Upload
haemid-amd
View
1.033
Download
5
Embed Size (px)
DESCRIPTION
International Student Biotechnology Congress
Citation preview
3rd
International Student Biotechnology Congress
In the name of God
3rd
International Student Biotechnology Congress
rd
International Student Biotechnology
Congress
May 6-8th
2013, Allameh-Amini Hall,
University of Tehran
3isbc.ir
3
3rd
International Student Biotechnology Congress
Organizers:
University of Tehran, Student Scientific Society of Biotechnology
Alzahra University, Student Scientific Society of Biotechnology
Committee Members:
Chair: Prof. Parviz Norouzi
Director: Ramin Fazel
Executive Chair: Fatemeh Gheidari
Scientific Chair: Dr. Mahdi Rahaie
Financial Manager: Pejman Shirazian
Public Relations Manager: Amir Banaei Esfahani
3rd
International Student Biotechnology Congress
Sponsors:
University of Tehran
Alzahra University
Cinnagen Company
Ministry of Science, Research and Technology
National Institute of Genetic Engineering and Biotechnology
Aryogen Biopharma
Institute for Research in Fundamental Sciences (IPM)
Sinaclon Company
Faculty of New Sciences and Technologies, University of Tehran
Stem Cell Technology Research Center
Biotechnology Development Council
3rd
International Student Biotechnology Congress
Conference Welcome Note
Research and investigation is one of the most important criteria of a society's
scientific development. An academic development is followed by an appropriate
training, actuating academic achievements, maintaining the youth capability,
sharpness and eagerness to aim a goal in research which makes modern societies
have young acumen involved in research fields. Most of worthwhile discoveries
and inventions are the fruit of youth age or have its roots in it.
I am honored to welcome you all to the "The 3rd
International Student
Biotechnology Congress" which is held by Student Scientific Society of
Biotechnology at University of Tehran and Alzahra University. This conference
is a worthy action which can encourages students and researchers to enter
researching fields. To meet all the conditions and facilities needed for this
academic investigative conference, the responsible panel particularly the director
Mr.Ramin Fazel, executive chair Ms.Fatemeh Gheidari, scientific chair Dr.Mahdi
Rahaie and public relations manager Mr.Amir Banaei Esfahani did lots of efforts
and I would like to appreciate them due to their feasible attempts.
Best regards,
Parviz Norouzi
Chairman of the 3rd
International Student Biotechnology Congress.
3rd
International Student Biotechnology Congress
Director Remarks
Reaching welfare, wealth and manufacturing is the main goal of all countries in
today's world. In this area, third world countries have sufficed with using natural
and nether resources. These countries are endeavoring to aim the target by
extracting these resources. On the other hand, circumspect countries have imitated
using developed technology instead of prospecting exhaustible resources. Using
these High-Tech fields such as Biotechnology, Nanotechnology and IT is the most
important device to actualize the concept of Earning money from science .
Unfortunately in our country, the first have been dominated up to now and have
been sustained from this point of view; therefore its the duty of scientists and
researchers to actuate the second view and propel people and government toward
it. Considering this point the Scientific Student Society of Biotechnology at
Univarsity of Tehran and Alzahra University are on the verge of holding
The 3rd
International Student Biotechnology Congress and are going to step
forward in making a progress in national level hoping it could gain such an aim.
Best Regards,
Ramin Fazel
Director of the 3rd
International Student Biotechnology Congress
3rd
International Student Biotechnology Congress
Scientific Committee Members:
Dr. Mehdi Alavi
Dr. Sedigheh Asad
Dr. Kayhan Azadmanesh
Dr. Valiollah Babaeipour
Dr. Behnaz Bakhshandeh
Dr. Mohammad Barshan Tashnizi
Dr. Shahin Bonakdar
Dr. Mehdi Dastgheib
Dr. Elahe Elahi
Dr. Jamshid Fouladi
Dr. Naser Ghaemi
Dr. Zahra Hajihassan
Dr. Monir Hosseinzadeh
Dr. Hamidreza Javadi
Dr. Mahbube Kabiri
Dr. Vahid Khalaj
Dr. Ali Mohammad Latifi
Dr. Sayed-Amir Marashi
Dr. Faramarz Mehrnejad
Dr. Mohammad MirDerikvand
Dr. Javad Mohammadnejad
Dr. Vahid Niknam
Dr. Ali Hossein Rezayan
Dr. Mehdi Sadeghi
Dr. Gholam reza Salehi
Dr. Sorush Sardari
Dr. Ehsan Seyedjafari
Dr. Zarvan Shahrzad
Dr. Meisam Tabatabaei
Dr. Ladan Teimoori-Toolabi
Dr. Masoud Tohidfar
Dr. Bagher Yakhchali
Dr. Mahboubeh Zarabi
3rd
International Student Biotechnology Congress
Executive Committee:
Hamideh Abbasi
Motahareh Agha Molaei
Hossein Akhoondi
Khadijeh Alishah
Mosab Asadi
Saba Asili
Saba Aslani
Farnoosh Azarian
Amin Azimi
Parizad Babaei
Soraya Bahari
Behnaz Bakhshandeh
Zeinab Bakhshi
Niloofar Dadkhah
Mohsen Dehghani
Ali Delavari
Samaneh Farajzadeh
Sudeh Farani
Sadaf Farsinejad
Armin Fazel
Hamideh Fouladiha
Tahereh Ghasemi
Zohreh Gheisary
Azadeh Hadadian Pour
Mahdieh Hadi
Samereh Hamedani
Raheleh Hamrahi
Sahar Hedayati Khah
Mahshid Heidary
Zhaleh Hosseini
Saeedeh Hosseinian
Mohadeseh Jamal Khan
Ali Karimi
Negin Katal
Narjes Kazemi
Arash Keshavarzi
Afrooz Khalili
Alireza Majd
3rd
International Student Biotechnology Congress
Yasaman Mian Mahaleh
Reihaneh Mir Hasani
Pouria Mirzavand
Azam Moosavi
Fatemeh Motamedi
Negin Motamedi
Mohammad Motealehi
Atena Mozafari
Narjes Nakhaei
Maryam Navaeian
Paria Pirasteh
Mohebat Pour Majidian
Amir Hossein Saadati
Zeinab Sadri
Mohammad Reza Sadrzadeh
Marzieh Sahebi
Mohammad Hasan Samiee Aref
Mohammad Reza Sarshar
Sajad Sarvari
Pejman Shirazian
Fatemeh Siahvashi
Salma Sohrabi
Sana Pour Tabatabaei
Andisheh Talaei
Meisam Yousefi
Roya Yousefi
Rafooneh Zafari
Mohammad Zim
3rd
International Student Biotechnology Congress
Responsibility for materials published in this collection is
solely with the authors. Be in printed in this series does
not indicate that the content where approved by the
scientific committee of the congress.
