Intramitochondrial Protein Sorting

THE JOWAL OF BIOLOGICAL CHEMISTRY 0 1993 by The American Society for Biochemistry and Molecular Biology, Inc

Vol. 268, No. 32, Issue of November 15, pp. 24262-24269, 1993 Printed in U.S.A.

Intramitochondrial Protein Sorting ISOLATION AND CHARACTERIZATION OF THE YEAST MSPl GENE WHICH BELONGS TO A NOVEL FAMILY OF PUTATIVE ATPases*

(Received for publication, March 23, 1993, and in revised form, July 7, 1993)

Masato NakaiS§, Toshiya EndoS, Toshiharu Hasen, and Hiroshi Matsubarall From the Vepartment of Chemistry, Faculty of Science, Nagoya University, Chikusa-ku, Nagoya 464-01, the Vnstitute for Protein Research, Osaka University, Suita, Osaka 565, and the lpepartment of Biology, Faculty of Science, Osaka University, Toyonaka 560, Japan

Replacement of the presequence of yeast cytochrome c1 by the amino-terminal 61 residues of MAS70, a yeast mitochondrial outer membrane protein, resulted in ex- clusive localization of the fusion protein (termed the 61- mC1 protein) to the outer membrane. When a cytochrome cl-deficient yeast strain was transformed with a plasmid encoding the fusion protein, the cells could not grow on nonfermentable carbon sources such as glycerol. We isolated a novel yeast gene MSPl (mitochondrial sorting of groteins) whose overexpression causes mislocalization of the 61mC1 fusion protein to the inner membrane, probably via the intermembrane space, and thereby allows the host cells to grow on glycerol. The predicted MSPl protein (MSP1) is a hydrophilic 40-kDa polypeptide containing a putative membrane-spanning domain near the amino terminus. Further sequence analyses revealed that MSPl is a member of a novel family of putative ATPases which share a highly conserved domain of about 185 amino acid residues, including a consensus motif for a nucleotide binding site. MSPl was found to be an intrinsic mitochondrial outer membrane protein of an apparent molecular mass of 40 kDa with a large domain facing to the cytosol. The MSPl gene is not essential for the cell growth either on fer- mentable or nonfermentable carbon sources.

Vast majority of the mitochondrial proteins are encoded by the nuclear genome, synthesized in the cytosol, and trans- ported to the mitochondria. Mitochondria have four distinct submitochondrial compartments, i.e. the outer and the inner membranes, the intermembrane space, and the matrix. There- fore a mitochondrial protein made in the cytosol should be sorted and delivered to one of the four possible final destina- tions on import into mitochondria. Evidence has been accumu- lated indicating that cytosolically made mitochondrial precursor proteins have an intramitochondrial sorting signal in addition to the intracellular mitochondrial targeting signal (Hurt and van Loon, 1986; Schatz, 1987; Hart1 et al., 1989; Glick et al., 1992).

Proteins targeted to the outer membrane do not have a presequence to be processed and appear to be sorted to the outer

* This study was supported in part by a grant-in-aid for Scientific Research from the Ministry of Education, Science and Culture of Japan. The costs of publication of this article were defrayed in part by the payment of page charges. This article must therefore be hereby marked “advertisement” in accordance with 18 U.S.C. Section 1734 solely to indicate this fact.

to the GenBankTMIEMBL Data Bank with accession number(s1 X68055. The nucleotide sequence(s) reported in this paper has been submitted

8 To whom correspondence should be addressed Dept. of Chemistry,

Japan. -1.: 81-52-781-5111 (ext. 2491); Fax: 81-52-782-9176. Faculty of Science, Nagoya University, Chikusa-ku, Nagoya, 464-01,

membrane by several different mechanisms. MAS70, a yeast outer membrane protein, is targeted to the outer membrane by its amino-terminal domain consisting of a hydrophilic region, which potentially target the protein to the matrix, followed by an extended hydrophobic stretch that may function as a signal for “stop-transfer” or a “membrane anchor” (Hase et al . , 1984, 1986; Nakai et al . , 1989a.; McBride et al., 1992). Another yeast outer membrane protein of 45 kDa (45-kDa protein) may be targeted to the outer membrane by the same mechanism as MAS70 (Yaffe et al., 1989). Porin, one of the most abundant outer membrane proteins, appears to share at least a part of the import pathway with proteins sorted to the matrix, but neither a mitochondrial targeting signal nor an outer membrane sorting signal was identified in the sequence (Pfaller et al., 1988). Another outer membrane protein, monoamine oxidase B, contains a targetinglsorting signal to the mitochondrial outer membrane near its carboxyl terminus (Mitoma and Ito, 1992).

Several proteins that may mediate protein targeting to mitochondria have been identified: an essential yeast outer membrane protein, ISP42 and its counterpart in Neurospora crassa, MOM38 (Vestweber et al., 1990; Baker et al., 1990; Kiebler et al . , 1990), an essential yeast inner membrane protein MPIl (Maarse et al., 19921, and nonessential, and possible receptor candidates, MAS70 and p32 from yeast and MOM19, and MOM72 from N . crussa (Hines et al., 1990, 1993; Pain et al., 1990; Murakami et al., 1990; Sollner et al., 1989). However, no mitochondrial component responsible for intramitochondrial sorting has been identified yet.

The 61-residue amino-terminal segment of MAS70 contains sufficient information to direct attached polypeptides to the outer mitochondrial membrane in vivo (Hase et al., 1984, 1986; Nakai et al., 1989a). A cytochrome c1 derivative (the 61mC1 fusion protein), in which the cytochrome c1 presequence is re- placed by the 61 amino-terminal residues of MAS70, is localized to the mitochondrial outer membrane in vivo (Nakai et al., 198913). Since cytochrome c1 normally assembles from the intermembrane space into the inner membrane cytochrome bcl complex (Glick et al., 19921, which is an indispensable component of the respiratory chain, a cytochrome cl-deficient yeast strain bearing a plasmid encoding the 61mC1 fusion protein destined for the outer membrane cannot form a functional cytochrome bcl complex, restore respiration ability, or grow on a nonfermentable carbon source such as glycerol.

