International Microbiology

INTERNATIONALMICROBIOLOGY

15(1)

2012

Inte

rnatio

nal M

icro

bio

log

y V

olu

me 1

5 N

um

ber 1

2012 p

p 1

-54

Published Quarterly by

Agricultural and Environmental Biotechnology Abstracts; ASFA/Aquatic Sciences & Fisheries Abstracts; BIOSIS; CAB Abstracts; Chemical Abstracts; SCOPUS;Current Contents®/Agriculture, Biology & Environmental Sciences®; EBSCO; EMBASE/Elservier Bibliographic Databases; Food Science and Technology Abstracts;ICYT/CINDOC; IBECS/BNCS; ISI Alerting Services®; MEDLINE®/Index Medicus®;Latíndex; MedBioWorldTM; SciELO-Spain; Science Citation Index Expanded®/SciSearch®

INDEXED IN

Volume 15 · Number 1 · March 2012 · ISSN 1139-6709

• Marc

h 2

012

IINNTTEERRNNAATTIIOONNAALL MMIICCRROOBBIIOOLLOOGGYYOfficial journal of the Spanish Society for Microbiology

RESEARCH ARTICLES

Schinke C, Germani JC

Screening Brazilian Macrophomina phaseolina isolates

for alkaline lipases and other extracellular hydrolases 1

Chen P, Yan L, Wang Q, Li Y, Li H

Surface alteration of realgar (As4S4)

by Acidithiobacillus ferrooxidans 9

Heindl H, Thiel V, Wiese J, Imhoff JF

Bacterial isolates from the bryozoan Membranipora membranacea: influence of culture media on isolation

and antimicrobial activity 17

García-Maldonado JQ, Bebout BM, Celis LB,

López-Cortés A

Phylogenetic diversity of methyl-coenzyme M reductase

(mcrA) gene and methanogenesis from trimethylamine

in hypersaline environments 33

Mariscotti JF, Quereda JJ, Pucciarelli MG

Contribution of sortase A to the regulation

of Listeria monocytogenes LPXTG surface proteins 43

Volume 15 · Number 1 · March 2012

www.im.microbios.org

Official journal of the Spanish Society for Microbiology

Publication Board

Editor-in-chiefCarles Pedrós-Alió, Institute of Marine Sciences-CSIC

Associate EditorsMercedes Berlanga, University of BarcelonaMercè Piqueras, International MicrobiologyWendy Ran, International Microbiology

Secretary GeneralRicard Guerrero, University of Barcelona, Institute for Catalan Studies

Adjunct Secretary and WebmasterNicole Skinner, International Microbiology

Managing CoordinatorCarmen Chica, International Microbiology

MembersTeresa Aymerich, University of GironaSusana Campoy, Autonomous University of BarcelonaJesús García-Gil, University of GironaJosep Guarro, Rovira i Virgili UniversityEnrique Herrero, University of LleidaEmili Montesinos, University of GironaJosé R. Penadés, Institute of Mountain Livestock-CSICJordi Vila, University of BarcelonaJordi Urmeneta, University of Barcelona

Addresses

Editorial OfficeInternational MicrobiologyPoblet, 1508028 Barcelona, SpainTel. & Fax +34-933341079E-mail: [email protected]

Spanish Society for MicrobiologyVitruvio, 828006 Madrid, SpainTel. +34-915613381. Fax +34-915613299E-mail: [email protected]

PublisherViguera Editores, S.L.Plaza Tetuán, 708010 Barcelona, SpainTel. +34-932478188. Fax +34-932317250E-mail: [email protected]; www.viguera.com

© 2012 Spanish Society for Microbiology & Viguera Editores, S.L.Printed in Spain

Print ISSN: 1139-6709Online ISSN: 1618-1095D.L.: B.23341-2004

Editorial Board

Ricardo Amils, Autonomous University of Madrid, Madrid, SpainAlbert Bordons, Rovira i Virgili University, Tarragona, SpainAlbert Bosch, University of Barcelona, Barcelona, SpainEnrico Cabib, National Institutes of Health, Bethesda, MD, USAVictoriano Campos, Pontificial Catholic University of Valparaíso, ChileJosep Casadesús, University of Seville, Sevilla, SpainYehuda Cohen, The Hebrew University of Jerusalem, Jerusalem, IsraelRita R. Colwell, Univ. of Maryland & Johns Hopkins University, MD, USAKaterina Demnerova, Inst. of Chem. Technology, Prague, Czech RepublicEsteban Domingo, CBM, CSIC-UAM, Cantoblanco, Madrid, SpainMariano Esteban, Natl. Center for Biotechnol., CSIC, Cantoblanco, SpainM. Luisa García López, University of León, León, SpainSteven D. Goodwin, University of Massachusetts-Amherst, MA, USAJuan C. Gutiérrez, Complutense University of Madrid, Madrid, SpainJohannes F. Imhoff, University of Kiel, Kiel, GermanyJuan Imperial, Technical University of Madrid, Madrid, SpainJohn L. Ingraham, University of California-Davis, CA, USAJuan Iriberri, University of the Basque Country, Bilbao, SpainRoberto Kolter, Harvard Medical School, Boston, MA, USAGermán Larriba, University of Extremadura, Badajoz, SpainPaloma Liras, University of León, León, SpainRuben López, Center for Biological Research, CSIC, Madrid, SpainJuan M. López Pila, Federal Environ. Agency, Dessau-Roßlau, GermanyMichael T. Madigan, Southern Illinois University, Carbondale, IL, USAM. Benjamín Manzanal, University of Oviedo, Oviedo, SpainBeatriz S. Méndez, University of Buenos Aires, Buenos Aires, ArgentinaDiego A. Moreno, Technical University of Madrid, Madrid, SpainIgnacio Moriyón, University of Navarra, Pamplona, SpainJosé Olivares, Experimental Station of Zaidín, CSIC, Granada, SpainJuan A. Ordóñez, Complutense University of Madrid, Madrid, SpainEduardo Orías, University of California-Santa Barbara, CA, USAJosé M. Peinado, Complutense University of Madrid, Madrid, SpainJ. Claudio Pérez Díaz, Ramón y Cajal Institute Hospital, Madrid, SpainAntonio G. Pisabarro, Public University of Navarra, Pamplona, SpainCarmina Rodríguez, Complutense University of Madrid, Madrid, SpainManuel de la Rosa, Virgen de las Nieves Hospital, Granada, SpainTomás A. Ruiz Argüeso, Technical University of Madrid, SpainHans G. Schlegel, University of Göttingen, GermanyJames A. Shapiro, University of Chicago, IL, USAJohn Stolz, Duquesne University, Pittsburgh, PA, USAJames Strick, Franklin & Marshall College, Lancaster, PA, USAJean Swings, Ghent University, Ghent, BelgiumGary A. Toranzos, University of Puerto Rico, San Juan, Puerto RicoAntonio Torres, University of Seville, Sevilla, SpainJosep M. Torres-Rodríguez, Municipal Inst. Medical Research, BarcelonaJosé A. Vázquez-Boland, University of Edinburgh, Edinburgh, UKAntonio Ventosa, University of Seville, Sevilla, SpainTomás G. Villa, Univ. of Santiago de Compostela, Santiago de C., SpainMiquel Viñas, University of Barcelona, Barcelona, SpainDolors Xairó, Biomat, S.A., Grifols Group, Parets del Vallès, Spain

P2

With the collaboration of theInstitute for Catalan Studies

Volume 15, Number 1, March 2012

RESEARCH ARTICLES

Schinke C, Germani JC Screening Brazilian Macrophomina phaseolina isolates for alkaline lipases and otherextracellular hydrolases 1

Chen P, Yan L, Wang Q, Li Y, Li H Surface alteration of realgar (As4S4) by Acidithiobacillus ferrooxidans 9

Heindl H, Thiel V, Wiese J, Imhoff JFBacterial isolates from the bryozoan Membranipora membranacea: influenceof culture media on isolation and antimicrobial activity 17

García-Maldonado JQ, Bebout BM, Celis LB, López-Cortés APhylogenetic diversity of methyl-coenzyme M reductase (mcrA) gene and methanogenesis from trimethylamine in hypersaline environments 33

Mariscotti JF, Quereda JJ, Pucciarelli MGContribution of sortase A to the regulation of Listeria monocytogenes LPXTGsurface proteins 43

A1

CONTENTSINTERNATIONAL MICROBIOLOGY (2012) 15:1-54ISSN 1139-6709 www.im.microbios.org

Spanish Society for Microbiology

The Spanish Society for Microbiology (SEM) is a scientific society foundedin 1946 at the Jaime Ferrán Institute of the Spanish National ResearchCouncil (CSIC), in Madrid. It’s main objectives are to foster basic andapplied microbiology, promote international relations, bring together themany professionals working in this science, and contribute to the dissemina-tion of science in general and microbiology in particular, among society. Itis an interdisciplinary society, with approximately 1700 members working indifferent fields of microbiology.

International Microbiology

Aims and scopeINTERNATIONAL MICROBIOLOGY, the official journal of the SEM, is a peer-reviewed, open access journal whose aim is to advance and disseminateinformation in the fields of basic and applied microbiology among scientistsaround the world. The journal publishes research articles and complements(short papers dealing with microbiological subjects of broad interest such aseditorials, perspectives, book reviews, etc.). A feature that distinguishes itfrom many other microbiology journals is a broadening of the term “micro-biology” to include eukaryotic microorganisms (protists, yeasts, molds), aswell as the publication of articles related to the history and sociology ofmicrobiology.

INTERNATIONAL MICROBIOLOGY offers high-quality, internationally-based information, short publication times (< 3 months), complete copy-

editing service, and online open access publication available to any readerprior to distribution of the printed journal.

The journal encourages submissions in the following areas:• Microorganisms (prions, viruses, bacteria, archaea, protists, yeasts,molds)• Microbial biology (taxonomy, genetics, morphology, physiology, ecol-ogy, pathogenesis)• Microbial applications (environmental, soil, industrial, food and med-ical microbiology, biodeterioration, bioremediation, biotechnology)• Critical reviews of new books on microbiology and related sciencesare also welcome.

Jounal Impact FactorThe 5-Year Journal Impact Factor (VIF) of INTERNATIONAL MICROBIOLOGYis 2.928.

The journal is covered in several leading abstracting and indexing data-bases, including the following ones: AFSA Marine Biotechnology Abstracts;Biological Abstracts; Biotechnology Research Abstracts; BIOSIS Previews;CAB Abstracts; Chemical Abstracts; Current Contents – Agriculture,Biology & Environmental Sciences; EBSCO; Embase; Food Science andTechnology Abstracts; Google Scholar; IEDCYT; IBECS; Latíndex;MedBioWorld; PubMed; SciELO-Spain; Science Citation Index Expanded;Scopus

A2Front cover and back cover design by MBerlanga & RGuerrero

Front coverCENTER. View of a raised microbial mat growing on top of highly sul-fidic sediments in an evaporitic flat in Laguna San Ignacio, Baja Cali-fornia Sur, Mexico. The irregular pustular morphology is due to theaccumulation of gas bubbles, which in those emanating from the sed-iment were found to contain methane. Phylogenetic analyses of thesamples revealed that the methanogen community was dominated bymoderately halophilic members of the genus Methanohalophilus. [Seearticle by García-Maldonado et al., pp. 33-41, this issue.] (Scale ca. 1:30)

UPPER LEFT. Particles of human immunodefficiency virus type 1 (HIV-1) budding from a lymphoid infected cell. The structural protein Gagoligomerizes in the inner leaflet of the plasma membrane to generatenew HIV particles. Immature particles are characterized by their circu-lar outlines, and mature HIV-1 virions by inner dense areas. Micrographby M. Teresa Fernández-Figueras, and Julià Blanco, Hospital Trias iPujol, Badalona, Spain. (Magnification, ca. 60,000×)

UPPER RIGHT. Typical position of filaments in a mature colony ofNostoc punctiforme Kützing (Hariot), isolated from a temporarilyinundated soil. The thallus is microscopic, gelatinous, and changesduring development. N. punctiforme is able to fix nitrogen in hetero-cysts, distinguished from vegetative barrel-shaped cells by their thick-walls and pale aspect. Isolation and micrograph by Mariona HernándezMariné, University of Barcelona, Spain. (Magnification, ca. 1000×)

LOWER RIGHT. Giemsa-stained promastigotes of Leishmania infantum.This flagellated form of the protist occurs in the insect vector.Following inoculation into their human hosts, promastigotes entermacrophages, where they develop into amastigotes (the non-flagellat-ed form) before multiplying. Micrograph by Roser Fisa and CristinaRiera, University of Barcelona, Spain. (Magnification, ca. 2000×)

LOWER LEFT. Low-temperature scanning electron micrograph ofmycobiont hyphae from the lichen Xanthoria elegans exposed tospace conditions in the BIOPAN-5 facility of the European SpaceAgency. Lichenized fungal and algal cells survived in space after fullexposure to massive UV, cosmic radiation and high vacuum. Image byCarmen Ascaso and Asunción de los Ríos (MNCN, CSIC, Madrid).(Magnification, ca. 1900×)

Back coverPortrait and signature of Antonio Vargas Reyes (1816–1873), Colom-bian pioneer of medicine and public health. Vargas Reyes belongedto a family linked to the development and progress of medicine in

Colombia throughout the nineteenth century. He was born inCharala in 1816, into wealthy family that, shortly afterwards, lost itsfortune, when Colombia became independent (1819) and the fami-ly was accused of having backed the Spanish crown. The familymoved to Bogota, but 5-year-old Antonio was left in the care of apriest, who was supposed to educate him but instead beat him andkept him illiterate, as well as close to starvation. He was rescued atthe age of 12, by his older, married sister, who took him to Bogota,where they joined their widowed mother. He soon recovered theyears that were lost with no education, and in 1834 began to studymedicine. Vargas Reyes may have been poverty stricken—some-times he could not even afford shoes, not to mention textbooks—buthe was certainly the most brilliant student in his class, and was oftenbullied by jealous fellow classmates. His situation greatly improvedafter the Rector of the University appointed him as an assistant inthe anatomy classes. After his graduation in 1838, he worked brieflyin the northern provinces of Colombia before joining the revolution-ary army. Along with Antonio Vargas Vega, he helped their commonrelative Jorge Vargas Suárez to organize the pox vaccine campaignduring the 1840–1841 epidemics. This was the first step in the even-tual creation of the Instituto Central de Propagación de la Vacuna(Central Institute for the Dissemination of Vaccination), in 1856. In1842, Vargas Reyes went to Paris, where he attended courses in var-ious medical specialties but also chemistry and botany. In 1845,after receiving a permit to work as a physician in France, he traveledto England, Italy, and Spain. Upon his return to Colombia in 1847,the country’s President, with the support of influential supporters,paid him an annual salary of 4000 pesos to ensure that he did notleave Colombia. In 1849, when a cholera pandemic reached severaltowns along the Colombian Atlantic shoreline, Vargas Reyes pub-lished a public health monography whose aim was to establish rulesfor the prevention and treatment of cholera. In the followingdecades, Vargas Reyes taught various medical subjects and cofound-ed the first Colombian scientific journals—La Lanceta (April-October, 1852) and La Gaceta Médica (July, 1864–December,1867), as well as a private School of Medicine (1865) that would bethe basis for the Faculty of Medicine of the National University,founded in 1867. In 1872, he went to Europe. He returned in 1873,retiring to Villeta, where he died on 23 August. A physician from thepre-bacteriological era, Vargas Reyes studied fevers and groupedthem in families. Although unaware of their microbial origin, he dis-tinguished between fever as a disease symptom and fever as a dis-ease in itself. His efforts towards the establishment of medicine as aprofession in Colombia and the foundation of a School of Medicinehave been widely recognized.

Cover legends

RESEARCH ARTICLE

Summary. Macrophomina phaseolina, phylum Ascomycota, is a phytopathogenic fungus distributed worldwide in hot dryareas. There are few studies on its secreted lipases and none on its colony radial growth rate, an indicator of fungal ability touse nutrients for growth, on media other than potato-dextrose agar. In this study, 13 M. phaseolina isolates collected in dif-ferent Brazilian regions were screened for fast-growth and the production of hydrolases of industrial interest, especially alka-line lipases. Hydrolase detection and growth rate determination were done on citric pectin, gelatin, casein, soluble starch, andolive oil as substrates. Ten isolates were found to be active on all substrates tested. The most commonly detected enzymeswere pectinases, amylases, and lipases. The growth rate on pectin was significantly higher (P < 0.05), while the growth rateson the different media identified CMM 2105, CMM 1091, and PEL as the fastest-growing isolates. The lipase activity of fourisolates grown on olive oil was followed for 4 days by measuring the activity in the cultivation broth. The specific lipolyticactivity of isolate PEL was significantly higher at 96 h (130 mU mg protein–1). The broth was active at 37 °C, pH 8, indicat-ing the potential utility of the lipases of this isolate in mild alkaline detergents. There was a strong and positive correlation(0.86) between radial growth rate and specific lipolytic activity. [Int Microbiol 2012; 15(1):1-7]

Keywords: Macrophomina phaseolina · pectinases · amylases · proteases · lipolytic activity · radial growth rate

Introduction

Enzymes are an important group of biological products usedin several processes in the food industry and in environmen-tal and industrial biotechnological applications [23]. As bio-catalysts, they have many advantages over chemical cata-

lysts: the ability to function under relatively mild conditionsof temperature, pH, and pressure; their specificity, and insome cases, their stereoselectivity. In addition, they produceno unwanted by-products [40]. Lipases are of particularinterest because of their many applications in oleochemistry,organic synthesis, the detergent industry, and nutrition [30].Indeed, the single biggest market for enzymes is in detergentformulations [27].

Fungi are excellent sources of enzymes as they producethese biocatalysts in great variety [8,31]. Macrophominaphaseolina (Tassi) Goid. [http://nt.ars-grin.gov/fungaldata-bases, accessed Feb. 24, 2012] is a phytopathogenic filamen-tous fungus belonging to the anamorphic Ascomycota,

INTERNATIONAL MICROBIOLOGY (2012) 15:1-7DOI: 10.2436/20.1501.01.153 ISSN: 1139-6709 www.im.microbios.org

*Corresponding author: C. SchinkeLaboratório de Tecnologia Bioquímica, Faculdade de FarmáciaUniversidade Federal do Rio Grande do SulAv. Ipiranga 2752 sala 707Porto Alegre, RS, CEP 90610-000, BrazilTel./Fax +55-5133085354E-mail: [email protected]

Claudia Schinke,* José C. Germani

Department of Raw Materials Production, Faculty of Pharmacy, Federal University of Rio Grande do Sul,Porto Alegre, Brazil

Received 27 December 2011 · Accepted 25 February 2012

Screening Brazilian Macrophomina phaseolinaisolates for alkaline lipases and other

extracellular hydrolases

2 INT. MICROBIOL. Vol. 15, 2012

Botryosphaeriaceae family [5,10], producing both sclerotiaand pycnidia. It is responsible for the plant disease calledcharcoal rot, which affects both the roots and the stems.There are also reports of the fungus causing human ocularinfection, skin infection in an immunocompromised child,and granuloma in a cat [6,14,37]. Macrophomina phaseolinais widely distributed in tropical regions and specifically inareas subjected to water stress, where it infects hundreds ofdifferent hosts [36] and causes severe economic losses [34].In Brazil, M. phaseolina is found from the Northeasternregion, where the climate is mostly hot and dry, to the South,where the humidity is high and temperatures range from 30°C in the summer to 5 °C in winter. The microorganism pen-etrates host tissues through mechanical pressure exerted bythe spore germ tube and the sclerotia hyphae, as well asthrough dissolution of the cell wall through processes medi-ated by secreted enzymes [4].

The plant cell wall is a complex structure of polymers thatsurrounds the cell. M. phaseolina produces cellulolytic,hemicellulolytic, pectolytic, and proteolytic extracellularenzymes [2], as well as lipases. Their concerted action resultsin the breakdown of the main polymeric components of thecell wall and the cell membrane. Studies on extracellularenzymes produced by M. phaseolina are few, and the mostrecent ones focused almost exclusively on cellulases andendoglucanases [1,7,29,41–43]. The colony radial growthrate reflects the ability of the fungus to use a particular sub-strate for growth, by secreting the necessary enzymes andthus enabling nutrient uptake for fungal metabolism and cellmultiplication. Thus far, only one study examined the relativegrowth rate of this phytopathogen, on potato-dextrose agar[18], whereas radial growth rates on other substrates have notbeen reported. The lipolytic activity of M. phaseolina,involving one or two isolates, has been described in only afew studies [2,16,28].

The objective of the present work was to screen wild-typeM. phaseolina collected in Brazil for fast growing isolatesthat produce hydrolases of industrial interest, and especiallyto select those producing alkaline lipases in large amounts.

Materials and methods

Equipment and reagents. Reagents and cultivation media were ofthe purest grade available, bought from Himedia (India), Merck (Germany),Vetec and Nuclear (Brazil). Extra-virgin olive oil was of commercial grade.A Minisart (Sartorius) filter, porosity 0.2 μm, was used for filter steriliza-tions. The rotatory shaker was from Oxylab (Brazil), and the spectropho-tometer was from Shimadzu UV Mini-1240.

Macrophomina phaseolina isolates. Isolates CMM 527, CMM932, CMM 979, CMM 1048, CMM 1091, CMM 2100, CMM 2105, collect-ed in the northeastern region of Brazil, were provided by thePhytopathogenic Fungi Culture Collection Prof. Maria Menezes of theFederal Rural University of Pernambuco (UFRPe). Isolates MMBF 564,MMBF 16–98, collected in the northeastern region, and MMBF 808, MMBF04–10, collected in the southeastern region, were from the Fungi CollectionMário Barreto Figueiredo of the Biological Institute of the Department ofAgriculture and Supply of the State of São Paulo (IB-SP). Isolate PEL, col-lected in the southern region, was obtained from the PhytosanitaryDepartment of the Federal University of Pelotas (UFPel). Isolate AJAM, col-lected in the southeastern region, was from the Phytopathology Departmentof the Federal University of Viçosa.

Isolates maintenance. Isolates were cultivated on potato dextroseagar (PDA) at 24±1 °C until colonies covered approximately two-thirds ofthe area of the Petri dishes. Discs of 0.5 cm in diameter were collected fromthe actively growing regions of the colonies and kept in sterile distilledwater, pH 6.5, at 6–8 °C, as stock for future inoculations.

Production of extracellular hydrolases. Petri dishes containingPontecorvo’s minimal medium agar [24], pH 6.8, and 0.2 % glucose [33],with the addition of 1 % (w/v) citric pectin, 4 % (w/v) gelatin (sodium nitratereduced to 3 mM), or 1 % (w/v) soluble starch, was used to detect pectinas-es, proteases on gelatin, and amylases, respectively. After the incubationperiod, substrate hydrolysis was detected by covering the plate with 1 %(w/v) hexadecyltrimethylammonium bromide (CTAB) [13] for pectinases,saturated solution of ammonium sulfate for proteases, or 1 % Lugol solutionfor amylases. A clear halo around the colony against an opaque surrounding,indicated pectin or gelatin hydrolysis. A reddish or yellowish halo around thecolony on a dark background indicated starch hydrolysis.

Extracellular proteolytic enzymes on casein were detected with skimmilk agar [19]. After incubation of the plates, a transparent halo around thecolony against an opaque background indicated casein hydrolysis. Lipaseswere detected with sterilized rhodamine B agar [39] added of previously fil-ter-sterilized olive oil at a 1 % (v/v) concentration. A yellow-orange coloraround the colony, detected using 350 nm UV light, indicated fungal produc-tion of lipases.

Each hydrolase assay was done in triplicate per isolate. A mycelium discin the center of each 9-cm Petri dish was inoculated and the plates were thenincubated at 30 °C in the dark for variable periods, until colonies covered60–75% of the plate area.

Colony radial growth rate. The growth rate was determined usingthe media and the incubation conditions described above, as well as PDA(pH 6.8). All assays were done in triplicate. Colony size was assessed at reg-ular intervals by measuring the colony diameter along two axes at a rightangle to the inoculation point, using a Vernier caliper. Measurements weredone until the colonies reached the sides of the plate. Radial growth rate onPDA was determined in 9-cm diameter plates with all isolates, and in 20-cmdiameter plates with isolates MMBF 04-10, MMBF 808, PEL, and CMM2105. The radial growth rate (mm/h), expressed as the angle of the linearportion of the regression line, was calculated based on the radius of thecolony vs. incubation time.

Lipolytic activity. Erlenmeyer flasks (250 ml) containing 100 ml of aminimal salts broth [9], pH 6.8, and 1 % (v/v) previously filter-sterilizedolive oil were inoculated with three mycelium discs of isolates MMBF 04-10, CMM 2105, PEL, and MMBF 808, one flask per isolate. The flasks wereincubated at 30 °C in a rotary shaker (160 rpm). Every 24 h for 4 days, 5-ml samples were collected, filtered through Whatmann paper, and frozen at–17 °C until analysis. The lipolytic activity of the cultivation broths was

SCHINKE ET AL.

3INT. MICROBIOL. Vol.15, 2012

assayed by using 4-nitrophenyl palmitate (pNPP) as substrate [22] in Tris-HCl buffer, pH 8, and 15-min incubation at 37 °C (ε = 13,300 M–1 cm–1).Absorbance was read at 410 nm by using heat-inactivated cultivation brothas blank. One unit (U) of lipolytic activity is defined as the amount ofenzyme that liberates 1 μmol of 4-nitrophenol (pNP) per minute per ml ofcultivation broth. The protein content of the samples was determined accord-ing to Lowry’s method, and the specific lipolytic activity (U mg protein–1)was calculated.

Statistical analysis. Assistat. Statistical Assistance software wasused for ANOVA, Tukey test, and Scott-Knott test [http://www.assistat.com/indexp.html].

Results and Discussion

Production of extracellular hydrolases. Table 1shows the hydrolases produced by each isolate. Consistentwith previous reports of pectin hydrolysis with enzymaticextracts of M. phaseolina [26], all 13 isolates hydrolyzedpectin. Pectinases were also detected in another study ofthree isolates [3], one of which was more efficient in causingstem rot. Dhingra et al. [11] demonstrated differentiated pec-tolytic and cellulolytic activity in vitro and in vivo between avirulent and an avirulent isolate. Maximum pectinase activi-ty was detected at 48 h when this phytopathogen was grownin submerged cultivation [2], with a rapid decrease in activi-ty after 96 h. By contrast, weak pectinase activity was report-ed for Macrophomina sp. MS 139 [35].

All 13 isolates secreted amylases. Onilude and Oso [21]also obtained amylases from M. phaseolina and used them,either as crude or partially purified preparations, in feed dietto improve the weight gain of broiler chicken. Another study[35], testing for extracellular hydrolases in several fungi,failed to detect amylases in Macrophomina sp. MS 139.However, according to one report [12] an isolate of this fun-gus showed good dextrinizing and saccharizing specificactivities on carbon sources such as starch, jackfruit seedflour, and rice flour.