3rd International Student Biotechnology Congress
1
Contents Oral Presentation Abstracts ............................................................................................................. 12
Medical Biotechnology ................................................................................................................ 12
Human Papillomavirus Type 16- E7 DNA Vaccine: Mutation in the RB binding site of E7 gene
Enhances Specic Cytotoxic T-Lymphocyte Induction and Antitumor Activity........................... 12
Recombinant 36kDa outer membrane protein (Omp2b) of Brucella abortus Elicited Strong
Cytokine Responses in BALB/c mice ......................................................................................... 13
DHPLC-mutation scanning of the breast cancer predisposing gene BRCA2 in breast cancer
patients from the south of Iran ................................................................................................ 14
Expression of the TrkC gene and a novel long non-coding RNA located in the gene in different
cancerous cell lines .................................................................................................................. 15
Cautiously view point on the effect of essential oils as therapeutic materials for
neurodegenerative diseases .................................................................................................... 16
Preparation of EGF Receptor-Targeted Polyplexes for breast cancer therapy ........................... 17
Relationship between TNF-a(-308) and LT-a(+252) polymorphisms and acute lymphoblastic
leukemia in Northwest of Iran.................................................................................................. 18
Inhibition of oncogenic activity of WWP1 on breast cancer cell line with synthetic microRNA .. 19
Transcription-mediated Isothermal Amplification for Rapid Identification of Lishmania major
using Sequence-based Primers................................................................................................. 20
The Differentiation of Mesenchymal Stem Cells into lnsulin-producing Cells through
Transduction of a Lentivirus Containing IPF-1 Gene.................................................................. 22
Crocetin attenuates spatial learning dysfunction and brain damage after chronic cerebral
hypoperfusion in rats ............................................................................................................... 23
Cytotoxic and Apoptotic Activity of Scrophularia amplexicaulis in MCF-7 Human Breast Cancer
Cells ......................................................................................................................................... 24
RNA-binding protein Rbm47 binds to Nanog in mouse embryonic stem cells ........................... 25
Codon optimization, cloning and expression of single-chain variable fragment (scFv) antibody
against CD22 in PichiaPastoris and optimization of Expression conditions ................................ 26
Agricultural Biotechnology ........................................................................................................... 27
dabb1 ........................................................... 27
Transgenic expression and recovery of biologically active recombinant human insulin from
Arabidopsis thaliana seeds ....................................................................................................... 28
3rd International Student Biotechnology Congress
2
Evaluation Molecular, Physical and Mechanical Procedures for Determinate Grain Hardness in
Bread Wheat ........................................................................................................................... 30
Evaluation Molecular, Physical and Mechanical Procedures for Determinate Grain Hardness in
Bread Wheat ........................................................................................................................... 31
...................................... 32
Subcellular targeting of transiently expressed GFP using a plant virus based expression system
in planta .................................................................................................................................. 33
Genetic diversity of dwarfing Apples (Malusdomestica) of Iran AFLP markers .......................... 34
Molecular and phenotypic tracking of Stb4, a gene conferring resistance to septoria tritici
blotch of wheat ....................................................................................................................... 35
SUF4 CLF ...................................................... 37
cDNA PR10 (zea mays) ................................................................. 38
Microbial and Industrial Biotechnology ........................................................................................ 39
Nitrate reductase purification from a moderately halophilic microorganism, Salinicoccus
iraniensis ................................................................................................................................. 39
Comparison and Optimization of Expression of a Chimeric-Truncated t-PA by Pichia pastoris
Strains: GS115 and KM71 ......................................................................................................... 40
Isothermal-based Amplification Technology for Rapid Molecular Diagnosis of Pseudomonas
syringae pv. syringae using Loop and Bumper Primers ............................................................. 42
.............................. 43
Design and construction of the expression cassette for producing the Epithermal growth factor
with the ability of connecting to the collagen ........................................................................... 44
Wastewater Algae: A Potential Candidate for Biodiesel Production .......................................... 45
Effects of agitation on enhancement of bacterial cellulose production..................................... 46
Effect of Different Carbon Sources on Activity of Biocatalyst in Biocathode Microbial Fuel Cells
(BMFCs) ................................................................................................................................... 47
A novel method for optimization of biomass lipid extraction.................................................... 48
Molecular Biotechnology ............................................................................................................. 49
In-cell western analysis, a new method of evaluating cellular protein expression and cell toxicity
assays ...................................................................................................................................... 49
Preparation of recombinant single domain antibody against epidermal growth factor receptor
................................................................................................................................................ 50
ADSCs/ESCs Co-culture: a novel approach to increase the proliferation of ADSCs ..................... 51
A novel cold-inducible expression system for Bacillus subtilis 1A772 ........................................ 52
3rd International Student Biotechnology Congress
3
Isothermal-based Amplification Technology for Rapid Molecular Diagnosis of Pseudomonas
syringae pv. syringae using Loop and Bumper Primers ............................................................. 53
Probing the binding sites of Fediamsar and bovine serum albumin ........................................ 54
The benefits of lanthanide cofactors for the characterization and application of RNA-ligating
deoxyribozymes ....................................................................................................................... 55
Investigating the Effects of Interactions between Histidin and Other Amino acids on
Thermostability of Methylglyoxal synthase from Thermus sp.GH5 ........................................... 56
Cell-Mediated Responses Elicited by Immunization of BALB/c Mice with Recombinant
Eukaryotic Vector, pVAX1 Harboring omp28 of Brucella abortus, and Recombinant Omp28 as
booster .................................................................................................................................... 57
Nono-Biotechnology .................................................................................................................... 59
phage Nanobioparticle expressing Apoptin suppress only human breast carcinoma tumor
growth in vivo .......................................................................................................................... 59
Synthesis of Nanobody- Dendrimer Conjugates for Targeted Breast Cancer therapy ................ 60
Dendrosome-based delivery of siRNA against GFP gene in CHO-cell ......................................... 61
PLGA Nanoparticles Containing a Combination of Recombinant 31kda Surface Protein and
Detoxified Lipopolysaccharide of Brucella abortus Significantly Stimulated a Protective
Response in BALB/C Mice ........................................................................................................ 62
Design a hydrogen peroxide biosensor by use of catalase and modified electrode with
magnesium oxide nanoparticles ............................................................................................... 64
An assessment of CH50 activity in mice (Mus msuculus ) treated with silver nanoparticles during
skin wound healing .................................................................................................................. 65
Cell supports of GNP-chitosan nanocomposite/hyaluronic acid and chondroitin sulphate
systems. cell adhesion and proliferation study ......................................................................... 66
Blood Lead level measurement using two biosensors pGL3-luc/pbr and pGL3-luc/cad ............. 68
Evaluation of ESAT-6 and CFP-10 proteins expression of Mycobacterium bovis at RNA level and
evokes cellular immunity in mice with proliferation lymphocyte method ................................. 69
Bioinformatics ............................................................................................................................. 71
Modeling and Molecular Dynamics Simulation of Survivin and Effect of T34A Mutation on its
Structure ................................................................................................................................. 71
From microarray data to gene expression pattern, network and protein analysis in Mus
musculus under Helicobacter pylori infection .......................................................................... 72
Preparing Draft Genome-Scale Metabolic Network of Bacillus licheniformis based on the
Reconstructed Metabolic Network of Bacillus subtilis .............................................................. 73
Poster Presentation Abstracts ......................................................................................................... 74
3rd International Student Biotechnology Congress
4
Medical Biotechnology ................................................................................................................ 74
Investigation of mouse embryonic stem cells proliferation on surface modified of aligned and
random nanofibrous PCL scaffolds ........................................................................................... 74
Stem Cells and Gene Therapy for Cartilage and Bone Repair .................................................... 76
Immunogenicity Prediction of the Chimeric Protein Consists of Shiga and Cholera Toxins B-
Subunits Using Bioinformatics approaches ............................................................................... 77
Immune Response to Combination of Recombinant Ag85B and Ag85C of Mycobacterium
tuberculosis in C57BL/6 Mice ................................................................................................... 79
Enhanced production of recombinant human Growth Hormone in Chinese Hamster Ovary cells
in presence of Dimethyl sulfoxide ............................................................................................ 80
Homozygosity mapping in an Iranian pedigree affected with muscular dystrophy limb girdle
(LGMD) reveals linkage to 2p12-14 and 10q25-26 chromosomes ............................................. 81
Targeting of the signal transducer Smo links microRNA-326 to the oncogenic Hedgehog
pathway in drug resistant CD34+ CML stem/progenitor cells ................................................... 82
..................................................................................... 83
The suitable purification method for investigation on Alpha-synuclein involved in Parkinson
disease .................................................................................................................................... 84
MicroRNA Profiling as a New Approachfor Early Detection of Breast Cancer ............................ 85
Investigating the different combinations of five monoclonal antibodies in ELISA development to