We utilized this growth defect to isolate a class of mutations in the host yeast genome which restored growth on glycerol as a consequence of missorting of the 61mC1 fusion protein to the intermembrane space,l since such mutants would be useful for

We initially isolated three host-linked mutants, EM-1, EM-2, and EM-4, by screening approximately lo7 cells. None of them appeared to

24262

Intramitochondrial Protein Sorting in Yeast 24263

identifying proteins involved in protein sorting in mitochondria, In the course of cloning a mutated gene from such a dominant nuclear mutant, we obtained a yeast genomic DNA fragment instead of the mutated gene, whose overexpression caused mislocalization of the 61mC1 fusion protein to the intermembrane space, thereby allowing the cells to grow on glycerol. Sequence analyses of the DNA fragment revealed a coding region (termed MSP1, the gene involved in Sitochondrial sorting of proteins) for a protein with molecular weight 40,343. Antisera raised against the MSPl protein (MSP1) expressed in Escherichia coli reacted with an outer mitochondrial membrane protein of yeast of an apparent molecular size of 40 m a . We also found that MSPl contains a conserved motif for a nucleotide binding site and is a member of a novel family of putative ATPases.

MATERIALS AND METHODS Strains and Plasmids-The following yeast Saccharomyces cerevi-

siae strains were used in this study: SF747-19D (a, his 3, ura 3, leu 2, gal 2 ); MH6-16 (a, his 3, ura 3, leu 2, gal 2, cyt c,::URA3) (Hase et al., 1987a); EM-2 (a, his 3, ura 3, leu 2, ga12, cyt cl::URA3, msp2); W303-1A (a, ade2-1, his3-11, 15, ura3-1, leu2-3, 112, trpl-1, canl-100); MNlO (a, ade2-1, his3-11, 15, ura3-1, leu2-3, 112, trpl-1, canl-100, cyt c,::UR.A3); D273-108 ((I). The authentic cytochrome c1 gene and the MAS70-cyt c1 fusion gene, 61mC1, were cloned into a yeast-E. coli shuttle vector YEpl3 to give pMNpC, and pMNGlm, respectively (Nakaiet al., 1989b). The pMNmx is a derivative of pMN6lm. Cloning for DNA sequencing was performed with pUCl19 (Vieira et al., 1987) and that for expression in E. coli with pKK233-2 (Amann and Brosius, 1985). Two E. coli strains, HBlOl and TG1 (Sambrook et al., 1989). were used for propa- gation of DNA construct in plasmid vectors.

Isolation ofMSP2 Gene-Initially, we isolated host-linked mutants in which the 61mC1 fusion protein was missorted to the mitochondrial inner membrane, thereby allowing growth of the cells on glycerol.' One of such mutants, EM-2, which had a dominant mutation, was used to construct a yeast genomic DNA library in pMNmx, the 2 pm-based multicopy vector containing the 61mC, fusion gene. Strain MH6-16 was transformed with the genomic DNA library, and the resultant transformants were screened for their ability to grow on glycerol. Plasmids were recovered from 40 gly' colonies, and genomic DNA inserts of the plasmids were separately recloned into the pMNmx and were used to re- transform MH6-16 to confirm the plasmid-dependent and genomic DNA insert-dependent gly+ phenotype. Only one clone out of 40 candidates exhibited such a phenotype; it was named pMNmx23 and used for further characterization.

Although the genomic DNA to construct a library for cloning had been prepared from a dominant nuclear mutant EM-2, we reasoned that the isolated gene was not the mutated gene of the mutant but a multicopy suppressor-like gene for the following reasons. First, disruption of the isolated gene in the original EM-2 mutant did not abolish the ability to restore respiration. Second, disruption of the isolated gene in the parent cytochrome e,-deficient yeast strain, MH616, did not comple- ment respiration. Third, the isolated gene on a single-copy vector did not regain any detectable respiration competence (data not shown).

Localization and DNA Sequence Analysis of the MSPl Gene-The 6.2-kbp' genomic DNA fragment on pMNmx23 was inserted into the Sal1 site of pUC119 in both directions to obtain subclones. The resultant plasmids, pMN119mx23L and pMN119 mx23R, were used to construct a set of deletion mutants of the fragment according to Yanisch-Perron et al. (1985). Insert DNAs were excised from the selected subclones and reintroduced into the pMNmx backbone, the ability of the shortened DNA fragment to confer growth on glycerol was checked by transformation into MH6-16 cytochrome c,-deficient yeast, and the location of the MSPl gene was determined.

A set of subclones were selected for DNA sequence analyses of the region covering the entire MSPl gene. The sequences of both strands

al., 1980). were determined by the dideoxy chain termination method (Sanger et

Construction of the MSPl Frameshifi Mutation and Gene Disruption "One of the subclones pMN119R125, which carries the 2.l-kbp ge-

contain any mutations in MSPl gene, and they were not studied further (M. Nakai, unpublished results).

The abbreviations used are: kbp, kilobase pair(s); PAGE, polyacryl- amide gel electrophoresis.

nomic DNAinsert, including the entire MSPl coding region and 5'- and 3'-noncoding region, was digested at the unique Bg211, StyI, or BstEII sites separately. The DNAends were filled with Klenow polymerase and self-ligated. The insert DNAs were excised from the resultant plasmids, and introduced into pMNmx. Each construct and its pMNmx derivative carrying the original genomic DNA insert of pMN119R125 were transformed into MH6-16 strain separately and effects of the frame shifts were examined.

To construct a plasmid for MSPl disruption, the LEU2 gene was inserted between the EglII and BclI sites of the pMN119R125. The 3.9-kbp SaWEcoRI fragment from the resultant pMN119R125- mspl::LEU2 was used for gene disruption experiments.

