Interaction of the chromosomal Tn557 with two thermosensitive derivatives, pS1 and p ΔD, of the plasmid pI9789 in Staphylococcus aureus

FEMS Microbiology Letters 127 (1995) 165-170 ELSEVIER

Interaction of the chromosomal Tn551 with two thermosensitive derivatives, pS1 and PAD, of the plasmid PI9789 in

Staphylococcus aureus

Muhammad Sohail, Mike Oldridge, Keith G.H. Dyke *

Microbiology Unit, Department of Biochemistry, South Parks Road, University of Oxford, Oxford OX1 3QU, UK

Received 12 December 1994; revised 1 February 1995; accepted 2 February 1995

Abstract

The plasmid pI9789::Tn552 carries genes conferring resistance to penicillins and to cadmium, mercury and arsenate ions. The presence of Tn551 at one location in the chromosome of StupIzylococcus uwzus enhances the frequency of suppression of thennosensitivity of replication of the plasmids pS1 and p AD which are derivatives of pI9789::Tn552. Bacteriophage propagated on the bacteria in which therrnosensitivity of replication had been suppressed was used to transduce cadmium resistance to S. aureus PS80N. The cadmium-resistant transductants obtained carried plasmid pS1 or p AD with a copy of Tn551 inserted into a specific site on pS1 but into several different sites on PAD. The possible mechanisms of the suppression are discussed.

Keywords: Staphylococcus aureus; Plasmid integration; ~19789; Tn551; Transposition

1. Introduction

Several strains of Staphylococcus aureus isolated

from nosocomial and community-acquired infections are resistant to more than one antimicrobial agent and can be difficult to treat. Resistance determinants are generally present on extra-chromosomal plasmid DNA. However, several resistance determinants pre- viously found on plasmids seem to have been acquired by the chromosome in more recent isolates of

S. aureus. This may occur by transposition or by integration of the plasmid carrying the resistance

’ Corresponding author. Tel.: +44 (865) 275 293; Fax: +44

(865) 275 297; e-mail: [email protected]

determinants into the chromosome, in part or in toto [ll. Such accumulation of resistance genes on the

chromosome is of clinical significance since chromosomal genes are likely to be stably maintained in the bacteria even in the absence of the selective pressure.

The study of mechanisms involved in the integration of plasmids into the chromosome is the subject of this paper.

p19789::Tn_552 [2] encodes resistance to penicillins and to cadmium, mercury and arsenate ions and is naturally found in S. aweus strain PS80. It is used here as a model large staphylococcal plasmid. This plasmid was mutagenised with EMS to obtain the derivative pS1 [3] which is thermosensitive for replication. The thermosensitive phenotype of pS1 was suppressed at a low frequency (0.33 X 10e4 per

0378-1097/95/%09.50 0 1995 Federation of European Microbiological Societies. All rights reserved

SSDZO378-1097(95)00055-O

166 hi. Sohail et al. /FEMS Microbiology Letters 127 (1995) 165-I 70

bacterium) when the PSSOd strain [3] carrying this plasmid was grown at 42” C with selection for cadmium resistance. Suppression was thought to be the result of integration of the plasmid into the chromosome [41.

It is reported here that the presence of transposon Tn551, which confers erythromycin resistance and is probably identical to Tn917 [5], in the chromosome of PS80d results in a significant increase in the frequency of suppression of the thermosensitivity of plasmid replication, and it is suggested that this may be a result of the increased frequency of integration of the plasmid into the chromosome by a process involving transposon Tn 551.

2. Materials and methods

2.1. Bacterial strains, growth medium and plasmids

Staphylococcus aureus PS80d and PS80d::Tn551 were used as hosts to determine the frequency of temperature sensitivity suppression of the replication of plasmid pS1 and a deletion derivative of pS1 called p AD [3]. Plasmid p AD has two deletions: the first includes the blaZ region and half of the right terminal inverted repeat (TIR,) of transposon Tn552, and the second a putative site-specific recombinase gene bin& [2]. Plasmids pBB33, pDB51 and pTD1 have Tn.551 inserted into pS1 and plasmids pRA1, pRDl1 and pRE56 have Tn551 inserted into PAD. CY medium (per litre) contains 10 g yeast extract, 10 g casein hydrolysate and 0.25 g MgSO, * 7H,O. Erythromycin was used at a concentration of 20 pg ml-l and cadmium acetate at 26.6 pg ml-’ of the CY medium.

2.2. DNA manipulation procedures

Plasmid DNA was purified from S. aureus according to [6]. Restriction enzyme analysis was carried out according to [7]. DNA sequencing was performed by the dideoxy chain termination method [8] using the SEQUENASE” * Version 2.0 DNA Sequencing Kit from United States Biochemical Cor- poration and [CX- 35S]ATP (37 TBq mmol- 1 Amer- sham).