In the present study, 11 isolates produced proteases ableto hydrolyze gelatin. Proteases active on casein were also fre-quently detected, except in two (AJAM and MMBF 564) ofthe 13 isolates. The sparse references on the proteases pro-duced by M. phaseolina also mention variability in theirdetection. Ahmad et al. [2] examined two strains of this fun-gus but did not detect proteolysis on casein either in solidmedium in Petri dishes or in submerged culture. However, intheir study of several fungi, Sohail et al. [35] reported thedetection of proteolytic enzymes produced by Macro-phomina sp. MS 139 in mineral medium with casein. Theauthors concluded that proteases are the most common

hydrolases in filamentous fungi. Kakde and Chavan [15] alsoobserved the ability of this fungus to use casein as source ofnitrogen.

In this study, all isolates showed lipase activity wheninduced with olive oil. The exception was isolate AJAM,which showed very restricted growth and no lipolysis evenafter 6 days of cultivation. Other studies also reported theproduction of lipolytic enzymes by this pathogen. In anexperiment comparing lipase production by M. phaseolinaand Phoma nebulosa [28], enzyme production was shown todepend on the culture medium used. In that work, M. phase-olina produced higher amounts of lipases when stimulated bythe addition of sesame flour to the medium. Another work[38] examined the M. phaseolina-induced deterioration ofpeanuts, specifically, the changes in moisture content, fattyacids, and proteins. A decrease in oil content and an increasein free fatty acids was noted, demonstrating the lipolyticaction of this fungus. In the above-mentioned study byAhmad et al. [2], the two M. phaseolina isolates also pro-duced lipases.

Ten of our 13 isolates showed hydrolytic activity on allsubstrates tested. In contrast to some studies on filamentousfungi, among the hydrolases, proteases were less frequentlydetected.

LIPASES FROM M. PHASEOLINA

Table 1. Detection of extracellular hydrolases of Macrophomina phaseolinaisolates grown on different substrates

Peca Amyb Prot gelc Prot casd Lipe

PEL + + + + +

AJAM + + – – –

CMM 527 + + – + +

CMM 932 + + + + +

CMM 979 + + + + +

CMM1048 + + + + +

CMM1091 + + + + +

CMM2100 + + + + +

CMM2105 + + + + +

MMBF564 + + + – +

MMBF808 + + + + +

MMBF16-98 + + + + +

MMBF04-10 + + + + +

Hydrolases detection: (+) hydrolases detected, (–) negative for substratehydrolysis on the triplicates. aPectinases. bAmylases. cProteases on gelatin. dProteases on casein. eLipases on olive oil.


Colony radial growth rate. The radial growth rates(mm/h) of each isolate grown on the different media werecalculated from the radius of the colony and the incubationtime. The overall radial growth rate achieved on a mediumwas determined by taking the individual rates of the tripli-cates of the 13 isolates on the same medium and calculating

their mean (Table 2). The several culture media resulted intwo distinct growth rates, showing that M. phaseolina grewsignificantly better (P < 0.05) on pectin and gelatin. Radialgrowth rates were quite variable among isolates grown on thesame medium, and also varied for the same isolate on the dif-ferent culture media (Table 3). The linear correlation coeffi-cient (Pearson’s r) of the regression lines remained between0.99 and 0.83 for all media, except gelatin (r = 0.75).

Although cultivated under the same conditions, isolatesof M. phaseolina in the present study showed radial growthrates on PDA well above those determined by Mayek-Pérezet al. [18] with Mexican isolates from different hosts and dif-ferent regions of the country. In that study, the rates rangedfrom 0.45 to 0.50 mm/h, and the authors related the het-erokaryotic nature of the mycelium of M. phaseolina to thevariability of its morphological characteristics, developmentin vitro, and virulence. Also mentioned as sources of variabil-ity were the geographical origin of the isolate, host type, cul-tivation time, and culture medium employed. Although in ourstudy isolate MMBF 04-10 showed the highest growth rateon PDA, the other isolates grew faster on several media. Ofall substrates tested, pectin yielded the highest growth rates,

SCHINKE ET AL.

Table 2. Radial growth rate (RGR)of Macrophomina phaseolina on differ-ent substrates

Substrate RGRa (mm/h)

Pectin 0.90±0.44 a

Soluble starch 0.60±0.22 b

Gelatin 0.77±0.27 a

Casein 0.55±0.25 b

Olive oil 0.62±0.28 b

aMean radial growth rate from triplicates of thirteen isolates on the samemedium. Means followed by the same letter do not differ statistically fromeach other (Scott-Knott test, P < 0.05).

Table 3. Radial growth rate of Macrophomina phaseolina isolates grown on different substratesa

Substrates Pectin Soluble starch Gelatin Casein Olive oil PDA

PEL 0.64±0.09 e 0.68±0.02 b 1.06±0.04 a 0.96±0.02 a 0.98±0.03 a 1.05±0.05 b

AJAM 0.22±0.01 g 0.19±0.05 c 0.28±0.01 d 0.04±0.01 h 0.07±0.01 h 0.06±0.01 i

CMM 527 0.62±0.08 e 0.72±0.04 b 0.72±0.20 b 0.83±0.03 b 0.74±0.01 b 0.61±0.02 f

CMM 932 0.45±0.06 f 0.26±0.18 c 0.35±0.17 d 0.24±0.02 g 0.34±0.02 g 0.45±0.01 g

CMM 979 1.05±0.06 d 0.67±0.02 b 0.98±0.03 a 0.63±0.05 c 0.78±0.01 b 0.74±0.01 d

CMM1048 1.38±0.05 b 0.58±0.01 b 0.84±0.06 b 0.55±0.08 d 0.76±0.01 b 0.49±0.02 g

CMM1091 1.62±0.07 a 0.72±0.02 b 1.06±0.03 a 0.89±0.01 b 0.98±0.05 a 0.61±0.06 f

CMM2100 1.21±0.22 c 0.62±0.04 b 0.91±0.03 a 0.58±0.03 d 0.65±0.03 c 0.41±0.01 g

CMM2105 1.25±0.08 c 1.02±0.01 a 0.98±0.03 a 0.69±0.08 c 1.00±0.01 a 1.02±0.01 b

MMBF564 0.78±0.03 e 0.68±0.11 b 0.78±0.03 b 0.45±0.01 e 0.30±0.01 g 0.69±0.02 e

MMBF808 0.97±0.03 d 0.56±0.03 b 0.57±0.04 c 0.36±0.04 f 0.52±0.02 e 0.85±0.03 c

MMBF16-98 0.26±0.04 g 0.38±0.01 c 0.47±0.09 c 0.47±0.02 e 0.41±0.08 f 0.21±0.06 h

MMBF04-10 1.28±0.10 c 0.60±0.27 b 0.93±0.07 a 0.49±0.03 e 0.59±0.04 d 1.33±0.07 a

aMean radial growth rate (mm/h) and standard error of three determinations. Means followed by the same letter do not differ statisti-cally from each other (Scott-Knott test, P < 0.05).


with isolate CMM 1091 growing significantly faster than theother isolates (1.61 ± 0.06 mm/h, P < 0.05). On starch, iso-late CMM 2105 showed a significantly higher growth rate (P< 0.05). Several isolates grew rapidly on gelatin but not oncasein, although both are protein substrates; in fact, caseinyielded the lowest growth rates among all substrates. Similarresults were obtained with the filamentous fungiBatrachochytrium dendrobatidis [25] and Aspergillussydowii [32], which also showed different growth patterns ongelatin than on casein, with both developing a higher myceli-um mass in media containing the latter. On olive oil, isolatesPEL, CMM 1091, and CMM 2105 showed significantlyfaster growth (P < 0.05) than the other isolates.

The variability in both the production of several extracel-lular hydrolases by M. phaseolina and the fungus’ rate ofradial growth on PDA, as described in the present study, con-firms the diversity reported by other authors. To our knowl-edge, ours is the first report on M. phaseolina radial growthrates on media other than PDA.

A high growth rate and the production of specificenzymes are features that allow the selection of isolates withspecific characteristics. CMM 1091 grew rapidly on all sub-

strates tested for the production of hydrolases, while isolatesPEL and CMM 2105 grew quickly on most media, producingthe corresponding hydrolase. Thus, CMM 1091, PEL, andCMM 2105 are isolates that produce enzymes of potentialindustrial interest and therefore merit further research.

Lipolytic activity. To verify the production of lipases byfour isolates using olive oil as sole source of carbon, thelipolytic activity of their cultivation broths was tested against4-nitrophenyl palmitate. Figure 1 shows the specific lipolyt-ic activity (U mg protein–1) of isolates PEL, CMM 2105,MMBF 04-10, and MMBF 808 during 4 days of cultivation.The activities of three isolates (PEL, CMM 2105, andMMBF 04-10) increased with cultivation time and in eachcase reached a maximum at 96 h: PEL 130 mU mg protein–1,CMM 2105 110 mU mg protein–1, and MMBF 04-10 80 mUmg protein–1. The activity of the fourth isolate, MMBF 808,was minimal (2 mU mg protein–1 in 96 h). The ANOVA andTukey test (P < 0.05) of the specific lipolytic activities ofPEL, CMM 2105, and MMBF 04-10 indicated that they weresignificantly different, with PEL showing the highest activi-ty throughout the cultivation period.


Int.

Mic

robi

ol.

Fig. 1. Extracellular lipase production by M. phaseolina isolates PEL (diamonds), CMM 2105 (squares),MMBF 04-10 (triangles), and MMBF 808 (circles) in minimal mineral salts medium with olive oil as indu-cer. Values represent the means and standard deviation of three determinations.


Ahmad et al. [2] cultivated two strains of M. phaseolinain minimal salts medium with olive oil for 96 h, while meas-uring the lipolytic activity of the broth at regular intervals.The activity of strain 1 peaked at 24 h and reached a mini-mum at 96 h, while strain 2 activity, which was only 40 % ofthat of strain 1, peaked at 24 h and reached a minimum at 48 h.Kakde and Chavan [16] cultivated an isolate of M. phaseolinafor 25 days in submerged cultivation in minimal salts medi-um containing oil and tested the lipolytic activity of the brothevery 5 days for 25 days. Maximum activity was reached onday 25, and half-maximal activity already on day 5. Since noother studies were found using spectrophotometry to deter-mine the lipolytic activity of M. phaseolina, our results can-not be compared with those of other researches. However, itis clear that the incubation time necessary for M. phaseolinato reach peak lipolytic activity in submerged culture is quitevariable, depending on culture conditions and the particularisolate.

A comparison of the radial growth rate on olive oil medi-um with the specific lipolytic activity of the four isolates test-ed showed that both CMM 2105 and PEL had high growthrates and produced the highest lipase activities. Studies ofother fungi have shown that growth rate and lipolytic activi-ty are regulated by the cAMP/PKA (cyclic AMP-dependentprotein kinase A) signaling pathway. In a study by Ocampoet al. [20], a mutant of Mucor circinelloides lacking the genefor one of the regulatory subunits of PKA (and thus exhibit-ing high PKA activity) exhibited a decrease in growth andalterations in germination rates, cell volume, germ tubelength, and asexual sporulation. Klose et al. [17] found thatcAMP/PKA signaling regulates the morphological growth ofUstilago maydis, whether filamentous or budding, and thathigher amounts of lipase are secreted in the presence oftriglycerides only by strains showing filamentous growth.They speculated that cAMP signaling is involved in the abil-ity of the fungus to use oils as carbon source and that thegene(s) encoding the lipase activity is regulated by PKA. Ourfindings suggest that this is also the case for Macrophominaphaseolina, as the correlation coefficient between radialgrowth rate on olive oil and lipolytic activity was strong andpositive (0.86), indicating that faster filamentous growth wasassociated with the higher production of lipolytic enzymes.

In summary, Macrophomina phaseolina was shown toproduce extracellular pectinases, amylases, proteases, andlipases. The isolates, however, varied in their abilities to pro-duce these enzymes, as some did not produce all the hydro-lases tested, and proteases were less commonly detected onboth gelatin and casein.

The determination of radial growth rates on different sub-strates together with the detection of the corresponding extra-cellular hydrolases identified CMM 1091, CMM 2105, andPEL as fast-growing isolates with great diversity in the pro-duction of extracellular hydrolases of industrial interest.Among the isolates tested, PEL produced the highest lipaseactivity, and the enzyme was active at 37 °C, pH 8, withpotential use in mild alkaline detergents. It is also reasonableto suggest that, as in other fungi, the radial growth rate andlipolytic activity of M. phaseolina are probably regulated bythe cAMP/PKA pathway, although this remains to be demon-strated in further studies.

Acknowledgements. The authors appreciate the financial support fromCAPES (Coordenação de Aperfeiçoamento de Pessoal de Ensino Superior,Ministry of Education, Brazil) in the form of a scholarship to C. Schinke.They also thank Igor Villela Marroni, the Federal Rural University ofPernambuco (UFRPE), the Biological Institute of the Department ofAgriculture and Food Supply of the State of São Paulo (IB-SP), the FederalUniversity of Pelotas (UFPel), and the Federal University of Viçosa for pro-viding samples of M. phaseolina. Thanks are also extended to Dr. MarcoAntonio Z. Ayub and Dr. Adriano Brandelli from the Institute of FoodScience and Technology of the Universidade Federal do Rio Grande do Sul(Brazil) for providing reagents and facilities.

Competing interests. None declared.

References

1. Afouda L, Wolf G, Wydra K (2009) Development of a sensitive serolog-ical method for specific detection of latent infection of Macrophominaphaseolina in cowpea. J Phytopathol 157:15-23

2. Ahmad Y, Hameed A, Ghaffar A (2006) Enzymatic activity of fungalpathogens in corn. Pak J Bot 38:1305-1316

3. Ali MM, Sayem AZM, Alam S, Ishaque M (1969) Relationship of pec-tic enzyme of Macrophomina phaseoli with stem-rot disease and rettingof jute. Mycopathologia 38:289-298

4. Ammon V, Wyllie TD, Brown Jr MF (1974) An ultrastructural investi-gation of pathological alterations induced by Macrophomina phaseoli-na (Tassi) Goid in seedlings of soybean, Glycine max (L.) Merrill.Physiol Plant Pathol 4:1-2

5. Arora P, Dilbaghi N, Chaudhury A (2012) Opportunistic invasive fungalpathogen Macrophomina phaseolina prognosis from immunocompro-mised humans to potential mitogenic RBL with an exceptional andnovel antitumor and cytotoxic effect. Eur J Clin Microbiol Infect Dis31:101-107

6. Bagyalakshmi R, Therese KL, Prasanna S, Madhavan HN (2008) Neweremerging pathogens of ocular non-sporulating molds (NSM) identifiedby polymerase chain reaction (PCR)-based DNA sequencing tech-nique targeting internal transcribed spacer (ITS) region. Curr Eye Res33:139-147

7. Beas-Fernández R, De Santiago-De Santiago A, Hernández-Delgado S,Mayek-Pérez N (2006) Characterization of Mexican and non-Mexicanisolates of Macrophomina phaseolina based on morphological charac-teristics, pathogenicity on bean seeds and endoglucanase genes. J PlantPathol 88:53-60

SCHINKE ET AL.


8. Bennett, JW (1998) Mycotechnology: the role of fungi in biotechnolo-gy. J Biotechnol 66:101-107

9. Colen G, Junqueira RG, Moraes-Santos T (2006) Isolation and screeningof alkaline lipase-producing fungi from Brazilian savanna soil. World JMicrobiol Biotechnol 22:881-885

10. Crous PW, Slippers B, Wingfield MJ, et al. (2006) Phylogenetic lineag-es in the Botryosphaeriaceae. Stud in Mycol 55:235-253

11. Dhingra OD, Schneider RW, Sinclair JB (1974) Cellulolytic and pec-tolytic enzymes associated with virulent and avirulent isolates ofMacrophomina phaseolina in vitro and in soybean seedlings. J Phyto-pathol 80:324-329

12. Fernandes LP, Ulhoa CJ, Asquieri ER, Monteiro VN (2007) Produçãode amilases pelo fungo Macrophomina phaseolina. R Eletrônica daFarmácia 4:43-51 (In Portuguese)

13. Hadj-Taieb N, Ayadi M, Trigui S, Bouabdallah F, Gargouri A (2002)Hyperproduction of pectinase activities by a fully constitutive mutant(CT1) of Penicillium ocitanis. Enzyme Microb Technol 30:662-666

14. Hasegawa T, Yoshida Y, Kosuge J, et al. (2005) Subcutaneous granulo-ma associated with Macrophomina species infection in a cat. Vet Rec156:23-24

15. Kakde RB, Chavan AM (2011) Effect of carbon, nitrogen, sulphur,phosphorus, antibiotic and vitamin sources on hydrolytic enzyme pro-duction by storage fungi. Recent Res Sci Technol 3:20-28

16. Kakde RB, Chavan AM (2011) Extracellular lipase enzyme productionby seed-borne fungi under the influence of physical factors. Int J Biol3:94-100

17. Klose J, de Sá MM, Kronstad JW (2004) Lipid-induced filamentousgrowth in Ustilago maydis. Mol Microbiol 52:823-835

18. Mayek-Pérez N, Castañeda CL, Gallegos JAA (1997) Variación en car-acteristicas culturales in vitro de aislamientos de Macrophomina phase-olina y su virulencia en frijol. Agrociencia 31:187-195 (In Spanish)

19. Medina P, Baresi L (2007) Rapid identification of gelatin and caseinhydrolysis using TCA. J Microbiol Methods 69:391-393

20. Ocampo J, Fernandez Nuñez L, Silva F, Pereyra E, Moreno S, Garre V,Rossi S (2009) A sub-unit of protein kinase A regulates growth anddifferentiation in the fungus Mucor circinelloides. Eukaryot Cell8:933-944

21. Onilude AA, Oso BA (1999) Effect of fungal enzyme mixture supple-mentation of various fibre-containing diets fed to broiler chicks 1:Performance and carcass characteristics. World J Microbiol Biotechnol15:309-314

22. Ozcan B, Ozyilmaz G, Cokmus C, Caliskan M (2009) Characterizationof extracellular esterase and lipase activities from five halophylicarcheal strains. J Ind Microbiol Biotechnol 36:105-110

23. Pandey A, Selvakumar P, Soccol CR, Nigam P (1999) Solid statefermentation for the production of industrial enzymes. Curr Sci77:149-162

24. Penariol MC, Monterio AC, Pitelli RA (2008) Crescimento eesporulação de Bipolaris euphorbiae cultivado sob diferentes condiçõesnutricionais. Ciência Rural 38:1907-1913 (In Portuguese)

25. Piotrowski JS, Annis SL, Longcore JE (2004) Physiology ofBatrachochytrium dendrobatidis, a chytrid pathogen of amphibians.Mycologia 96:9-15

26. Radha K (1953) The enzymic activity of Macrophomina phaseoli(Maubl.), Ashby. Proceedings: Plant Sci 38:231-234

27. Rathi P, Saxena RK, Gupta R (2001) A novel alkaline lipase fromBurkholderia cepacia for detergent formulation. Process Biochem37:187-192

28. Reddy AS, Reddy SM (1983) Lipase activity of two seed-borne fungi ofsesamum (Sesamum indicum Linn.). Folia Microbiol 28:463-466

29. Roy PK, Roy U, Vora VC (1993) Hydrolysis of wheat bran, rice branand jute powder by immobilized enzymes from Macrophomina phase-olina. World J Microbiol Biotechnol 9:164-167

30. Saxena RK, Sheoran A, Giri B, Sheba Davidson W (2003) Purificationstrategies for microbial lipases. J Microbiol Methods 52:1-18

31. Serrat M, Rodríguez O, Camacho M, Vallejo JA, Ageitos JM, Villa TG(2011) Influence of nutritional and environmental factors on ethanol andendopolygalacturonase co-production by Kluyveromyces marxianusCCEBI 2011. Int Microbiol 14:41-49

32. Sharma AK, Sharma V, Saxena J (2011) Production of protease andgrowth characteristics of Aspergillus sydowii. Nat Sci 9:217-221

33. Silva JH, Monteiro RTR (2000) Degradação de xenobióticos por fungosfilamentosos isolados de areia fenólica. R Bras Ciência Solo 24:669-674(In Portuguese)

34. Smith GS, Carvil ON (1997) Field screening of commercial and exper-imental soybean cultivars for their reaction to Macrophomina phaseoli-na. Plant Dis 81:363-368

35. Sohail M, Naseeb S, Sherwani SK, Sultana S, Aftab S, Shahzad S,Ahmad A, Khan SA (2009) Distribution of hydrolytic enzymes amongnative fungi: Aspergillus the pre-dominant genus of hydrolase producer.Pak J Bot 41:2567-2582

36. Songa W, Hillocks RJ, Mwango’mbe AW, Buruchara R, Ronno WK(1997) Screening common bean accessions for resistance to charcoal rot(Macrophomina phaseolina) in Eastern Kenia. Exp Agric 33:459-468

37. Srinivasan A, Wickes BL, Romanelli AM et al. (2009) Cutaneous infec-tion caused by Macrophomina phaseolina in a child with acute myeloidleukemia. J Clin Microbiol 47:1969-1972

38. Umechuruba CI, Otu KA, Ataga AE (1992). The role of seed-borneAspergillus flavus Link Ex Fr, Aspergillus niger Van Tiegh andMacrophomina phaseolina (Tassi) Goid on deterioration of groundnut(Arachis hipogaea L.) seeds. Int Biodeterior Biodegradat 30:57-63

39. Vitorino SI, Neves ESG, Gaspar F, Figueiredo Marques JJ, San RomãoMV (2007) Suberin utilization by Chrysonilia sitophila: evidence forlipolytic enzymes production. Ciência Técn Vitivinicola 22:1-4

40. Waites MJ, Morgan NL, Rockey JS, Higton G (2001) Industrial micro-biology: an introduction. Blackwell, London, England

41. Wang H, Jones RW (1995) A unique endoglucanase-encoding genecloned from the phytopathogenic fungus Macrophomina phaseolina.Appl Environ Microbiol 61:2004-2006

42. Wang H, Jones RW (1995) Cloning, characterization and functionalexpression of an endoglucanase-encoding gene from the phytopatho-genic fungus Macrophomina phaseolina. Gene 158:125-128

43. Wang H, Jones RW (1999) Properties of the Macrophomina phaseolinaendoglucanase (EGL 1) gene product in bacterial and yeast expressionsystems. Appl Biochem Biotechnol 81:153-160


RESEARCH ARTICLE

Summary. The chemical and physical characteristics of realgar (an arsenic sulfide mineral that occurs in several crys-talline forms) in the presence of Acidithiobacillus ferrooxidans BY-3 were investigated in this work. Grains of the mineralwere incubated for 10, 20, and 30 days with A. ferrooxidans cultured in 9K medium at 30 °C and at 150 rpm agitation.Abiotic control experiments were conducted in identical solutions. The effect of bioleaching on the surface properties ofrealgar was characterized by scanning electron microscopy (SEM), energy-dispersive spectroscopy (EDS), inductively cou-pled plasma atomic emission spectroscope (ICP-AES), X-ray diffraction (XRD), and Raman spectroscopy. SEM and EDSanalyses confirmed the ability of A. ferrooxidans to modify surfaces of realgar and to efficiently enhance its dissolution.ICP-AES showed the dissolution and precipitation of realgar during bioleaching. Based on the XRD pattern and the Ramanspectra, the decrease in arsenic in the liquid phase was due to co-precipitation of the mineral with Fe(III) or Fe(III) com-pounds (e.g., jarosite or goethite). Thus, not only did Fe(III) alter the surface of realgar, but it also promoted its dissolutionduring bioleaching. [Int Microbiol 2012; 15(1):9-15]

Keywords: Acidithiobacillus ferrooxidans · realgar (arsenic sulfide) · bioleaching · Raman spectroscopy · X-ray diffraction

Introduction

Realgar is a red, semiconductor, arsenic sulfide mineral thatexists in several crystalline forms. It is often found in associ-ation with orpiment, another arsenic sulfide. Natural realgaroccurs in a low-temperature phase termed α-As4S4. A high-temperature polymorph, β-As4S4, can be obtained by heatingrealgar above 252 °C. Both forms are based on the same

cage-like molecule even though they differ in their molecu-lar packing, which involves two distinct monoclinic lattices[4]. Throughout history, realgar has had many applications inthe manufacture of fireworks and leather , in pesticides, andas a medicinal agent [16]. Recently, realgar was reported tobe clinically effective in the treatment of various forms ofcancer both in vitro and in vivo [3,20,27].

The preparation of realgar is achieved using various tra-ditional and modern methods, such as acid extraction, calci-nation, membrane dialysis, mechanical milling, cryo-grind-ing, and the chemical synthesis of quantum dots [1,21].However, realgar is poorly soluble in aqueous and mostorganic solvents due to its high intrinsic lattice energy.Consequently, these technologies are often expensive and


*Corresponding author: Hongyu LiInstitute of Microbiology, School of Life SciencesLanzhou UniversityTianshui Road No. 222Lanzhou, 730000, PR ChinaTel. +86-9318912560. Fax +86-9318912561E-mail: [email protected]; [email protected]

Peng Chen,1,2 Lei Yan,1,3 Qiang Wang,4 Yang Li,1 Hongyu Li1*1Institute of Microbiology, School of Life Sciences, Lanzhou University, Lanzhou, PR China. 2GIBT, Gansu Institute ofBusiness and Technology, Lanzhou, PR China. 3College of Life Science and Technology, Heilongjiang Bayi Agricultural

University, Daqing, PR China. 4College of Chemistry and Chemical Engineering, Lanzhou University, Lanzhou, PR China.

Received 6 January 2012 · Accepted 26 February 2012

Surface alteration of realgar (As4S4)by Acidithiobacillus ferrooxidans


environmentally deleterious; moreover, their success may behindered by ineffective dissolution and storage difficulties[7]. Additional problems are the high toxicity and poorbioavailability of realgar, which have seriously limited its usein the clinical setting.

Bioleaching, a long-standing technology in hydrometal-lurgy, has recently been applied to prepare realgar, with theaim of increasing its bioavailability [7]. In the case of realgarproduction, the first report of biological precipitation wasthat of Huber et al. in 2000 [6,12]. Those authors describedbioleaching of the mineral by the hyperthermophilePirobaculum arsenaticum. Under organotrophic conditionsand in the presence of thiosulfate and arsenate, P. arsen-aticum forms realgar [5]. By taking advantage of an arsenic-resistant strain of indigenous Acidithiobacillus ferrooxidans(A. ferrooxidans) BY-3, we applied this bioleaching methodto develop a bio-arsenic aqueous solution from coarse realgarand confirmed its in vitro and in vivo anticancer activities[26].