Expression of the MSPl Protein Fragment in E. coli and Production of the Antisera-The NsillHindIII restriction fragment of pMN119R125 containing a part of the MSPl gene (amino acid residues 71-362) was ligated into the PstllHindIII sites of the pKK233-2 expression vector (Amann and Brosius, 1985). A transformant of E. coli (TG1 strain) harboring this construct was induced by 1 mM isopropyl-1-thio++ galactopyranoside in the 2 x YT medium (Sambrook et al., 1989) to overexpress the MSPl fragment. The expressed MSPl fragment formed an inclusion body; it was washed twice with 1 M urea and then extracted with 4.5 M urea. The MSPl fragment in the extract was concentrated on a DEAE-cellulose column, purified further by preparative SDS-PAGE, and extracted by electroelution. The amino acid composition of the purified protein was in good agreement with that deduced from the DNA sequence. Antisera against the purified protein were obtained from rabbits injected initially with 0.6 mg of protein emulsified in complete Freund's adjuvant followed by a boost injection with 0.2 mg of protein emulsified in incomplete Freund's adjuvant. Anti-MSP1 fragment antibodies were further purified from the immunized serum by epitope selection with the MSPl fragment-bound membrane filter.

Submitochondrial Fractionation-Subcellular and submitochondrial fractionations were carried out essentially according to the conven- tional methods (Nakai et al., 198913). Submitochondrial membrane vesicles were separated by centrifugation through a linear sucrose density gradient (15 ml, 0.85-1.6 M sucrose in 10 mM KC1 and 20 mM Tris-HC1, pH 7.5) according to Pon et al. (1989).

Proteinase K Treatment and Solubilization of Mitochondria "Aliquots (70 pl) of mitochondria suspension (20 mg/ml) were placed in 1.5 ml microcentrifuge tube and 595 p1 of bufferA(20 mM HEPES-KOH, pH 7.4,0.6 M mannitol) containing desired amounts of proteinase K (0-1 mg/ml as a final concentration) were then added. The suspension was kept a t 0 "C for 30 min, and the digestion was terminated by adding 1 pl of 1 M phenylmethylsulfonyl fluoride. The proteinase K-treated mitochondria were pelleted by centrifugation at 12,000 x g for 15 min at 4 "C.

Aliquots (1 mg of protein) of mitochondria were diluted either with 850 pl of 0.1 M Na2C0, (pH 11) or with 300 pl of &l% Triton X-100. After incubation for 30 min at 0 "C, membranes were recovered by centrifugation at 100,000 x g for 60 min.

Miscellaneous Methods-Cell growth of yeast and E. coli in liquid or on solid media were performed according to the published procedures (Sherman et al., 1986; Sambrook et al., 1989). Standard methods of yeast genetics (Sherman et el., 1986) were used for transformation into yeast cells and crossing strains. Enzymatic analyses of the mitochondrial respiration chain were as described previously (Hase et al., 1987b). Proteins were separated by SDS-PAGE, transferred to polyvinylidene difluoride membrane filters, and exposed to antisera. Polypeptides bound to the antibodies on the filter were visualized with a commer- cially available horseradish peroxidase-protein A conjugate or with an alkaline phosphatase-conjugated goat anti-rabbit IgG antibody (Haid and Suissa, 1983). In certain cases, antibodies were affinity-purified by the antigen-bound polyvinylidene difluoride membrane filter according to the method by Johnson et al. (1985). Protein concentrations were determined according to Lowry et al. (1951) with bovine serum albumin as a standard. Computer analyses of the DNA sequence were carried out using the GENETYX program (Software Development Corporation, Tokyo, Japan).

RESULTS

Isolation of the MSPl Gene-We have devised an in vivo selection scheme for identification of any components of intramitochondrial protein sorting machinery in yeast. When a cytochrome cl-deficient yeast cell was transformed with a plasmid encoding the 61mC1 fusion protein consisting of the 61-residue amino-terminal region of MAS70 and the mature

24264 Intramitochondrial Protein Sorting in Yeast

part of cytochrome c l , the cells could not grow on a nonfermentable carbon source such as glycerol since the fusion protein was delivered to the outer membrane (Fig. 1, A and B ) (Nakai et al., 1989b). If intramitochondrial sorting between the outer membrane and the intermembrane space is perturbed in such a way that a fraction of the 61mC1 fusion protein is missorted to the intermembrane space, the fusion protein may assemble into the cytochrome bcl complex so that the cells may restore respiration ability and grow on glycerol. Such perturbation of the intramitochondrial sorting may be caused by a change in the sorting signal of the fusion protein itself or a change in the function(s) of mitochondrial proteins involved in protein sorting. For example, host-linked mutations that alter the function(s) of the mitochondrial proteins mediating protein sorting may cause mislocalization of the fusion protein to the intermembrane space in the transformed cells (Fig. 10. Indeed we isolated a class of host-linked mutants, in which a fraction of the 61mC1 fusion protein reached the mitochondrial inner membrane.’

Alternatively, overexpression of a mitochondrial protein, e.g. one of the components of a putative protein complex mediating intramitochondrial protein sorting, may affect the correct localization of the 61mC1 fusion protein to the outer mitochondrial membrane (Fig. lD). Indeed in the course of characterization of one of the above-mentioned host-linked mutants, EM-2, we isolated in the present study a yeast genomic DNA

B.Parent

I 6 1 d 1 hmlon p&ln

&-- Glycerol e

[CYTOSOL]

C. Host-link mutant

D. Yultlcopy suppressor

mitochondrial location in the parent cytochrome el-deficient FIG. 1. The structure of the 61 mC1 fusion protein (A), its sub-

yeast (B) , and the two possible mechanisms that cause mislocalization of the fusion protein to the intermembrane space (C and D ) . The filled box and the shaded box indicate, respectively, an uninterrupted stretch of uncharged amino acids (residues 3657) of the cytochrome c1 precursor and that of the amino-terminal region (residues 10-37) of W 7 0 . The hatched box (circle) and the open box show the amino acids derived from the cytochrome c1 precursor and MAS70, respectively. Arrowheads indicate proteolytic cleavage sites. The amino acid sequence around the fusion point is shown by the single-letter code for amino acids. Linker-encoded amino acids are underlined. Abbrevia- tions: ZM, the inner membrane; OM, the outer membrane; X, a mutation that alters either the anchoring signal of the fusion protein or some cellular component mediating protein sorting to the outer membrane.

lNs€fu - A : e 0 : - C :

6lmC1 The 6.2 kbp wnomlc DNA fragment -

“ P i I +

D : cl). - + - w (1 E : - .