detect 26kDa antigen of H. Pylori ............................................................................................. 86
Inhibition of survivin restores the sensitivity of breast cancer cells to docetaxel and vinblastine
................................................................................................................................................ 87
Approaches to detect matrix metalloproteinases (MMPs) as disease biomarkers ..................... 88
mRNA and microRNA Transferring by Microvesicles ................................................................. 89
EGFR expressing tumor model establishment to evaluate the efficacy of mimotope vaccine .... 90
Genotype Analysis of CCR5-59353-C/T Using PCR Allele Specific Amplification in Iranian normal
population ............................................................................................................................... 91
Recombinant Omp19 combined with detoxified LPS Elicited Protective Immunity against
Brucella melitensis infection in BALB/c Mice ............................................................................ 92
Linkage of a locus for autosomal recessive familial spastic paraplegia to chromosome 8q24 .... 93
Comparing specific genes expression in differentiated and undifferentiated cells derived BMSCs
during BMP-4 and 4mT SMF treatments .................................................................................. 94
Generation of a pLEX-lamp-darpins chimeric lentiviral vector for expression of DARPins in
exosomes surface for breast cancer gene therapy.................................................................... 95
In vitro anti HIV-1 testing of (2, 3-diaryl-1, 3-thiazolidin-4-one) derivatives against HIV-1 ......... 96
3rd International Student Biotechnology Congress
5
The response of human breast cancer cells to the non-thermal atmospheric pressure plasma . 97
.......................................................... 98
The role of p-glycoprotein in resistance of lung cancer............................................................. 99
Phylogenetic Analysis of HLA-B27 Various Alleles based on Coding Sequence Using in silico AFLP
Technique .............................................................................................................................. 101
2- ....................................... 103
Enzybiotics and their applications in medicine ....................................................................... 104
......................................... 105
Adapting SyberGold and Loop-mediated Isothermal Amplification for Rapid Molecular
Detection of Human Influenza Virus ....................................................................................... 105
MicroRNA mediated knockdown of STAT3 reduces breast cancer stem cells viability ............. 106
-2 " "
.............................................................................................................................................. 108
Recombinant TraQ of Brucella melitensis Elicited Potent IFN- and IL-12 Response in BALB/c
Mice ...................................................................................................................................... 109
Tri-block copolymer: An efficient membrane sealant recovers sever spinal cord injury .......... 111
The cytotoxic effects of the organophosphates chlorpyrifos on human lymphoid cells in vitro113
Induction of cardiac differentiation through overexpression of microRNA-1 in human-induced
pluripotent stem cells ............................................................................................................ 114
Diagnosis of Breast cancer with saliva samples: A review ....................................................... 115
RNAi-based fusion oncogene knockdown; a plausible strategy for cancer therapy ................. 116
CagA EPIYA-C ................................... 117
Cyclin D1 expression in brain tissue of a murine model of alzheimers disease ....................... 118
.................................................................. 119
Cloning and Molecular Characterization of an Immunogenic LipL41 Protein of Leptospira
interrogans Serovar Icterohaemorrhagia ............................................................................... 120
Detection of Borna Disease Virus p24 RNA in peripheral blood cells of obese patients in Iran 121
Designing specific ARMS tetra-primers of C/T polymorphism in promoter region of F8 gene.. 122
Effect and mechanism of Sphingosin 1-Phosphate in malignant behavior of lymphocytic
leukemia and non-smallcell lung cancer cells ....................................................................... 123
Spermicidal activity of Arum maculatum L. on human sperm ................................................. 124
Investigation of genes expression in differentiated cells derived BMSCs during BMP-4
treatments with FTIR ............................................................................................................. 125
16141 rs NPY ......... 126
3rd International Student Biotechnology Congress
6
Pluripotency features in adipose tissue-derived stem cells ..................................................... 127
Agricultural Biotechnology ......................................................................................................... 128
Agrobacterium rhizogenes Mediated Induction of Recombinant Tobacco Hairy Roots Expressing
the Chimeric stxB-ctxB Gene .................................................................................................. 128
............................................................................... 130
(Iris spp.) ISSR ........................... 131
Iris .................................................................................. 132
Plantlet regeneration from hairy root cultures of Atropa belladonna Hamadan sp ................. 133
MTLD ................................................... 134
................................ 135
Molecular characterization and assessment inter and intra diversity of some prunus species In
Iran by AFLP marker ............................................................................................................... 136
(Solanum tuberosum L.)
................................................................................................................... 137
....................... 138
Tissue culture and somaclonal variation in M7 rootstock ..................................................... 139
Optimization of Cronobacteriocin DGH2 a bacteriocin inhibiting Xanthomonas axonopodis pv.
Citri ....................................................................................................................................... 140
Characterization of cronobacteriocin DGH2 an anticitrus canker disease bacteriocin ............. 141
Contamination of cattle slaughtered in the city KazerounE.coli O157: H7 in 2012 .................. 142
Construction of a genetic linkage map with SSR, AFLP and morphological markers to locate QTLs
controlling pathotype-specific powdery mildew resistance in diploid roses ............................ 143
Assessment Of Regeneration Of Stevia Rebaudiana By Seed .................................................. 144
Marker Assisted Selection for Overexpressed Bx7 Gene (Bx7OE) Effective in Bread Wheat
Quality ................................................................................................................................... 145
Validation and Identification GPC-B1 Gene Effective in High-Grain Protein Content in the Wheat
Cultivars and Advance lines.................................................................................................... 146
Identification and Distribution of the Photoperiod Insensitive Allele in Ppd-D1 locus in Wheat
.............................................................................................................................................. 147
Application of Allele-Specific Markers for Identification of Different Sources of 1AL/1RS and
1BL/1RS WheatRye Translocations in Wheat ........................................................................ 148
Allelic Variation at the Vernalization Genes Vrn-A1, Vrn-B1, Vrn-D1, and Vrn-B3 in Iranian
Wheat Cultivars and Their Association with Growth Habit ..................................................... 149
................................................ 150
3rd International Student Biotechnology Congress
7
Analysis of molecular methods for producing glyphosate resistance .................................... 151
Evaluation of allelic variation and assessment of quality of storage proteins in Iranian durum
wheats ................................................................................................................................... 152
PROLIFRATION OF MOHREKHOSH (ZHUMERIA MAJDAE Resh. f. & Wendelbo) BY SEED
GERMINATION AND CALLUS INDUCTION ............................................................................... 153
Proliferation of Mouhrekhosh(Zhumeria Majde Resh.f.& wendelbo) by seed germination and
callus induction ...................................................................................................................... 155
Molecular and phenotypic tracking of Stb4, a gene conferring resistance to septoria tritici
blotch of wheat ..................................................................................................................... 156
Identification of single nucleotide polymorphism in exon 26 of apoB gene in khazak breed
chickens ................................................................................................................................. 157
Prevalence of foot and mouth disease virus (FMDV) in carrier cow reffered to Khorasan Razavi
industrial abattoir by Realtime quantitative PCR (q-PCR) ........................................................ 158
............................... 159
(Glycyrhiza glabra) ................................................................................................................. 159
New techniques in development of transgenic animal technology ......................................... 160
Morphological investigation of hairy roots induced in Datura metel ...................................... 161
Application of vermicompost as a carrier of phosphate solubilizing bacteria (Pseudomonas
fluorescens) in increase growth parameters of maize ............................................................ 162
Divesity of iranian genotypes for seed storage proteins and storage proteins and
two_dimensional protein pattern in genotypes with high and low oleic acid .......................... 163
Transcripts pattern in bread wheat under drought stress ....................................................... 164
................................ 165
.......................................................................................................... 166
Investigation of callus induction, regeneration and BYMV virus elimination by meristem tip
culture in three cultivars of Gladiolus ..................................................................................... 167
Microbial and Industrial Biotechnology ...................................................................................... 168
Optimization of algal lipid extraction for biodiesel production (hexane) ................................. 168
............................................................................ 169
Cloning, Expression, Purification and in Silico Analysis of the Brucella Urease ........................ 170
Enhanced production of recombinant human Growth Hormone in Chinese Hamster Ovary cells
in presence of Dimethyl sulfoxide .......................................................................................... 171
PCR ....................................................... 172
3rd International Student Biotechnology Congress
8
Optimization of amylase and protease co-produced by Bacillus licheniformis using economical
medium ................................................................................................................................. 173
Molecular detection of TEM-derived ESBLs and CTX-M gene in E. coli from fecal of canaries,
lovebirds and pigeons in regions of Iran ................................................................................. 174
Survey Pathogenicity of Listeria monocytogenes and Listeria Ivanovii isolated from silage in
mice ...................................................................................................................................... 175
Microbial bio-degradation of polyethylene ............................................................................ 177
Stable immobilization of Aspergillus niger phytase on perlite; activity and stability ................ 178
Multi Drug Resistance of Genomic Islands in Haemophilus influenza Isolated from Clinical
Isolates of Iran ....................................................................................................................... 179
Aspergillus Niger