2.3. Assay of thermosensitivity suppression

Strains PS80d(pSl), PS80d(pAD), PS80d:: Tn551(pSl) and PS80d::Tn551(pAD) were used to assay the suppression of thermosensitivity of plasmids pS1 and PAD, respectively. Plasmid-encoded resistance to cadmium salts was used as selective marker. A single colony was used to inoculate 10 ml of CY broth and was grown for 18 h at 30” C with aeration. This culture was used to plate out lo6 cfu onto CY-Cd agar plates which were then incubated at 42” C. The number of colonies appearing after 18 h was counted.

2.4. Propagation of phases and transduction

Staphylococcal phage 80 of the International Phage Typing Set [9] was propagated on the donor culture in 2 volumes of phage buffer (per litre: sodium P-glycerophosphate, 18.9 g; MgSO, .7H,O, 0.25 g; NaCl, 5 g; gelatin, 1 g) plus 1 vol. of CY-broth containing CaCl, (0.004 M) at 30” C with gentle shaking [lo]. Transduction was done as previ- ously described [3].

3. Results

3.1. Thermosensitivity suppression and Cd’Em’ co- transduction frequencies

Johnston used the co-transduction of plasmid- borne Cd’ and chromosomal Em’ to show linkage of plasmid and chromosomal genes after thermosensitivity suppression (unpublished). The Em’ determi- nant, however, was subsequently shown to be part of transposon Tn551 [11,12] and so other explanations for the linkage were investigated. The thermosensitivity suppression frequencies of plasmids pS1 and pAD in strains PS80d and PS80d::Tn551 (Table 1) show that there is a significant increase in the suppression frequencies for plasmids in strain PS80d::Tn551 compared to PS8Od. Forty thermostable colonies for each type were tested for the presence of plasmid DNA, but no plasmid DNA was detected. Ten colonies that had grown at 42” C from PS8Od::TnSSl(pSl) and ten from PS80d::Tn551(pAD) were picked at random to anal-

M. Sohail et al. /FEMS Microbiology Letters 127 (1995) 165-170 167

Table 1 Table 2

Frequencies of thermosensitivity suppression of the plasmids pS1

and p AD

Strain na (Mean + SD.)

The number of transductants and the frequency of Cd’Em’ link-

age among the transductants for each of the ten

PS80d::Tn55l(pSl) type revertants

PSSOd 0

PSBOd(pS1) 33*7

PSSOd(p AD) 11*5

PSROd::TnSSl 0

P%Od::Tn551(pSl) _ 300

PSSOd::Tn551(pAD) * 1000

Number of Cd’ colonies per lo6 cfu at 42” C after 18 h. Mean

values are shown for the results of three independent experiments

each with three determinations.

yse by transduction any linkage of the Cd’ to chromosomal DNA particularly the Tn551-encoded Em’. Phage 80 was propagated on cultures grown from all 20 colonies and these phages were used to transduce a new PS80d host to cadmium resistance. For the transduction of Cd’ from each of the thermostable derivatives of PS80Nd:Tn55I(pAD), more than 100 transductants were obtained. Similar numbers of transductants were obtained from five of the ther-

Revertant Total number of Number Number

transductants Cd’ Em’ Cd’ Ems

1 > 100 100

2 > 100 100

3 40 2

4 51 0

5 2 0

6 > 100 100

7 6 1

8 >lOO 100

9 2 0

10 >lOO 100

0

0

38

51

The transductants were selected on cadmium acetate

mostable derivatives of PS80d::Tn552(pSl), but the other five gave fewer transductants although the transduction conditions were made as similar as possible (Table 2). The transductants were screened for Em’ by plating individual colonies onto CY-Em agar

TlRR

blaRI

Tn.551 TL55I

t 7. t \ pRA1 /’ _\

‘\ ‘\ pRDl1 /j ‘\ 1’

/’ ‘\

‘\ ‘\ ,’

\\ / ‘\ 2.3

lb]: + t ‘\ ’ 8.9 ‘\ “23.3

‘\ /’ t inv ‘\\ /’ \I t I I I / I f (1.8

i.7 + + 7.3 8.0

mu

+ w .sin ‘X f 22.4 11.8 13.4 I’ ‘j\ 18.8 C-1 (+I,’ \

, \ 1’

\

1’ ‘\

, PREY2 ‘\

i 1‘

Tll551

Fig. 1. (a) The site of insertion of Tn551 into the putative transposase gene (p480) of Tn552 on the plasmid pS1. Various putative genes and the terminal inverted repeats (TfR, and TfR,) of Tn552 are also indicated. Jr and Jl represent the right and the left terminal inverted

repeats of Tn551, respectively. (b) A composite linear map of the plasmid p AD showing the three insertion sites of Tn551 in the plasmids

pRA1, pRE56 and pRDl1. The region labelled inu (invertible region) can occur in either of the two orientations [13]. mer is for mercury

resistance and sin is a site-specific recombinase gene [2,13,15].