4 1 F: - . 0 : “ 8

8.1 Ell

FIG. 2. Growth of the various transformants on YPG plate. MH6-16 cytochrome cl-deficient yeast cells were transformed with YEpl3 derivatives containing the various DNAinserts as indicated, and transformants were streaked onto a YPG plate containing 1% yeast extracts, 2% polypeptone, and 2% glycerol, and grown for 7 days at 30 “C: +, growth; -, no growth. X indicates the position of introduced frame shift mutations.

fragment carrying a gene whose overexpression resulted in mislocalization of the fusion protein.

Fig. 2 shows the ability of the cloned yeast genomic DNA fragment to render the host cells expressing the 61mC1 fusion protein respiration competent. Whereas the originally isolated 6.2-kbp yeast genomic DNA fragment alone did not make the cells grow on glycerol (Fig. 2C), co-transformation of the fragment with the 6ImC1 fusion gene allowed growth on glycerol (Fig. 2 B ) .

In the co-transformed yeast cells, the enzymatic activity of succinate-cytochrome c reductase was significantly recovered (Table I), indicating that the recovery of the respiration competence was due to the regained activity of the cytochrome bel complex; 6.2-kbp genomic fragment most likely caused mislocalization of the 61mC1 fusion protein to the intermembrane space so that it assembled into the cytochrome bcl complex, which would otherwise have lacked cytochrome c1 and have been enzymatically i n a ~ t i v e . ~ The apparent size or the amount of the expressed 61mC1 fusion protein was not affected by the co-transformation of the 6.2-kbp genomic DNA fragment. To map the respiration recovering activity in the 6.2-kbp

insert more precisely, we constructed a set of subclones of the fragment. The smallest fragment capable of making the host cells respiration competent was a 2.1-kbp fragment shown in Fig. 20. A total of 2,930 nucleotides were then determined for the region, including the 2.1-kbp fragment by the dideoxy sequencing method (Fig. 3). l b o possible open reading frames consisting of 1,086 and 351 bp, respectively, were found in this region. The 2.1-kbp fragment contains only the former, and the latter is identical with the ERVl gene which is involved in biogenesis of mitochondria (Lisowsky, 1992). The former open reading frame, a candidate for the gene capable of suppressing the respiration deficiency, encodes a protein of 362 amino acid residues with a molecular weight of 40,343. Since, however, there are several ATG codons throughout the open reading frame, three frame shift mutations were constructed in the predicted open reading frame to determine which ATG codon functions as the initiation codon. All of these frame shift mutations, including the one introduced between the first and the second ATG codons, eliminated the suppressing activity of the fragment for respiration deficiency (Fig. 2, E”). Thus the gene with ability to recover respiration should be assigned to the longest open reading frame starting from the first ATG codon, and we termed it the MSPl gene (for mitochondrial sorting of protein).

DNA Sequence Analyses of MSPl-Hydropathy analyses of

Mislocalization of the fusion protein in the cells overexpressing MSPl was detected by enzymatic assay, but that of outer membrane proteins including the fusion protein and MAS70 escaped from detec- tion by other biochemical means such as Coomassie staining or immunoblotting (data not shown).

Zntramitochondrial Protein Sorting in East 24265 TABLE I

Enzymatic activity of mitochondriut respiratory chain

Enzymatic activity Lactate-cytochrome c

reductase Strain (plasmid) Succinate-cytochrome c

reductase Cytochrome c

oxidase

pmol cytochrome c reduction or oxidationlminlmg protein

SF747-19D (YEp13) 0.670 0.597 1.346 MH6-16 (YEpl3) 0.000 0.321 1.413 MH6-16 (pMNpC1) 0.498 0.518 1.598 MH6-16 (pMN6lm) 0.039 0.476 1.241 MH6-16 (pMNmx23) 0.130 0.381 1.559

the deduced amino acid sequence of the MSPl gene product (MSP1) by the method of Kyte and Doolittle (1982) revealed a potential membrane-spanning region of 16 uncharged and mostly apolar residues at the amino terminus from residues 13 through 28. This protein also contains a nucleotide binding motif (P-loop), -G-X-X-G-X-G-K-T-, at residues 133-140. In ad- enylate kinase, this glycine-rich region forms a loop between a p-strand and a n a-helix and provides a binding site for one of the phosphate groups of the nucleotide (Dreusicke et al., 1986). Prediction of secondary structures by the methods of (Chou and Fasman, 1978) indicates that residues 133-140 and the flank- ing regions of MSPl form similar organization of the secondary structures, i.e. @-sheet, loop, and a-helix, supporting the inter- pretation of this region being a nucleotide binding site.

Comparison of the amino acid sequence of MSPl with other known protein sequences compiled in the Swiss Protein Data- base (release 23.0) and NBRF Protein Database (release 34.0) revealed another striking feature of MSP1. MSPl contains a region of about 185 amino acids, including the consensus nucleotide binding motif, which is shared by members of a newly identified family of putative ATPases (Erdmann et al., 1991). The eukaryotic members of the family identified so far are Secl8p, which is essential for protein transport between ER to Golgi (Eakle et al., 1988), Paslp, which is required for per- oxisome biogenesis (Erdmann et al., 19911, CDC48p, which is involved in the cell division cycle (Frohlich et al., 19911, Bcslp, which is necessary for the functional cytochrome bcl complex (Nobrega et al., 19921, TBP1, which is a human protein and interacts with the tat protein of the human immunodeficiency virus (Neblock et al., 1990), and Osdlp, which is involved in the degradation process of a certain mitochondrial protein of yeast.* FtsH, an inner membrane protein of E. coli, is a prokaryotic member of the family and involved in the assembly process of inner membrane protein^.^ Fig. 4 shows the diagrammatic and amino acid alignments of some of the members of this putative ATPase family. Secl8p, Paslp, and CDC48p contain two consensus sequences for ATP binding, whereas TBP, FtsH, Osdlp, and MSPl have only one copy of the sequence. W o of the members, Secl8p and VCP, a vertebrate homologue of yeast CDC48p, have been confirmed to have ATPase activity (Eakle et al., 1988; Peters et al., 1990).