Aspergillus Niger .......................................................................................... 180
......................................................................... 181
In vitro proteome analysis of an Iranian strain (NIGEB-088) of Xanthomonas citri subsp. Citri 182
Using microarray data to construct network and its analysis for kidney transplantation rejection
.............................................................................................................................................. 184
........................................................ 185
Isolation of a Native Bacillus cereus Amylase Producer from Hot spring of sabalan mountain 186
Comparison of expression of single chain variable fragment of anti human CD4 receptor
antibody fused to green fluorescent protein in two strains of Escherichia coli using flow
cytomerty .............................................................................................................................. 187
In vitro evaluation of co-aggregation effect of probiotic lactobacilli on mutans streptococci .. 188
Microbial diversity of culturable halophilic and halotolerant bacteria from Urmia Salt lake .... 190
........................................... 191
The Assessment of Substrate Preference of Microbial Biocatalysts in Biodesulfurization ........ 192
Suitable strategies for heterologous expression and purification of membrane proteins ........ 193
Effects of phosphate limitation on Saccharomyces cerevisiae gene expression pattern and its
expression network analysis .................................................................................................. 194
Antibacterial activity of methanol extract of the leaves and fruit of Chenopodium foliosum
(Moench) Asch against four strains of Gram-negative pathogenic bacteria ............................ 195
Molecular cloning of Fusion of GP96gene and Kinetoplastid membrane protein-11(KMP-11) of
Leishmania infantum in pET28a vector as a candidate for vaccine preparation against visceral
leishmaniasis ......................................................................................................................... 196
Design of a gene construct by Intein self-splicing properties in order to EGF protein expression
in E.coli .................................................................................................................................. 197
3rd International Student Biotechnology Congress
9
Antibacterial activity of Echium amoenum aqueous and ethanolic extracts............................ 198
Evaluation of Molecular Farming Industry in the Production of Recombinant ........................ 199
................... 200
: ........................................................... 201
Quantitative competitive PCR assay for detection of Lactobacillus acidophilus in probiotic
yogurts .................................................................................................................................. 202
Application of vermicompost as a carrier of phosphate solubilizing bacteria (Pseudomonas
fluorescens) in increase growth parameters of maize ............................................................ 203
Design and Construction of Rotary Biological Contactor (RBC) for enhancement of microbial
cellulose Production .............................................................................................................. 204
Production of truncated recombinant nmp22 protein reactive towards commercial antibody
and inducing immune system for polyclonal response ........................................................... 205
The effectiveness and enzyme potential of honey for inhinition of growth on Pseudomonas
aeruginosa, Staphylococcus aureus, Escherichia coli .............................................................. 206
Identification of GABA production by Lactobacillus casei and Lactobacillus parcasei and
characterization of their glutamate decarboxylase gene ........................................................ 207
Construction of an Eukaryotic Plasmid Encoding ESAT-6 gene of Mycobacterium Bovis as a
Candidate for DNA Vaccine .................................................................................................... 208
Developing of effective enzyme based biofuel cells ................................................................ 209
Molecular Biotechnology ........................................................................................................... 210
................................. 210
GFP M13 ................ 211
Analysis of intratype E6 variants of Human papillomavirus type 31, 52 and 58 in Indian HIV-
positive women with different cervical disease status: a pilot study ....................................... 212
Using a combination of mutations in photoprotein aequorin to application study .................. 213
Modification of Collagen- Chitosan Scaffold by PVA for Skin Tissue Engineering Application .. 214
Cloning and overexpression of miR-939 in HUH7 cell line ....................................................... 215
Efficient expression of laccase gene from Bacillus pumilus ..................................................... 216
The study of interaction between -Lactoglobulin with retinol at monomer and dimmer
conditions by circular dichroism ............................................................................................. 217
...................... 218
............................................................................. 219
Translational targeting of breast cancer cells using construct containing 5UTR of bFGF......... 221
BRCA1 ................ 222
3rd International Student Biotechnology Congress
10
Molecular aspects on the interaction of isatin-3-isonicotinylhydrazone to deoxyribonucleic acid
.............................................................................................................................................. 223
.............................................................................................................................................. 224
Isolation, Cloning and Expression Verification of the Mycobacterium Bovis CFP-10 Gene in
BALB/c mice........................................................................................................................... 225
Protein engineering of bacterial -xylosidase by Site-directed mutagenesis and expression in
Pichia pastoris........................................................................................................................ 226
Optimization of Genomic DNA Extraction of Mistletoe (Viscum album) .................................. 227
Pluripotency features in adipose tissue-derived stem cells ..................................................... 228
ND3 mitochondrial genes, a good candidate for DNA Barcoding ............................................ 229
Nono-Biotechnology .................................................................................................................. 230
Experimental Study of Nanoarchaeosomal Carrier for Paclitaxel on MCF-7 Cell Line............... 230
Application of siRNA nanoparticles in stem cells differentiation ............................................. 231
The investigation of Electron transfer mechanism of glucose oxidase at graphene and graphene
oxide electrode ...................................................................................................................... 232
The use of chitosan nanoparticles as new anticancer drug carrier system .............................. 233
Viral-mediated gene delivery against cancer metastasis......................................................... 234
Metal nanoparticle production assisted by -amylase............................................................ 235
Co-delivery of shRNA and DNA by a neutral phospholipid-based bilayer nanosystem ............. 236
Transcriptional targeting of breast cancer stem cells using anti-HER2 nanobody targeted
dendrimeric nanoparticles ..................................................................................................... 237
Spectroscopic studies of the interaction of a novel silver nanoparticles with bovine serum
albumin ................................................................................................................................. 239
Antibacterial properties of magnetic hydrogel nanocomposite based on salep- poly (acrylic acid)
.............................................................................................................................................. 240
Controlled release of defrasirox through magnetic hydrogel nanocomposite based on salep-
poly (acrylic acid) ................................................................................................................... 241
RNAi-based fusion oncogene knockdown; a plausible strategy for cancer therapy ................. 242
Investigation of the effects of nanoparticles ZnO on the histopathological of lung rat ............ 243
( )
Monobromobimane ....................................................................................... 244
Fluorescence spectroscopic evaluation of Cu-diamsar-bovine serum albumin interactions .... 245
3rd International Student Biotechnology Congress
11
Study of the Forster resonance energy transfer between [Co (diNOsar)] Cl3 and bovine serum
albumin ................................................................................................................................. 246
Bioinformatics ........................................................................................................................... 247
(SNPs) (GWAS)
.............................................................................................................................................. 247
...... 248
Evaluating relationship in cytokines level, Fibromyalgia Impact Questionnaire and Body Mass
Index in women with Fibromyalgia Syndrome ........................................................................ 249
Modeling and Molecular Dynamics Simulation of Survivin and Effect of T34A Mutation on its
Structure ............................................................................................................................... 250
Prediction and modeling of Phytasethermostable structure based on bioinformatics tool ..... 251
Determination of Listeriolysin O protein structure using Homology Modeling ........................ 252
Using percolation theory for studying Studying the relationship between robustness against
mutations in metabolic networks and lifestyle of organisms .................................................. 253
Phylogenetic Analysis of HLA-B27 Various Alleles based on Coding Sequence Using in silico AFLP
Technique .............................................................................................................................. 254
cDNA ....... 255
Prediction of subnuclear location of proteins using Artificial Immune System ........................ 256
Analysis Some of the Features Bioinformatics CSN3 Gene in Dairy Cattle ............................... 257
The Study of Human Glucose-6 Phosphatase Protein Structure using Homology Modeling .... 258
In silico Search and Synthesis Design of 3- (phenyl) acrylonitrile Derivatives and Evaluation Anti-
inflammatory Properties with Marvin Sketch Software .......................................................... 260
Bioinformatics Study Of microRNAs To Identify Genes and Cellular Pathways Associated With
Medulloblastoma................................................................................................................... 261
The Identifying Of Diagnostic Markers In Prostate Cancer By The Use Of EST-SSRs ................. 262
General Biotechnology .............................................................................................................. 263
................................................................... 263
.................................................................................................... 264
........................................................................................... 265
.................................................................................. 266
3rd International Student Biotechnology Congress
12
Oral Presentation Abstracts
Medical Biotechnology
Human Papillomavirus Type 16- E7 DNA Vaccine: Mutation in the RB binding
site of E7 gene Enhances Specic Cytotoxic T-Lymphocyte Induction and
Antitumor Activity
Armina Alaghebandbahrami golestan university of medical science
Amir Ghaemi* golestan university of medical science
Introduction:Increasing evidences has suggest that infection with high-risk human papillomavirus
(HPVs) is closely associated with cervical cancer. The HPV16-E7 oncoprotein has been shown to be
continuously expressed in cervical carcinoma cells, therefore it is an attractive tumor-specic
antigen target for immunotherapy of patients with cervix dysplasia and cancer.For safety reasons,
we design and construct a modified the E7 gene with reduced oncogenecity (HPV-16 MUT E7).