Acidithiobacillus ferrooxidans (formerly Thiobacillusferrooxidans) is a mesophilic and acidophilic chemoli-thotrophic bacterium and the most well-studied acidophilicorganism [8]. Due to its bioleaching capabilities, it is animportant member of microbial consortia involved in the ironcycle. In fact, A. ferrooxidans, Acidiphilium spp., andLeptospirillum spp. were reported to account for 80% of theprokaryotic diversity in the Río Tinto ecosystem (Huelva,Spain), where ferric iron and sulfates are abundant [9,10,19].Even though arsenic can be toxic to A. ferrooxidans, the bac-terium can be adapted to tolerate much higher arsenic con-centrations than it does in nature [Mandi C (2003) The effectsof arsenic on Thiobacillus ferrooxidans. Columbia Univer-sity, Master Thesis], with some strains resistant to arsenic atconcentrations in the milligram per liter range [23].Compared to the traditional above- mentioned methods, thebioleaching of realgar produces extraordinary increases in itssolubility and bioavailability while decreasing its toxiceffects [3].

Previous investigations revealed that ferrous iron and ele-mental sulfur exert important effects on metal extraction dur-ing the bioleaching of realgar, but the chemical and physicalchanges that take place at the realgar surface have yet to bethoroughly studied [7]. Several analytical investigations ofthe inorganic alteration process of realgar surfaces have pro-vided information about their oxidation kinetics and thelight-induced degradation of realgar as well as electrochemi-

cal effects and the surface properties of realgar nanoparticlesin the absence of bacteria [2,14,15,22]. These studies haveimproved our understanding of realgar alterations in the pres-ence of air, water, acidic, neutral, and other abiotic surround-ings. To date, however, surface analytical techniques, such asRaman spectroscopy, have not been applied in the examina-tion of realgar after its reaction with A. ferrooxidans. In a pre-vious study, the reactivity of realgar with iron-oxidizing bac-teria was monitored by scanning electron microscopy (SEM)and energy dispersive spectrometric (EDS) [17].

The aim of this study was to observe the chemical andphysical changes occurring at powdered realgar surfaces inthe presence of the bacterium A. ferrooxidans. The long-termgoal is to achieve the necessary modifications of the mineralthat will facilitate its effective use in biotechnological andclinical applications. Accordingly, change in the realgar sur-faces were analyzed using several complementary tech-niques: SEM, EDS, powder X-ray diffraction (XRD), andRaman spectroscopy.


Realgar. The investigation was carried out using realgar As4S4 (99.01 %purity) from Shimen County, Hunan Province, China, which was purified bytraditional methods according to the Chinese Pharmacopeia [ChinesePharmacopoeia Committee (2010) Pharmacopoeia of the People’s Republicof China, China People’s Press, Beijing, pp 316]. The raw realgar wascrushed to 200 mesh size (approximately 75 ± 10 μm) and then analyzedchemically, using an inductively coupled plasma atomic emission spectro-scope (ICP-AES, IRIS Advantage, Thermo Jarrell Ash Corporation, USA),and mineralogically by XRD.

Microorganism and bioleaching experiments. The native A. ferro-oxidans strain BY-3 (CCTCC-M203071) was previously isolated from anabandoned copper mine in Baiyin, Gansu Province, China. The bacteriumwas cultured in 9K medium [18], consisting of (per liter): 3.0 g (NH4)2SO4,0.1 g KCl, 0.5 g K2HPO4, 0.5 g MgSO4·7H2O, 0.01 g Ca(NO3)2. Bioleachingexperiments were performed in 250-ml conical flasks containing 100 ml of9K medium (with 44.69 g of FeSO4·7H2O per liter) and 0.5 g of realgar at aninitial pH of 1.7 (adjusted with sulfuric acid). The flasks were incubated at30 °C, with shaking at 150 rpm. A sterile flask without bacteria but subject-ed to identical experimental conditions was included as a negative control.The experiments lasted for 30 days. All experiments were performed induplicate at a minimum. The average values are reported.

Analytical procedures. In bioleaching experiments, soluble arsenicconcentrations were measured by ICP-AES [7]. Surfaces of realgar beforeand after bioleaching were coated with gold and observed with a JEOL scan-ning electron microscope (JSM-5600LV, Tokyo, Japan) operated at 20 kVand a JEOL field emission scanning electron microscope (FESEM; JSM-

CHEN ET AL.


6701F, Tokyo, Japan) operated at 5–8 kV and using image slave software forimage capture. The ratio of arsenic to sulfur was analyzed by EDS (ThermoKevex) at a JSM-5600LV workstation. Sample preparation for SEM analy-sis was previously described [17]. XRD analyses of the powder form of theraw sample and residual bioleaching were conducted on a multipurpose X-ray diffraction system (X’Pert-Pro MPD, Philips), using Cu Kα radiation(λ= 0.15406 nm) and operated at 40 kV and 40 mA. The sample preparationmethod for XRD was previously described [23]. Raman spectroscopy meas-urements were carried out with a high-resolution Raman spectrometer(Horiba-Jobin, Yvon, HR-800) using a He–Ne laser (λ = 532 nm) as the exci-tation source.


The studied sample mostly consisted of realgar (97 %, w/w),with very small inclusions of arsenolite (3 %, w/w). Chem-ical analysis of this sample showed that it contained the fol-lowing elements (expressed as %, w/w): As (68.0), S (31.01),

Ca (0.01057), Fe (0.04015), Mg (0.00293), Hg (0.00323),K (0.00412), Se (0.00598), Al (0.00662), Cd (0.00004), Zn(0.00092), Cu (0.00013), and Ba (0.00028).

The interactions between realgar powder and cultures ofA. ferrooxidans BY-3 in the presence of ferrous iron wereanalyzed by SEM and EDS, with the results presented in Fig. 1and Table 1, respectively. Realgar samples subjected tobioleaching by A. ferrooxidans BY-3 for 0 (non-treated), 10,20, and 30 days, are shown in Fig. 1. During the first 10 daysof the experiment, no significant changes in the raw realgarpowder were observed (Fig. 1B). However, after 20 days, asshown in Fig. 1C,D, larger cracks or pits appeared on the themineral surface. Previous investigations suggested that theattachment of A. ferrooxidans to the realgar surface is the keystep in the bioleaching process [7].

The combined actions of attached bacteria and free bac-teria were determined to increase the rate of realgar dissolu-

ALTERATION OF REALGAR BY A. FERROOXIDANS

Int.

Mic

robi

ol.

Fig. 1. Scanning electron microscopy (SEM) image of the surface of realgar reacted with Acidithiobacillus ferrooxidans. (A) Beforeleaching; raw realgar powder. (B) After 10 days. (C) After 20 days. (D) After 30 days. Scale bar = 1 μm.


tion, confirming that direct bacterial action plays a major rolein the modification of realgar surfaces.

As evidenced by EDS analysis, the major constituents ofbioleached realgar were As, S, Fe, K, Mg, and Ca. This resultwas consistent with those of the XRD analysis, whichrevealed that magnetite and jarosite were the major Fe(III)compounds, while they were not found in the non-treatedrealgar. According to the EDS results, the ratio of arsenic tosulfur was 0.44:0.56 at the beginning of the experiment;0.41:0.59 on day 20, and 0.38:0.62 on day 30. The ratios onthe latter two days were lower than the stoichiometric ratio,

as described in Table 1. This is in agreement with previousstudies showing that the proportion of soluble arsenic gradu-ally increases in the bioleaching process [25]. On day 20, theratio of arsenic to sulfur decreased to a greater extent in thebioleaching realgar than in the non-treated realgar. Thus,bioleaching not only leads to a more rapid extraction ofarsenic, it also causes a relatively severe attack on the realgarsurface compared to non-treated realgar. The stoichiometricratio gradually decreased from 0.41:0.59 on day 20 to0.38:0.62 on day 30. This decrease in the ratio of arsenic tosulfur was accompanied by an increase in the concentrations

CHEN ET AL.

Table 1. The EDS analysis of the arsenic and sulfur ratio of realgar

Sample Time (days) Element Weight conc. (%) Atom conc. (%) Ratio As/S Stoichiometric As/S

Before bioleaching 0 As 50.44 30.34 0.44 As0.44S0.56

S 49.56 69.66

After bioleaching 20 As 48.95 29.10 0.41 As0.41S0.59

S 51.05 70.90

30 As 46.85 27.39 0.38 As0.38S0.62

S 53.15 72.61

Int.

Mic

robi

ol.

Fig. 2. X-ray diffraction (XRD) of: (A) solid realgar; (B) residual realgar after bioleaching by Acidithiobacillus ferrooxidans cultures in a medium contai-ning ferrous sulfate. (a) realgar, (b) arsenolite, (c) dimorphite, (d) magnetite, (e) jarosite.


of soluble arsenic in the leach liquor. The results demonstratedthat A. ferrooxidans can efficiently enhance the dissolution ofrealgar.

The changes in arsenic concentration over time in thepresence of ferrous iron were also analyzed. In the presenceof A. ferrooxidans (121.95 mg/l), the maximum level wasreached on day 15 and was 7.4 times higher than in the ster-ile control (16.44 mg arsenic/l). Afterwards, however, thearsenic content began to decrease such that by day 25 it waseven lower than in the sterile control. In order to understandthese variations in arsenic concentrations, the XRD patternsand Raman spectra of the solid residues were evaluated.

Figure 2 shows the XRD patterns of the realgar particlesbefore and after bioleaching. The many overlapping peakswere accompanied by a tendency toward gradual amorphiza-tion as a consequence of microbial action. All identifiedpeaks belonged to different phases. Based on a comparisonwith the Inorganic Crystal Structure Database (ICSD) data,two phases in the studied raw realgar sample could beascribed to this form: As4S4 (97 %) and As2O3 (3 %). In con-

trast, the mineral composition found in the solid residuesafter bioleaching comprised realgar, dimorphite, magnetiteand jarosite, which accounted for 43.0 % (w/w), 23.0 %(w/w), 6.0 % (w/w) and 28.0 % (w/w) of the sample, respec-tively. These results are consistent with those obtained bySEM and EDS. The most widely used adsorbents are thosethat are iron-based (e.g., jarosite or magnetite), due to theirhigh arsenic removal efficiency [11]. After 30 days, the pres-ence of jarosite and magnetite was confirmed by the XRDpatterns of the solid residues in the bioleaching experiment.However, jarosite was not found in the residue of the culturewithout A. ferrooxidans. The above results suggested thatarsenic leached from realgar is adsorbed onto Fe(III) orFe(III) compounds (including jarosite, goethite, magnetiteand hematite), and co-precipitated with Fe(III) extractedfrom jarosite, as described in [24]. Co-precipitation may havefurther inhibited the dissolution of realgar. Moreover, previ-ous studies have proposed that the adsorption of As(V) andis competitive, or that ionic As species (H2AsO4

–) is selec-tively adsorbed [24]. Consequently, adjustment of the Fe(III)


Int.

Mic

robi

ol.

Fig. 3. Raman spectra: (a) realgar powder; (b) residual realgar after bioleaching.


or Fe(III) compounds is of great importance during thebioleaching of realgar, as it significantly decreases theremoval of arsenic from the liquid phase.

The Raman spectrum of raw realgar is presented in Fig.3a, which shows two As-As stretching vibration peaks at 189cm–1 and 204 cm–1, two As-S stretching vibration peaks at350 cm–1 and 362 cm–1, and a characteristic As-S-As bendingvibration at 274 cm–1. This spectrum did not change signifi-cantly over time, confirming that the material was realgar. TheRaman spectrum of realgar modified by bioleaching is shownin Fig. 3b. The relative intensity of the As-As stretching vibra-tion peak at 189 cm–1 is increased; in addition, there are twoAs-S stretching vibration peaks at 270 cm–1 and 351 cm–1 anda characteristic As-S-As bending vibration at 234 cm–1.According to Kyono [13], the Raman spectrum of para-real-gar is characterized by a pair of strong peaks near 230 cm–1

and a grouping of four distinguishable peaks centered atapproximately 340 cm–1. These phase characteristics are notseen in the spectrum of Fig. 3b. Instead, there was a strongincrease in the dissolution of realgar, which retained its orig-inal characteristics after bioleaching without alterations in itsphysicochemical properties.

This study shows that A. ferrooxidans is able to modifyrealgar surfaces and to enhance dissolution of the mineral, asdetected by SEM and EDS. Additionally, the ICP-AESresults indicated that both dissolution and precipitationoccurred during the bioleaching of realgar. As determinedfrom XRD and Raman spectral analyses, the bioleaching ofrealgar by A. ferrooxidans is due to the oxidative propertiesof ferric iron. Therefore, the addition of Fe(III) and Fe(III)compounds can improve the dissolubility of realgar, in addi-tion to decreasing the arsenic concentration in the liquidphase.

Acknowledgements. This work was supported by the TechnologyProgram of Gansu Province (grant nos. 2GS064-A43-019-02,0912TCYA025, 098TTCA013 and 1004TCYA041), the InternationalCooperation Project (grant no. 0708WCGA150), Open Project of KeyLaboratory for Magnetism and Magnetic Materials of the Ministry ofEducation, Lanzhou University (grant no. LZUMMM2010016), and theFundamental Research Funds for the Central Universities (grant no. lzujbky-2010-36).


References

1. Baláz P, Fabián M, Pastorek M, Cholujová D, Sedlák J (2009)Mechanochemical preparation and anticancer effect of realgar As4S4

nanoparticles. Mater Lett 63:1542-15442. Baláz P, Nguyen AV, Fabián M, Cholujová D, Pastorek M, Sedlák J,

Bujnáková Z (2011) Properties of arsenic sulphide As4S4 nanoparticlesprepared by high-energy milling. Powder Tech 211:232-236

3. Baláz P, Sedlák J (2010) Arsenic in cancer treatment: challenges forapplication of realgar nanoparticles (a minireview). Toxins 2:1568-1581

4. Bonazzi P, Bindi L, Muniz-Miranda M, Chelazzi L, Rödl T, Pfitzner A(2011) Light-induced molecular change in HgI2·As4S4: Evidence by sin-gle-crystal X-ray diffraction and Raman spectroscopy. Amer Mineral96:646-653

5. Bruneel O, Pascault N, Egal M, Bancon-Montigny C, Goñi-Urriza M,Elbaz-Poulichet F, Personné JC, Duran R (2008) Archaeal diversity in aFe–As rich acid mine drainage at Carnoulès (France). Extremophiles12:563-571

6. Chaban B, Ng SYM, Jarrell KF (2006) Archaeal habitats-from theextreme to the ordinary. Can J Microbiol 52:73-116

7. Chen P, Yan L, Leng FF, Nan WB, Yue XX, Zheng YN, Feng N, Li HY(2011) Bioleaching of realgar by Acidithiobacillus ferrooxidans usingferrous iron and elemental sulfur as the sole and mixed energy sources.Bioresour Technol 102:3260-3267

8. Corkhill C Vaughan D (2009) Arsenopyrite oxidation—A review. ApplGeochem 24:2342-2361

9. De los Ríos A, Valea S, Ascaso C, Davila A, Kastovsky J, McKay CP,Gómez-Silva B, Wierzchos J (2010) Comparative analysis of the micro-bial communities inhabiting halite evaporites of the Atacama Desert. IntMicrobiol 13:79-89

10. García-Muñoz J, Amils R, Fernández VM, De Lacey AL, Malki M(2011) Electricity generation by microorganisms in the sediment-waterinterface of an extreme acidic microcosm. Int Microbiol 14:73-81

11. Giménez J, Martínez M, de Pablo J, Rovira M, Duro L (2007) Arsenicsorption onto natural hematite, magnetite, and goethite. J Hazard Mater141:575-580

12. Huber R, Sacher M, Vollmann A, Huber H, Rose D (2000) Respirationof arsenate and selenate by hyperthermophilic archaea. Syst ApplMicrobiol 23:305-314

13. Kyono A (2010) Growth and Raman spectroscopic characterization ofAs4S4 (II) single crystals. J Cryst Growth 312:3490-3492

14. Lazaro I, Gonzalez I, Cruz R, MG M (1997) Electrochemical study oforpiment (As2S3) and realgar (As2S2) in acidic medium. J ElectrochemSoc 144:4128-4132

16. Liu J, Lu YF, Wu Q, Goyer RA, Waalkes MP (2008) Mineral arsenicalsin traditional medicines: orpiment, realgar, and arsenolite. J PharmacolExp Ther 326:363-368

17. Ozturk S, Aslim B, Suludere Z (2010) Cadmium (II) sequestration char-acteristics by two isolates of Synechocystis sp. in terms of exopolysac-charide (EPS) production and monomer composition. BioresourTechnol 101:9742-9748

18. Silverman MP, Lundgren DG (1959) Studies on the chemoautotrophiciron bacterium Thiobacillus ferrooxidans. I. An improved medium anda harvesting procedure for securing high cellular yields. J Bacteriol77:642-647

CHEN ET AL.


19. Starek M, Kolev KI, Berthiaume L, Yeung CW, Sleep BE, WolfaardtGM, Hausner M (2011) A flow cell simulating a subsurface rock frac-ture for investigations of groundwater-derived biofilms. Int Microbiol14:163-171

20. Wang L, Zhou GB, Liu P, Song JH, Liang Y, Yan XJ, Xu F, Wang BS,Mao JH, Shen ZX, Chen SJ, Chen Z (2008) Dissection of mechanismsof Chinese medicinal formula Realgar-Indigo naturalis as an effectivetreatment for promyelocytic leukemia. Proc Natl Acad Sci U S A105:4826-4831

21. Wu J, Shao Y, Liu J, Chen G, Ho PC (2011) The medicinal use of real-gar (As4S4) and its recent development as an anticancer agent. J Ethno-pharmacol 135:595-602

22. Xu JL, Xu XX, Zhou XY, Zhang P, Zhang CZ (2007) Microscopicraman imaging spectra of realgar and light-induced degradation prod-ucts in realgar. Spectrosc Spectral Anal 27:577-580

23. Yan L, Yin HH, Zhang S, Leng FF, Nan WB, Li HY (2010) Biosorptionof inorganic and organic arsenic from aqueous solution byAcidithiobacillus ferrooxidans BY-3. J Hazard Mater 178:209-217

24. Yuichi T, Naoki H, Yasumasa K, Masami T (2005) Effect of jarosite onthe removal of arsenic ions in sulfuric acid solution. Shigen-to-Sozai212:597-602 (in Japanese)

25. Zhang JH, Zhang X, Ni YQ, Yang XJ, Li HY (2007) Bioleaching ofarsenic from medicinal realgar by pure and mixed cultures. ProcessBiochem 42:1265-1271

26. Zhang X, Xie QJ, Wang X, Wang B, Li HY (2010) Biological extractionof realgar by Acidithiobacillus ferrooxidans and its in vitro and in vivoantitumor activities. Pharm Biol 48:40-47

27. Zhao QH, Zhang Y, Liu Y, Wang HL, Shen YY, Yang WJ, Wen LP(2010) Anticancer effect of realgar nanoparticles on mousemelanoma skin cancer in vivo via transdermal drug delivery. MedOncol 27:203-212


RESEARCH ARTICLE

Summary. From specimens of the bryozoan Membranipora membranacea collected in the Baltic Sea, bacteria were iso-lated on four different media, which significantly increased the diversity of the isolated groups. All isolates were classifiedaccording to 16S rRNA gene sequence analysis and tested for antimicrobial properties using a panel of five indicator strainsand six different media. Each medium featured a unique set of isolated phylotypes, and a phylogenetically diverse collectionof isolates was obtained. A total of 96 isolates were assigned to 49 phylotypes and 29 genera. Only one-third of the membersof these genera had been isolated previously from comparable sources. The isolates were affiliated with Alpha- andGammaproteobacteria, Bacilli, and Actinobacteria. A comparable large portion of up to 22 isolates, i.e., 15 phylotypes, prob-ably represent new species. Likewise, 47 isolates (approximately 50%) displayed antibiotic activities, mostly against gram-positive indicator strains. Of the active strains, 63.8 % had antibiotic traits only on one or two of the growth media, whereasonly 12.7 % inhibited growth on five or all six media. The application of six different media for antimicrobial testing result-ed in twice the number of positive hits as obtained with only a single medium. The use of different media for the isolation ofbacteria as well as the variation of media considered suitable for the production of antibiotic substances significantlyenhanced both the number of isolates obtained and the proportion of antibiotic active cultures. Thus the approach describedherein offers an improved strategy in the search for new antibiotic compounds. [Int Microbiol 2012; 15(1):17-32]

Keywords: Membranipora membranacea · antimicrobial activity · gene analysis · cultivation media · Baltic Sea

Introduction

Surfaces in the marine environment, whether biotic or abiot-ic, are exposed to colonization by a multitude of organisms.For example, the encrusting bryozoan Membranipora mem-branacea and related species populate kelps in temperate

waters all over the world. The genus Membranipora is apotent colonizer and disperser; its global distribution mostlikely begain in the North Pacific several million years ago[42]. In the Baltic Sea, a preferred substrate is provided byphyloids of Saccharina latissima (newer synonym ofLaminaria saccharina [24]). In turn, bryozoan surfaces arethemselves subjected to colonizers and grazers. Like othersessile and colony-forming organisms in the marine environ-ment, bryozoans rely on mechanical and chemical defensestrategies [13]. As such, bryozoans and their associatedmicroorganisms might be a source of biologically active sub-stances.


*Corresponding author: J.F. ImhoffKieler Wirkstoff-ZentrumAm Kiel Kanal 4424106 Kiel, GermanyTel.+49-4316004450. Fax +49-4316004452E-mail: [email protected]

Herwig Heindl, Vera Thiel, Jutta Wiese, Johannes F. Imhoff*

Kieler Wirkstoff-Zentrum (KiWiZ) at the Helmholtz-Zentrum für Ozeanforschung, GEOMAR, Kiel, Germany


Bacterial isolates from the bryozoanMembranipora membranacea:

influence of culture media on isolationand antimicrobial activity


Although the phylum Bryozoa contains several thousandsof recent species, studies on natural products have focusedonly on a few of them [43]. Bryozoan metabolites accountonly for about 1 % of marine natural products, according tothe annually reviews of Blunt et al. [2]. Bryostatins are themost prominent compounds [35] extracted and isolated frombryozoans. However, bryostatins from Bugula neritina wereshow to be produced by the bacterial symbiont “CandidatusEndobugula sertula” [9], which is associated with the bry-ozoan. The resemblance of natural products originally isolat-ed from marine macroorganisms to those identified frommicroorganisms has led to the assumption that these com-pounds are of microbial origin [21,22]. This has been aprominent reason to intensify studies on the production ofbioactive compounds from bacteria and fungi associated withmarine algae, sponges, other invertebrates and, in this study,the bryozoan Membranipora membranacea.

Host-associated bacteria, in particular those colonizingsurfaces and living in biofilm communities, establish com-plex interactions with other microorganisms and with theirhosts. Communication is mediated chemically, and the sumof all factors shapes the composition of microbial covers,which in many cases have been shown to differ considerablyfrom the surrounding environment [11]. Therefore, regardingthe discovery of bioactive compounds, marine surface-asso-ciated microorganisms represent excellent sources [10,31].Bryozoan-associated microorganisms have been studied sofar using microscopic [30,48], genetic [20], and cultivation-based [16,36] methods, as well as combinations thereof [14].So far, no report is available on natural products produced byM. membranacea or bacteria associated with this bryozoan[49]. Therefore, the aim of this study was to isolate bacteriafrom the surface of M. membranacea by varying the culturemedia and growth conditions and then to analyze the abilityof these isolates to produce antibacterial compounds.


Sampling site and sample preparation. Bryozoan samples collectedby dredging in the Baltic Sea north of Læsø (Kattegat, coordinates 57° 28.3′ N,11°10.4′ E, depth 20 m) were identified as Membranipora membranacea grow-ing on phylloids of Saccharina latissima. Three separate bryozoan colonieswere cut out, washed with sterile filtered surrounding sea water, and transferredaseptically into sterile tubes containing 50 % (v/v) glycerol and 3 % (w/v)sodium chloride. The tubes were immediately frozen and stored at –18 °C untilfurther treatment. Excess bryozoan samples growing on algae were placed in acloseable beaker containing local sea water (total volume about one liter) andstored at 4 °C until used for media preparation. In addition, 2 l of seawater fromthe sampling site were collected before dredging, filtered through a 0.2-μm cel-lulose acetate filter, and added to selected agar media.

Culture media. For the isolation of microorganisms four media wereprepared: “bryozoan extract medium” (BM), “algal extract medium” (AM),diluted “Reasoner’s 2A medium” (R2Ad), and diluted “Difco all culturemedium” (ACd). For antibiotic activity testing six media were prepared:“Väätänen nine salt solution medium” (VNSS), “Pseudoalteromonas specif-ic medium” (PSA), “Reasoner’s 2A medium” (R2A), “Difco all culturemedium” (AC), “marine broth medium” (MB), and “tryptic soy broth medi-um” (TSB). Isolation media were prepared as follows: the excess samplesfrom the beaker were used for the media that resembled the natural habitat(BM and AM). Bryozoans were cut out from the algae and minced. Anequivalent weight of 3 % (w/v) saline was added. This material was thor-oughly blended with an Ultraturrax-homogenizer (IKA Werke, Germany),frozen at –100 °C, and lyophilized to obtain a “bryozoan extract.” Theremaining algae were recombined with the seawater in a beaker, homoge-nized, frozen, and lyophilized to yield an “algal extract.” Both extracts weredissolved in sea water collected from the sampling site at concentrations of0.06 % (w/v), yielding BM and AM media. Additionally, R2Ad medium(containing 0.01 % (w/v) Bacto yeast extract, Difco proteose peptone, Difcocasamino acids, glucose, soluble starch; 0.006 % (w/v) sodium pyruvateand K2HPO4; and 0.00048 % (w/v) MgSO4), and ACd medium [0.06 %(w/v)], both with 3% (w/v) sea salt (Tropic Marin) were prepared.

Six media for the activity tests were prepared (all percentages are w/v):(i) VNSS medium with 0.1 % peptone from soymeal (Merck), 0.05% yeastextract, 0.05 % glucose, 0.5 % soluble starch, 0.001 % FeSO4·7H2O, 0.001 %NasHPO4·2H2O, 1.7 6% sodium chloride, 0.147 % Na2SO4, 0.008 %NaHCO3, 0.025 % KCl, 0.004 % KBr, 0.187 % MgCl2·6H2O, 0.041 %CaCl2·2H2O, 0.001 % SrCl2·6H2O, and 0.001 % H3BO3) (according toMården et al. [28]); (ii) PSA medium with 0.2 % peptone from soymeal, 0.2 %yeast extract, 0.1 % glucose, 0.02 % KH2PO4, 0.005 % MgSO4·7H2O, 0.1 %CaCl2·2H2O, 0.01 % KBr, and 1.8 % sea salt (according to Kalinovskaya etal. [19]); (iii) R2A medium; (iv) AC medium were fivefold concentratedcompared to isolation media and 3 % sea salt was added; (v) MB medium with0.5 % peptone, 0.1 % yeast extract, and 3.14 % sea salt), and (vi) TSBmedium with 0.3 % tryptic soy broth (Difco) and 2.5 % sodium chloride).To all media, 1.5 % agar was added for solidification.