Identification and Localization of the MSPl Gene Product in Yeast-In order to find the intracellular location of MSP1, the total cell extract of the wild-type yeast strain was analyzed by immunoblotting using the anti-MSP1 antibodies affinity-purified on immobilized MSPl fragment. In good agreement with the predicted size of the MSPI gene product, a protein of -40 kDa was recognized by the antibodies, and the signal was much stronger with the cell extract from the strain overproducing MSPl (Fig. 5A, lane 2 ) . Fig. 5B shows subcellular distribution of the possible MSPl gene product in yeast; MSPl appeared to be localized in the mitochondria exclusively. When mitochondria were subfractionated into outer and inner membranes,

T. Nakai, personal communication. T. Ogura, personal communication.

(Fig. 6, A and B), MSPl cofractionated with antimycin A-in- sensitive NADH-cytochrome c reductase, an outer membrane enzyme. These results indicate that MSPl is an outer mitochondrial membrane protein.

Fig. 7 shows the effects of various treatments to probe the association of MSPl with the outer membrane. Although MSPl was extracted with lower concentration (0.25%) of !hiton X-100 than MAS70 and porin, it still stayed with membranes after sonication or alkali treatment. These results confirm that MSPl is an integral membrane protein and that at least a part of the molecule is embedded in the lipid bilayer.

Next, we examined the accessibility of MSPl to exogenous proteinase Kin intact mitochondria and compared it with those of MAS70, porin, and cytochrome b2 (Fig. 8). Cytochrome b2, a mitochondrial intermembrane space enzyme, was not significantly degraded by proteinase K even at the highest concentration, indicating the intactness of mitochondria during the digestion; after disruption of the outer membrane, cytochrome b2 was digested at this proteinase K concentration (data not shown). Porin, an integral mitochondrial outer membrane protein, was also hardly degraded, because it forms a protease- resistant trimer structure in the membrane. In contrast, MSPl and MAS70 were rather easily digested, and no degradation intermediates were detected in the mitochondrial pellet after the digestion; MSPl thus appears to be exposed on the cytosolic face of the outer membrane.

Disruption of the MSPl Gene-In order to determine whether MSPl encodes an essential mitochondrial protein, we constructed a null mutation by inserting the yeast LEU2 gene into one of the two MSPI alleles of the homozygous leu2 diploid W303. When the strain was sporulated and ascospores were dissected, each tetrad yielded four viable spores. Absence of MSPl was confirmed for Leu+ spores by immunoblotting using the antibodies against the MSPl fragment. The disruption of the MSPl gene in a haploid cell had no effect on cell viability even on a medium containing a nonfermentable carbon source (data not shown). These results suggest that MSPl is not essential for either cell growth or mitochondrial functions in yeast.

DISCUSSION

We have devised a highly sensitive genetic selection proce- dure to identify genes involved in protein sorting between the outer membrane and the intermembrane space in the yeast mitochondria. By using this positive selection system, we isolated the MSPl gene whose overexpression leads to missorting of the 61mC1 fusion protein from the outer membrane to the intermembrane space; a fraction of the 61mC1 fusion protein appears to assemble into the respiratory cytochrome bel complex in the cells overproducing MSP1. We expect that this screening system is also useful for positive selection for nuclear mutants, in which sorting of the fusion protein is perturbed between the outer membrane and the intermembrane space. Indeed two mutants have been isolated in our laboratory that

24266 Intramitochondrial Protein Sorting in East

B 101 a c t g g a t g a c a t t g a a a t t t t a t t c t a a t a a t a ~ ~ t g c a t c a g ~ t c t t t ~ a a a a ~ ~ t t g ~ t ~ t t t ~ g ~ t a t t t g ~ a g ~ ~ ~ g ~ ~ a t L L L ~ ~ c a g ~ t t ~ c c a t c c 1 C C a a c a a t t a t c t c a a C a t t c a c a t a t t t c t c a t t t c t ~ a t l ~ t ~ ~ a t c t t c a t g g t a t c t t t t t t a ~ ~ c c g t ~ t ~ t g a t a ~ ~ ~ t ~ c a ~ g t ~ ~ r . ~ L ~ ~ ~ ~ ~ c c a g c ~

201 gatatagtgtaacggctatcacatcacgcttt===cgtgg=gaccggggtt~g~=tc~=~gt~tcgg=gtgtt~tttttcttac=t=ttgaa==agaggt 301 agtaaagtcaatataaattcttggctgaagtatttcaataca~~tggtc~aggaagttattatttttttaatgacttatatctgtcca~cacaacaggtt 401 a c a c c a t a t B a t c t c t a t t t a c t g g a c a g g c g g a a a t c g a ~ ~ t ~ g ~ t ~ g c t t ~ g c t t t ~ c t a ~ a a a t c g t t ~ t a t t a t ~ g ~ ~ g ~ g t ~ t t g ~ ~ ~ ~ g t t . ~ t ~ a ~ ~ ~ ~ ~ 501 g g a a g a a g c a a g a a c g a a a a g a g a t a a g g a t ~ ~ g g a t t ~ ~ ~ ~ a g a ~ ~ g g a a g c c ~ ~ a t g t ~ t ~ g c a ~ ~ t t t g ~ t t t ~ ~ a a a c g ~ t t a c t ~ ~ t ~ L l t c c g t c c t a g t