Material and Methods:The construct was synthesized and cloned in pEX cloning vector and its
accuracy was confirmed by sequencing. Then the construct was transformed to competent E.coli
Top10F and prepared in mini scale. After Subcloning in to pCDNA3 eukaryotic expression vector,
CHO cell line were transfected with vectors expressing MUTE7 and wild E7 and characterized by SDS
page and Western Blotting. Confirmed constructs were administrated in C57BL/6 tumor mice model
as therapeutic vaccines and different aspects of cellular immune response were evaluated. For this
purpose, MTT cell proliferation assay, LDH assay and cytokine assay were performed.
Results:The results showed that the genes of E7 wild and E7 MUT were successfully cloned and
expressed compared to negative control vector.
Immunization of mice with vaccine expressing the MUT E7 gene produced signicantly stronger E7-
specic cytotoxic T-lymphocyte response and better tumor suppression in mice than did a wild-type
E7 DNA vaccine expressing a stable E7 protein.
Conclusion: Our results suggests that MUT E7 may be useful for DNA immunization and
development of anti-cancer vaccines against HPV-16 mediated cancers.
Keywords: cervical cancer, human Papilloma virus,oncogenicity,DNA vaccines,mutation
3rd International Student Biotechnology Congress
13
Recombinant 36kDa outer membrane protein (Omp2b) of Brucella abortus
Elicited Strong Cytokine Responses in BALB/c mice
Sara Aryanfar * Islamic Azad University-Karaj branch
Nima Khoramabadi Islamic Azad University-Karaj branch
Haniyeh Aghababa Tarbiat Modares University
Majid Sohrabi Tarbiat Modares University
Nazanin Nazanin Islamic Azad University-Karaj branch
Introduction : Brucellosis is an important zoonotic disease which is globally prevalent. Prevention of
the disease in animals is based on attenuated vaccine strains which are highly pathogenic for human
hosts. Immunologic evaluation of Brucella antigens has a substantial role in vaccine investigations.
We report the production of recombinant 36kDa outer membrane protein Brucella abortus (Omp2b)
in E. coli host and evaluation of IFN-, IL-12 and IL-4 responses in mice which were immunized with
this protein.
Materials and methods omp2b gene was cloned in pET28a(+) and expression of protein performed
in E coli BL21(DE3). Recombinant Omp2b (rOmp2bpET28) was purified using nickel affinity
chromatography. 6-8 weeks old BALB/c mice were immunized with 20g rOmp2bpET28 formulated
in Freunds adjuvant, subcutaneously. Mice received a primary dose followed by two boosters with
12 days of interval. A week after last booster, mice were sacrificed and their spleen lymphocytes
were cultures; all cultures were subsequently stimulated with rOmp2bpET28. Production of IL-4, IL-
12 and IFN- was evaluated in lymphocyte cultures by ELISA
Results : Level of IL-4, IL-12 and IFN- were significantly higher in mice immunized with
rOmp2bpET28. Production of IFN- was higher than that of IL-4 and IFN-/IL-4 ratio suggested that a
cell-mediated response had been developed in mice receiving rOmp2bpET28.
Conclusion : rOmp2bpET28 strongly stimulated the development of immune responses in BALB/c
mice. The cellular-type response also makes it an appropriate antigen for further investigations of
brucella vaccines.
Keywords : Brucellosis, Brucella abortus, Omp2b
3rd International Student Biotechnology Congress
14
DHPLC-mutation scanning of the breast cancer predisposing gene BRCA2 in
breast cancer patients from the south of Iran
Safoora Deihimi Shiraz Institute for Cancer Research, Shiraz University of Medical Sciences
Nasrollah Erfani Shiraz Institute for Cancer Research, Shiraz University of Medical Sciences
Abdol Rasoul Talei Department of Surgery, Shiraz University of Medical Sciences
Abbas Ghaderi * Shiraz Institute for Cancer Research, Shiraz University of Medical Sciences
Introduction : Germline mutations in Breast Cancer gene (BRCA2) confer an estimated cumulative
lifetime risk of breast cancer of 5684%. Furthermore, the cancer-founder effects of BRCA mutations
have been suggested to be race and ethnic population-specific. Previous investigations of our group
indicated no association of known founder mutations in BRCA genes (185delAG, 5382insC, 6174delT)
with familial breast cancer in Iranian populations. As a part of a larger project searching for BRCA
founder mutations in Iranians, we aimed in the present study to investigate germ-line mutations in
exon 11E of BRCA2 gene in females with familial breast cancer in south of Iran.
Materials and methods : DNA was extracted from peripheral blood samples of 70 affected women
with familial breast cancer, and 70 age-sex matched healthy subjects. Denaturing high performance
liquid chromatography (DHPLC) method, using Transgenomic WAVE 4500 system, was applied for
genetic pre-screening of BRCA1 gene in order to reduce the cost and time for the analysis of this
gene. Chromatograms analysis was performed with Navigator Software 2.2.0. Mutation positive
amplicons had to be subsequently sequenced by direct DNA sequencing using BigDye Terminator
chemistry and ABI 310 sequencer.
Results : A Novel point mutation was detected in exon 11E of BRCA2 gene of patients. The frequency
of G/T missence mutation (c.[5961G>T]) causing Glutamine 1987 with Histidine substitution was
12.9% of 70 breast cancer patients. The mutation was not detected in none of controls and all the
patient carriers were heterozygote for the mutation.
Conclusion : This study indicated identification of a novel mutation in exon 11E of BRCA2 gene,
suggesting appropriate target for further investigations as a founder mutation in Iranian population.
In this regard, utilizing a fast and reliable mutation pre-screening method like DHPLC can help to
accelerate mutations scanning in BRCA genes of carrier females.
Keywords : Breast Cancer, DHPLC, BRCA2 gene
3rd International Student Biotechnology Congress
15
Expression of the TrkC gene and a novel long non-coding RNA located in the
gene in different cancerous cell lines
Sadat Dokanehiifard Tarbiat modares university
Bahram* Mohammad Soltani Tarbiat modares university
Fahime Hosseini Tarbiat modares university
Hadi Najafi Tarbiat modares university
Seyad Ali Mousavizadeh Tarbiat modares university
Introduction : TrkC gene plays a critical role in proliferation, differentiation and survival of the
developing neurons. There is no data about the mechanisms of different roles of TrkC gene. There
are reports on Trk family expression in neoplasms as well, namely, the primitive neuroectodermal
tumors of childhood, and in adult astrocyticgliomas. TrkC expression is also reported in breast cancer
samples.
Materials and methods : In our previous study, a novel long non-coding RNA (N-lncRNA) located in
TrkC gene was identified. Here we examined 15 tumorcell lines (identified as glioma, lung,
hepatoma, cervix, breast and etc), for the expression of TrkC gene as well as N-lncRNA located in it.
Results : Result of our study revealed that TrkC gene and the N-lncRNA are differentially expressed in
these cell lines.
Keywords : TrkC, non-coding RNA, cancer
3rd International Student Biotechnology Congress
16
Cautiously view point on the effect of essential oils as therapeutic materials
for neurodegenerative diseases
Masoome Khalife National Institute of Genetic Engineering and Biotechnology
Farhang Aliakbari National Institute of Genetic Engineering and Biotechnology
Dina Morshedi* National Institute of Genetic Engineering and Biotechnology
Introduction: Neuronal death, mainly apoptosis, is the cause of the indication of many human
neurodegenerative diseases, such as Parkinsons and Alzheimers. Recognition of the mechanisms
which prevent or promote apoptosis in nerve cells come new manner for treating
neurodegenerative disorders. A major component of protein plaques in synucleinopathies, especially
Parkinsons disease is alpha-synuclein which its aggregation in dopaminergic cells promotes
apoptosis. Nowadays, preventing protein fibrillation might be one of the main options to treat
neurodegenerative diseases.