Isolation and cultivation of bacteria. For comparison, two differ-ent methods of sample preparation were applied. The first two bryozoansamples were crushed with a sterile micropestle, the third was processedwith a Precellys 24 lysis & homogenization device with a hard tissue grind-ing MK28 kit (Bertin Technologies) at 6300 rpm for 20 s. Dilution serieswith sterile seawater were prepared (10–1 to 10–5) [16] and a 100-μl aliquotof each one was spread on agar plates containing four different media. Inaddition, pieces of the bryozoan samples were placed on plates with all fourmedia. The plates were incubated at 25 °C in the dark until colonies were vis-ible. These were picked and sub-cultured on MB agar plates. For preservation,pure cultures were suspended in liquid MB medium containing 5 % (v/v)DMSO and stored at –100 °C.

Screening for inhibitory activities against indicatororganisms. Bacterial isolates were grown on MB agar plates directlyfrom the DMSO stock. Colonies were picked, and suspended in 1 ml sterile3 % (w/v) saline, and a 15-μl aliquot of each one was pipetted onto agarplates with six different media. After growing for 3–4 days at room temper-ature (ca. 22 °C), the bacterial colonies were checked for the presence ofclearance zones to anticipate false-positive results. The plates were then cov-ered with 5 ml TSB soft agar (with 1 % (w/v) sodium chloride and 0.8 %(w/v) agar) containing one of the following indicator strains: Escherichiacoli DSM 498, Bacillus subtilis subsp. spizizenii DSM 347, Staphylococcuslentus DSM 6672, Pseudomonas fluorescens NCIMB 10586, and the yeastCandida glabrata DSM 6425. The presence of inhibition zones was exam-ined the following day as well as on days 3, 7 and 14.

HEINDL ET AL.


Amplification, sequencing, and classification of the isolates.Amplification, sequencing, and phylogenetic analysis of the 16S rRNA genesequences from the bacterial isolates were carried out as previouslydescribed [16]. Isolates were grouped into phylotypes by sequence similari-ties ≥99.5 %. Genus affiliation was determined using the RDP classifier [46].If resulting confidence values were <60 % for the classified genus, the affil-iation was specified by constructing phylogenetic trees and comparingBLAST results. This was the case for phylotypes 1 (Erwinia), 16(Roseobacter), and 19 (Ruegeria).

In the case of strain BB77, a 16S rRNA gene clone library was con-structed because direct sequencing of the PCR product was not successful.The PCR product was purified after gel electrophoresis with a MinElute Gelextraction kit (Qiagen, Hilden, Germany) and excision of the band. The puri-fied 16S rRNA gene was cloned into the pCR 2.1-TOPO vector and trans-formed into One Shot TOP10 chemically competent E. coli cells, using theTOPO TA cloning kit (Invitrogen, Karlsruhe, Germany) according to themanufacturer’s instructions. Correct insertion was checked by PCR withvector binding primers included in the kit. Fourteen clones were chosen forsequencing and classification of the inserted 16S rRNA gene as describedabove. The 16S rRNA gene sequences were deposited with the EMBLNucleotide Sequence Database under the accession numbers FR693269 toFR693364.

Cluster analysis. The distribution patterns of phylotypes and antibioticactivities of isolates were compared by cluster analysis using the Bray-Curtissimilarity index. Dendrograms were generated with the program PAST,applying the paired group algorithm [15].

Results

Isolation of Membranipora membranaceaassociated bacteria. Four media were used for the iso-lation of bacteria, and all colonies grown on the agar plateswere picked and purified on MB agar. The results are shownin Table 1. Most isolates (60.4 % of all 96 isolates) derivedfrom media inoculated with a piece of the bryozoan; 30.2 %from dilution step 10–1, 8.3 % from step 10–2, and 1.0 % fromstep 10–4. Most isolates (43.8 % of all isolates) were obtainedfrom ACd medium, fewer isolates resulted from R2Ad medi-um (34.4 %), BM medium (15.6 %), and AM medium (6.2%). Portions of 29, 32 and 39 % of the isolates were obtainedfrom the three bryozoan samples.

Phylogenetic affiliation. All isolates were classifiedphylogenetically based on 16S rRNA gene sequences andgrouped into phylotypes according to sequence similarityvalues of ≥99.5 %. The resulting 49 phylotypes were affiliat-ed with 28 different genera (Table 2). A cluster analysisregarding the presence and absence of phylotypes within thethree bryozoan samples revealed low similarity values at≤0.3, with samples 1 and 2 as the most related (Fig. 1A). Thisclearly indicated that distinct phylotypes were obtained fromeach sample, especially from the third bryozoan specimen,

which was prepared differently as described above. Themedia had a significant influence on the types of bacteria iso-lated and resulted in dissimilar phylotype patterns. 37 phylo-types (75.5 %) were unique to one of the media, i.e., repre-sentatives of these phylotypes were not found elsewhere.Most “unique” phylotypes derived from R2Ad medium (17of the 23 phylotypes of this medium) followed by ACd medi-um (11 of 23), BM medium (6 of 12), and AM medium (3 of6). Accordingly, similarity values for the phylotypes obtainedfrom the different media were low and ranged from 0.1 to 0.3(Fig. 1B).

The bacterial isolates were affiliated with four classes:Gammaproteobacteria (40 isolates), Alphaproteobacteria (21isolates), Bacilli (12 isolates), and Actinobacteria (23 iso-lates). Representatives of these classes were isolated fromeach bryozoan sample, with the exception of theAlphaproteobacteria, which were not obtained from sample 3(Fig. 2).

Gammaproteobacteria. The 40 isolates of theGammaproteobacteria could be grouped into 15 phylotypesand assigned to ten genera: Erwinia, Pseudoalteromonas,Vibrio, Shewanella, Halomonas (4 phylotypes), Marino-bacter, Psychrobacter, Microbulbifer (2 phylotypes), Alca-nivorax, and Pseudomonas (2 phylotypes) (Fig. 3A; Table 2).The majority of these bacteria (85%, covering 14 phylotypes)were picked from media inoculated with a piece of the bry-ozoan, and most isolates (47.5 %, covering 11 phylotypes)were obtained using ACd medium (Table 1).

Bacteria related to Halomonas were isolated from allthree bryozoan samples and from all four media. In contrast,all eight isolates assigned to Pseudoalteromonas originatedfrom sample 3 but were picked from three different isolationmedia (BM, R2Ad, Acd). Representatives of Psychrobacter,Microbulbifer, and Pseudomonas each derived from morethan one medium and bryozoan sample. Single isolates wereobtained of Vibrio, Shewanella, Marinobacter, Alcanivorax,and Erwinia. The latter (BB49, phylotype 1) could representa new species, as indicated by 16S similarity values ≤ 97%with validly described species (Table 2). This is below thethreshold value of 98.7 % for 16S similarity values proposedby Stackebrandt and Ebers [44], which indicate genomicuniqueness of novel isolates.

Alphaproteobacteria. Members of 16 phylotypes (21isolates) were affiliated with the Alphaproteobacteria andassigned to ten genera: Roseobacter, Roseovarius (2 phylo-types), Ruegeria (4 phylotypes), Jannaschia, Paracoccus,

BACTERIA FROM THE BRYOZOAN M. MEMBRANACEA

20 INT. MICROBIOL. Vol. 15, 2012 HEINDL ET AL.

Table 1. Origin, affiliation, and antimicrobial activity of Membranipora membranacea-associated bacteria

Isolation Activityb

Phylotype Isolates Affiliation Sa Medium Bs Sl Ec Pf Cg

1 BB49 Erwinia 2 BM T

2 BB66a Pseudoalteromonas 3 BM

2 BB67 Pseudoalteromonas 3 R2Ad T

2 BB68/ BB69 Pseudoalteromonas 3 R2Ad M

2 BB71 Pseudoalteromonas 3 ACd M

2 BB72b/ BB73/ BB74 Pseudoalteromonas 3 ACd TM

3 BB8 Vibrio 1 ACd

4 BB86 Shewanella 1 ACd TMVA

5 BB12b Halomonas 1 ACd

5 BB66b Halomonas 3 BM A T

5 BB85 Halomonas 2 ACd PRA

5 BB7 Halomonas 1 AM P

6 BB10/ BB3 Halomonas 1 ACd

6 BB6 Halomonas 1 AM

6 BB65 Halomonas 3 BM

7 BB9 Halomonas 1 ACd

8 BB11b Halomonas 1 ACd

8 BB81/ BB82b Halomonas 1 R2Ad

9 BB15 Marinobacter 1 ACd TA

10 BB13/ BB14 Psychrobacter 1 R2Ad

10 BB20/ BB83 Psychrobacter 1 ACd

10 BB62 Psychrobacter 3 BM TV

11 BB44 Microbulbifer 2 R2Ad MVPRA A A

12 BB27 Microbulbifer 1 AM R

12 BB34 Microbulbifer 2 ACd PR

12 BB48 Microbulbifer 2 ACd R

13 BB31 Alcanivorax 2 R2Ad n.t. n.t. n.t. n.t. n.t.

14 BB5/ BB82a/ BB79 Pseudomonas 1 R2Ad

14 BB80 Pseudomonas 1 R2Ad TVA

15 BB75a/ BB78 Pseudomonas 3 ACd

16 BB43 Roseobacter 2 R2Ad R

17 BB22 Roseovarius 1 R2Ad R

18 BB19 Roseovarius 1 AM RA

19 BB50b Ruegeria 2 BM VRA

20 BB40 Ruegeria 2 R2Ad MVPRA

(Continued on next page)

21INT. MICROBIOL. Vol.15, 2012BACTERIA FROM THE BRYOZOAN M. MEMBRANACEA

Table 1. (Continued) Origin, affiliation, and antimicrobial activity of Membranipora membranacea-associated bacteria

Isolation Activityb


21 BB2 Ruegeria 1 ACd MVA

21 BB29 Ruegeria 2 R2Ad RA

21 BB45 Ruegeria 2 R2Ad MVR

22 BB33 Ruegeria 2 ACd MVRA

23 BB23 Jannaschia 1 R2Ad

24 BB51b Paracoccus 2 BM TRA

25 BB54 Anderseniella 2 AM R

26 BB18 Amorphus 1 AM

27 BB32 Erythrobacter 2 R2Ad

28 BB17 Erythrobacter 1 R2Ad MV

29 BB1 Sphingopyxis 1 ACd T

29 BB4/ BB46 Sphingopyxis 1/2 ACd

30 BB24 Sphingopyxis 1 R2Ad VP

30 BB28 Sphingopyxis 2 ACd M

31 BB21 Pelagibius 1 R2Ad MPRA

32 BB58a/ BB58b Staphylococcus 3 ACd n.t. n.t. n.t. n.t. n.t.

32 BB60 Staphylococcus 3 R2Ad P

32 BB26 Staphylococcus 1 ACd

33 BB41 Bacillus 2 R2Ad

34 BB50c Bacillus 2 BM P P

34 BB51c Bacillus 2 BM

35 BB42 Bacillus 2 R2Ad TVPRA TMVPRA VR

36 BB52 Bacillus 2 R2Ad T PA

37 BB61 Bacillus 3 R2Ad TP

38 BB75b Exiguobacterium 3 ACd TMPR

38 BB76 Exiguobacterium 3 ACd M

39 BB36 Mycobacterium 2 ACd

39 BB55/ BB56/ BB57 Mycobacterium 3 ACd

39 BB64 Mycobacterium 3 BM

40 BB35 Mycobacterium 2 ACd

41 BB37 Mycobacterium 2 ACd TP

42 BB38 Mycobacterium 2 BM

43 BB63 Pseudonocardia 3 R2Ad



Anderseniella, Amorphus, Erythrobacter (2 phylotypes),Sphingopyxis (2 phylotypes), and Pelagibius (Fig. 3B; Table2). In contrast to the Gammaproteobacteria, these isolateswere predominantly picked from R2Ad medium (47.6 %,covering 9 phylotypes) and from the dilution series (71.4 %,covering 12 phylotypes) (Table 1). Except for the isolatesaffiliated with Sphingopyxis (both phylotypes) and Ruegeria(phylotype 21), all Alphaproteobacteria were single isolates(Table 2). New species were possibly represented by mem-bers of 13 phylotypes: Roseobacter (phylotype 16), Roseo-varius (phylotype 17), Ruegeria (phylotypes 19 and 21),Jannaschia (phylotype 23), Paracoccus (phylotype 24),Anderseniella (phylotype 25), Amorphus (phylotype 26),Erythrobacter (phylotypes 27 and 28), Sphingopyxis (phylo-types 29 and 30), and Pelagibius (phylotype 31) (Table 2).

Bacilli. This class [27] was represented by seven phylo-types (12 isolates) affiliated with the genera Staphylococcus,Bacillus (5 phylotypes), and Exiguobacterium (Fig. 3C;Table 2). All but one of the isolates were obtained from platesinoculated with bryozoan samples 2 and 3 (41.7 % and 50 %,covering four and three phylotypes, respectively). ACd andR2Ad media yielded five isolates each. Bacillus and

HEINDL ET AL.

Table 1. (Continued) Origin, affiliation, and antimicrobial activity of Membranipora membranacea-associated bacteria

Isolation Activityb


44 BB16 Streptomyces 1 BM P

44 BB47a/ BB47b Streptomyces 2 ACd

44 BB50a/ BB51a Streptomyces 2 BM

44 BB11a Streptomyces 1 ACd TMVPRA TMVPRA

44 BB84 Streptomyces 1 ACd TMVPRA TMVPRA T

45 BB12a Streptomyces 1 ACd TMVPRA TMVPRA

46 BB72a Arthrobacter 3 ACd

47 BB59/ BB70 Arthrobacter 3 R2Ad

48 BB77 Arthrobacter 3 BM

49 BB25/ BB30 Microbacterium 1/2 R2Ad

aSpecimen. bStrains tested: Bs, B. subtilis; Sl, S. lentus; Ec, E. coli; Pf, P. fluorescens; Cg, C. glabrata. Media used: T, TSB; M, MB; V, VNSS; P, PSA; R, R2A; A, AC,n.t.: not tested.

Int.

Mic

robi

ol.Fig. 1. Similarity dendrograms of shared phylotypes within the three

Membranipora membranacea specimens (A), the four isolation media (B),as well as the antimicrobial activities expressed by the isolates on differentmedia (C).

23INT. MICROBIOL. Vol.15, 2012BACTERIA FROM THE BRYOZOAN M. MEMBRANACEA

Table 2. Phylogenetic affiliation (RDP) and nearest type strains (BLAST)

Phylotype Representative No. of isolates Affiliation Nearest type strain Similarity (%) Accession no.

1 BB49 1 Erwinia Erwinia tasmaniensisCitrobacter gilleni

9797

AM055716AF025367

2 BB66a 8 Pseudoalteromonas Pseudoalteromonas aliena 99 AY387858

3 BB8 1 Vibrio Vibrio tasmaniensis 98 AJ316192

4 BB86 1 Shewanella Shewanella kaireitica 98 AB094598

5 BB66b 4 Halomonas Halomonas titanicae 99 FN433898

6 BB65 4 Halomonas Halomonas boliviensis 99 AY245449

7 BB9 1 Halomonas Halomonas boliviensis 99 AY245449

8 BB82b 3 Halomonas Halomonas boliviensis 99 AY245449

9 BB15 1 Marinobacter Marinobacter algicola 99 AY258110

10 BB13 5 Psychrobacter Psychrobacter piscatorii 99 AB453700

11 BB44 1 Microbulbifer Microbulbifer thermotolerans 99 AB124836

12 BB34 3 Microbulbifer Microbulbifer epialgicus 98 AB266054

13 BB31 1 Alcanivorax Alcanivorax venustensis 99 AF328762

14 BB82a 4 Pseudomonas Pseudomonas perfectomarina 100 U65012

15 BB78 2 Pseudomonas Pseudomonas chloritidismutans 99 AY017341

16 BB43 1 Roseobacter Leisingera nanhaiensisSeohicola saemankumensis

9796

FJ232451EU221274

17 BB22 1 Roseovarius Roseovarius aestuarii 97 EU156066

18 BB19 1 Roseovarius Roseovarius aestuarii 99 EU156066

19 BB50b 1 Ruegeria Ruegeria scottomollicae 96 AM905330

20 BB40 1 Ruegeria Ruegeria scottomollicae 98 AM905330

21 BB2 3 Ruegeria Ruegeria atlantica 96 D88526

22 BB33 1 Ruegeria Ruegeria atlantica 99 D88526

23 BB23 1 Jannaschia Jannaschia pohangensis 97 DQ643999

24 BB51b 1 Paracoccus Paracoccus homiensis 97 DQ342239

25 BB54 1 Anderseniella Anderseniella baltica 97 AM712634

26 BB18 1 Amorphus Amorphus coralli 95 DQ097300

27 BB32 1 Erythrobacter Erythrobacter longus 97 AF465835

28 BB17 1 Erythrobacter Erythrobacter aquimaris 98 AY461441

29 BB1 3 Sphingopyxis Sphingopyxis litoris 98 DQ781321

30 BB24 2 Sphingopyxis Sphingopyxis litoris 98 DQ781321

31 BB21 1 Pelagibius Pelagibius litoralis 92 DQ401091

32 BB58b 4 Staphylococcus Staphylococcus epidermidis 99 D83363

33 BB41 1 Bacillus Bacillus hwajinpoensis 98 AF541966



Exiguobacterium related isolates originated predominantlyfrom agar plates inoculated with a bryozoan piece, while thoseof Staphylococcus derived from the dilution series (Table 1).

Actinobacteria. The 11 phylotypes (23 isolates) affiliatedwith this class [45] were assigned to the genera Myco-bacterium (4 phylotypes), Streptomyces (2 phylotypes), Ar-

throbacter (3 phylotypes), Pseudonocardia, and Micro-bacterium (Fig. 3C; Table 2). The majority of the isolates wasobtained from ACd medium (52.2 %, 6 phylotypes). Isolatesaffiliated with Streptomyces and Arthrobacter originatedfrom media inoculated with a piece of the bryozoan speci-mens, while all others were obtained from dilution series(Table 1). Isolates belonging to Mycobacterium (phylotype

HEINDL ET AL.

Table 2. (Continued) Phylogenetic affiliation (RDP) and nearest type strains (BLAST)

Phylotype Representative No. of isolates Affiliation Nearest type strain Similarity (%) Accession no.

34 BB50c 2 Bacillus Bacillus hwajinpoensis 99 AF541966

35 BB42 1 Bacillus Bacillus stratosphericus 99 AJ831841

36 BB52 1 Bacillus Bacillus licheniformis 99 CP000002

37 BB61 1 Bacillus Bacillus cereus 99 AE016877

38 BB76 2 Exiguobacterium Exiguobacterium oxidotolerans 99 AB105164

39 BB64 5 Mycobacterium Mycobacterium frederiksbergense 99 AJ276274

40 BB35 1 Mycobacterium Mycobacterium aurum 99 X55595

41 BB37 1 Mycobacterium Mycobacterium aurum 98 X55595

42 BB38 1 Mycobacterium Mycobacterium komossense 97 X55591

43 BB63 1 Pseudonocardia Pseudonocardia carboxydivorans 99 EF114314

44 BB51a 7 Streptomyces Streptomyces griseorubens 99 AB184139

45 BB12a 1 Streptomyces Streptomyces praecox 99 AB184293

46 BB72a 1 Arthrobacter Arthrobacter parietis 99 AJ639830

47 BB70 2 Arthrobacter Arthrobacter tumbae 97 AJ315069

48 BB77 1 Arthrobacter Arthrobacter agilis 98 X80748

49 BB25 2 Microbacterium Microbacterium schleiferi 99 Y17237

Fig. 2. Relative abundance of isolatesfrom three Membranipora membra-nacea specimens affiliated with the fourbacterial classes observed in this study. In

t. M

icro

biol

.


42) and Arthrobacter (phylotype 47) might represent newspecies (Table 2).

Antibiotic activity. Antibiotic activity against at least oneindicator strain was shown by 47 out of 93 tested bacteria. Thevast majority of the tested isolates inhibited growth of gram-positive test strains (45.2 % B. subtilis, 10.8% S. lentus, 7.5 %both), while only a minor part (5.4 %) was active againstgram-negative indicator bacteria (1.1 % E. coli, 4.3% P. flu-

orescens) or against the yeast C. glabrata (1.1 %). Three iso-lates were not analyzed due to insufficient growth on the testmedia (Table 1).

Activity profiles on different media. The mediaused for the antibiotic tests had a clear influence on the pat-tern of antibiotic activities. Antibiotic activities were ana-lyzed on six different media (TSB, MB, VNSS, PSA, R2A,and AC medium). 21 isolates each displayed activity on R2A


Int.

Mic

robi

ol.


Fig. 3. Maximum-likelihood tree constructed from 16S rRNA gene sequences showing the phylogenetic relationships of isolates from this study with close-ly related species and some other selected representatives of the Gammaproteobacteria (A), the Alphaproteobacteria (B) and gram-positive bacteria (C). Non-parametric bootstrapping analysis (100 datasets) was conducted. Values ≥ 50 are shown. The scale bar indicates the number of substitutions per nucleotideposition. The total number of represented sequences is given in square brackets.


and MB media, followed by TSB (20 isolates), AC (19 iso-lates), PSA (18 isolates), and VNSS (15 isolates). The major-ity (63.8 % of active isolates) inhibited growth of indicator

strains on a single medium or on two media. Only six isolates(12.8 % of active isolates) showed antibacterial activities onfive or all six media (Table 1). A corresponding cluster analy-

HEINDL ET AL.

Int.

Mic

robi

ol.


Fig. 3. (Continued) Maximum-likelihood tree constructed from 16S rRNA gene sequences showing the phylogenetic relationships of isolates from this studywith closely related species and some other selected representatives of the Gammaproteobacteria (A), the Alphaproteobacteria (B) and gram-positive bacte-ria (C). Non-parametric bootstrapping analysis (100 datasets) was conducted. Values ≥ 50 are shown. The scale bar indicates the number of substitutions pernucleotide position. The total number of represented sequences is given in square brackets.


sis revealed similar activity patterns on R2A and AC as wellas on MB and VNSS media, whereas patterns on TSB andPSA media were clearly different from those on the othermedia (Fig. 1C).

Activity profiles according to phylogeneticaffiliation. While the Gammaproteobacteria were mainlyactive on TSB and MB media, most of the Alphapro-teobacteria were active on R2A and AC media, and most ofthe Bacilli and Actinobacteria were active on PSA and TSB

plates. The number of isolates active on the different mediaand their affiliation with the four bacterial classes are shownin Fig. 4.

Gammaproteobacteria. Almost 50 % of the Gamma-proteobacteria (19 of 39 tested strains) displayed antimicrobialproperties. Antibiosis was mostly directed against B. subtilis(78.9 % of active isolates), followed by S. lentus (15.8 %) andP. fluorescens (10.5 %). Antibiotically active isolates were affil-iated with Erwinia (phylotype 1), Shewanella (phylotype 4),


Fig. 3. (Continued) Maximum-likelihood tree constructed from 16S rRNA gene sequences showing the phylogenetic relationships of isolates from this studywith closely related species and some other selected representatives of the Gammaproteobacteria (A), the Alphaproteobacteria (B) and gram-positive bacte-ria (C). Non-parametric bootstrapping analysis (100 datasets) was conducted. Values ≥ 50 are shown. The scale bar indicates the number of substitutions pernucleotide position. The total number of represented sequences is given in square brackets.

Int.

Mic

robi

ol.


Marinobacter (phylotype 9), Pseudoalteromonas (phylotype 2;7 out of 8 isolates), Halomonas (phylotype 5; 3 of 4), Psychro-bacter (phylotype 10; 1 of 5), Microbulbifer (phylotypes 11 and12; all isolates), and Pseudomonas (phylotype 14; 1 of 4). AllMicrobulbifer affiliated isolates were active on R2A medium,while most Pseudoalteromonas isolates displayed activity onMB agar plates. Whereas activity against B. subtilis was shownby almost all active strains, bacteria of phylotype 5 (assigned toHalomonas) were active against S. lentus and P. fluorescensinstead. Only single isolates, Microbulbifer sp. BB44 (phylo-type 11) on AC medium and Pseudoalteromonas sp BB67(phylotype 2) on TSB medium, were active against E. coli or C.glabrata, respectively. No activity was exhibited by phylotypes3 (Vibrio), 6, 7, 8 (all Halomonas), and 15 (Pseudomonas).

Alphaproteobacteria. Among the Alphaproteobacteria, > 75 %(16 out of 21 strains) were antimicrobially active. Activity wasdirected exclusively against B. subtilis. Active isolates were mem-bers of Roseobacter (phylotype 16), Roseovarius (phylotypes 17and 18), Ruegeria (phylotypes 19 to 22), Paracoccus (phylotype

25), Erythrobacter (phylotype 28; 1 of 2 isolates), Sphingopyxis(phylotype 29; 1 of 3 isolates; and phylotype 30), and Pelagibius(phylotype 31). Most of the active strains (68.8 %) showed antimi-crobial activities on R2Amedium, followed by AC (50.0 %) medi-um. Especially isolates of the Roseobacter-clade, which was rep-resented by phylotypes 16 to 23, displayed activity (90 % of theseisolates) preferentially on R2A medium (88.9 % of the active iso-lates). The Jannaschia-related strain BB23 (phylotype 23) was theonly non-active member of the Roseobacter-clade. In addition,strains of phylotypes 26 (Amorphus) and 27 (Erythrobacter) dis-played no activity, nor did two strains of phylotype 29(Sphingopyxis).

Bacilli. Antibiotic activity of isolates related to Bacilli wasdirected against B. subtilis (7 strains) or both B. subtilis andS. lentus (3 strains, all Bacillus, phylotypes 34, 35, and 36).One of these isolates (BB42, phylotype 35) additionallyshowed activity against P. fluorescens and also expressedantimicrobial activities on all media. All Exiguobacteriumaffiliated strains (phylotype 38) were active against B. sub-

HEINDL ET AL.

Int.

Mic

robi

ol.

Fig. 4. Number of bioactive isolates on different growth media, (A) absolute counts, (B) percentage of active isolates within each bac-terial class.


tilis. One representative each of phylotypes 32 (Staphylo-coccus) and 34 (Bacillus) as well as phylotype 33 (Bacillus)did not impede the growth of any indicator strain.

Actinobacteria. Only five out of 23 Actinobacteria relat-ed isolates inhibited the growth of indicator strains. Fourstrains each were active against B. subtilis and S. lentus.Three of them (phylotypes 44 and 45, both Streptomyces)were active against both gram-positive test strains on all sixmedia. Isolate BB84 (phylotype 44) was additionally activeagainst P. fluorescens. The Mycobacterium-related strain ofphylotype 41 showed anti-S. lentus activity. No antibioticactive representatives were found in phylotypes 39, 40, and42 (all Mycobacterium), 43 (Pseudonocardia), 46 to 48 (allArthrobacter), and 49 (Microbacterium).