Y 8 P l . t a r t M S R K F D L K T I T D F , S V L V

601 tgggactggcatatcattatactacctggtcagtcggctact~aacgatgttgaatc~gg~ccgtt~t~aggta~~tc~aggg~~t~aa~gg~~aaacag G T G I S L Y Y L V S I R L L N D V E S G P L S C K S R E S K R K Q

a p u t a t i w mabrroa spurning d-in 701 tCC~tgcaatgggaaaagCtggtgaaagatcacc99caccggcattggcagaagt~~~att~g~cgcatatg~aagga~t~t~ttatct.tctatcgtr;icgccag

S L Q W E K L V K R S P A L A E V T L D A Y E R T I L S S I V T P D

801 atgaaataaatattacattccaggatattggtggcttagacccgcttattt a c catgaaagtgtuataIaCcccttgatgccagaLg~c~gaagta1.a BglII

E I N I T F Q D I G G L D P L I S W H E S V I Y P L M M P E V Y

901 ttctaatagccctttacttcaagcacctagcggtgtcttgctatatgggccaccaggatgtggtaaaaccatgttggcgaaggccctag caag aagt s t y 1

S N S P L L Q A P S G V L L Y E - n M L A K A L A p S a puta t i ve nuc leo t ide binding a m i n

1001 ~ g t g ~ t a a t t t t a t ~ t c a a t a a g a a t g t C a t g t ~ a t ~ t ~ t ~ a t g g a t a a ~ t g g t ~ t g g t g ~ a t c t a a ~ ~ ~ a a t a g t ~ g a c g c a a t . g L l ~ t c ~ t . L g g ~ ~ g a a ~ a ~ g L G A N F I S I R M S S I M D K W Y G E S N K I V D A M F S L A N K L

1101 t acaacc t tg ta taa ta t t ca t tgacgaaa t tga t t ca t t cc t tagagaacgg tc t t c tacaga tca tgaagL tacggcaac~ l . t aaaagc tgaaL~ .ca t Q P C I I F I D E I D S F L R E R S S T D H E V , ~ A T L K A E F M

1101 g a c ~ t t a c g g g a t g g c t t a ~ t g a a t a a l g g a ~ g g g t t a t g a : t a t c g g t g ~ t a c t a a t c g g a t a a a t g a c a t ~ g a t g a t g c g t t t t l . g ~ g g ~ g acc BStEII

T L W D G L L N N G R V M I I G A T N R I N D 1 D V A F L . H H ~

1301 a a a a g g t t t c t t g t t L c a t t g c c t g g t t = t g = t = ~ ~ ~ g t t ~ = ~ ~ a a t ~ t t ~ = g t g t t t t = t t ~ a ~ a g ~ ~ ~ ~ ~ t . ~ a a = t ~ g ~ c g a a g = = g ~ ~ l L c g a ~ L L g c K R F L V S L P G S D Q R Y K I L S V L L K D ~ ~ K L D E D E F D L Q

1401 aactgat tgcagacaataccaaaggat t t tc tgggtcggacctgaaag~g~t t tgcagagaagcggcctLagatgcagcaaaggaalacata~aacagaa L I A D N T K G F S G S D L K E L C R E A A L D A A K E Y I K Q K

1501 g a g g c a g c t c a t t g a C a g t g g t a c a a t c g a t c g a t g t t a a t g a t ~ ~ t t c t t c ~ t t g ~ = g ~ t ~ a g ~ = ~ ~ t t a a a g = = ~ a a a g a t t r . t a ~ a a a a a a a L t ~ a g a ~ l . g R Q L I D S G T I C V N D T S S L K I R P L K T K D F T K K L R M

1601 g a t g c t a c a a g t a ~ g t t g t C a t c t c a a c c L c t t g a t t a a g g a a g g a a a ~ t t a g a a a a a a a a g a a g a a a g ~ t t L t l a t t c ~ c g c ~ t c ~ L ~ t ~ ~ L ~ c c a g ~ t D A T S T L S S Q P L D * Y S P l * n d

1101 C g c c t g g c t c a a g a a c a t a u a g g a a g g t t g a c c c t c c t g ~ ~ g t a g a g c ~ a ~ t ~ g g t a g a t c t t ~ ~ ~ g g a c g c t g t t ~ ~ ~ ~ t c l g t a g c t g c c a g c t a t c c P G S R T Y R K V D P P D V E Q L G R S S W T L L H S V A A S Y P

1301 tgctcaacctacagaccaacagaagggtgaaatgaaacagtt~ttg~atatcttctc~c~t~ttt~tc~t~g~a~~tggtgtg~t~~agactl.tg~aaaa A Q P T D Q Q K G E M K Q F L N I F S H I Y P C N W C A K V F E K

1401 ~atatcagagaaaatgcaccacaagt:gagtcaagagaag~~~ttgggaggtggatgtgtgaagc~cacaa~aaagtcaataagaaa~tgagg~agCCca Y I R E N A P Q V E S R E E L G R W M C E A H N K V N K K L R K P K

1501 a a t t t g a c t g t a a t t t c t g g g a a a a a a g a l g g a a g g a c g g ~ t g g g ~ ~ g ~ a t a ~ g t ~ ~ ~ a t ~ t ~ ~ g ~ a t t c l . g a a ~ g ~ ~ ~ ~ c a t a a a a g ~ ~ ~ ~ ~ t r a t a c a F D C N F W E K R W K D G W D E * W V l O n d

1601 C a t t t a c a g a t t c t c g t g t a t a r a a c a c r c c a a t c g t a t c g t a ~ t g ~ t ~ a g t ~ ~ t a t g t t g g ~ t t t t t t ~ t t t ~ g g ~ t t g ~ g ~ c ~ L a ~ ~ L ~ t c ~ ~ g ~ t g a ~ t g ~ ~ 1701 t t t t c t a c t a a t a t a t g t t a g g a t t a a t a g t t t t a t a t g t a t a a a a a t a t t t ~ g t c a g t a t t t ~ g c t ~ ~ ~ ~ a g t t t a c t t t ~ ~ ~ ~ g ~ a l L g t ~ a t g t . L t g O B 0 1 c a g c t a g t g c c t c t g g t c t t t t g a g t a t t c c c a g c c c t t g t t t a g a g g t c a t ~ a ~ g a a c g a a c t t g a a a t t a g c c g c c g t a t c ~ g t g g t ~ L t ~ ~ ~ c c c 1 . t 2901 ctaagaagagcagaaaaagaaaaaaatctc