168 M. Sohail et al. /FEMS Microbiology Letters 127 (1995) 165-I 70

with incubation at 30” C for 18 h. Complete linkage of Cd’ and Em’ was found for the transductants derived from nine of the thermostable PSSOd:: Tn551(pAD) colonies, whereas for the tenth the linkage was 97%. The Cd’Em’ linkage frequency in the transductants obtained from the thermostable PS80d::Tn551(pSl) colonies is shown in Table 2.

3.2. Restriction enzyme and sequence analyses of the plasmids in transductants

Plasmid DNA was prepared from ten independent examples of the Cd’Em’ transductants, derived from both PS80d::Tn551(pSl) and PS80d::Tn55I(pAD) type thermostable bacteria. Restriction enzyme map- ping revealed a 5.3-kb insertion (the size of Tn551) into every plasmid isolated from these transductants. In the case of derivatives of pS1, the insertion al- ways occurred into the same site on a 10.2-kb EcoRI fragment whereas in the case of PAD, the insertions occurred at many different sites (Fig. 1). No deletion or insertion other than Tn551 was detected in any of the plasmids. The plasmids in the transductants were thermosensitive for replication and this thermosensitivity was suppressed at a frequency indistinguishable from that for, as applicable, pS1 or p AD in PS80d (results not shown).

In order to determine the sequence at the site of integration of Tn551 on pS1 and at the sites of insertion of Tn551 on PAD, an oligonucleotide, (5’ GCATGTATCTCCATTAATI’CGG 3’) was de- signed to permit sequencing out from one of the terminal inverted repeats (TIR,) of the transposon. Sequencing was performed on three plasmids of pSl::Tn551 type (pBB33, pDB51 and pTD1) and three of pAD::Tn551 type (pRA1, pRDl1 and pRE.56). For all three plasmids from pS1, Tn551 had inserted site- and orientation-specifically into the putative transposase gene (p&O; [13]) of Tn552 (Fig. 2). In the case of PAD, Tn551 had inserted into sites which show no obvious homology to one another. In the plasmid pRA1, Tn551 had inserted into a sequence which shows 98.7% homology to the ORF2 of the mercury-resistance operon of the staphylococcal plasmid ~1258 [14] which is closely related to pS1. PS8ON(pRAl) was found to be mercury-sensitive, suggesting either that 0RF2 is impor- tant in mercury resistance or that the gene for ORF2 is co-transcribed with other genes in the operon. The sequence of p AD obtained at the junction of Tn551 on plasmid pRDl1 showed no homology to those in the GenEMBL databases. However, it shows homology to the nucleotide sequence in a region on a small Cd’-conferring plasmid ~0x6 (Dyke, unpublished).

pBB33 :

0RF480:

2094

CACTAAGCGCTCGGGACCC~TAGACGAGATTAAACGC

GCATAAATTAAAACAAAACATAATAGACGAGATTAAACGCCTTGCACTCUGMTAAAAGA

pRA1:

ORF2 :

1217 CACTAAGCGCTCGGGACCCCPTTAGCGAGAAATCCAATTCCTTCATTCGTTTAATZUACCG

CAAACAACAGGTGGATTTCCTTTAGCGAGAAATCCAATTCCTTCATTCGTTTAAT~CCG

pRD11: CACTAAGC!GCWGGGACCCCTCTAAGAActccgtaactccgtaaGAGCATAAGGGGAAATT

~0x6 : TCGAGAAATTTCAATTTTTCTCTAAGAActccgtaa--------GAGCATAAGG-AAAATA

pRE56 :

sin :

619 CACTAAGCGCTCGGGACCCCATTATCATGTTTAATTCTATMACTGTCTGTCTTGTAATAT

Fig. 2. The nucleotide sequence obtained on the pSl::Tn551 type (pBB33, pDB51 and pTD1) and the pAD::Tn551 type (pRA1, pRDll and

pRE56) plasmids. The sequences of pDB51 and pTD1 are not shown separately since they are identical to that of pBB33. The sequence of

the plasmid pBB33 is compared with that of ORF480 [13] and the sequences of pRA1, pRDl1 and pRF56 are compared with those of ORFZ

[14], ~0x6 and sin [2,15], respectively, at the sites of TnSZI insertion. The numbers correspond to those of published sequences. The

sequence of the terminal inverted repeat of Tn551 is shown in italics. The 8-bp direct repeat on p AD in the plasmid pRDl1 is in lower case.