Discussion

Phylogenetic affiliation of isolates. A phylogenet-ically diverse collection of isolates was obtained during thisstudy from three specimens of Membranipora membranaceausing different isolation media. Each medium featured arather unique set of isolated phylotypes. This resulted in ahighly diverse array of 96 isolates assigned to 49 phylotypesand 29 genera. Only one-third of the members of these gen-era had been isolated previously from comparable sources.Three of these genera (Shewanella, Pseudoalteromonas, andPseudomonas) were isolated in all three comparable studieson bryozoans from the North Sea and the Baltic Sea, as wellas from Baltic Sea S. latissima samples [16,36,47]. Othergenera (Bacillus, Arthrobacter, Vibrio, Psychrobacter,Ruegeria, Staphylococcus, Streptomyces) were also found,but not consistently, in all three studies.

The use of four different isolation media was undoubtedlyan important factor in our success in obtaining such a diversecollection of bacteria. The high number of phylotypes thatwere exclusively found on one medium (75.5 %) and theresulting large differences in the phylotypes obtained from thedifferent media (Fig. 1B) resulted in a “unique” set of isolatesobtained from each medium. This observation correlates withthe fact that different bacteria differ in their needs on nutri-ents, growth factors, salt composition, trace elements, etc.,which cannot be covered by a single medium. Nonetheless,clear media preferences could not be narrowed down to a spe-cific group of phylotypes or genera, as all media yielded phy-logenetically diverse isolates. However, a certain bias of ACdmedium towards the isolation of Gammaproteobacteria and

Actinobacteria, as well as of R2Ad medium towards Alpha-proteobacteria and Bacilli was noted.

Note that fewer isolates were obtained from media thatcontained algal or bryozoan extract (BM and AM media),approximately one third of the isolates that grew on the othermedia (R2Ad and ACd). This may be related to the com-pounds that originate from bryozoans or algae, which mightbe involved in the chemical defense mechanisms of thesesessile organisms [13,34] and, as such, inhibit bacterialgrowth. In particular, marine algae are known as producers ofa variety of active metabolites that prevent biofouling of theirown surfaces [1]. Some of these natural products may be sta-ble enough to express growth inhibiting properties even afterautoclaving or long-term storage. Unsaturated fatty acidshave been identified as antibacterial active agents frombrown algae with activities especially directed against gram-positive bacteria, and they maintain their antibiotic propertieseven if stored at room temperature for several years [40].This fact correlates well with our finding that the fewest iso-lates were obtained from “algal extract medium” (AM) andthat no gram-positive bacteria were obtained from this medi-um. Thus, detrimental effects of inhibitory compounds in thismedium might have outbalanced the usually beneficialimpact of habitat water demonstrated in previous studies[12,29].

As attempts to isolate bacteria from bryozoans are stillvery scarce compared to other marine sources, bryozoans pro-vide a good source for the search for new bacteria and newantibiotic compounds. Validly described type strains that wereoriginally isolated from bryozoans include Tenacibaculumadriaticum (Flavobacteria), Marinobacter bryozoorum (Gam-maproteobacteria), and Paracoccus seriniphilus (Alphapro-teobacteria) [17,37,39]. Single isolates of the latter two gen-era were also obtained in the present study. Quite significantwas the finding that 15 out of 49 phylotypes of this study rep-resented new species (some even new genera), applying thephylogenetic relationship according to Stackebrandt andEbers [44]. Most significant was the high number ofAlphaproteobacteria with 16S rRNA gene sequence similari-ties of or below 97 % to known species. Moreover, half of thephylotypes (16 to 23) of Alphaproteobacteria isolated in thisstudy were affiliated with members of the Roseobacter line-age, which represents typical marine bacteria [6] and is abun-dant in bacterial communities associated, e.g., with algalblooms, biofilms, and cephalopods.

Note that the three bryozoan specimens yielded a similaramount of exclusive phylotypes: 38 phylotypes (77.6 %)originated from single samples exclusively, which resulted



in clear differences between the samples (Fig. 1A). Similarto the influence of the isolation media, this resulted in“unique” collections of bacteria obtained from each speci-men. A previous cultivation-based study on the microbialdiversity with samples of the North Sea bryozoan Flustrafoliacea yielded similar results: although a great array of dif-ferent isolation media was used and the same procedureswere applied to all specimens, such that the distribution ofbacterial taxons was highly divergent. Indeed, not a singlegenus could be found on all three samples [36]. Another cul-ture-independent study on bacterial communities of bry-ozoans in the North Sea demonstrated species-specific asso-ciations for three of the four bryozoan species (Aspidelectramelolontha, Electra monostachys, and E. pilosa). In con-trast, a site-dependent influence was observed in Conopeumreticulum specimens [20].

Antimicrobial activity. A large proportion, almost50%, of the bacteria isolated from Membranipora mem-branacea revealed antibiotic activity, predominately againstgram-positive test strains. This result is similar to thoseobtained in our previous study on the antibiotic activities ofbryozoan-associated bacteria with the same indicator organ-isms [16]. However, isolates from the present work, with afew exceptions (Vibrio, Shewanella, Pseudoalteromonas,Pseudomonas), were affiliated with different genera andincluded also gram-positive representatives. Activity againstthe gram-positive bacteria Bacillus subtilis and Staphylo-coccus lentus could be advantageous on surfaces in situ, asmembers of both genera were also isolated from the bryo-zoan specimens.

The pattern of antibiotic activities was quite variable andstrain-specific, phylotype-specific as well as genus-specificactivity patterns were observed. All isolates of the generaMicrobulbifer, Roseovarius, Ruegeria, and Exiguobacteriumshowed consistent genus-specific activity profiles. Moreover,this antibiosis was expressed on the same media, each withsingle exceptions of Ruegeria-affiliated strains (Table 1). Incontrast, only some of the isolates related to Pseudoal-teromonas, Psychrobacter, Pseudomonas, Sphingopyxis,Bacillus, Staphylococcus, or Streptomyces inhibited targetorganisms in a strain-specific pattern.

Note that strain-specific activities will more likely bedetected if larger subsets of isolates of the considered groupare included, such as those related to Pseudoalteromonas andStreptomyces in this study [25,26]. In addition, growth condi-tions and media are important factors for the production of

bioactive compounds and should be considered in all studieson antibiosis and antibiotic activity of microorganisms. Inthis study, the influence of test media on antibiotic traitsreflected this dependency of the bacterial isolates on a “suit-able” environment. Most activities were expressed on one ortwo media only (63.8 %), whereas a minor fraction of the iso-lates produced growth inhibitory compounds on all or fivemedia (12.8 %).

The activation of secondary metabolite pathways, whichremain silent under standard laboratory conditions, is a feasi-ble way to access new natural products in microorganisms[4,33]. Five isolates related to Sphingopyxis expressed activ-ities against B. subtilis in different media or did not showactivity on any of those used (Table 1). Altogether, the use ofsix different media resulted in a twofold increase in the dis-covery of antibiotic active bacteria compared to the resultsobtained with a single medium.

Microorganisms belong to the prominent producers of nat-ural products in the marine environment. Among the beststudied genera in terms of published metabolites areStreptomyces, Alteromonas, Bacillus, Vibrio, Pseudomonas,Actinomyces, and Pseudoalteromonas, all of which were alsoisolated from M. membranacea in this work. Other generafound in this study, such as Microbacterium, Marinobacter,Halomonas, Ruegeria, and Erythrobacter, have also con-tributed to published marine natural products but to a lesserextent [23]. However, only some of these compounds havebeen reported as antimicrobially active. For example, in thecase of Pseudoalteromonas and Pseudomonas some second-ary metabolites display antibiotic properties [3,18]. Sponge-and ascidian-associated Microbulbifer strains produce varia-tions of parabens [32,38]. As far as Alphaproteobacteria areconcerned, only a few members of this class are known toproduce antimicrobial metabolites. Among them are represen-tatives of the Roseobacter clade, producing thiotropocin andits precursor tropodithietic acid [5,7,8]. Finally, well-docu-mented producers of antimicrobially active compounds, suchas Streptomyces strains, can be a source of novel compounds,although only few of the Actinobacteria isolated in this studywere antibiotically active.

Recently, the production of the antibacterial compoundmayamycin by a marine Streptomyces related strain reportedto be induced by variation of culture conditions [41], whichfurther supports the requirement for varying the culture con-ditions to find new antibiotic compounds. Novel species orknown taxa of this work with as yet unknown antimicrobialproperties, such as members of the genera Roseobacter,

HEINDL ET AL.


Roseovarius, Ruegeria, Paracoccus, Anderseniella, Erythr-obacter, Sphingopyxis and Pelagibius, are candidates to bestudied more intensively with regard to the production of newantimicrobial compounds.

Acknowledgements. This study was supported by the Ministry ofScience, Economic Affairs and Transport of the State of Schleswig-Holstein(Germany) within the framework of the “Future Program of Economy,”which is co-financed by EFRE.


References

1. Bhadury P, Wright PC (2004) Exploitation of marine algae: biogeniccompounds for potential antifouling applications. Planta 219:561-578

2. Blunt JW, Copp BR, Munro MH, Northcote PT, Prinsep MR (2010)Marine natural products. Nat Prod Rep 27:165-237

3. Bowman JP (2007) Bioactive compound synthetic capacity and eco-logical significance of marine bacterial genus Pseudoalteromonas.Mar Drugs 5:220-241

4. Brakhage AA, Schroeckh V (2010) Fungal secondary metabolites.Strategies to activate silent gene clusters. Fungal Genet Biol 48:15-22

5. Brinkhoff T, Giebel H, Simon M (2008) Diversity, ecology, andgenomics of the Roseobacter clade: a short overview. Arch Microbiol189:531-539

6. Brinkhoff T, Bach G, Heidorn T, Liang L, Schlingloff A, Simon M(2004) Antibiotic production by a Roseobacter clade-affiliated speciesfrom the German Wadden Sea and its antagonistic effects on indige-nous isolates. Appl Environ Microbiol 70:2560-2565

7. Bruhn JB, Nielsen KF, Hjelm M, Hansen M, Bresciani J, Schulz S,Gram L (2005) Ecology, inhibitory activity, and morphogenesis of amarine antagonistic bacterium belonging to the Roseobacter clade.Appl Environ Microbiol 71:7263-7270

8. Bruhn JB, Gram L, Belas R (2007) Production of antibacterial com-pounds and biofilm formation by Roseobacter species are influencedby culture conditions. Appl Environ Microbiol 73:442-450

9. Davidson SK, Allen SW, Lim GE, Anderson CM, Haygood MG(2001) Evidence for the biosynthesis of bryostatins by the bacterialsymbiont “Candidatus Endobugula sertula” of the bryozoan Bugulaneritina. Appl Environ Microbiol 67:4531-4537

10. de Carvalho CCCR, Fernandes P (2010) Production of metabolites asbacterial responses to the marine environment. Mar Drugs 8:705-727

11. Egan S, Thomas T, Kjelleberg S (2008) Unlocking the diversity andbiotechnological potential of marine surface associated microbialcommunities. Curr Opin Microbiol 11:219-225

12. Eguchi M (1999) The nonculturable state of marine bacteria. In: BellCR, Brylinsky M, Johnson-Green P (eds) Microbial biosystems: NewFrontiers. Proceedings of the 8th International Symposium onMicrobial Ecology. Atlantic Canada Society for Microbial Ecology,Halifax, Canada, pp 8-13

13. Gerdes G, Kahle J, Wieking G, Liebezeit G, Scholz J (2005) Bryozoenkontrollieren ihre Biofilme: “Gepflegte” Mikrogärten auf belebterOberfläche. Biol Unserer Zeit 35:250-259 (In German)

14. Gerdes G, Kadagies N, Kaselowsky J, Lauer A, Scholz J (2005)Bryozoans and microbial communities of cool-temperate to subtropi-cal latitudes–paleoecological implications. II. Diversity of microbialfouling on laminar shallow marine bryozoans of Japan and NewZealand. Facies 50:363-389

15. Hammer Ø, Harper DAT, Ryan PD (2001) PAST: paleontological sta-tistics software package for education and data analysis. PalaeontolElectron 4:9

16. Heindl H, Wiese J, Thiel V, Imhoff JF (2010) Phylogenetic diversityand antimicrobial activities of bryozoan-associated bacteria isolatedfrom Mediterranean and Baltic Sea habitats. Syst Appl Microbiol33:94-104

17. Heindl H, Wiese J, Imhoff JF (2008) Tenacibaculum adriaticum sp.nov., from a bryozoan in the Adriatic Sea. Int J Syst Evol Microbiol58:542-547

18. Isnansetyo A, Kamei Y (2009) Bioactive substances produced bymarine isolates of Pseudomonas. J Ind Microbiol Biotechnol36:1239-1248

19. Kalinovskaya NI, Ivanova EP, Alexeeva YV, Gorshkova NM,Kuznetsova TA, Dmitrenok AS, Nicolau DV (2004) Low-molecular-weight, biologically active compounds from marine Pseudo-alteromonas species. Curr Microbiol 48:441-446

20. Kittelmann S, Harder T (2005) Species- and site-specific bacterialcommunities associated with four encrusting bryozoans from theNorth Sea, Germany. J Exp Mar Biol Ecol 327:201-209

21. König GM, Wright AD (1996) Marine natural products research: cur-rent directions and future potential. Planta Med 62:193-211

22. König GM, Kehraus S, Seibert SF, Abdel-Lateff A, Müller D (2006)Natural products from marine organisms and their associatedmicrobes. Chembiochem 7:229-238

23. Laatsch H (2006) Marine bacterial metabolites. In: Proksch P, MüllerW (eds) Frontiers in marine biotechnology. Horizon Bioscience,Norfolk, pp 225-288

24. Lane CE, Mayes C, Druehl LD, Saunders GW (2006) A multi-genemolecular investigation of the kelp (Laminarales, Phaeophyceae) sup-ports substantial taxonomic re-organization. J Phycol 42:493-512

25. Lo Giudice A, Brilli M, Bruni V, De Domenico M, Fani R, Michaud L(2007) Bacterium-bacterium inhibitory interactions among psy-chrotrophic bacteria isolated from Antarctic seawater (Terra NovaBay, Ross Sea). FEMS Microbiol Ecol 60:383-396

26. Lo Giudice A, Bruni V, Michaud L (2007) Characterization ofAntarctic psychrotrophic bacteria with antibacterial activities againstterrestrial microorganisms. J Basic Microb 47:496-505

27. Ludwig W, Schleifer KH, Whitman WB (2009) Class I. Bacilli class. nov.In: De Vos P, Garrity GM, Jones D, Krieg NR, Ludwig W, Rainey FA,Schleifer KH, Whitman WB (eds), Bergey’s manual of systematic bacte-riology, 2nd ed, vol.3 (The Firmicutes). Springer, New York, pp 19-20

28. Mårdén P, Tunlid A, Malmcrona-Friberg K, Odham G, Kjelleberg S(1985) Physiological and morphological changes during short termstarvation of marine bacterial isolates. Arch Microbiol 142:326-332

29. Muscholl-Silberhorn A, Thiel V, Imhoff JF (2008) Abundance andbioactivity of cultured sponge-associated bacteria from the Medi-terranean Sea. Microb Ecol 55:94-106

30. Palinska KA, Scholz J, Sterflinger K, Gerdes G, Bone Y (1999)Microbial mats associated with bryozoans (Coorong Lagoon, SouthAustralia). Facies 49:25-28

31. Penesyan A, Kjelleberg S, Egan S (2010) Development of noveldrugs from marine surface associated microorganisms. Mar Drugs8:438-459



32. Peng X, Adachi K, Chen C, Kasai H, Kanoh K, Shizuri Y, Misawa N(2006) Discovery of a marine bacterium producing 4-hydroxyben-zoate and its alkyl esters, parabens. Appl Environ Microbiol 72:5556-5561

33. Peric-Concha N, Long PF (2003) Mining the microbial metabolome: anew frontier for natural product lead discovery. Drug Discov Today8:1078-1084

34. Peters L, König GM, Wright AD, Pukall R, Stackebrandt E, Eberl L,Riedel L (2003) Secondary metabolites of Flustra foliacea and theirinfluence on bacteria. Appl Environ Microbiol 69:3469-3475

35. Pettit GR, Herald CL, Doubek DL, Herald DL, Arnold E, Clardy J(1982) Isolation and structure of bryostatin 1. J Am Chem Soc104:6846-6848

36. Pukall R, Kramer I, Rohde M, Stackebrandt E (2001) Microbial diver-sity of cultivatable bacteria associated with the North Sea bryozoanFlustra foliacea. Syst Appl Microbiol 24:623-633

37. Pukall R, Laroche M, Kroppenstedt RM, Schumann P, Stackebrandt E,Ulber R (2003) Paracoccus seriniphilus sp. nov., an L-serine-dehy-dratase-producing coccus isolated from the marine bryozoan Bugulaplumosa. Int J Syst Evol Microbiol 53:443-447

38. Quévrain E, Domart-Coulon I, Pernice M, Bourguet-Kondracki M(2009) Novel natural parabens produced by a Microbulbifer bacteriumin its calcareous sponge host Leuconia nivea. Environ Microbiol11:1527-1539

39. Romanenko LA, Schumann P, Rohde M, Zhukova NV, Mikhailov VV,Stackebrandt E (2005) Marinobacter bryozoorum sp. nov. andMarinobacter sediminum sp. nov., novel bacteria from the marineenvironment. Int J Syst Evol Microbiol 55:143-148

40. Rosell KG, Srivastava LM (1987) Fatty acids as antimicrobial sub-stances in brown algae. Hydrobiologia 151/152:471-475

41. Schneemann I, Kajahn I, Ohlendorf B, Zinecker H, Erhard A, NagelK, Wiese J, Imhoff JF (2010) Mayamycin, a cytotoxic polyketide froma Streptomyces strain isolated from the marine sponge Halichondriapanicea. J Nat Prod 73:1309-1312

42. Schwaninger HR (2008) Global mitochondrial DNA phylogeographyand biogeographic history of the antitropically and longitudinally dis-junct marine bryozoan Membranipora membranacea L. (Cheilos-tomata): another cryptic marine sibling species complex? MolPhylogenet Evol 49:893-908

43. Sharp JH, Winson MK, Porter JS (2007) Bryozoan metabolites: anecological perspective. Nat Prod Rep 24:659-673

44. Stackebrandt E, Ebers J (2006) Taxonomic parameters revisited: tar-nished gold standards. Microbiol Today 8:152-155

45. Stackebrandt E, Rainey FA, Ward-Rainey NL (1997) Proposal for anew hierarchic classification system, Actinobacteria classis nov. Int JSyst Bacteriol 47:479-491

47. Wiese J, Thiel V, Nagel K, Staufenberger T, Imhoff JF (2009)Diversity of antibiotic-active bacteria associated with the brownalga Laminaria saccharina from the Baltic Sea. Mar Biotechnol11:287-300

48. Woollacott RM (1981) Association of bacteria with bryozoan larvae.Mar Biol 65:155-158

49. Newman DJ, Cragg GM (2007) Natural products as sources of newdrugs over the last 25 years. J Nat Prod 70:461-477

HEINDL ET AL.

RESEARCH ARTICLE

Summary. Methanogens have been reported in complex microbial communities from hypersaline environments, but littleis known about their phylogenetic diversity. In this work, methane concentrations in environmental gas samples were deter-mined while methane production rates were measured in microcosm experiments with competitive and non-competitive sub-strates. In addition, the phylogenetic diversity of methanogens in microbial mats from two geographical locations was ana-lyzed: the well studied Guerrero Negro hypersaline ecosystem, and a site not previously investigated, namely Laguna SanIgnacio, Baja California Sur, Mexico. Methanogenesis in these microbial mats was suspected based on the detection ofmethane (in the range of 0.00086 to 3.204 %) in environmental gas samples. Microcosm experiments confirmed methane pro-duction by the mats and demonstrated that it was promoted only by non-competitive substrates (trimethylamine andmethanol), suggesting that methylotrophy is the main characteristic process by which these hypersaline microbial mats pro-duce methane. Phylogenetic analysis of amino acid sequences of the methyl coenzyme-M reductase (mcrA) gene from natu-ral and manipulated samples revealed various methylotrophic methanogens belonging exclusively to the familyMethanosarcinaceae. Moderately halophilic microorganisms of the genus Methanohalophilus were predominant (>60 % ofmcrA sequences retrieved). Slightly halophilic and marine microorganisms of the genera Methanococcoides andMethanolobus, respectively, were also identified, but in lower abundances. [Int Microbiol 2012; 15(1):33-41]

Keywords: Methanosarcinaceae · hypersaline environments · microbial mats · trimethylamine · gene mcrA

Introduction

Methane-producing anaerobes (methanogens) were firstidentified by Woese and Fox in 1977 [45] as being phyloge-

netically distinct from all other cell types, and they are thefounding members of the Archaea Domain [11].Methanobacteria comprise a large and diverse Class whosemembers are the main constituents of the KingdomEuryarchaeota [46]. The five Orders recognized thus far(Methanobacteriales, Methanococcales, Methanomicro-biales, Methanosarcinales, and Methanopyrales) have dis-tinctive characteristics [11,24,44]; a novel Order ofmethanogens, Methanocellales, was proposed recently and iscurrently represented by a single strain [23,36]. Metha-


*Corresponding author: A. López-CortésCentro de Investigaciones Biológicas del Noroeste (CIBNOR)Mar Bermejo 195, Colonia Playa Palo de Santa RitaLa Paz, B.C.S. 23096, MéxicoTel. +52-6121238484. Fax +52-6121253625E-mail: [email protected]

José Q. García-Maldonado,1 Brad M. Bebout,2 Lourdes B. Celis,3Alejandro López-Cortés1*

1Laboratory of Molecular Microbial Ecology, Northwestern Center for Biological Research (CIBNOR), La Paz, Mexico.2Exobiology Branch, Ames Research Center, National Aeronautics and Space Administration, Moffett Field, CA, USA.

3Applied Geosciences Division, Scientific and Technological Research Institute of San Luis Potosi (IPICYT), San Luis Potosi, Mexico


Phylogenetic diversity of methyl-coenzyme Mreductase (mcrA) gene and methanogenesis

from trimethylamine in hypersaline environments


nogenic archaea are vital for the anaerobic microbial degra-dation of organic waste; the resultant production of methane,a potent greenhouse gas, is valuable as a non-fossil fuel [29].

Methanogenic archaea obtain energy for growth by theoxidation of a limited number of substrates, with the con-comitant production of methane gas. In freshwater aquaticenvironments, methanogens are quantitatively extremelyimportant terminal oxidizers of organic matter. In marine andhypersaline environments, characterized by the presence ofhigh concentrations of sulfate, sulfate-reducing bacteria, notmethanogenic archaea, are the primary mediators of terminalanaerobic mineralization. Sulfate reducers [6] utilizing sul-fate as terminal electron acceptor outcompete methanogensfor CO2/H2, formate, and acetate. A limited number of othercompounds such as methanol, monomethylamine (MMA),dimethylamine (DMA), trimethylamine (TMA), anddimethylsulfide, and some alcohols, such as isopropanol,isobutanol, cyclopentanol, and ethanol, are also substrates forsome methanogens [44]. Of these, MMA, DMA, TMA anddimethylsulfide are unavailable to sulfate reducers, and soare referred to as “non-competitive substrates.” The relativelack of information on methanogens from hypersaline envi-ronments may stem, in part, from a belief that significantrates of methane production are unlikely to occur when sul-fate concentrations exceed many tens of millimoles per liter(> 30 mM), as is commonly found in the brine of these envi-ronments [15].

Although sulfate-reducing organisms dominate anaerobiccarbon consumption in marine microbial mats, methanogenspersist and their activities vary both vertically and temporal-ly in the mat system in response to non-competitive sub-strates such as TMA [32]. All methanogens that have beenisolated to date from hypersaline environments use TMA asa catabolic substrate [44], and all the TMA-degradingmethanogens from marine and hypersaline environmentsbelong to the family Methanosarcinaceae.

Culture-dependent and culture-independent techniquestargeting 16S rRNA and methyl coenzyme M reductase(mcrA) genes have been used to assess the phylogeneticdiversity of methanogen assemblages [20,28,29,41].Methane production has been studied most extensively inmicrobial mats from the salterns of Exportadora de Sal inBaja California Sur, Mexico. Incubation of the surface layersof microbial mats obtained near the photic zone predomi-nantly yield Methanolobus spp., while Methanococcoideshas been preferentially recovered from incubations of uncon-solidated sediments underlying the mat. Methanohalophilussequences in low abundances have been retrieved from sam-

ples of 20- to 60-mm depth [33]. Clone libraries from micro-bial mats maintained in field-like conditions in a long-termgreenhouse study consist exclusively of sequences related tomethylotrophic members of the genus Methanolobus.Increases in pore water methane concentrations under condi-tions of low sulfate (from 50 to 0 mM), in mats maintainedfor more than one year in that same greenhouse study, wereassociated with an increase in the abundance of putativehydrogenotrophic mcrA sequences related to Methanogenium[37].

Profoundly distinct vertical microenvironments at milli-metric and micrometric scales have been recognized inmicrobial mats [4,6,34]. Differences in microbial communitystructure have also been observed in the horizontal direction,as a result of either different adaptations to gradients of salin-ity [5,10,35,38], thereby favoring marine and halophilicmethanogens, or by the association of methanogen assem-blages with different types of minerals. These observationssuggest heterogeneity and the existence of three-dimensionalmicroniches. The study of microbial community structurefrom as yet unexamined sites could broaden our understand-ing of the composition of the microbial community.

As such, the aim of the present work was to further ourknowledge of methanogenesis in hypersaline environments.To this end, we analyzed several features of both the well-studied Guerrero Negro hypersaline ecosystem and a locationnot previously investigated, namely, Laguna San Ignacio,Baja California Sur, Mexico. The locations share a physio-graphic setting and climate [16]. Methane concentrations inenvironmental gas samples were investigated, together withthe methane production rates obtained in microcosm experi-ments using hypersaline microbial mats samples amendedwith competitive and non-competitive substrates. Finally, thephylogenetic diversity of the methanogenic community wasdetermined.


Site description and sample collection. Samples were collectedfrom two locations along the Pacific coast in the state of Baja California Sur,Mexico in March 2009. Location 1, with one site, corresponded to a concen-trating pond of Exportadora de Sal (ESSA), a solar salt works located nearGuerrero Negro (28°N, 114°W). Location 2, with two studied sites (26° 50′ N,113° 10′ W), was the evaporitic flats at Laguna San Ignacio (LSI), a naturalhypersaline ecosystem. Three types of mats were studied: (i) thick (10 mm),soft, well-laminated, green-black microbial mats found in Area 1 of ESSA(site ESSA-A1); (ii) thick (7 mm), leathery textured, pustular, non-laminat-ed, black microbial mats found at site H7 of LSI (site LSI-H7); and (iii)thick (8 mm), smooth, laminated, orange-pink microbial mats found at siteH8 of LSI (site LSI-H8). All three microbial mats were growing on top of

GARCÍA-MALDONADO ET AL.


highly sulfidic sediments. Mat cores (1 cm deep × 1 cm diameter) were col-lected and stored in liquid nitrogen for molecular analysis. Five core samples1 cm deep × 1cm of diameter (~10–20 g) from LSI sites were placed into 38-ml serum vials, and water samples were saved for further microcosm exper-iments. Larger cores (8 cm deep × 8 cm diameter) were collected and trans-ported at room temperature for subsequent measurements of sulfate contentin the sediments.