FIG. 3. The restriction map, sequencing scheme, nucleotide sequence, and deduced amino acid sequence of the MSPI gene. A, a total of 2,930 nucleotides were determined. Abbreviations for restriction sites are: B, BanIII; N , NsiI; G , BgZII; S, StyI; EZI, BstEII; and H, HindIII. Arrows represent regions and strands of the DNA that were sequenced. B , the predicted amino acid sequence of MSPl is shown by the single-letter code for amino acids below the nucleotide sequence, The putative membrane spanning domain and the putative nucleotide binding domain are indicated. The ERVl gene, which was found to be involved in the biogenesis of mitochondria (Lisowsky 1992), is also shown. The sequence data have been submitted to the EMBL‘GenBank Data Libraries under the accession number X68055.

cause temperature-sensitive growth and missorting of the fusion protein.6

MSP1, the MSPl gene product, was found to be localized in the outer mitochondrial membrane. The apparent molecular mass, 40 kDa, is in good agreement with that deduced from the DNA sequence, indicating that MSPl has no presequence to be processed. The alkali extraction and protease digestions revealed that it is an integral membrane protein with at least a part of the polypeptide exposed to the cytosolic side. The amino-

6 We rescreened the - los cells for missorting of the fusion protein and temperature-sensitive growth and isolated two mutants belonging to different complementation groups. The two mutants did not contain any mutations in the MSPl gene (M. Yamada, M. Nakai, and T. Endo, unpublished results).

terminal part of MSPl shows a two-domain structure with a 12-residue hydrophilic segment, which is rich in basic residues at the NH2 terminus, followed by a 16-residue uncharged and hydrophobic segment, which forms a potential membrane- spanning region. The hydropathy profiles of the amino-terminal regions resemble those of the two other outer membrane proteins, MAS70 and a 45-kDa mitochondrial outer membrane protein (Hase et al., 1983; Yaffe et al., 1989) (data not shown). MAS70 and the 45-kDa protein have the bulk of the polypeptide largely exposed to the cytosol, and in MAS70, the amino- terminal region has been shown to be responsible for targeting to the mitochondria and for anchoring to the outer membrane (Hase et al., 1984; Nakai et al., 1989a). It is thus likely that MSP1, MAs70, and the 45-kDa protein have the same type of


MSPl (362 ea)

Parlp (1043 aa)

"", rc Sec18p (757 sa)

'-c CDC48p (834 ea)

__"_1

""

Bcrl p (456 aa)

Sec18p, CDCap, and Bcslp. In the FIG. 4. Alignment of MSP1, Paslp,

diagrammatic alignment (A), positions of consensus sequence for ATP binding (shaded boxes), regions of higher similarity (boxes with solid outline), and regions of lower similarity (boxes with dashed outline) are shown. N and C indicate the amino and the carboxyl termini, respectively, and "aa" means amino acid residues. In the amino acid alignment of the regions of higher similarity ( B ) , identical amino acid residues are marked.

B MSPl 1 Paalp 6 0 1 Secl8p 143 CDC48p 117 B C ~ ~ D 129

MSP1 55 Paalp 661

CDC48p 177 secl8p 203

BCslp 189

MSP1 115 Paslp 721 Sec18p 263 CDC48p 237 B ~ a l p 249

nsm 174 Paelp 179

CDC48p 295 Secl8p 323

BCSlp 3 0 4

MSPl 2 3 5 Paalp 8 4 0 Secl8p 383 CDC48p 3 4 5 Bcalp 353

MSPl 285 Paalp 900

CDC46p 403 SeclBp 439

B ~ s l p 4 1 3

MSPl 3 4 5 Paalp 960 Secl8p 4 9 8 CDC48p 4 5 1

targetindsorting signals and have the same topology for membrane integration; the amino-terminal apolar stretch may function as a membrane-spanning domain leaving the rest of the polypeptides on the cytosolic side of the membranes.

The gene disruption experiment described here revealed that the MSPl gene is not required for the normal cellular growth or mitochondrial functions. We also carried out in vitro import experiments using mitochondria isolated from the mspl null mutant cells. However, no significant difference in the efficiency of import of mitochondrial precursors to such proteins as the p subunit of F,-ATPase, cytochrome cl, and MAS70 was observed between mitochondria from the null mutant cells and those from the wild-type cells (data not shown). Purified anti- MSPl IgG did not inhibit import of proteins into mitochondria isolated from the wild-type cells, either (data not shown). These data indicate that MSPl is not essential for protein import into mitochondria either in vivo or in vitro. One explanation for the apparent lack of an obvious phenotype for the mspsl mutant in vivo and in uitro is that the mitochondrial outer membrane has proteins with similar functions to MSP1. For example, the ini- tial stage of protein targeting to mitochondria has been shown to involve several functionally redundant components, and re- moval or inactivation of one component inhibits protein import

into mitochondria only partly (Pfanner et al., 1991; Baker and Schatz, 1991). However, Southern analyses with the MSPl gene as a probe under low stringency hybridization conditions showed that the MSPl gene is likely a single-copy gene in yeast (data not shown). A second possibility is that the function of MSPl under normal conditions has nothing to do with the intramitochondrial sorting of proteins and that its overexpression artificially perturbs the protein sorting in mitochondria; for example, overexpression of MSPl may cause onset of its interaction with the 61mC1 fusion protein or a putative sorting machinery so that the normal sorting of the fusion protein is impaired.