Materials and Methods: In the present study the effect of several essential oils including Myrtus
communis, Spearmint, Citrus sinensis, Citrus limon, Tarragon, Mentha pulegium, Thymus vulgaris
and Rosmarinus officinalis on the inhibition of alpha-synuclein fibril formation was investigated.
Furthermore their cell cytotoxicity on the pc12 pheochromocytoma cells was assessed using MTT,
LDH, DNA fragmentation and anexin V methods
.
Results: The fibrillation of alpha-synuclein was monitored by the standard tests. Results indicated
that adding some of these essential oils to the samples could inhibit fibril formation of alpha-
synuclein significantly. On the other hand some of them did not change the fibrillation process and
some induced such process. For examining the prevention of apoptosis by adding these supplements
to fibrils, they exposure to dopaminergic pc12 cell line. Result showed that all essential oil had
destructive cytotoxicity effects even at low concentrations and it was a general phenomenon for
essential oils.
Conclusion: Results demonstrated that albeit some of the noted essential oils had potential to
prevent fibrillation but they were highly toxic for cell which may lead to apoptosis. Due to their well
inhibitory effect, essential oil must be fractioned and those fractions which can prevent fibrillation
with no toxicity on cell, are introduced for further study in neurodegenerative diseases medication.
Key words: Alpha-synuclein, Essential oils, Neurodegenerative diseases, Park
3rd International Student Biotechnology Congress
17
Preparation of EGF Receptor-Targeted Polyplexes for breast cancer therapy
Mosleh Mohamadi Rad Laboratory of Microanalysis, Institute of Biochemistry and Biophysics, University of Tehran Hedayatollah Ghourchian Laboratory of Microanalysis, Institute of Biochemistry and Biophysics, University of Tehran Davoud Ahmadvand * School of Allied Medical Sciences, Tehran University of Medical Sciences, Tehran, Iran
Introduction : Breast cancer is one of the problems threatening human health in the developed
countries. Today, advances in molecular techniques have influenced on the field of cancer
treatment. Among molecular methods, gene therapy and drug carrier nanoparticles are the most
prominent threatments. Gene therapy has considerable development in recent years. Successful
gene therapy depends on several factors; one of the most important is targeted delivery of
therapeutic genes into cancer cells without trauma to normal cells. Therefore, in this study we
decided to target the cancer cells at two levels: first, targetting at transcription level and second by
use of targeted nanocarriers with antibody against human epidermal growth factor receptor 2
(HER2) which is over-expressed in breast cancer cells. In this study, we decided to synthesis PAMAM
(Poly(amido amine))-PEG-Trastuzumab polyplexes containing a killer gene construct.
Materials and methods : G5 PAMAM dendrimers conjugated to PEG in different ratios and TNBS
assay was used for determination the number of PEG attached to each dendrimer molecule.
Thiolated Trastuzumab (a monoclonal anti-HER2 antibody) was conjugated to PAMAM/PEG.
Polyplexes (complexes of PAMAM and DNA) were generated at different N/P ratios. Particle size and
zeta-potential of polyplexes was measured by dynamic light scattering. These polymers were used to
deliver a killer gene under the control of a breast cancer specific promoter to HER2 expressing BT474
cell line and HER2 non-expressing MCF10A cell line as negative control. Transfection efficiency of
different denriplexes was determined using Real Time PCR assay.
Results : The conjugation of PEG and anti-HER2 antibody was confirmed by TNBS and ELLMAN assay.
Different Pegylation degree and N/P ratios affect the particle size and zeta-potential. The best
concentration ratio of the components (PEG and DNA constructs) was determined in order to
achieve the most efficient complexes for transfection. Real Time PCR results showed that PAMAM-
PEG-Trastuzumab has higher transfection efficiency than PAMAM alone.
Conclusion : Results of this study confirmed that Pegylation of dendrimers significantly reduced the
toxicity of PAMAM dendrimers and conjugation of PAMAM-PEG to trastuzumab antibody make
these polymers good candidates for targeted cancer gene therapy.
Keywords : Nanocarrier. PAMAM dendrimer, trastuzumab, genethrapy
3rd International Student Biotechnology Congress
18
Relationship between TNF-a(-308) and LT-a(+252) polymorphisms and acute
lymphoblastic leukemia in Northwest of Iran
Hajar Nasiri medical tabriz univercity
Safar Farajna* medical tabriz univercity
Azim Rezamand medical tabriz univercity
Amir Monfaredan medical tabriz univercity
Majid Farshdosti medical tabriz univercity
Fateme Skandari medical tabriz univercity
Leyla Sahebi medical tabriz univercity
Introduction : Acute Lymphoblastic Leukemia (ALL), the main subtype of lymphoid malignancy in
children overall, almost occurs in 2-5 years old. The etiology of disease is unclear but some
translocations and genetic variations are effective on occurrence and progress of this malignancy.
Previous studies have shown TNF-a (-308) and LT-a (+252) polymorphisms have relationship with
some diseases such as ALL, because these genetic polymorphisms lead to over expression and high
plasma level of them. This study investigate the association TNF-a (-308) and LT-a(+252)
polymorphisms between ALL patients and healthy individuals in northwest of Iran .
Materials and Methods DNA extracted from 5ml peripheral blood of 70 ALL patients and 130 healthy
population by chloroform salting-out method for RFLP-PCR. After conventional PCR, digestion with
NCOI as restriction Enzyme was done and acquired data was analyzed with SPSS ver.13
Results :The TNF-a mutant alleles (GA) in ALL and control are 11.1% to 88.9% respectively and we do
not have any TNF-a (AA) homozygote in ALL group. The meaningful association of TNF-a variant is
between ALL and control ( pvalue= 0.005). In contrast with TNF, we do not have any significant
difference of LT variant between 2 subjected groups (pvalue =0.616)
Conclusion :Our result shows in ALL and control group from northwest of Iran with Azari ethnicity;
the TNF-a variant allele has meaningful relationship between ALL and healthy people, although,
there is not any significant association of LT-a variant in 2 selected groups.
Keywords: ALL polymorphism, RFLP-PCR, TNF-a
3rd International Student Biotechnology Congress
19
Inhibition of oncogenic activity of WWP1 on breast cancer cell line with
synthetic microRNA
Fatemeh Nematpour Tarbiat Modares University
Mahdi Forozandeh * Tarbiat Modares University
Introduction
MicroRNAs (miRNA) are small RNAs that regulate gene expression. MiRNAs involve in numerous
processes such as proliferation, differentiation, apoptosis, etc. These functions support a role for
miRNAs in initiation and progression of malignancies. MiRNAs act as tumoursuppressor or oncogene,
these miRNAs named oncomirs and classified into two groups; 1-Tumoursuppressor oncomirs, which
downregulate expression of the oncogenes, 2-Oncogenic oncomirs, which downregulate expression
of the tumoursuppressors. We can use this model for regulation of target tumoursuppressor or
oncogene, so we designed and synthesized miRNA against one of the important oncogene in breast
cancer, WWP1 (WW domain containing E3 ubiquitin ligase1), which is overexpressed in breast
cancer. WWP1 promotes cell proliferation and regulates other proteins such as; TGF.B, P53, KLF2,
KLF5,ErbB2,andEGFR.
Material and Methods
MicroRNA was designed by Invitrogen RNAi Designer, and after synthesizing, miRNA gene was
ligated into a miR-155-based Block-iT Pol II miR RNAi Expression Vector (Invitrogen), and then
expression level of WWP1 in WWP1-miRNA-transfected breast tumor cells (MCF7) was measured
with Real-Time PCR. Furthermore cell proliferation was measured by cell counting and MTT assay.
Results
This synthetic miRNA reduced expression level of WWP1 up to 70% as compared with control cells
after 72 hours. Also cell counting and MTT assay showed 30% reduction in cell proliferation of MCF7
cells.
Conclusion
In this experiment we succeed to reduce expression of WWP1 in MCF7 cells via miRNA, which led to
inhibition of its function too. These data support that we can regulate expression of target gene via
miRNA. So this new tool has therapeutic potential for treatment of genetically disease such as
cancers.