Gas bubbles were collected by perturbing the mat and sediments andtrapping the released bubbles in a capped, inverted funnel at flooded sites(ESSA-A1). From desiccated sites (LSI-H7 and LSI-H8), gas samples werecollected directly from large (2–10 cm) bubble structures overlain by araised microbial mat (sometimes called pustular mat) using a hypodermicneedle fitted to a 5-ml syringe. All bubbles were then transferred with asyringe to an evacuated serum vial for quantification of the methane concen-tration by gas chromatography.

Microcosm experiment. Ten ml of deoxygenated (N2-purged) brinefrom the site was added to the serum vials with the mat samples to make aslurry. The vials were capped with blue butyl rubber stoppers and aluminumcrimps, and the headspace was flushed with N2 to remove any O2. The slur-ries from the LSI sites were amended with TMA (15 mM), methanol (20mM), formate (20 mM), acetate (20 mM), H2/CO2 (80/20 %), and sodiummolybdate (2 mM). The sodium molybdate was added to specifically inhib-it sulfate reduction in these samples. TMA (1 mM) was tested in slurries ofESSA-A1. Samples of ESSA-A1 were incubated at room temperature (ca.25 °C) for 48 h, while LSI samples were incubated at 30 °C for 33 days. Gassamples were collected at different time points to monitor the methane con-centration in the headspace, which allowed the specific production rates pergram of mat sample (nmol g–1 day–1) to be calculated. At the end of theexperiment, vials of LSI were maintained at room temperature (25 °C) for1 year and were subsequently re-activated with specific medium for Metha-nohalophilus DSM 525, using TMA (15 mM) and methanol (20 mM) as sub-strates, with an incubation at 30 °C for one week. Vials with DSM 525medium that were previously enriched with TMA, and methanol were incu-bated again with the same substrates at the same concentration. Meanwhile,the vials used for methanogenesis inhibition were further incubated withmethanol (data not shown); these new incubations were used for furthermolecular analyses.

Methane and sulfate determinations. Gas samples collectedfrom all incubations and from environmental bubbles were used to measurethe evolved methane and methane concentrations, respectively, by gas chro-matography with a flame ionization detector (Shimadzu GC-14 A, Kyoto,Japan) equipped with a 2-m Porapak N column held at 40 °C [3]. Sulfatecontent in the sediments was analyzed by turbidimetry in an automated spec-trophotometer (QuickChem series 8000 FIAS, Lachat Instruments, Hach,Loveland, CO, USA), using Morgan solution as extractant and BaCl2 for theprecipitation [7].

DNA extraction. DNA was extracted from natural and enriched samples(PowerBiofilm DNA isolation kit 24000-50, Mo Bio Laboratories, Carlsbad,

CA, USA). Extraction was performed according to the manufacturer’s pro-tocol, starting from 0.1 g samples and with 45-s bead-beating at speed 5 forcell lysis. DNA was observed in an agarose gel.

PCR of mcrA gene. PCRs were carried out in a final volume of 25 μlcontaining 2 μl of undiluted template DNA, 1 μl of each primer (10mM), and12.5 μl of GoTaq master mix (Promega M7122, Madison, WI, USA). ThemcrA gene was amplified using the primers developed by Luton et al. [29].Amplification consisted of the following steps: 95 °C for 1 min, 35 cycles at94 °C for 30 s each, 55–54.5 °C (decreasing 0.1 °C for the first five cycles)for 30 s each, 72 °C for 1 min, and a final elongation for 5 min at 72 °C.

Denaturing gradient gel electrophoresis (DGGE). PCR prod-ucts from DNA extracted from slurries in microcosm experiment withDSM 525 medium were separated using a modification of a previously pub-lished protocol [26]. The gels were stained with ethidium bromide andarchived with a UV photograph documentor (BioDoc-It® Imaging System,GelDoc-It TS300, UVP, Upland, CA, USA). Representative bands wereexcised with a sterile scalpel and DNA was eluted in ultra clean, pure waterovernight at 4 °C. DNA was re-amplified and sequenced by a commercialservice.

Clone libraries. Fresh PCR products from natural samples from ESSA-A1 and LSI-H8 were purified with an extraction kit (QIAquick gel extrac-tion kit 28704, Qiagen, Valencia, CA, USA). One–2 μl of the purified PCRproduct was ligated into a cloning vector (pCR4-TOPO), which was thenused to chemically transform TOP10 Escherichia coli competent cellsaccording to the manufacturer’s instructions (Invitrogen, Carlsbad, CA,USA). White colonies were inoculated into 125 μl LB broth amended with8 % (v/v) glycerol and carbenicillin (100 mg/ml), then incubated overnightat 37 °C. The inserts were verified by PCR using the M13F and M13Rprimers. Positive colonies were shipped at room temperature (ca. 23 °C) toa commercial firm for sequencing (Sequetech, Mountain View, CA, USA).

Phylogenetic analysis and nucleotide sequence accessionnumbers. All sequences were quality-filtered, trimmed, translated intoprotein sequences, and aligned with a custom database of methyl-coenzymeM reductase alpha protein sequences using bioinformatics software(Geneious 5.3, Biomatters, Auckland, NZ). Inferred amino acid sequenceswere clustered at 97 % similarity using CD-HIT [22]; representativesequences were queried against the NCBI non-redundant peptide sequencedatabases [2] to identify closest protein matches for phylogenetic analysisand tree building. Taxonomic assignment of the sequences was based oncomparisons with sequences in the gene databases [1] with > 97 % similar-ity (Table 1).

Phylogenetic analyses were performed on the aligned amino acidsequences using maximum-parsimony and neighbor-joining evolutionarymodels in PAUP* version 4 (Sinauer Pub., Sunderland, MA, USA). Therobustness of inferred tree topologies was evaluated by 1000 bootstrapresamplings of the data. Two topologies from the different analyses weresimilar and the presented tree was based on a neighbor-joining analysis, with

METHANOGENESIS IN HYPERSALINE ENVIRONMENTS

Table 1. Taxonomic assignment and accession numbers of all the sequences obtained in this study

Genes Techniques Accession numbers Taxonomic assignment/number of sequences

mcrA DGGE JF836061 – JF836067 Methanolobus/5Methanococcoides/2

mcrA Clone libraries HQ131850 - HQ131869 Methanohalophilus/17Methanolobus/3


bootstrap support of branch nodes only when supported by the two models.All sequences determined in this study are available in GenBank (accessionnos. HQ131850 to HQ131869 and JF836061 to JF836067) (Table 1).


Detection and quantification of methane inenvironmental gas samples. Methane gas wasdetected from environmental samples from all field sitessampled (two evaporitic flats at Laguna San Ignacio andfrom area 1 of Exportadora de Sal at Laguna Ojo de Liebre).Methane concentrations ranged from 0.00086 to 3.204 %.Methane production has been observed in a wide variety ofhypersaline environments [32], including stratified microbialmats and endoevaporites [8,13,15,39]. Similar results werepreviously reported for soft microbial mats from hypersalineenvironments near the field sites described here (Tazaz et al.,personal communication).

Site ESSA-A1 had the highest concentrations of methaneand the lowest concentration of sulfate in sediments. In con-trast, sites LSI-H7 and LSI-H8 had the lowest concentrationsof methane and the highest concentration of sulfate (Table 2).These results are consistent with the hypothesis thatmethanogenesis is attenuated by sulfate-reducing bacteria atnon-limiting sulfate concentrations [27]. Considering thatmethanogenic archaea are abundant only in habitats whereelectron acceptors such as SO4

2– are limiting, the cell densi-ties of methanogens in the samples analyzed may have beenlow, since the concentrations of sulfate in sediments rangedfrom 4.12 to 8.36 g/kg. Nevertheless, methanogenesis is alsoconstrained by ecological interactions (both stimulatory andcompetitive) and/or physicochemical environmental factorsthat act at biochemical or bioenergetic levels. In addition tophysicochemical “extremes” (mainly temperature, salinity,and pH), other factors affect the environmental distributionof methanogens, which is constrained to a great extent byenergy availability, the environmental distributions of oxy-

gen (biochemical inhibition), and the seawater anion sulfatecontent (competitive effects that act at a bioenergetic level)[27]. More exhaustive sampling will be needed to establishwhich physicochemical factors (salinity, temperature, pH,moisture, water activity and nutrients) have the greatestinfluence on microorganism distributions in different naturalenvironments [9].

An alternative explanation for the low concentrations ofmethane, which will not be considered further here, is theaerobic and anaerobic oxidation of methane, which has beenreported in microbial mats in salt marshes [4].

Production of methane from samples incubatedwith substrates. To further explore the metabolic process-es giving rise to the methane detected at our field sites, micro-cosm incubations were conducted. Determination of the use ofsubstrates in methanogenesis is of great relevance for explain-ing trophic relationships and the level of activity in nature. Asan example, only members of the Order Methanosarcinales usemethylamines as catabolic substrates. These organisms also useH2 + CO2, while the other four Orders only containhydrogenotrophic or acetoclastic members.

Although the production of CH4 within the upper layer(0–20 mm) of hypersaline microbial mats has been previous-ly correlated with the cyanobacterial production of H2 [13],microcosm experiments with different substrates showed thatmethanogenesis was not stimulated by the addition of hydro-gen; rather, only TMA stimulated methane production insamples from ESSA-A1 and H7 and H8 of LSI (Fig. 1).These results are congruent with previous studies that haverecorded methane production in media designed to enrichmethylotrophic methanogens on TMA using sulfate-richsamples from hypersaline microbial mats in the Napoli mudvolcano [19]. Methanol additions also resulted in an increasein methane production in samples from LSI.

Substrates utilized by hydrogenotrophic and acetoclasticmethanogens (H2/CO2, formate and acetate) did not increase


Table 2. Salinity in water samples, methane concentration in environmental gas samples and sulfate concentration in sediment sam-ples from studied sites

Site Geoposition Salinity (ppt) Methane (%) Sulfate (g/kg)

LSI-H7 26°47.998Ń113°07.649´W

~93 0.00086 (± 0.0003) 5.35 (± 1.36)

LSI-H8 26°45.223Ń113°07.406´W

>100 0.01293 (± 0.02) 8.36 (± 0.86)

ESSA-Area1 27°36.01Ń113°53.46´W

~50 3.204 (± 0.37) 4.12 (± 0.15)


methane production in the LSI samples (Fig. 1), confirmingprevious studies in which acetate, hydrogen, or methionineadditions did not stimulate methanogenesis in freshly collect-ed marsh sediments from intertidal sediments [43].Acetoclastic and hydrogenotrophic methanogens, with theirlower energetic yields, are therefore more susceptible thanmethylotrophic methanogenesis, which further explains thepredominance of methylotrophic methanogens in hypersalineenvironments [30].

Our understanding of how methanogenesis is coupled toenergy conservation has proceeded more slowly. As for allrespirers, energy conservation is fundamentally chemiosmot-ic. A methyl transfer step plays a central role in mostmethanogenic pathways and directly drives the export ofsodium ions. Other components of the energy conservationapparatus appear to differ in the methylotrophic andhydrogenotrophic methanogens. Methylotrophic metha-

nogens have cytochromes and a proton-translocating electrontransport chain, which they use to conserve energy in the last,exergonic step in methanogenesis. Hydrogenotrophicmethanogens, however, lack these components, and it is notclear how these organisms achieve a net positive gain in ener-gy conservation, because the first step in methanogenesisfrom CO2 is endergonic [21]. A proposed mechanism involv-ing electron bifurcation, in which exergonic electron flowdirectly drives endergonic electron flow, could resolve thisconundrum [42].

To assess whether the activity of sulfate-reducing bacte-ria attenuated hydrogenotrophic methanogenesis at non-lim-iting sulfate concentrations, sulfate reduction was inhibitedin microcosm experiments. Thus, the addition of sodiummolybdate resulted in a 76–78 % decrease in hydrogen sul-fide production in the microcosm (data not shown), indicat-ing a sharp decrease in sulfate reduction rates. This decrease


Int.

Mic

robi

ol.

Fig. 1. Methane production rates from microbial mat samples from Laguna San Ignacio (sites H7 and H8) and the site ESSA-A1 inGuerrero Negro amended with site field water and non-competitive and competitive substrates under anoxic conditions. Samples ofESSA-A1 were incubated at room temperature (ca. 25 °C) for 48 h, while LSI samples were incubated at 30 °C for 33 days. Errorbars indicate one standard deviation about the mean of two replicate samples.


did not, however, increase methane production (Fig. 1), whichmight be explained by the low abundances of methanogenscapable of using H2/CO2 or acetate as substrate in those sam-ples. Methane production in the unamended samples best rep-resented natural conditions, which are probably suboptimal formethylotrophic methanogens due to the low concentrations ofmethylamines (Kelley et al., personal communication).

Phylogenetic diversity of methanogens. Metha-nogens are frequently studied without cultivation, owing to agenerally good correspondence between phylogeny and phe-notype, which is less typical in other groups [30]. The phylo-genetic diversity of methanogens was different for all thestudied sites. Clone libraries of mcrA from natural ESSA-A1samples consisted exclusively of sequences related to methy-


Int.

Mic

robi

ol.

Fig. 2. Phylogenetic tree based on comparison of inferred amino acid sequences of mcrA gene from methanogenic euryarchaeota from natural (clusters A-D) and manipulated (clusters E, F) samples of microbial mats from hypersaline environments. Branch nodes supported by phylogenetic analysis (bootstrapvalues >95 % by both maximum parsimony; MP and neighbor-joining; NJ analyses) are indicated by filled circles. Open circles indicate >75 % bootstrapsupport by either MP or NJ analysis, while branch nodes without circles were not resolved (bootstrap value <75 %). Bootstraped trees were generated with1000 resamplings. The tree is rooted using an environmental sequence related to anaerobic methanogenic-oxidizing archaea group 1 (ANME-1) as the out-group. Abundance of each phylotype cluster (97 % identity) detected is stated in parentheses. The bar represents 0.2 changes per amino acid.


lotrophs of the Order Methanosarcinales, including moder-ately halophilic and marine members of the generaMethanohalophilus (8 sequences from cluster A and 3sequences from cluster C) and Methanolobus (3 sequencesfrom cluster B). Sequences closely related to members of thegenera Methanohalophilus were also retrieved from naturalsamples from LSI-H8 (3 sequences from cluster A and 3sequences from cluster D) (Fig. 2). This confirms earlierreports that the methanogenic community in hypersalineenvironments is dominated by methylotrophic methanogens[44]. The mcrA sequences retrieved from DGGE bands fromLSI-H7 samples incubated with methanol and TMA weresimilar to sequences of uncultured Euryarchaeota that phylo-genetic analyses showed to be distantly related to slightlyhalophilic and marine organisms of the genera Methano-coccoides (2 sequences from cluster F) and Methanolobus (5sequences from cluster E) (Fig. 2). However, we were notable to detect hydrogenotrophic or acetoclastic methanogensusing the described molecular approaches, presumably due tothe low abundances of methanogens that utilize the pathwayinvolving CO2 reduction and acetoclastic reaction. Membersof the genus Methanococcoides have been frequently foundin anoxic marine sediments [17], but have also been reportedfor incubations of surface layers of microbial mats fromhypersaline environments [33]. Enrichment cultures havealso shown the presence of viable methylotrophic Methano-coccoides in shallow sediment layers from hypersalinemicrobial mats in the Napoli mud volcano [19], suggestingthat this genus is common in hypersaline environments.

Enrichments made it possible to assess the differentialeffects of environmental factors imposed on mixed microbialpopulations, as well as to select organisms capable of attack-ing or degrading particular substrates or of thriving underunusual conditions [18]. The retrieval, from enriched sam-ples, of sequences that were not found in natural samplesshowed the importance of applying different approaches tothe characterization of methanogenic community composi-tion.

There is uncertainty about the phenotype of uncultivatedorganisms giving rise to sequences that cluster within theEuryarchaeota but outside of known methanogens [30].Recent studies, however, have shown the importance ofstudying uncultured microorganisms, because novelmicrobes can be detected with molecular data [12]. Examplesof this are the recently described novel major lineage ofNanohaloarchaea, from hypersaline microbial communities[31], and the report of a new candidate division, MSBL1,which branchs deeply within the Euryarchaeota, from

extremely halophilic microbial communities in anaerobicsediments from a solar saltern [25].

Although mcrA sequences of the same genera of methy-lotrophic methanogens found in our samples have beenreported from other hypersaline environments [33,37,40], therelative abundances of retrieved sequences were different atthe field sites reported here. Previous studies at the siteESSA-A4 reported that Methanolobus and Methanococ-coides sequences were the most abundant while Metha-nohalophilus-like sequences were retrieved in lower abun-dances [33,37]. In our study, > 60% of the sequences (17sequences) were related to Methanohalophilus. These resultsshow the importance of studying the microbial communitycomposition from different hypersaline environments eventhough many identical phylogenetic groups are detected insediments independent of their geographic location [17]. Incontrast to the hypothesis that microbial diversity in hyper-saline environments is essentially the same at different geo-graphical locations, there can apparently be great heterogene-ity in phylogenetic diversity between sites that share physio-graphic setting and climate.

We can conclude that geochemical and molecular evi-dence confirm the presence of methanogenesis in thesehypersaline environments. The detection of methane sug-gests that physicochemical extreme conditions in hypersalineenvironments should not prevent methanogenesis. Theretrieval of mcrA sequences showed that the methanogencommunity was dominated by moderately halophilic organ-isms of the genus Methanohalophilus (more than 60 of mcrAsequences retrieved). Nevertheless, slightly halophilic andmarine organisms of the genera Methanococcoides andMethanolobus, respectively, were identified at lower abun-dances. These results suggest that the community composi-tion of methanogens differs even in similar ecosystems. Allsequences were related exclusively to methylotrophic mem-bers of the Family Methanosarcinaceae.

Acknowledgements. We thank Ira Fogel and Manuel Trasviña of CIB-NOR for editorial improvements and sulfate determinations, respectively.This work was supported by CONACYT grant 105969-2008-2012, CIB-NOR grant PC0.18-2011 to A.L.C, and a grant from the NASA ExobiologyProgram to B.M.B. A grant from the NASA-Planetary Biology InternshipProgram 2009 at the Marine Biological Laboratory, Woods Hole, MA wasreceived by J.Q.G.M.; he also has a CONACYT doctoral fellowship. We aregrateful to Exportadora de Sal, S.A. de C.V. for access to the Guerrero Negrofield site. We are thankful for the field and laboratory assistance of JeffChanton, Cheryl Kelley, Jennifer Poole, Amanda Tazaz, Angela Detweiler,and Natalia Trabal.




References

1. Altschul SF, Gish W, Miller W, Myers EW, Lipman DJ (1990) Basiclocal alignment search tool. Mol Biol 215:403-410

2. Altschul SF, Madden TL, Schäffer AA, Zhang J, Zhang Z, Miller W,Lipman DJ (1997) Gapped BLAST and PSI-BLAST: a new generationof protein database search programs. Nucleic Acids Res 25:3389-3412

3. Bebout BM, Hoehler TM, Thamdrup B, Albert D, Carpenter SP, HoganM, et al. (2004) Methane production by microbial mats under low sul-phate concentrations. Geobiology 2:87-96

4. Buckley DH, Baumgartner LK, Visscher PT (2008) Vertical distributionof methane metabolism in microbial mats of the Great Sippewissett saltmarsh. Environ Microbiol 10:967-977

5. Bolhuis H, Stal LJ (2011) Analysis of bacterial and archaeal diversity incoastal microbial mats using massive parallel 16S rRNA gene tagsequencing. ISME J 5:1701-1712

6. Canfield DE, Des Marais DJ (1991) Aerobic sulfate reduction in micro-bial mats. Science 251:1471-1473

7. Chesnin L, YTien CH (1951) Turibidimetric determination of availablesulphates. Soil Sci Soc Am Proc 15:149-151

8. Conrad R, Frenzel R, Cohen Y (1995) Methane emission from hyper-saline microbial mats: lack of aerobic methane oxidation activity. FEMSMicrobiol Ecol 16:297-306

9. de los Ríos A, Valea S, Ascaso C, Davila A, Kastovsky J, McKay CP,Gómez-Silva B, Wierzchos J (2010) Comparative analysis of the micro-bial communities inhabiting halite evaporites of the Atacama Desert. IntMicrobiol 13:79-89

10. Ferrer M, Werner J, Chernikova TN, Bargiela R, Fernández L, La ConoV, Waldmann J, Teeling H, Golyshina OV, Glöckner FO, Yakimov MM,Golyshin PN (2012) Unveiling microbial life in the new deep-sea hyper-saline Lake Thetis. Part II: a metagenomic study. Environ Microbiol14:268-281

11. Ferry JG, Kastead AK (2007) Methanogenesis. In: Cavicchioli R (ed)Archaea: Molecular and cellular biology. ASM Press, Washington, DC,pp 288-314

12. Ghai R, Pasic L, Fernández AB, Martin-Cuadrado AB, et al. (2011) Newabundant microbial groups in aquatic hypersaline environments.Scientific Rep DOI:10.1038/srep00135

13. Hoehler TM, Bebout BM, Des Marais DJ (2001) The role of microbialmats in the production of reduced gases on the early Earth. Nature412:324-327

14. Hoehler T, Gunsalus RP, McInerney MJ (2010) Environmental con-straints that limit methanogenesis. In: Timmis KN (ed) Handbook ofhydrocarbon and lipid microbiology. Springer-Verlag, BerlinHeidelberg, pp. 635-654

15. King GM (1988) Methanogenesis from methylated amines in a hyper-saline algal mat. Appl Environ Microbiol 54:130-136

16. Kinsman DJJ (1969) Modes of formation, sedimentary associations, andDiagnostic Features of shallow-water and supratidal evaporates. AmerAssoc Petro Geol Bull 53:830-840

17. Köchling T, Lara-Martín P, González-Mazo E, Amils R, Sanz JL (2011)Microbial community composition of anoxic marine sediments in theBay of Cádiz (Spain). Int Microbiol 14:143-154

18. Krieg NR (1981) Enrichment and isolation. In: Gerhardt P (ed) Manualof methods for general bacteriology. American Society forMicrobiology, Washington DC, pp. 112-142

19. Lazar CS, L’Haridon S, Pignet P, Toffin L (2011) Archaeal populationsin hypersaline sediments underlying orange microbial mats in theNapoli mud Volcano. Appl Environ Microbiol 77:3120-3131

20. Lehmacher A, Klenk HP (1994) Characterization and phylogeny ofMCRII, a gene-cluster encoding an isoenzyme of methyl coenzyme-Mreductase from hyperthermophilic Methanothermus fervidus. Mol GenGenet 243:198-206

21. Leigh JA, Albers SV, Atomi H, Allers T (2011) Model organisms forgenetics in the domain Archaea: methanogens, halophiles, Thermo-coccales and Sulfolobales. FEMS Microbiol Rev 35:577-608

22. Li W, Godzik A (2006) Cd-hit: a fast program for clustering and com-paring large sets of protein or nucleotide sequences. Bioinformatics22:1658-1659

23. Liu Y, (2010) Taxonomy of methanogens. In: Timmis KN (ed)Handbook of hydrocarbon and lipid microbiology. Springer-Verlag,Heidelberg, pp. 549-558

24. Liu Y, Whitman WB (2008) Metabolic, phylogenetic, and ecologicaldiversity of the methanogenic archaea. Ann NY Acad Sci 1125:171-189

25. López-López A, Yarza P, Richter M, Suárez-Suárez A, Antón J,Niemann H, Rosselló-Móra R (2010) Extremely halophilic microbialcommunities in anaerobic sediments from a solar saltern. EnvironMicrobiol Rep 2:258-271

26. López-Cortés A, Lanz-Landázuri A, García-Maldonado JQ (2008)Screening and isolation of PHB-producing bacteria in a polluted marinemicrobial mat. Microb Ecol 56:112-120

27. Lovley DR, Dwyer DF, Klug MJ (1982) Kinetic analysis of competitionbetween sulfate reducers and methanogens for hydrogen in sediments.Appl Environ Microbiol 45:187-192

28. Lueders T, Chin KJ, Conrad R, Friedrich M (2001) Molecular analysesof methyl-coenzyme M reductase α-subunit (mcrA) genes in rice fieldsoil and enrichment cultures reveal the methanogenic phenotype of anovel archaeal lineage. Environ Microbiol 3:194-204

29. Luton PE, Wayne JM, Sharp RJ, Riley PW (2002) The mcrA gene as analternative to 16S rRNA in the phylogenetic analysis of methanogenpopulations in landfill. Microbiology 148:3521-3530

30. McGenity TJ (2010) Methanogens and methanogenesis in hypersalineenvironments. In: Timmis KN (ed) Handbook of hydrocarbon and lipidmicrobiology. Springer-Verlag, Berlin, Heidelberg, pp 665-680

31. Narasingarao P, Podell S, Ugalde JA, Bronchier-Armanet C, et al.(2012) De novo metagenomic assembly reveals abundant novel majorlineage of Archaea in hypersaline microbial communities. ISME J 6:81-93

32. Oremland RS, Marsh LM, Polcin S (1982) Methane production andsimultaneous sulfate reduction in anoxic, salt-marsh sediments. Nature296:143-145

33. Orphan VJ, Jahnke LL, Embaye T, Turk KA, Pernthaler A, SummonsRE, Des Marais DJ (2008) Characterization and spatial distribution ofmethanogens and methanogenic biosignatures in hypersaline microbialmats of Baja California. Geobiology 6:376-393

34. Revsbech NP, Jørgensen BB, Blackburn TH, Cohen Y (1983) Micro-electrode studies of the photosynthesis and O2, H2S, and pH profiles ofa microbial mat. Limnol Oceanogr 28:1062-1074

35. Rodríguez-Valera F (1986) The ecology and taxonomy of aerobicchemoorganotrophic halophilic eubacteria. FEMS Microbiol Rev 39:17-22

36. Sakai S, Imachi H, Hanada S, Ohashi A, Harada H, Kamagata Y (2008)Methanocella paludicola gen. nov., sp. nov., a methane-producingarchaeon, the first isolate of the lineage ‘Rice Cluster I’, and proposal ofthe new archaeal order Methanocellales ord. nov. Int J Syst EvolMicrobiol 58:929-936