Gaps (-) have been introduced to maximize homology between the sequences of pRDl1 and ~0x6.

M. Sohail et al. / FEMS Microbiology Letters 127 (199.5) 165-l 70 169

Table 3

The nucleotide sequence at the site of insertion on Tn5.51 on the plasmids pS1 and p AD

Plasmid

pBB33

(pDB51 & pTD1)

PRAl

pRDl1

pRE56

Nucleotide sequence at the site of Tn551 insertion

5’ ATTAAAACAAAACATAATAGACGAGATTAAAC

5 ’ ACAGG%&&&TTTAGCGA=AAT

5’ AATTTCAATTTTTCTCTATCCGTAACT,

5’ TATCAAGATAATCCATTATCATGTTTAATTCT

I Site of Tn.551 insertion

The nucleotide sequence which is presumably duplicated on insertion of Tn551 is underlined. The arrows indicate inverted repeats in the

pRA1 sequence.

This region has no large open reading frame and

undergoes spontaneous rearrangements. The sequence at the junction of Tn5.51 on plasmid pRE56

shows that Tn5.51 had inserted into the sin (also called bin3) gene of plasmid pAD 12,151. The sites of insertion of Tn551 on plasmids pS1 and p AD are shown in Table 3.

4. Discussion

4. I. Suppression of thermosensitivity of replication

of PSI

Although there was some suppression of the ther-

mosensitivity of replication of pS1 in the absence of a chromosomal copy of Tn551, the presence of Tn55I greatly enhanced the frequency of suppres-

sion (Table 1). It was clearly suppression, as op- posed to reversion, since growth of phage 80 on the suppressed bacteria permitted transduction of a plasmid to a new host in which the plasmid was again thermosensitive for replication. The suppression was presumably the result of integration of the plasmid into the chromosome since there was no evidence for the presence of a plasmid in the suppressed derivatives, although in no case was evidence obtained for insertion of chromosomal DNA, other than Tn551, into the pS1 plasmid.

Two possible mechanisms for the enhanced fre-

quency of suppression, which is assumed to be the result of integration into the chromosome, are:

6)

(ii)

The pS1 integrated by a mechanism that involved recombination between one end of the Tn551 and the specific site within the plasmid’s

Tn552 transposase gene ( ~480) resulting in a linear version of the plasmid opened at the site within ~480 and adjacent to Tn551. The Tn551

transposase may have catalysed this insertion and may also, perhaps aided by a phage 80- specified protein, have catalysed the excision of pS1 together with the adjacent Tn551 by acting at the site within ~480 and either the distal or proximal end of Tn551, thereby creating either a

thermosensitive plasmid with Tn551 inserted within ~480 or a pS1 indistinguishable from the original. The latter would be Cd’ Em” as was

seen for several transductants (Table 2) and a lower frequency of recombination in this case could explain the observed lower frequency of transduction. In this mechanism, Tn551 was acting in cis to increase the integration of pS1. The presence of Tn551 on the plasmid and not on the

chromosome was found not to enhance the frequency of suppression and therefore it seems that Tn551 cannot exert this effect in trans.

Tn552 transposed to the pS1 plasmid inserting into the ~480 and the copies of Tn551 on plasmid and chromosome underwent either site-

170 hf. Sohail et al. /FEW Microbiology Letters 127 (1995) 165-I 70

specific or homologous recombination, resulting

in integration of the plasmid into the chromosome. On propagation of phage on the bacteria, excision of the plasmid occurred by reversion of

the recombination between two copies of Tn551. In this mechanism, the Cd’ Ems plasmid (Table 2) would be produced either by integration of

pS1 at a site away from Tn5.51 and subsequent

precise excision or by recombination at the ends

of the integrated pS1 between the two Tn551s. Further evidence is needed to show whether or

not either explanation is correct.

4.2. Thermosensitivity suppression of PAD

Compared to pS1, p AD lacks part of Tn552

including TIR, and the gene that specifies a resolvase/invertase (binR). Suppression of thermosen-

sitivity of the replication of p AD was, like pS1, enhanced by the presence of Tn551 on the chromosome. However, there are significant differences:

(i) Linkage between Em’ and Cd’ was higher than

with pS1. (ii) In plasmids prepared from transductants, Tn551

had inserted into many different sites and in

none of ten such plasmids mapped was Tn551 in the same site as for pS1.