Keywords: Breast cancer, Gen silencing, MicroRNA, WWP1
3rd International Student Biotechnology Congress
20
Transcription-mediated Isothermal Amplification for Rapid Identification of
Lishmania major using Sequence-based Primers
Alireza Niazi Golestan Univercity of medical univercity
Oghol Niaz Jorjani* Golestan Univercity of medical univercity
Hassan Nikbakht Golestan Univercity of medical univercity
Sareh Zhand** Golestan Univercity of medical univercity
Pooria Gill*** Golestan Univercity of medical univercity
*: [email protected] **: [email protected]
***: [email protected]
Introduction: Lishmania major is a flagellate protozoan parasite with a global expansion. This
parasite is caused cutaneous lishmaniasis in human and considered as fairly prevalent infectious
agent in the world. Employing advanced diagnostics for molecular identification of this
microorganism has a more sensitivity and specificity in comparison to the microscopic methods. PCR
is also introduced as one of the best known techniques for diagnosis of this parasite; however, the
method is not widely used due to its expensive equipments and the time requested. Main aim of this
research is diagnosis of L. major via employing an isothermal amplification technology so-called
transcription-mediated amplification (TMA) using sequence-based primers.
Materials and methods: Several specimens of cutaneous lishmaniasis were analyzed using TMA and
RT-PCR in parallel. Total RNA of the specimens were isolated and used in the both assays. Sequence
specific primers with T7 engineered promoter with hinge were used in the amplification process at
37 C for targeting L. major 18S rRNA. Dimethylsulfoxide enhanced T7 RNA Polymerase activity in the
reaction with optimized concentration. The RNA amplicons were produced in less than 90 minutes
and then identified via electrophoresed agaros gel after staining with SyberGold. RT-PCR assays were
also done to be compared with TMA.
Results: Specific 200-nt amplicons of RNAs were characterized in the gel electrophoregram in
comparison to RNA ladder. In addition, the TMA products could be identified with SyberGold
fluorescent emission while exposed with ~300 nm UV irradiation wavelength in the reaction
microtubes.
Conclusion: TMA technology could be applied for molecular diagnosis of L. major in parallel with the
culture, microscopy, and PCR. Using a fluorescent dye e.g. SyberGold in the reaction increases the
sensitivity of the method and provide a significant rapidity in molecular diagnosis of the pathogen.
Obtained results are also shown a comparable specificity and sensitivity between TMA and RT-PCR.
Keywords: L. major, TMA, 18S rRNA
3rd International Student Biotechnology Congress
21
Prediction of the genes involved in blood disorders during infection by
Influenza virus A (H1N1) 2009
Zahra Nurolah university of shahrekord
Esmaeil Ebrahimi* university of shiraz
Abstract: The influenza virus belongs to the Orthomyxoviridae family virus. In 2009, a kind of this
viruses appears in many areas of the word and leads to 18000 mortality. The symptoms of pandemic
influenza are very different in humans, Including: the neuronal disorders that specially happen in
children, Respiratory and blood disorders, that eventually lead to disability and death. In this study,
Using microarray analysis, some genes involved in blood disorders, which are caused by influenza
virus pandemic, was found. To do this end, microarray data of the effects of the tow mentioned
viruses, pandemic and seasonal viruse, on Canis lupus (host) were obtained from NCBI (GEO=
GSE17079). Then, the gene network of these genes was drawing. the results including one down
regulated genes and 14 up regulated genes, Considering that Pvalue
3rd International Student Biotechnology Congress
22
The Differentiation of Mesenchymal Stem Cells into lnsulin-producing Cells
through Transduction of a Lentivirus Containing IPF-1 Gene
Saman Rahmati Biochemistry Department, Pasteur Institute of Iran, Tehran, Iran
Saman Setoodeh Stem Cell Department, Stem Cell Technology Research Centre , Tehran, Iran
Mahdi Hasanvand Biochemistry Department, Pasteur Institute of Iran, Tehran, Iran
Mohsen Karimi-Arznani Molecular Medical Department, Pasteur Institute of Iran, Tehran, Iran
Mehdi Kadivar * Biochemistry Department, Pasteur Institute of Iran, Tehran, Iran
Introduction: Mesenchymal stem cells, are multifunctional cells with the ability to change and
differentiate into different cell types such as Insulin-producing cells. Differentiation of mesenchymal
stem cells into insulin-producing cells can be done by genetic or environmental factors. One of the
most important factors which is involved in pancreas development and transcription of insulin gene
is PDX-1 Transcription Factor. The purpose of this study is the differentiation of mesenchymal stem
cells into insulin-producing cells.
Materials and Methods: The recombinant lentivirus (made in previous study) was transduced into
mesenchymal stem cells after being concentrated and titrated by ultracentrifugation and Flow
cytometry respectively. The expression of pancreatic cell-specific genes, including insulin and Glut-2
were assessed by RT-PCR in differentiated cells. The differentiated cells were then detected using
anti-C-peptide antibody in ELISA.
Results: The titration of viral particles was calculated in transducing unit per ml (TU/ml), in terms of
the number of cells at the time of transduction and the percentage of the number of GFP-positive
cells. Semi-quantitative RT-PCR results showed high expression of insulin and Glut-2. Quantitative
measurement of C-peptide by using anti-C-peptide indicated the existence of cells having C-peptide.
Conclusion: Regarding the results obtained from current study, mesenchymal stem cells are able to
differentiate into insulin-producing cells via IPF-1 genetic factors.
Keywords: Mesenchymal stem cells, IPF-1 gene,Lentivirus
3rd International Student Biotechnology Congress
23
Crocetin attenuates spatial learning dysfunction and brain damage after
chronic cerebral hypoperfusion in rats
Faezeh Tashakori Sabzevar* Mashhad university of medical science
Introduction : Cerebral hypoperfusion is a major cause of cognitive deficits and memory
impairment, in aging and in age-related neurological disorders .Alzheimer's disease (AD), vascular
dementia and post-stroke hypoperfusion are the most important disorders, especially in elderly
people after the age 65.The persistent decrease in cerebral blood flow is correlated with above
mentioned disorders and severity of cognitive impairment. Also, the reduced cerebral blood flow
(CBF) has been recently suggested as an important factor in progression of AD. Bilateral permanent
occlusion of the common carotid arteries (2-VO) of rats has been widely used as a suitable model to
investigate the chronic cerebral hypoperfusion.
Materials and methods : our process consist of: 1.Preparation of crocetin 2.Analysis of crocetin with
HPLC,TLC,spec 3.Animals (30 rats were divided into five groups: (1) sham-operated animals (non-
ischemic group) underwent the same surgical procedure without ligation of the common carotid
arteries (n=6); (2) control group received vehicle (n=6); treatment groups (group 3-5) received
crocetin 2, 4 and 8mg/ kg per day, respectively (n=6 in each group). 4.Surgery and experimental
procedure with 2VO 5.Behavioral experiments(Morris water maze 6.Pathology
Results : The results indicated that the escape latency time significantly decreased in crocetin
treated rats, in comparison with control animals. Also, the percentage of time spent and traveled
distance in target quadrant on final test trial day increased in crocetin 8 mg/kg group, compared to
control group, while no difference was observed between groups in swimming speed. All behavioral
results confirmed by histopathological analysis.
Conclusion : In conclusion, treatment with crocetin could effectively prevent neuropathological
alterations in hippocampus and thereby resulting in improvement of spatial learning memory in rats
after chronic cerebral hypoperfusion.
Keywords : Cerebral hypoperfusion, Crocetin, Morris water, maze, Saffron
3rd International Student Biotechnology Congress
24
Cytotoxic and Apoptotic Activity of Scrophularia amplexicaulis in MCF-7
Human Breast Cancer Cells
Samira Valiyari* Department of Medical Biotechnology, Pasteur Institute of Iran
Saeid Yaripour Department of Drug and Food Control, Faculty of Pharmacy, Tehran
University of Medical Sciences, Tehran, Iran.
Fateme Zare Shahneh Immunology Research Center, Tabriz University of Medical Sciences
Behzad Baradaran Immunology Research Center, Tabriz University of Medical Sciences
Abbas Delazar Drug Applied Research Center, Tabriz University of Medical Sciences
Introduction : Breast cancer is the most common cancer in women. Therefore, there is an urgent
need to identify and develop therapeutic strategies against this deadly disease. This study is the first
to investigate the cytotoxic and apoptotic effects of Scrophularia amplexicaulis in MCF-7 human
breast cancer cells
Materials and methods : Three extracts of Scrophularia amplexicaulis including the n-hexane,
dichloromethane and methanol extracts were examined. MTT and Trypan-blue assays were
performed in MCF-7 cells as well as control cell line MCF10A to analyze the cytotoxic activity of the
plant. Further, the apoptosis inducing action of extracts of the plant was evaluated using cell death
ELISA and TUNEL assay.