37. Smith JM, Green SJ, Kelley CA, Prufert-Bebout L, Bebout BM (2008)Shifts in methanogen community structure and function associated withlong-term manipulation of sulfate and salinity in a hypersaline microbialmat. Environ Microbiol 10:386-394

38. Sørensen KB, Canfield DE, Oren A (2004) Salinity responses of benth-ic microbial communities in a solar saltern (Eilat, Israel). Appl EnvironMicrobiol 70:1608-1616

39. Sørensen KB, Canfield DE, Teske AP, Oren A (2005) Community com-position of a hypersaline endoevaporitic microbial mat. Appl EnvironMicrobiol 71:7352-7365

40. Sørensen K, Reháková K, Zapomelová E, Oren A (2009) Distributionof benthic phototrophs, sulfate reducers, and methanogens in twoadjacent saltern evaporation ponds in Eilat, Israel. Aquat MicroblEcol 56:275-284

41. Springer E, Sachs MS, Woese CR, Boone DR (1995) Partial genesequences for the A subunit of methyl-coenzyme M reductase (mcrI) asa phylogenetic tool for the family Methanosarcinaceae. Int J SystBacteriol 45:554-559

42. Thauer RK, Kaster AK, Seedorf H, Buckel W, Hedderich R (2008)Methanogenic archaea: ecologically relevant differences in energy con-servation. Nat Rev Microbiol 6:579- 591

43. Winfrey MR, Ward DM (1983) Substrates for sulfate reduction andmethane production in intertidal sediments. Appl Environ Microbiol45:193-199

44. Whitman WB, Bowen TL, Boone DR (2006) The methanogenic bacte-ria. In: Dworkin M, et al. (eds) Prokaryotes. Springer, New York, pp.165-207

45. Woese CR, Fox GE (1977) Phylogenetic structure of the prokaryoticdomain: the primary kingdoms. Proc Natl Acad Science USA74:5088-5090

46. Woese CR, Kandler O, Wheelis ML (1990) Towards a natural system oforganisms. Proposal for the domains Archaea, Bacteria, and Eucarya.Proc Natl Acad Sci USA 87:4576-4579


RESEARCH ARTICLE

Summary. Gram-positive bacteria of the genus Listeria contain many surface proteins covalently bound to the peptidogly-can. In the pathogenic species Listeria monocytogenes, some of these surface proteins mediate adhesion and entry into hostcells. Specialized enzymes called sortases anchor these proteins to the cell wall by a mechanism involving processing andcovalent linkage to the peptidoglycan. How bacteria coordinate the production of sortases and their respective protein sub-strates is currently unknown. The present work investigated whether the functional status of the sortase influences the levelat which its cognate substrates are produced. The relative amounts of surface proteins containing an LPXTG sorting motifrecognized by sortase A (StrA) were determined in isogenic wild-type and ΔsrtA strains of L. monocytogenes. The possibili-ty of regulation at the transcriptional level was also examined. The results showed that the absence of SrtA did not affect theexpression of any of the genes encoding LPXTG proteins. However, marked differences were found at the protein level forsome substrates depending on the presence/absence of SrtA. In addition to the known “mis-sorting” of some LPXTG proteinscaused by the absence of SrtA, the total amount of certain LPXTG protein species was lower in the ΔsrtA mutant. These datasuggested that the rate of synthesis and/or the stability of a subset of LPXTG proteins could be regulated post-transcription-ally depending on the functionality of SrtA. For some LPXTG proteins, the absence of SrtA resulted in only a partial loss ofthe protein that remained bound to the peptidoglycan, thus providing support for additional modes of cell-wall association insome members of the LPXTG surface protein family. [Int Microbiol 2012; 15(1):43-51]

Keywords: Listeria monocytogenes · sortases · peptidoglycan · surface proteins · covalent anchoring · bacterial regulation

Introduction

Gram-positive bacteria have a thick cell wall consisting of amultilayered peptidoglycan [26]. This backbone is decorated

with teichoic (TA) and lipoteichoic acids (LTA) that areeither directly bound to the peptidoglycan or tethered to themembrane, respectively. Besides these structures, the bacter-ial cell wall acts as a platform for the anchorage of a varietyof surface proteins, many of which play essential physiolog-ical roles, for example, in nutrient acquisition, quorum sens-ing, biofilm formation, and host interactions [21]. The mech-anisms of protein association with the cell wall are diverseand include non-covalent protein-peptidoglycan interactionsvia peptidoglycan-binding domains such as LysM and WxL;direct protein-TA and protein-LTA interactions; and covalentanchoring of the protein to the peptidoglycan lattice [1,21].


*Corresponding author: M.G. PucciarelliDepartamento de Biología Molecular /

Centro de Biología Molecular Severo OchoaUniversidad Autónoma de Madrid28049 Cantoblanco (Madrid), SpainTel. +34-915854551. Fax +34-915854506 E-mail: [email protected]¶Equal contributors

Javier F. Mariscotti,1¶ Juan J. Quereda,1¶ M. Graciela Pucciarelli1,2*1Spanish National Center of Biotecnology, Spanish National Research Council (CSIC), Madrid, Spain. 2Departmentof Molecular Biology and Center for Molecular Biology Severo Ochoa, Autonomous University of Madrid, Spain


Contribution of sortase A to the regulation ofListeria monocytogenes LPXTG surface proteins


In the latter case, the covalent association between the pro-tein and the cell wall occurs upon recognition of the proteinsubstrate by specialized enzymes called sortases [10,21].Enzymatic cleavage of a C-terminal sorting motif in turnleads to the covalent anchorage of the protein to the peptido-glycan via a transpeptidation reaction. The first sorting motif,LPXTG, was identified in protein A of Staphylococcusaureus. Since then, distinct sortases with different specifici-ties for different sorting motifs have been described [11,18,24,30].

Genome sequencing studies have revealed that bacteria ofthe genus Listeria contain the largest family of genes encod-ing predicted surface proteins recognized by sortases. Morethan 40 genes of this class have been annotated in everyListeria genome sequenced to date [5,6,15,16]. Listeria con-tains two sortases, SrtA and SrtB, which recognize LPXTGand NPKSS/NAKTN sorting motifs, respectively [2,3,20,27]. In the case of the pathogenic species L. monocyto-genes, SrtA was reported to be essential for virulence [3].This phenotype is linked to the major role in virulence playedby distinct surface proteins containing the LPXTG sortingmotif. Examples of these proteins are internalin A (InlA),Vip, InlJ and LapB, which promote bacterial adhesion andinvasion of eukaryotic cells and modulate host immuneresponses [7,12,25,28,29]. By contrast, no evidence of arequirement for alternative sortase B in L. monocytogenesvirulence has been found, and SrtB recognizes only the sur-face proteins Lmo2185 (SvpA) and Lmo2186 (SvpB) [2].

Our previous proteomic studies revealed that the absenceof SrtA resulted in a cell-wall proteome devoid of the 13LPXTG surface proteins that were detected by this techniquein the wild-type strain [27]. This study was performed withpeptidoglycan material obtained under harsh purificationconditions, i.e., extensive boiling of the cell-wall extract insolutions containing high percentage of ionic detergents (4 %SDS). This methodology could have impacted, at least tosome extent, the ability to detect LPXTG surface proteinsthat, in the absence of SrtA, were retained in the cell wall bynon-covalent associations with other proteins or cell-wallcomponents. These hypothetical cell-wall–protein associa-tions might naturally play additional roles in the fine-tuningof protein function. A similar diversity of associations for asingle surface protein with the cell wall was recently demon-strated for the L. monocytogenes ActA protein, involved inactin-tail polymerization in intracellular bacteria [13]. Thus,in addition to being tethered to the membrane by its C-termi-nal hydrophobic domain, ActA strongly associates with thecell wall in bacteria that proliferate within epithelial cells

[13,14]. Variable associations of surface proteins with thecell wall have also been reported for members of the sameprotein family. Specifically, L. monocytogenes surface pro-teins covalently bound to the peptidoglycan by SrtA, such asInlA, InlH and InlJ, or by alternative sortase SrtB, such asLmo2185 (SvpA), were recently shown to preferentiallylocate in distinct regions of the bacterial surface [4]. Anotheraspect, poorly understood, is to what extent, if any, sortasescontribute to regulating the production of surface proteinsthat they recognize for anchoring to peptidoglycan. Consis-tent with what is known for essentially every enzymaticprocess, a tight co-regulation of the relative amount of thesorting enzyme and its substrates can be expected. Based onthese considerations, in the present study the effect of a lackof L. monocytogenes SrtA on the expression of LPXTG sur-face proteins was examined. In addition, we analyzed whetherthe absence of SrtA results in changes in both the relativeamounts and the subcellular distribution of these proteins.


Bacterial strains and growth conditions. The Listeria monocy-togenes serotype 1/2a strain used in this study was EGDe; its genome hasbeen sequenced [15]. The isogenic mutant derivative was the previouslydescribed ΔsrtA BUG 1777 [3]. Both were grown at 37 ºC to exponentialphase (OD600 = 0.2) in brain-heart infusion (BHI) medium with shaking (150rpm). For experiments involving stationary-phase regulation, the bacteriawere grown at 37 ºC in BHI medium under static, non-shaking conditions.In these stationary-phase conditions, bacteria grown display high invasionrates when exposed to cultured eukaryotic cell lines [13].

Bacterial fractionation and Western blot analysis. Fractionscontaining cytosolic, membrane, cell-wall, and secreted proteins of L. mono-cytogenes grown at 37 ºC in BHI media were obtained as described previ-ously [27], except that the pellets were incubated in lysis buffer for 4 hinstead of 1 h. The supernatants, corresponding to the cell-wall fractions,were filtered and precipitated on ice in 15 % TCA for 1 h. Proteins presentin the cell-wall fraction were recovered by centrifugation at 29,000 ×g for 20min at 4 ºC . The pellet was washed in cold acetone and centrifuged againunder the same conditions. A volume of the cell-wall fraction was analyzedby SDS-PAGE followed by Western blotting using polyclonal rabbitimmune sera recognizing the LPXTG proteins Lmo0130, Lmo0159,Lmo0160, Lmo0263 (InlH), Lmo0610, and Lmo0880, and mouse mono-clonal antibody anti-Lmo0434 (InlA). Other proteins analyzed in these frac-tions as controls were the StrB substrate SvpA and the peptidoglycan hydro-lase Iap (P60). Polyclonal rabbit antibody recognizing P60 was a gift of Dr.Andreas Bubert (University of Würzburg, Germany). Mouse monoclonalanti-Lmo0434 (InlA) and polyclonal rabbit anti-SvpA were a gift of Prof.Pascale Cossart (Institut Pasteur, Paris, France).

RNA preparation and RT-PCR assays. RNA was purified in threeindependent experiments from bacteria grown in 10 mL of BHI at exponen-tial phase (OD600 = 0.2). Total RNA from bacterial pellets was extracted

MARISCOTTI ET AL.


using the TRIzol reagent method (Invitrogen) [31]. RNA was treated withDNase I for 30 min at 37 ºC (Turbo DNA-free kit, Ambion/AppliedBiosystems). RNA integrity and concentration were assessed by agarose-TAE electrophoresis and absorbance at 260 nm, respectively. RT-PCR wasperformed using a one-step RT-PCR kit (Qiagen). Briefly, RNA sampleswere diluted to 25 ng/μl and used in the RT-PCR, which was carried out ina final volume of 25 μl consisting of 5 μl buffer (5×), 1 μl of dNTP (10 mM),3 μl each of the forward and reverse primers (5 mM), 1 μl of RT-PCRenzyme mix, 40 ng of RNA, and RNase-free water. RT-PCR cycling condi-tions were as follows: 50 ºC for 35 min and 95 ºC for 15 min, followed by30 cycles of 94 ºC for 30 s, 55 ºC for 30 s, and 72 ºC for 40 s and then anextra elongation step at 72 ºC for 10 min. Oligonucleotides used in these RT-PCR assays were designed using the software Primer Express v3.0 (AppliedBiosystems) and are listed in Table 1.


The expression of L. monocytogenes genesencoding LPXTG surface proteins is unalteredin a strain lacking sortase A. Sortases anchor sur-face proteins to the peptidoglycan of gram-positive bacteriaonce most of the protein substrate has passed through themembrane and is further retained there by its C-terminalregion rich in hydrophobic amino acids [21]. At this stage,the sorting motif of the substrate protein is exposed on theouter leaflet of the membrane for recognition and cleavageby the sortase, leading to the covalent anchoring of the pro-tein substrate to the peptidoglycan. Considering that theencounter between enzyme and substrate must be finelymodulated spatially, temporally, and stoichiometrically, weexamined whether the relative amounts of the sortase and itssubstrates were, to some extent, co-regulated. This type ofregulation would prevent the potentially detrimental accumu-lation of surface proteins in their precursor form, i.e., teth-ered to the membrane, when either the level or the activity ofSrtA was not optimal. This hypothesis was tested using theintracellular bacterial pathogen L. monocytogenes, whichcontains a large family of surface proteins bearing theLPXTG motif, recognized by StrA. Our first goal was todetermine whether the expression of any of the genes encod-ing thesetranscriptionally regulated any of the genes encod-ing these LPXTG surface proteins could be modulated byStrA. Thus, the expression of the respective genes was ana-lyzed by RT-PCR using total RNA purified from exponentialcultures of the L. monocytogenes isogenic strains EGDe(wild-type) and BUG1777 (ΔsrtA). The genome of the EGDestrain has been sequenced and is known to contain 41LPXTG-encoding genes [15]. As expected, the relativeexpression levels of these genes in the wild-type strain varied,

with some genes more highly expressed than others (Fig. 1).However, there were no major differences in the relativeamounts of their respective transcripts between the wild-typeand ΔsrtA isogenic strains (Fig. 1). The only differencesbetween the wild-type and srtA strains were in the relativelevels of the lmo0263 (inlH), lmo0880, lmo1289 andlmo1666 (lapB) transcripts (Fig. 1).

Further expression analyses by quantitative real-timePCR (qRT-PCR), however, ruled out the differential expres-sion of any of these four genes (data not shown). Altogether,these data led us to conclude that the presence of SrtA on theL. monocytogenes cell surface does not, per se, constitute acellular signal to modulate the expression of the genes encod-ing its protein substrates. Rather, as sugggested in previousreports [7,9,28,29], regulation appears to be governed most-ly at the level of regulators that modulate the expression of aspecific set of genes encoding the LPXTG surface proteins.Representative examples of these genes are lmo0434 (inlA),regulated by PrfA and SigB [23], and lmo0263 (inlH),lmo0610, lmo0880 and lmo2085, regulated by SigB[9,17,31].

The lack of SrtA does not completely abolishthe strong attachment of certain LPXTG surfaceproteins to cell-wall peptidoglycan. Since SrtA doesnot seem to regulate the expression of any of the 41 genesencoding the protein substrates of this sorting enzyme, we askedwhether post-transcriptional regulatory mechanisms relied onthe functional status of the sortase. To answer this question, itwas necessary to quantify the relative levels of LPXTG proteinsin the absence/presence of SrtA. Antibodies for all LPXTG sur-face proteins encoded in the genome of L. monocytogenes strainEGDe were generated, with the exception of anti-InlA and anti-InlJ sera, available from other sources. While all the immunesera recognized the recombinant protein produced for immu-nization purposes, only some of these sera readily recognizednative LPXTG proteins in cell-wall extracts of L. monocyto-genes (data not shown). In most cases, the latter consisted ofthose LPXTG proteins encoded by highly expressed genes(Fig. 1 and data not shown), such as InlA, Lmo0130, Lmo0160,Lmo0263 (InlH) and Lmo0610. In the other cases, differenceswere observed between the RT-PCR and Western-blot data, per-haps reflecting the existence of post-transcriptional regulatorymechanisms. Alternatively, and irrespective of the amount ofprotein produced, a distinct topology of the protein within thecell wall could render it either more resistant or labile to extrac-tion from the peptidoglycan lattice.

REGULATION OF L. MONOCYTOGENES SURFACE PROTEINS

46 INT. MICROBIOL. Vol. 15, 2012 MARISCOTTI ET AL.

Table 1. Oligonucleotides used in this studya

Oligonucleotide Forward sequence (5′→3′) Reverse sequence (5′→3′)

iapb AAAGCAACTATCGCGGCTAC TCTTGAACAGAAACACCGTA

lmo2026 CAGCCTCCACTTCATGGATTG TCACCATGGGAAACTCCTGTAA

lmo2396 CCAGTTACCGGCCTAATTAAAGATT TGGTATGCAGGATTGGACCAT

inlJ GCAGCAACGAATGATGTTATTGATA GCTAAGATCAAGGGTGGTAATGTTGT

lmo0171 ATCATCCAGTGAAGAAGCTGCAA GTGAGCTCATTGTTGTTCACATTG

lmo0732 ACCAAAAACGGTCGACGTAAA AGGTATTTGCCCAACCAAACG

lmo0175 TACGGACTTACAGGTTTCTGTTGGT GCTTTAACAACTGGTGCGCTAA

lmo0327 CAATAACTGCCTTGCGAGTAACA TGGAACTTTCACTAAGCGGTTATTATTT

inlI CTTGGTTATTTAGCGCCTTTTGA CCTGTTGCAGCCGCATTT

lmo0835 CAGATGGAGCGGAGATTGCT TATGCAAGCCATCTATGCTAATGTC

lmo1413 GGCAATGCAGCTTATGTGCTT AGTTTCACCGAGTTTTCCGGATA

lmo2178 GACTATGGATTCTCTTTTACCTGGTGAT TTCCCTGAAAATGCAAAGTTCA

lmo2179 TTGAATCTGGTCAGACGGTAAACTAT CTGCGCTTAATTCACCTGTTACTACT

inlA AATATTAGTATTTGGCAGCGGAGTATG GGCGTTATGTCCGTAAGTTGATT

lmo0130 GCGACAACTGACAATGCTATCC GCCTTCTGCGACTGTGTTTG

lmo0159 CGATCTCGCTTTTGACGTGAA TTACTAGCATCTACCCAACCATATTTGA

lmo0160 AGGGCAATTAACAGGCGATAAC GACGCATCCAACACGTATCCT

inlG AGTAGATAAAATGCCGGCTACGA TTTCCGGGAGCTGTTTGAGA

inlH CAGTAGCGCCAACGAAGGAT GCGTCGCTGTTCCTAGCAA

inlE GGTGAGCTTATTGCACCGGATA TGCGTCATACCATCCATCGA

lmo0320 CCGTTTATCATCCAAGTGGCTAT GCGCATCCAATTGTTGTTGA

lmo0331 GCCACCGTAACAAGCAGCTTAC ACCTTGGCTTCGTGCATCTAG

inlF ACCGAACTTGAAGTGGTCTTTACC ATTTGCCCGGTTGTGAAGTC

lmo0435 GACTTTGTGGATGTTAGTGCGAAT TGCTACGTCCTCCCCGTTT

lmo0463 GAGTTCAAGCTAGTCAAACAGTGGTT CCAAATAAGGACGAGCACTAAGC

lmo0514 TGCTGCAGGACTCAAAGCAA TGTCCACTGTCGCTTGTAGTCA

lmo0550 GCGTCGCCATTTTATGTGAA ATGAAACCAACCCCTAGTAAAACAA

lmo0610 GTTTAAAAGCAACGCCAACACA GTGGCGTCGGAGGTTCATT

lmo0627 TCACAAACCCAGTTGACATTCC AATTTGCCGCGCCAGAA

lmo0725 TGCTGTTTTCATTTCACTTGGATT GCAAGCGCGACAAGTACCA

lmo0801 AGATCCTGCCATGGCTAATGAA TTAGCTAAATCAGCCACTGGTGAT

lmo0842 AACGGATGTGTCAGTGGGAGTATA CCAGCCACGCTTAAGAAGGT

lmo0880 TAAAGTGCGAGTGGCGTATGA TTTACCGGAAATGCGATTGG

lmo1115 ACGAAAGCTGGAGAAGAGGCTAA AGAGAACGGAATAGGGCGTGTA

lmo1136 GCAACATCAACTACACTCGAGACA AATTGTTACGGGCAAAGCGTAT

lmo1289 CTGAAATCAAAGCCACAACCAA TAGGATTTCTTGAGTTTGAATGTTGAAC

lmo1290 ACAGGCATTGAATATGCTCACAATA TGGCATTGTTTTAAGTGGCATAA

lmo1666 TTATGACTTCGACTGCTGACGAAA TCGGACTTCCAACATCAACTACA

lmo1799 GATGATGGTAGCGCCTGTCA CCGCCAATTCCTAAATAAGCAA

lmo2085 GTATTCAGCAAGATAGCGAAGAACCT TCGTCGTTATTCCCGCATCTA

lmo2576 TCGTCGTTTACAATTGGTCGAT CGCTGATTGGGAAAACGATT

lmo2714 CCGGCAGATGAAAACTTTGG GTCACCTGTGCTTGGCAAATCaOligonucleotides were designed using the Primer Express v3.0 software (Applied Biosystems). bOligonucleotide sequences taken from the study of Cabanes et al. [7].


Among the LPXTG proteins better detected by ourimmune sera were Lmo0130, Lmo0159, Lmo0160, Lmo0263(InlH), Lmo0610 and Lmo0880. Therefore, the relativeamounts of these six LPXTG proteins and Lmo0434 (InlA)were examined in the cell-wall and extracellular-medium frac-tions of exponentially growing isogenic wild-type and ΔsrtAstrains. The cell-wall-associated protein Iap (also known asP60), which binds to peptidoglycan non-covalently by itsLysM domain, and the SrtB substrate Lmo2185 (SvpA) wereincluded as controls of surface protein not recognized by SrtA.In the ΔsrtA strain, the lack of SrtA resulted in a significantdecrease in LPXTG protein levels in the cell wall and a con-comitant increase in the amount of protein released into theextracellular medium (Fig. 2A). As expected, the mis-sortingof the LPXTG proteins by the ΔsrtA mutant was not observedfor the P60 and SvpA proteins, which do not depend on SrtA

for their cell-wall association (Fig. 2A). Instead, consistentwith the mode of association reported for these two proteins,P60 was mostly secreted into the medium while SvpA wasretained in the cell wall by the covalent linkage mediated bySrtB (Fig. 2A). Of interest, the levels of some the LPXTG pro-teins examined, such as Lmo0610 and Lmo0880, were lowerin the ΔsrtA mutant than in the wild-type strain, when consid-ering both the cell-wall and the extracellular fractions (Fig.2A). Slight decreases in the amounts of two other LPXTG pro-teins, Lmo0159 and Lmo0160, were also noted while theremaining two LPXTG proteins examined, Lmo0263 (InlH)and Lmo0434 (InlA), were detected in similar amounts irre-spective of the presence/absence of SrtA (Fig. 2A).

Of note, some of these LPXTG proteins were detected inthe Western immunoassays as double or multiple bands.However, they were found to be specific when compared


Fig. 1. As seen in real-time PCR (RT-PCR) assays, there was no difference between EGDe (wild-type) and BUG1777 (ΔsrtA) isogenic strains with respectto the expression of the 41 Listeria monocytogenes genes encoding LPXTG surface proteins. Bacteria were grown to exponential phase (OD = 0.2) in BHImedium at 37 ºC. The iap gene, encoding the peptidoglycan hydrolase P60, which is not recognized by SrtA, was included as control. Note that, despite thevariability in expression between some genes encoding LPXTG proteins, there were no differences among the two strains tested.

Int.

Mic

robi

ol.


with mutants defective in these LPXTG proteins (data notshown). This multiplicity of bands for sortase substrates inboth peptidoglycan and secreted fractions has been previous-ly reported [2] and might reflect the attachment of muropep-tides to proteins extracted from the cell wall by muramidasedigestion. In these two fractions (cell wall and secreted), dif-ferences in protein mobility in the gel are not likely to be dueto unprocessed precursor forms of these proteins, as theywould be almost certainly retained at the membrane.

To determine whether the LPXTG proteins detected atlower levels in the cell wall and extracellular fractions of theΔsrtA mutant were produced at normal levels but accumulat-ed in the membrane or cytosol, these two subcellular frac-tions were examined for the representative cases of Lmo0130and Lmo0160. As shown in Fig. 2B, Lm0130 was not detect-

ed in either the cytosol or the membrane fraction of wild-typeand ΔsrtA strains. These data suggested that Lmo0130 couldbe subjected to post-transcriptional regulation, with theinvolvement of SrtA. By contrast, Lmo0160 was detected inthe cytosol and membrane fractions of the ΔsrtA mutant (Fig.2B). Considering that Lmo0160 was also detected in the cell-wall and extracellular medium fractions and that its totalamount was indistinguishable between wild-type and ΔsrtAstrains (Fig. 2B), the production of this protein might havebeen constitutive. Nonetheless, it remains to be explainedwhy a portion of Lmo0160 molecules remained bound to thepeptidoglycan in the absence of SrtA. This behavior, sharedby other LPXTG proteins such as Lmo0263 (InlH) andLmo0434 (InlA) (Fig. 2A), suggests that the presence ofadditional modules of these proteins favored the retention of

MARISCOTTI ET AL.

Int.

Mic

robi

ol.

Fig. 2. (A) Western-blot assays showing the relative levels of distinct LPXTG proteins (Lmo0130, Lmo0159, Lmo0160, Lmo0263 -InlH-, Lmo0434 -InlA-,Lmo0610, and Lmo0880) in the cell wall (CW) and extracellular medium (‘Secreted’) fractions of L. monocytogenes EGDe (wild-type) and BUG1777(ΔsrtA) strains grown to exponential phase (OD600 = 0.2) in BHI medium at 37 ºC. Non-SrtA substrates, such as the peptidoglycan hydrolase Iap (P60) andthe SrtB substrate Lmo2185 (SvpA), were run as controls. (B) Western assays showing the distribution of the LPXTG proteins Lmo0130 and Lmo0160 insubcellular fractions of bacteria grown as in panel A. Cyt: cytosol; Mb: membrane; Sec.: secreted.


the protein in the cell wall. The existence of additional pepti-doglycan-binding domains in LPXTG surface proteins is, toour knowledge, unreported. Note that in-silico analyses havedemonstrated that the L. monocytogenes Lmo0880 harbors aLysM domain [1], as do other surface proteins not recognizedby sortases, such as P60. Our subcellular fractionation stud-ies showed, however, that Lmo0880 was not extensivelyretained in the ΔsrtA mutant. This result is consistent with thelow percentage of P60—a surface protein that includes twoLysM domains—able to withstand the harsh peptidoglycanpurification method, involving extensive boiling in SDS-con-taining solutions (Fig. 2A) [26]. Overall, our observationspoint to as-yet-unidentified modes of association—and thusindependent of the action of SrtA—between peptidoglycanand certain LPXTG surface proteins. These associationswould presumably also rely on domain(s) other than LysMand perhaps contained in LPXTG proteins, such as Lmo0263(InlH), Lmo0434 (InlA) and Lmo0160. That some of theseproteins might be able to form macromolecular complexes isalso an interesting possibility.

