure 4: Filamin-A gene transcription is increased in p38 and MKK6 transfected cells.
Fibroblasts were cultured at 75% confluence in 6 well plates and transfected with the
vectors indicated below. Total RNA was isolated and 1 µg was subjected to RT-PCR
analysis for filamin-A and GADPH. Lane 1: bead-loaded cells, no force (mock
transfected); lane 2: bead-loaded cells with force (mock transfected); lane 3: cells
transfected with pCMV-MKK6AL; lane 4: cells transfected with pCMV-MKK6+; lane 5:
cells transfected with pCMV-p38; lane 6: cells transfected with pCMV-Sp1; lane 7: cells
transfected with pCMV-p38 and treated with SB203580 and lane 8: cells transfected with
pCMV-p38 and treated with PD98059. Data are the mean values and standard errors from
n=3 experiments.
Figure 5: Filamin-A and Sp1 protein contents are augmented in fibroblasts transfected by MKK6
and p38 expression vectors. Cells were transfected with pCMV-MKK6+ (A), pCMV-
MKK6AL (B) or pCMV-p38+ (C) and total cellular protein was analyzed 48 hr later for
filamin-A, Sp1 by immunoblotting and densitometry. In addition, the ratios of pp38/p38
blot densities were computed and presented as means±standard errors of the ratios. For
the left panel graphs: lane 1: bead-loaded, no force; lane 2: bead-loaded with force; lane
3: cells transfected with each respective vector; lane 4: cells transfected and subjected to
by guest on Novem
ber 14, 2020http://w
ww
.jbc.org/D
ownloaded from
33
force application. For the right side graphs, the relative induction was plotted as pp38/p38
and the four lanes are; lane 1: bead-loaded, no force; lane 2: bead-loaded, force
application; lane 3: transfected cells and lane 4: transfected cells subjected to force
application. Each plotted bar graph shows the result of three individual experiments (n=3;
data are mean±standard errors of the mean).
Figure 6: MKK6/p38 activate a filamin-A promoter construct containing Sp1-dependent
transcription factor binding sites. Rat-2 fibroblasts were cultured at 70% confluence the
day prior to transfection. Following transfection (36-48 hours later), cells were loaded
with beads, treated with force (or not), lysed and whole cell protein was analyzed for
luciferase activity. In all single and co-transfection assays, preliminary titration
experiments were performed to determine the optimal amount of each vector needed. In
addition, all relative induction values were determined in comparison to the basal
transfection luciferase level of pFil3.2luc (arbitrarily chosen as 1; n= 3 individual). For
assays requiring the use of either SB203580 or PD98059, these reagents were added 20
min prior to the application of force (6-8 hrs). All expression vectors and reporter vectors
(denoted above each bar graph) are described in the materials and methods. In those
transfection experiments requiring additional treatments, the specific treatments are
described in the central panel. Note the difference in the relative increases of induction on
the X-axis in the three graphs. Data are means and standard errors of means from 3
independent experiments. pFil3.2luc is the full-length filamin A promoter construct while
pFil75(wt)luc is a 75 bp minimal construct for assessing promoter activity. The
pFil75(mut)luc contains 2 mutated Sp1 binding sites.
by guest on Novem
ber 14, 2020http://w
ww
.jbc.org/D
ownloaded from
34
Figure 7: Force application enhances binding of Sp1 to filamin-A proximal promoter elements.