Results : The results showed that dichloromethane and methanol extracts significantly inhibited cell
growth and viability without inducing damage to MCF10A cells. Cell death ELISA and morphological
changes of cells in TUNEL assay showed that the induction of apoptosis was the main mechanism of
cell death.
Conclusion : Our results strongly suggest that this plant may contain potential bioactive
compound(s) for the treatment of breast cancer.
Keywords : Scrophularia amplexicaulis, cytotoxic, MCF-7 cells, apoptosis, anticancer, breast cancer
3rd International Student Biotechnology Congress
25
RNA-binding protein Rbm47 binds to Nanog in mouse embryonic stem cells
Meghdad Yeganeh University of Tehran
Farnaz Akbari Kamrani Tehran University of Medical Sciences
Nasser Ghaemi University of Tehran
Ehsan Seyedjafari * University of Tehran
Introduction : Embryonic stem cells (ES cells) are pluripotent cells capable for self-renewal and to
differentiate to all cell types. Finding the molecular mechanisms responsible for these unique
characteristics of ES cells is important. RNA-binding proteins play important roles in post-
transcriptional gene regulation by binding to specific mRNA targets. In this study, we investigated
the targets of RNA binding protein Rbm47 in mouse ES cells.
Materials and methods : To this aim, we overexpressed HA epitope-tagged Rbm47 in mouse ES cells,
and then RNA-binding protein immunoprecipitation (RIP) was performed. For the RNA co-
immunoprecipitated with Rbm47, we did RT-PCR for Oct4, Sox2, and Nanog, which are the main
pluripotency factors.
Results : RT-PCR results show that Rbm47 binds to Nanog transcript in mouse ES cells and
doesnt bind to Sox2 and Oct4 transcripts in these cells.
Conclusion : This finding can give rise to reveal molecular mechanisms underlying pluripotency and
stemness of ES cells and will be necessary for efficient application of these cells in regenerative
medicine and tissue engineering.
Keywords : Embryonic stem cell, RNA binding protein, Rbm47, RIP
3rd International Student Biotechnology Congress
26
Codon optimization, cloning and expression of single-chain variable fragment
(scFv) antibody against CD22 in PichiaPastoris and optimization of Expression
conditions
Najmeh Zarei Pasteur Institute of Iran, Biotechnology Research Center
VahidKhalaj* Pasteur Institute of Iran, Biotechnology Research Center
BehruzVaziry Pasteur Institute of Iran, Biotechnology Research Center
Abstracts : The methylotrophic yeast Pichiapastoris has become a highly popular expression host
system for the recombinant production of a wide variety of proteins such as antibody fragments.
Single chain variable fragments (scFv) have many advantages over whole antibodies for use in
antibody-targeted immunotherapy due to their small size. CD22, a B-cell specific surface molecule, is
known to be up regulated in Non-Hodgkin's Lymphoma and other types of B-cell Lymphomas. To
treat B-cell Lymphomas, multiple approaches including CD22 specific antibodies have been
developed.
In this project, the methylotrophic yeast Pichiapastoriswas used to produce an anti-CD22 single
chain variable fragment, with the intention of conjugation to a radioisotope for therapeutic use. The
scFv gene was designed and synthesized by choosing the P.pastorispreferred codons while keeping
the G+C content at relatively low level. The full length gene cloned in the yeast vector, pPICZ and
expressed in P.pastoris strain GS115.SDS-PAGE and western blotting analysis of culture medium
from methanol-induced expression yeast clones demonstrated that the scFv was secreted into the
culture medium. To improve scFv production we examined parameters such as time, pH, methanol
concentration and cell density. Under optimized conditions (culture medium pH: 6-6.5, methanol
concentaratin:1%, induction time: 72 h)the yield of soluble recombinant scFv was approximately 22
mg/L. The recombinant protein was purified to greater than 95% purity using Ni-NTA column
chromatography. Flow cytometry, immunohistochemistry, and western blotting revealed that the
purified scFv could bind strongly to the membrane of CD22-positive cells, Raji cells, but not to CD22-
negative cells, Jurkat cells. These results suggest that anti CD22 scFv produced in P. pastoris is active
and specific toward CD22-positive cells and has potential for use in CD22-targeted immuonotherpy.
ssergnoC ygolonhcetoiB tnedutS lanoitanretnI dr3
72
ygolonhcetoiB larutlucirgA
1bbad
*naihcnahA mahlE ygolonhcetoib dna gnireenigne citeneG fo etutitsni lanoitaN
ibaltaM afatsoM ygolonhcetoib dna gnireenigne citeneG fo etutitsni lanoitaN
inamaZazer dammahoM ygolonhcetoib dna gnireenigne citeneG fo etutitsni lanoitaN
ihcbaruoJ tamsE ygolonhcetoib dna gnireenigne citeneG fo etutitsni lanoitaN
imorhaJsadahgom arhaZ ygolonhcetoib dna gnireenigne citeneG fo etutitsni lanoitaN
:
1bbaD .
.
fBAD. AND BATC anailaht.A :
)GTTACACGGCAGAAGAAGTATTCTCGAGC( rBAD )CACGAGCTGCTAACTTCTGTAAGATCTCG(
. IBCN 1caS 1abX
. 2.1TEJp . RCP
. negorcaM AND . )1002( llessuR &koorbmaS
AND. esreverdrawrof 1bbad :
. rBADfBAD RCP 1bbad
. 336 AND RCP
RocE RCP. 2.1TEJp
. . V
. 1bbad
.
1bbad :
.
1bbad :
3rd International Student Biotechnology Congress
28
Transgenic expression and recovery of biologically active recombinant human
insulin from Arabidopsis thaliana seeds
BehnazHosseini* Shahidbahonar university of Kerman
GholamrezaSharifiSirchi** Shahidbahonar university of Kerman
Abstract: The increased incidence of diabetes, coupled with the introduction of alternative delivery
methods that rely on higher doses, is expected to result in a substantial escalation in the demand for
affordable insulin in the future. Limitations in the production capacity and economics will make it
difficult for current manufacturing technologies to meet this demand. We have developed a novel
expression and recovery technology for the economical manufacture of biopharmaceuticals from
oilseeds. The production of therapeutic proteins in plant seed augments alternative production
platforms such as microbial fermentation, cell-based systems, transgenic animals, and other
recombinant plant production systems to meet increasing demands for the existing biologics, drugs
under evaluation, and undiscovered therapeutics in the future. A very useful tool in these endeavors
is the plant model system Arabidopsis thaliana. As a proof of concept for this technology, we have
produced recombinant human insulin in the model plant species Arabidopsis thaliana. In
PlantaTransformatin by Agrobactrium is a new, simple and low cost method for plant
transformation. This method applies successfully in Arabidopsis taliana and great attempts are done
in applying this method in other speciecs. In this research, kind of Inplanta transformation method
(Floral dip) was used for transformation of Arabidopsis plant. Agrobacterium strain, C58 containing
pjawhol III having insulin gene was used in this investigation. In this method, in Floral dip infiltration
method flowering plant dipped in the Agrobactrium culture. Seeds From infltrated Arabidopsis plant
were planted in ortder to select transformants in media containig 50 and 30 myl Kanamycin.
Recombinant insulin from transgenic Arabidopsis seeds was matured in vitro using trypsin and
further characterized by mass spectral analysis. Using our technology, we have demonstrated that
insulin can be expressed and recovered as an active molecule at commercially relevant levels from
transgenic seeds.
A. thaliana plants were transformed with the plant binary expression vector pJawhol III. Plant
derived insulin accumulates to significant levels in transgenic seed (0.13% total seed protein) and
can be enzymatically treated in vitro to generate a product with a mass identical to that of the
predicted product, DesB(30)-insulin. The biological activity of this product in vivo and in vitro was
demonstrated using an insulin tolerance test in mice respectively. The study demonstrates
bioequivalence of purified insulin from Arabidopsis seeds when compared with commercial insulin
products in an animal model. "Demand for insulin will continue to grow as the incidence of diabetes
increases