Growth arrest also regulates the production ofcertain L. monocytogenes LPXTG proteins in anSrtA-dependent manner. Previous studies have shownthat certain L. monocytogenes LPXTG proteins, namely,Lmo0263 (InlH), Lmo0610, Lmo0880, and Lmo2085, areregulated by the alternative sigma factor SigB [17,19,25].SigB is also known to control cellular responses to diversestresses, such as high osmolarity and acidic pH, to governbacterial adaptation to conditions of nutrient limitation, andto modulate the expression of other virulence genes(reviewed in [22]). Our proteomic studies showed that manyLPXTG proteins are up-regulated when L. monocytogenes isgrown to stationary phase [8,13]. Based on these observa-tions, we analyzed whether the up-regulation of theseLPXTG proteins in growth-arrested cells requires a function-al sortase enzyme. Thus, the distribution of different LPXTGproteins was examined in cell-wall and extracellular-mediumextracts of L. monocytogenes wild-type and ΔsrtA strainsgrown to stationary phase. In a first set of experiments, thedistribution of Lmo0130, Lmo0159, Lmo0160, Lmo0610,


Fig. 3. (A) Western-blot assays depicting the relative levels of the LPXTG proteins Lmo0130, Lmo0159, Lmo0160, Lmo0434 -InlA-, and Lmo0610 in thecell wall (CW) and extracellular medium ('Secreted') fractions of L. monocytogenes EGDe (wild-type) and BUG1777 (ΔsrtA) strains grown to stationaryphase (OD600 = 1.0) in BHI medium at 37 ºC under non-shaking conditions. Non-SrtA substrates, such as the peptidoglycan hydrolase Iap (P60) and the SrtBsubstrate Lmo2185 (SvpA), were run as controls. (B) Western blots showing the distribution of the SigB-regulated LPXTG proteins Lmo0263 (InlH) andLmo0880 in subcellular fractions prepared from wild-type and ΔsrtA bacteria grown as in panel A. In the anti-InlH immunoblot, the asterisk denotes anunspecific band not related to the LPXTG protein. Cyt: cytosol; Mb: membrane; Sec.: secreted.

Int.

Mic

robi

ol.


and Lmo0434 (InlA) was examined. In all cases, the relativeamount of these LPXTG proteins anchored to the peptidogly-can was lower in the ΔsrtA mutant (Fig. 3A).

The fact that most of these LPXTG proteins were notdetected in the extracellular medium suggested that the lack ofSrtA blocked their up-regulation during the transit of L. mono-cytogenes to stationary phase. Taken together, these data sup-port a model in which the lack of SrtA affects the productionof LPXTG proteins, at least those tested, when the cells reachstationary phase. This effect was especially evident forLmo0434 (InlA), since during exponential phase it wasdetected at similar levels in wild-type and ΔsrtA strains (seeFig. 2A). Control experiments with the SigB-regulatedLPXTG proteins Lmo0263 (InlH) and Lmo0880 demonstrat-ed that their marked decrease in the ΔsrtA mutant grown tostationary phase was not due to an accumulation in thecytosol or the membrane (Fig. 3B). In addition, non-SrtAsubstrates, such as P60 and Lmo2185 (SvpA), were detectedboth in the cell wall and, especially, in the extracellular frac-tions (Fig. 3A). This finding excludes the possibility of ageneral degradation of LPXTG proteins in the extracellularmedium by proteases secreted during stationary phase.Overall, our findings provide support for a novel mechanismof regulation of LPXTG surface proteins, in which SrtAseems to contribute mostly when the bacteria reach station-ary phase. This mechanism in essence acts as a negative formof regulation of LPXTG proteins when StrA, which anchorsthese substrate proteins to cell-wall peptidoglycan, is func-tionally altered. Future studies will need to address the exactregulatory elements involved and the mechanism(s) underly-ing their regulatory activities in the distinct phases of bacter-ial growth.

Acknowledgements. We thank Francisco García-del Portillo for criti-cal reading of the manuscript, and Hélène Bierne and Pascale Cossart(Institut Pasteur, Paris, France) for the L. monocytogenes ΔsrtA strain. Thisstudy was funded by grant BIO2010-18962 of the Spanish Ministry ofEconomy and Competitiveness to M.G.P.


References

1. Bierne H, Cossart P (2007) Listeria monocytogenes surface proteins:from genome predictions to function. Microbiol Mol Biol Rev71:377-397

2. Bierne H, Garandeau C, Pucciarelli MG, et al (2004) Sortase B, anew class of sortase in Listeria monocytogenes. J Bacteriol186:1972-1982

3. Bierne H, Mazmanian SK, Trost M, et al. (2002) Inactivation of thesrtA gene in Listeria monocytogenes inhibits anchoring of surface pro-teins and affects virulence. Mol Microbiol 43:869-881

4. Bruck S, Personnic N, Prevost MC, Cossart P, Bierne H (2011)Regulated shift from helical to polar localization of Listeria monocy-togenes cell wall-anchored proteins. J Bacteriol 193:4425-4437

5. Buchrieser C (2007) Biodiversity of the species Listeria monocyto-genes and the genus Listeria. Microbes Infect 9:1147-1155

6. Cabanes D, Dehoux P, Dussurget O, Frangeul L, Cossart P (2002)Surface proteins and the pathogenic potential of Listeria monocyto-genes. Trends Microbiol 10:238-245

7. Cabanes D, Sousa S, Cebriá A, Lecuit M, García-del Portillo F,Cossart P (2005) Gp96 is a receptor for a novel Listeria monocyto-genes virulence factor, Vip, a surface protein. EMBO J 24:2827-2838

8. Calvo E, Pucciarelli MG, Bierne H, Cossart P, Albar JP, García-delPortillo F (2005) Analysis of the Listeria cell wall proteome by two-dimensional nanoliquid chromatography coupled to mass spectrome-try. Proteomics 5:433-443

9. Camejo A, Buchrieser C, Couve E, Carvalho F, Reis O, Ferreira P,Sousa S, Cossart P, Cabanes D (2009) In vivo transcriptional profilingof Listeria monocytogenes and mutagenesis identify new virulencefactors involved in infection. PLoS Pathog 5:e1000449

10. Dramsi S, Magnet S, Davison S, Arthur M (2008) Covalent attachmentof proteins to peptidoglycan. FEMS Microbiol Rev 32:307-320

11. Dramsi S, Trieu-Cuot P, Bierne H (2005) Sorting sortases: a nomen-clature proposal for the various sortases of Gram-positive bacteria.Res Microbiol 156:289-297

12. Gaillard JL, Berche P, Frehel C, Gouin E, Cossart P (1991) Entry ofL. monocytogenes into cells is mediated by internalin, a repeat proteinreminiscent of surface antigens from Gram-positive cocci. Cell 65:1127-1141

13. García-del Portillo F, Calvo E, D’Orazio V, Pucciarelli MG (2011)Association of ActA to peptidoglycan revealed by cell wall proteomicsof intracellular Listeria monocytogenes. J Biol Chem 286:34675-34689

14. García-del Portillo F, Pucciarelli MG (2012) Remodelling of theListeria cell wall inside eukaryotic cells. Communic Integr Biol 5:1-3

15. Glaser P, Frangeul L, Buchrieser C, et al. (2001) Comparative gen-omics of Listeria species. Science 294:849-852

16. Hain T, Chatterjee SS, Ghai R, et al. (2007) Pathogenomics of Listeriaspp. Int J Med Microbiol 297:541-557

17. Hain T, Hossain H, Chatterjee SS, et al. (2008) Temporal transcrip-tomic analysis of the Listeria monocytogenes EGD-e σB regulon.BMC Microbiol 8:20

18. Hendrickx AP, Budzik JM, Oh SY, Schneewind O (2011) Architects atthe bacterial surface - sortases and the assembly of pili with isopeptidebonds. Nature Rev Microbiol 9:166-176

19. Loh E, Gripenland J, Johansson J (2006) Control of Listeria mono-cytogenes virulence by 5′-untranslated RNA. Trends Microbiol14:294-298

20. Mariscotti JF, García-del Portillo F, Pucciarelli MG (2009) TheListeria monocytogenes sortase-B recognizes varied amino acids atposition 2 of the sorting motif. J Biol Chem 284:6140-6146

21. Marraffini LA, Dedent AC, Schneewind O (2006) Sortases and the artof anchoring proteins to the envelopes of Gram-positive bacteria.Microbiol Mol Biol Rev 70:192-221

22. O’Byrne CP, Karatzas KA (2008) The role of sigma B (σB) in thestress adaptations of Listeria monocytogenes: overlaps between stressadaptation and virulence. Adv Appl Microbiol 65:115-140

23. Ollinger J, Bowen B, Wiedmann M, Boor KJ, Bergholz TM (2009)

MARISCOTTI ET AL.


Listeria monocytogenes σB modulates PrfA-mediated virulence factorexpression. Infect Immun 77:2113-2124

24. Pallen MJ, Lam AC, Antonio M, Dunbar K (2001) An embarrassmentof sortases—a richness of substrates? Trends Microbiol 9:97-102

25. Personnic N, Bruck S, Nahori MA, et al. (2010) The stress-inducedvirulence protein InlH controls interleukin-6 production duringmurine listeriosis. Infect Immun 78:1979-1989

26. Pucciarelli MG, Bierne H, García-del Portillo F. (2007) The cell wallof Listeria monocytogenes cell wall and its role in pathogenicity. In:GoldfineH, Sghen H (eds), Listeria monocytogenes: pathogenesis andhost response. Springer-Verlag, New York, pp 81-110

27. Pucciarelli MG, Calvo E, Sabet C, Bierne H, Cossart P, García-delPortillo F (2005) Identification of substrates of the Listeria monocyto-genes sortases A and B by a non-gel proteomic analysis. Proteomics5:4808-4817

28. Reis O, Sousa S, Camejo A, Villiers V, Gouin E, Cossart P, Cabanes D(2010) LapB, a novel Listeria monocytogenes LPXTG surfaceadhesin, required for entry into eukaryotic cells and virulence. J InfectDis 202:551-562

29. Sabet C, Toledo-Arana A, Personnic N, et al. (2008) The Listeriamonocytogenes virulence factor InlJ is specifically expressed in vivoand behaves as an adhesin. Infect Immun 76:1368-1378

30. Spirig T, Weiner EM, Clubb RT (2011) Sortase enzymes in Gram-pos-itive bacteria. Mol Microbiol 82:1044-1059

31. Toledo-Arana A, Dussurget O, Nikitas G, et al. (2009) The Listeriatranscriptional landscape from saprophytism to virulence. Nature 459:950-956


Acknowledgement of InstitutionalSubscriptions

INTERNATIONAL MICROBIOLOGY staunchly supports the policyof open access (Open Access Initiative, see Int. Microbiol.7:157-161). Thus, the journal recognizes the help receivedfrom the many institutions and centers that pay for a sub-scription—in spite of the possibility to download completeand current issues of the journal free of charge. We wouldtherefore like to thank those entities. Their generous contribu-tion, together with the efforts of the many individualsinvolved in preparing each issue of INTERNATIONAL MICRO-BIOLOGY, makes publication of the journal possible and playsan important role in improving and expanding the field ofmicrobiology in the world. Some of those institutions andcenters are:

Area de Microbiología. Departamento de BiologíaAplicada. Universidad de Almería / Biblioteca. Institut Quí-mic de Sarrià. Universitat Ramon Llull. Barcelona / Biblio-teca. Instituto Nacional de Seguridad e Higiene en el Trabajo-Ministerio de Trabajo y Asuntos Sociales. Barcelona / Ecolo-gia microbiana, Fisiologia microbiana. Departament deGenètica i de Microbiologia. Universitat Autònoma de Bar-celona. Bellaterra (Barcelona) / Biblioteca. Institut de Bio-tecnologia i Biomedicina. Universitat Autònoma de Bar-celona. Bellaterra (Barcelona) / Laboratori d’Ecogenètica.Departament de Microbiologia. Universitat de Barcelona /Societat Catalana de Biologia–Institut d’Estudis Catalans.Barcelona / Departamento de Microbiologia. UniversidadeFederal de Minas Gerais. Belo Horizonte. Brasil / Departa-mento de Inmunología, Microbiología y Parasitología, Uni-versidad del País Vasco, UPV-EHU, Bilbao / Biblioteca.Universidad de Buenos Aires. Argentina / Biblioteca. Facul-tad de Ciencias. Universidad de Burgos / Biblioteca. Depar-tamento de Producción Animal CIAM-Centro Mabegondo.Abegondo (Coruña) / Laboratorio de Microbioloxia. Univer-sidade da Coruña. Coruña / Biblioteca. Divisió Alimentària

VOLUME 15(1) MARCH 2012


53

del IRTA-Centre de Tecnologia de la Carn. Generalitat deCatalunya. Monells (Girona) / Biblioteca Montilivi. Facultatde Ciències. Universitat de Girona / Área de Microbiología.Departamento de Ciencias de la Salud. Universidad de Jaén /Microbiologia. Departament de Ciències Mèdiques Bàsi-ques. Facultat de Medicina. Universitat de Lleida / Facultadde Ciencias. Universidad de Vigo / Laboratorio de Microbio-logía Aplicada. Centro de Biología Molecular. UniversidadAutónoma de Madrid-CSIC. Cantoblanco (Madrid) / Grupode Investigación de Bioingeniería y Materiales (BIO-MAT).Escuela Técnica Superior de Ingenieros Industriales. Univer-sidad Politécnica de Madrid / Biblioteca. Centro de Investi-gaciones Biológicas, CSIC. Madrid / Fundación CienciasMicrobianas. Servicio de Microbiología. Hospital Univer-sitario Ramón y Cajal, INSALUD. Madrid / Merck Sharp &Dohme de España, Madrid / Departamento de Microbiología.Facultad de Ciencias. Universidad de Málaga / Grupo deFisiología Microbiana. Departamento de Genética yMicrobiología. Universidad de Murcia. Espinardo (Murcia) /Library. Department of Geosciences. University ofMassachusetts-Amherst. USA / Biblioteca de Ciencias.Universidad de Navarra. Pamplona / Grupo de Investigaciónde Genética y Microbiología. Departamento de ProducciónAgraria. Universidad Pública de Navarra. Pamplona /Microbiología Ambiental. Departamento de Biología.Universidad de Puerto Rico. Río Piedras. Puerto Rico /Biblioteca General. Universidad San Francisco de Quito.Ecuador / Biblioteca. Facultat de Medicina. UniversitatRovira Virgili. Reus / Instituto de Microbiologia. Univer-sidade Federal de Rio de Janeiro. Brasil / Instituto de Micro-biología Bioquímica-Departamento de Microbiología yGenética. CSIC-Universidad de Salamanca / Departamentode Microbiología y Parasitología. Universidad de Santiagode Compostela. Santiago / Laboratorio de Referencia de E.coli (LREC). Facultad de Veterinaria. Universidad de San-tiago de Compostela. Lugo / Departamento de Genética.Universidad de Sevilla / General Library. Marine BiologicalLaboratory. Woods Hole, Massachusetts, USA.

General Information

INTERNATIONAL MICROBIOLOGY is a quarterly, open-access, peer-reviewed journal in the fields of basic and applied microbiology. It pub-lishes two kinds of papers: research articles and complements (editori-als, perspectives, books reviews, etc.).

Submission

Manuscripts must be submitted by one of the authors of the manuscriptby e-mail to [email protected]. As part of the submissionprocess, authors are required to comply with the following items, andsubmissions may be returned if they do not adhere to these guidelines:1. The work described has not been published before, including publi-cation on the World Wide Web (except in the form of an Abstract or aspart of a published lecture, review, or thesis), nor is it under considera-tion for publication elsewhere.2. All the authors have agreed to its publication. The correspondingauthor signs for and accepts responsibility for releasing this material andwill act on behalf of any and all coauthors regarding the editorial reviewand publication process.2. The submission file is in Microsoft Word, RTF, or OpenOffice docu-ment file format.3. The manuscript has been prepared in accordance with the journal’saccepted practice, form, and content, and it adheres to the stylistic andbibliographic requirements outlined in “Preparation of manuscripts.”4. Illustrations and figures are placed separately in another document.Large files should be compressed.

Copyright and license

If an article is accepted for publication in INTERNATIONAL

MICROBIOLOGY, the authors (or other copyright holders) must transferthe copyright to the journal, which covers the right—not exclusive—toreproduce and distribute the article including reprints, translations, pho-tographic reproductions, microforms, electronic form (offline, online)or any other reproduction of similar nature.

Creative Commons

The journal is published under a Creative Commons Attribution-NonComercial-ShareAlike 3.0 Unported License.

http://creativecommons.org/licenses/by-nc-sa/3.0/

All articles in INTERNATIONAL MICROBIOLOGY will be available on theInternet to any reader at no cost. The journal allows users to freelydownload, copy, print, distribute, search, and link to the full text of anyarticle provided the authorship and source of the published article iscited and it is not used for commercial purposes. We recommendauthors read about the Creative Commons Attribution-NonComercial-ShareAlike 3.0 Unported License before submitting their paper.

Open access and article processing charges

Open access publishing provides immediate, permanent, free onlineaccess to the full texts of all the journal’s peer-reviewed research arti-cles. It allows all interested readers to view, download, print, and/orredistribute any article without requiring a subscription on the principlethat making research freely available to the public supports a greaterglobal exchange of knowledge.

INTERNATIONAL MICROBIOLOGY’s open access policy enables a fargreater distribution and impact of an author’s work and is in the interestof the scientific community worldwide. The journal’s expenses for pro-viding immediate, permanent, free online access to the full text ofresearch articles are recovered partly from article-processing charges.Currently many research funding agencies not only allow these expens-es to be paid from their grants, but also encourage open access publica-tion. The journal’s standard processing fee is 800.00 €. If a manuscriptrequires extensive editorial work, an extra charge may be requested. Theacceptance of a paper, however, will not depend on the authors’ abilityto pay these charges. Individual waiver requests must be done during thesubmission process and will be considered on a case-to-case basis.

Information for Subscribers

INTERNATIONAL MICROBIOLOGY is published quarterly. Volume 14 willconsist of 4 issues—March, June, September and December—and willbe published during 2011.

Recommended annual subscription is 300.00 € plus shipping andhandling. Single-issue prices are available upon request. SAL (SurfaceAir Lifted) delivery is mandatory for Japan, Northeast and Southeast Asia,India, Australia and New Zealand. Airmail delivery to all other countriesis available upon request. Orders or claims can be sent directly to:

International MicrobiologyPoblet, 1508028 Barcelona, SpainTel. & Fax +34-933341079E-mail: [email protected]

Cancellations must be received by 30 September to take effect at theend of the same year. Change of address: allow six weeks for allchanges to become effective. Please contact [email protected] if you have any questions regarding your subscription.

Information for advertisers

For advertising inquiries, please contact us at [email protected]. All advertisements are subject to the publisher's approval.

Disclaimer

While the contents of this journal are believe to be true and accurate atthe date of its publication, neither the authors and editors nor the pub-lisher can accept any legal responsibility for any errors or omissions thatmay be made. The publisher makes no guarantee, expressed or implied,with regard to the material contained therein.

54

P3

Preparation of manuscripts

General informationResearch articles and research reviews should not exceed 12 pages, includ-ing tables and figures. The text should be typed in 12-point, Times NewRoman font, with one and a half line spacing, left justification, and no linenumbering. All pages must be numbered consecutively, starting with the tilepage.

The Title page should comprise: title of the manuscript, first name andsurname and affiliation (department, university, city, state/province, andcountry) for all authors. The address, telephone and fax numbers, and e-mailaddress of the corresponding author should also be included.

The Summary should be informative and completely comprehensible,briefly present the topic, state the scope of the experiments, indicate signif-icant data, and point out major findings and conclusions. It should notexceed 200 words. Standard nomenclature should be used and abbreviationsshould be avoided or defined. No references should be cited. Immediatelyfollowing the Summary, up to five Keywords should be provided; these willbe used for indexing purposes.

The Introduction should be concise and define the objectives of the workin relation to other work done in the same field. It should not give an exhaus-tive review of the literature.

Materials and methods should provide sufficient detail to allow theexperiments to be reproduced. However, only truly new procedures shouldbe described in detail; previously published procedures should be cited, andimportant modifications of published procedures should be mentionedbriefly. The suppliers of chemicals and equipment should be indicated if thismight affect the results. Subheadings may be used. Statistical techniquesused must be specified.

Results should be presented with clarity and precision. The results shouldbe written in the past tense when describing findings in the author’s experi-ments. Previously published findings should be written in the present tense.Results should be explained, but largely without referring to the literature.

The Discussion should be confined to interpretation of the results (not torecapitulating them), also in light of the pertinent literature on the subject.When appropriate, the Results and Discussion sections can be combined.This will be the case in research notes.

Acknowledgements should be presented after the Discussion section.Personal acknowledgements should only be made with the permission of theperson(s) named.

Competing interests should be declared by authors at submissionindicating whether they have any financial, personal, or professional inter-ests that could be construed to have influenced their paper.

References should be listed and numbered in alphabetical order. In thetext, citations should be indicated by the reference number in square brack-ets. The list of references should include only works that are cited in the textand that have been published or accepted for publication. Unpublished workin preparation, Ph.D. and Masters theses, etc., should be mentioned in thetext only, in parentheses. The author(s) must obtain written permission forthe citation of a personal communication or other’s researchers’ unpublishedresults. References cited in the text should be numbered and placed withinsquare brackets, referring to an alphabetized list at the end of the paper.

References should be in the following style:Published papers

Venugopalan VP, Kuehn A, Hausner M, Springael D, Wilderer PA,Wuertz S (2005) Architecture of a nascent Sphingomonas sp. biofilm undervaried hydrodynamic conditions. Appl Environ Microbiol 71:2677-2686

BooksMiller JH (1972) Experiments in molecular genetics. 2nd ed. ColdSpring Harbor Laboratory Press, Cold Spring Harbor, New York, USA

Book chaptersLo N, Eggleton P (2011) Termite phylogenetics and co-cladogenesis withsymbionts. In: Bignell DE, Yves R, Nathan L (eds) Biology of termites: amodern synthesis, 2nd ed. Springer, Heidelberg, Germany, pp.27-50

Please list the first eight authors and then add “et al.” if there are additionalauthors. Citation of articles that have appeared in electronic journals isallowed if access to them is unlimited and their URL or DOI number to thefull-text article is supplied.

Tables and Figures should be restricted to the minimum needed to clar-ify the text; a total number (F + T) of five is recommended. Neither tablesnor figures should be used to present results that can be described with ashort statement in the text. They also must not be integrated into the text.Figure legends must be typed double-spaced on a separate page and append-ed to the text. Photographs should be well contrasted and not exceed theprinting area (17.6 × 23.6 cm). Magnification of micrographs should beshown by a bar marker. For color illustrations, the authors will be expectedto pay the extra costs of 600.00 € per article. Color figures may be acceptedfor use on the cover of the issue in which the paper will appear. Tables mustbe numbered consecutively with Arabic numerals and submitted separatelyfrom the text at the end of the paper. Tables may be edited to permit morecompact typesetting. The publisher reserves the right to reduce or enlargefigures and tables.

Electronic Supporting Information (SI) such as supplementalfigures, tables, videos, micrographs, etc. may be published as additionalmaterials, when details are too voluminous to appear in the printed version.SI is referred to in the article’s text and is ported on the journal’s website(www.im.microbios.org) at the time of publication.

Abbreviations and units should follow the recommendations of theIUPAC-IUB Commission. Information can be obtained at:http://www.chem.qmw.ac.uk/iupac/.

Common abbreviations such as cDNA, NADH and PCR need not to bedefined. Non-standard abbreviation should be defined at first mention in theSummary and again in the main body of the text and used consistently there-after. SI units should be used throughout.

For Nomenclature of organisms genus and species names must bein italics. Each genus should be written out in full in the title and at first men-tion in the text. Thereafter, the genus may be abbreviated, provided there isno danger of confusion with other genera discussed in the paper. Bacterialnames should follow the instructions to authors of the International Journalof Systematic and Evolutionary Microbiology. Nomenclature of protistsshould follow the Handbook of Protoctista (Jones and Bartlett, Boston).

Outline of the Editorial Process

Peer-Review ProcessAll submitted manuscripts judged potentially suitable for the journal are for-mally peer reviewed. Manuscripts are evaluated by a minimum of two and amaximum of five external reviewers working in the paper’s specific area.Reviewers submit their reports on the manuscripts along with their recom-mendation and the journal’s editors will then make a decision based on thereviewers.

Acceptance, article preparation, and proofsOnce an article has been accepted for publication, manuscripts are thorough-ly revised, formatted, copy-edited, and typeset. PDF proofs are generated sothat the authors can approve the final article. Only typesetting errors shouldbe corrected at this stage. Corrections of errors that were present in the orig-inal manuscript will be subject to additional charges. Corrected page proofsmust be returned by the date requested.

Instructions for authors

INTERNATIONALMICROBIOLOGY

15(1)

2012

Inte

rnatio

nal M

icro

bio

log

y V

olu

me 1

5 N

um

ber 1

2012 p

p 1

-54

Published Quarterly by

Agricultural and Environmental Biotechnology Abstracts; ASFA/Aquatic Sciences & Fisheries Abstracts; BIOSIS; CAB Abstracts; Chemical Abstracts; SCOPUS;Current Contents®/Agriculture, Biology & Environmental Sciences®; EBSCO; EMBASE/Elservier Bibliographic Databases; Food Science and Technology Abstracts;ICYT/CINDOC; IBECS/BNCS; ISI Alerting Services®; MEDLINE®/Index Medicus®;Latíndex; MedBioWorldTM; SciELO-Spain; Science Citation Index Expanded®/SciSearch®

INDEXED IN

Volume 15 · Number 1 · March 2012 · ISSN 1139-6709

• Marc

h 2

012

IINNTTEERRNNAATTIIOONNAALL MMIICCRROOBBIIOOLLOOGGYYOfficial journal of the Spanish Society for Microbiology

RESEARCH ARTICLES

Schinke C, Germani JC

Screening Brazilian Macrophomina phaseolina isolates

for alkaline lipases and other extracellular hydrolases 1

Chen P, Yan L, Wang Q, Li Y, Li H

Surface alteration of realgar (As4S4)

by Acidithiobacillus ferrooxidans 9

Heindl H, Thiel V, Wiese J, Imhoff JF

Bacterial isolates from the bryozoan Membranipora membranacea: influence of culture media on isolation

and antimicrobial activity 17

García-Maldonado JQ, Bebout BM, Celis LB,

López-Cortés A

Phylogenetic diversity of methyl-coenzyme M reductase

(mcrA) gene and methanogenesis from trimethylamine

in hypersaline environments 33

Mariscotti JF, Quereda JJ, Pucciarelli MG

Contribution of sortase A to the regulation

of Listeria monocytogenes LPXTG surface proteins 43

Volume 15 · Number 1 · March 2012


Official journal of the Spanish Society for Microbiology

Documents

International Microbiology