Both suggested mechanisms could apply to the integration of p AD, with the difference that either the plasmid integrated at a range of different sites or

Tn55I had no preferred site of integration. The most likely candidate to direct the differences between pS1 and p AD is the resolvase/invertase specified by

binR. The product of binR could, for example, direct recombination to the p480 site in pS1. The three sites of insertion sequenced for pAD::Tn552 plasmids are AT-rich but show no discernible homology to each other (Table 3).

Whatever the explanation, it is clear that trans- posons in this as in many other examples are impli- cated in the horizontal transfer of genes in these

organisms.

Acknowledgements

M. Sohail was the recipient of an S and T Schol- arship from the Government of Pakistan.

References

111

[21

[31

[41

151

[‘51

[71

b31

Skurray, R.A., Rouch, D.A., Lyon, B.R., Gillespie, M.T.,

Tennent, J.M., Bryne, M.E., Messerotti, L.J. and May, J.W.

(1988) Multiresistant Staphylococcus aureus: genetics and

evolution of epidemic Australian strains. J. Antimicrob.

Chemother. 21 Suppl. C, 19-38.

Rowland, S.-J. and Dyke, K.G.H. (1989) Characterization of

the plactamase transposon Tn.552. EMBO J. 8, 2761-2773.

Johnston, L.H. and Dyke, K.G.H. (1971) Stability of penicil-

linase plasmids in Staphylococcus aureus. J. Bacterial. 107,

68-73.

Johnston, L.H. and Dyke, K.G.H. (1974) Staphylococcal

penicillinase plasmids: studies on the reversion of a tempera-

ture-sensitive replication mutant to temperature stability. J.

Gen. Microbial. 82, 309-317.

Shaw, J.H. and Clewell, D.B. (1985) Complete nucleotide

sequence of macrolide-lincosamide-streptogramin B-resis-

tance transposon Tn917 in Streptococcus faecalis. J. Bacte-

riol. 164, 782-796.

Novick, R.P. and Bouanchaud, D. (1971) Extrachromosomal

nature of drug resistance in Staphylococcus aureus. Ann.

N.Y. Acad. Sci. 182, 279-294.

Sambrook, J., Fritsch, E.F. and Mania& T. (1989) Molecu-

lar Cloning: A Laboratory Manual. Cold Spring Harbor

Laboratory, Cold Spring Harbor, NY.

Sanger, F., Nicklen, S. and Coulson, A.R. (1977) DNA

sequencing with chain-terminating inhibitors. Proc. Natl.

Acad. Sci. USA 74, 5463-5467.

[9] Kloos, W.E. and Schleifer, K.H. (1989) Staphylococcus. In:

Bergey’s Manual of Systematic Bacteriology (Williams, ST.,

Sharpe, M.E. and Holt, J.G., Eds.), Vol. 2, pp. 1013-1035.

Williams and Wilkins, Baltimore, MD.

[lo] Dyke, K.G.H., Parker, M.T. and Richmond, M.H. (1970)

Penicillinase production and metal-ion resistance in Staphy-

lococc~s aureus cultures isolated from hospital patients. J.

Med. Microbial. 3, 12.5-136.

[ll] Pattee, P.A., Thompson, N.E., Haubrich, D. and Novick,

R.P. (1977) Chromosomal map locations of integrated plas-

mids and related elements in Staphylococcus aureus. Plasmid

1, 38-51.

[12] Khan, S.A. and Novick, R.P. (1980) Terminal nucleotide

sequences of TnSSI, a transposon specifying erythromycin

resistance in Staphylococcus aureus: homology with Tn3.

Plasmid 4, 148-154.

[13] Rowland, S.-J. and Dyke, K.G.H. (1990) Tn552, a novel

transposable element from Staphylococcus aureus. Mol. Mi-

crobiol. 4, 961-975.

[14] Laddaga, R.A., Chu, L., Misra, T.K. and Silver, S. (1987)

Nucleotide sequence and expression of the mercurial-resis-

tance operon from Staphylococcus aureus plasmid ~1258.

Proc. Natl. Acad. Sci. USA 84, 5106-5110.

[15] Paulsen, LT., Gillespie, M.T., Littlejohn, T.G., Hanvi-

vatvong, O., Rowland, S.-J., Dyke, K.G.H. and Skurray,

R.A. (1994) Characterization of sin, a potential recombinase-

encoding gene from Staphylococcus aureus. Gene 141, 109-

114.

Documents

Interaction of the chromosomal Tn557 with two thermosensitive derivatives, pS1 and p ΔD, of the plasmid pI9789 in Staphylococcus aureus