A) Fibroblasts were plated on 100 mm culture dishes and subjected to vertically applied
forces for various lengths of time. Cells were lysed, nuclear extracts (NE) were prepared
and 5 µg of nuclear protein was bound to the filamin-A Sp1 binding site (-15, described
in the materials and methods). Lane 1: bead-loaded, no force; lane 2: 4 hr of force
application; lane 3: 8 hr of force application; lane 4: 12 hr of force application and lane 5:
24 hr of force application. B) Competition assays were performed on NE isolated from
force-treated fibroblasts. Lane 1: NE from bead-loaded control cells; lane 2: NE from
force-treated cells; lane 3: same as lane 2, but competition with 200-fold molar excess of
unlabelled mutant Sp1 filamin oligonucleotide (5’-
CTCTCTCGGGCGGGGAGCTCAG-3’); lane 4: same as lane 2, but competition with
100 fold molar excess of unlabelled wild type Sp1 oligonucleotide; lane 5: same as lane
2, but competition with 200-fold molar excess of unlabelled wild type Sp1
oligonucleotide; lane 6: same as lane 2, but competition with 200-fold molar excess of
unlabelled wild type Igγ NF-κBp50 oligonucleotide. C) Supershift detection of Sp1 in the
filamin-A promoter of force-treated fibroblasts. Fibroblasts were subjected to force,
nuclear proteins were prepared and subjected to EMSA analysis. Five micrograms of NE
were bound to the filamin-A Sp1 oligonucleotide and run on a native Tris-glycine gel.
Bound extracts were lane 1: untreated cell extracts; lane 2: 75 ng of anti-Sp1 mAb; lane
3: 1 µg of anti-NF-κB50 mAb; lane 4: 1 µg of anti-CREB mAb and lane 5: 1 µg of anti-
Sp1 mAb.
Figure 8: Fibroblasts subjected to force exhibit increased Sp1 phosphorylation and enhanced
binding of p38 to β-actin and Sp1. Fibroblasts were cultured in 6 well dishes and were
by guest on Novem
ber 14, 2020http://w
ww
.jbc.org/D
ownloaded from
35
untreated (-) or subjected to force (+). Cell extracts were immunoprecipitated with
antibody to either pp38, p38 or FLAG. The immunoprecipitated material was separated
on a 5-20% gradient-denaturing PAGE, transferred to nitrocellulose and then
immunoblotted for β-actin. Lysates were immunoprecipitated (with antibody to FLAG)
from cells transfected with pCMV-p38FLAG, separated on a 5-20% gradient-denaturing
PAGE and immunoblotted for β-actin. Force application increased the interaction of
p38/pp38 with β-actin. Each histogram shows the mean and range from two independent
experiments.
Figure 9: Force application to fibroblasts increases levels of phosphorylated Sp1. Cell extracts
from untreated (-) and force-treated (+) cells were immunoprecipitated with antibody to
Sp1, separated on a 5-20% gradient denaturing PAGE, transferred to nitrocellulose and
immunoblotted with anti-phosphoserine/threonine antibody. As a standard,
immunoprecipitated material from force-treated and untreated cells was immunoblotted
for Sp1 with a different Sp1 antibody (ii). Each histogram shows the mean and range
from two independent experiments.
Figure 10: Sp1 and pp38 associated at higher levels in force treated fibroblasts. Cell extracts
from untreated and force-treated cells were immunoprecipitated with pp38 and p38
antibodies, separated on a gradient denaturing PAGE and immunoblotted for Sp1 (i) or
for phosphoserine/threonine in adjacent lanes (ii). In all experiments, compared to
untreated cells, extracts from force-treated cells showed enhanced p38 and pp38
interaction with Sp1 and phosphoserine/threonine residues that co-migrated with Sp1.
Histograms are mean and range from two independent experiments.
by guest on Novem
ber 14, 2020http://w
ww
.jbc.org/D
ownloaded from
Mario D'Addario, Pamela D Arora, Richard P Ellen and Christopher A. G. McCullochfilamin-A
proteinb1-integrin-mediatedtranscriptional circuit that regulates the actin binding Interaction of p38 and Sp1 in a mechanical force-induced,
published online September 24, 2002J. Biol. Chem.
10.1074/jbc.M207681200Access the most updated version of this article at doi:
Alerts:
When a correction for this article is posted•
When this article is cited•
to choose from all of JBC's e-mail alertsClick here
by guest on Novem
ber 14, 2020http://w
ww
.jbc.org/D
ownloaded from