Although the function of MSPl is still unclear, it has a conserved motif for a nucleotide binding site. Since insertion into the outer membrane of the fusion protein, consisting of the amino-terminal 29 residues of MAS70 and dihydrofolate reductase has been shown to require ATP (Li and Shore, 19921, it would be interesting to examine if outer membrane proteins including MSPl are partly responsible for this ATP require- ment. Besides, MSPl belongs to a novel family of putative ATPases, some of which have been indeed confirmed to have ATPase activity; there is remarkable partial sequence similarity among the proteins, including MSP1, SeclBp, Paslp,

24268 Zntramitochondrial Protein Sorting in East

A 1%

67.0 - 43.0 -

..

1 2

kDa 1 . -,

94.0 - a)MSP1

b) Ssclp lIm O i 2 3

30.9 - I c) Kadp l o o y i

20.1 - 1 2 3

FIG. 5. Identification of M S P l in whole cell extracts of yeast (A) and subcellular localization of M S P l ( B ) . In A, the total cell homogenates were prepared from SF747-19D transformed with YEp13 (lane 1 ) or a YEpl3 derivative containing the entire M S P l region (lane 2 ) and analyzed by 12.5% SDS-PAGE followed by immunoblotting using the affinity-purified anti-MSP1 antibodies. In B, wild-type yeast (SF747-19D) cells were fractionated as described under “Materials and Methods.” Aliquots were analyzed for the distribution of the MSPl (a) and marker proteins Ssclp ( b ) (mitochondria), Kar2p ( c ) (microsomes), and Ssalp ( d ) (cytosol) by immunoblotting. Immunoblots were quanti- fied densitometrically. Columns: 1, mitochondria; 2, microsomes; 3, cytosol.

A

2 4 6 8 10 12 14 16 18 20 Fraction number - Succinetecyt c reductase

+ Antlmycln A-lnsensltlve NADKcyt c reductase

B MSPl

MAS70 - , .- - ”

2 4 6 8 10 12 14 16 18 20

Fraction number FIG. 6. Localization of M S P l in the outer mitochondrial mem-

brane. Submitochondrial membrane vesicles were prepared from SF747-19D yeast and then separated in a sucrose density gradient as described under “Materials and Methods.” Each gradient fraction was analyzed for the activity of marker enzymes of mitochondrial membranes (A), and the distribution of MSP1, MAS70 outer membrane protein, and cytochrome c, inner membrane protein was determined by immunoblotting (B ).

CDC48p, Bcslp, TBP1, Osdlp, and FtsH. Although significance of the sequence similarity among these rather functionally un- related proteins has not been understood yet, it is interesting to note that the FtsH protein, a prokaryotic member of the

Na *COS Triton X-1 00

P S P S P S P S P S ”“P Sonic’ 0.1M 0.05% 0.25% 1.0%

~~ ~~ - . ” I F - 7

M S P l * I b

b FIG. 7. Effects of sonication, alkali extraction, and Triton X-100

treatment on the association of MSPl with mitochondrial membrane. Aliquots of mitochondria (1 mg of protein) were treated with sonication, 0.1 M Na2CO:,, or Triton X-100 (0.05,0.25 1.0%) as described under “Materials and Methods.” Mitochondrial membranes were then recovered by centrifugation and analyzed by immunoblotting as described in the legend to Fig. 3.

Proteinase K 0 0.01 0.05 0.25 0.5 1.0

L -1

Porinb 1 i L J

FIG. 8. Accessibility of M S P l to externally added proteinase K in intact mitochondria. Aliquots of mitochondria prepared from D273-10B yeast cells were treated with various concentrations of proteinase K (0, 0.01, 0.05, 0.25, 0.5, 1.0 mg/ml) for 30 min a t 0 “C. After proteinase K was inhibited by phenylmethylsulfonyl fluoride, mitochondria were recovered by centrifugation and then analyzed by immunoblotting with appropriate antisera as indicated.

ATPase family, probably participates in the assembly of inner membrane proteins of E. coli, mediating efficient stop-transfer of their transmembrane segments at the inner membrane.’ Like MSP1, the FtsH protein contains only one ATP-binding motif and is a membrane protein with its large carboxyl-terminal domain exposed to the cytoplasm. Furthermore, Akiyama has isolated a ftsH mutation (stdl ) that impairs the anchoring efficiency of a transmembrane segment of a protein to the inner membrane and allows its following carboxyl-terminal part to be translocated across the inner membrane to the peripla~m.~ The FtsH protein thus resembles MSPl in that its mutation results in a similar phenotype to the overexpression of MSPl described in the present study; this could favor the possibility that MSPl may participate in the assembly of membrane proteins, in this case at the mitochondrial outer membrane.

Saeki, Y. Suetsugu (Osaka University), and T. Yamada (Nagoya Univer- Acknowledgments-We thank M. Harabayashi, Y. Takahashi, K.

sity) for helpful suggestions and technical assistance in preparing various antibodies and Dr. S. Wakabayashi (Himeji Institute of Technology) for advice on analyses of amino acid composition. We are grateful to James N. Burnell for critical reading of the manuscript, Dr. K. Ito (Kyoto University) for informing us with the results on the FtsH protein

K. Ito, personal communication.


prior to publication, and Drs. A. P. G. M. van Loon and G. Schatz (University of Basel) for the cytochrome c1 gene.

REFERENCES Amann, E., and Brosius, J. (1985) Gene (Amst.) 40, 183-189 Baker, K. P., and Schatz, G. (1991) Nature 349, 205-208 Baker, K. P., Schaniel, A., Vestweber, D., and Schatz, G. (1990) Nature 348, 605-

Dreusicke, D., and Schultz, G. E. (1986) FEES Lett. 208,301-304 Chou, P. Y., and Fasman, G. D. (1978) Adu. Enzymol., 45148

Eakle, K. A., Bemstein, M., and Emr, S . D. (1988) Mol. Cell. Biol. 8, 4098-4109 Erdmann, R., Wiebel, F. F., Flessau, A,, Rytka, J., Beyer, A,, Frohlich, K.-U., and

Frohlich, K.-U., Fries, H.-W., Rudiger, M., Erdmann, R., Bostein, D., and Mecke, D.

Glick, B. S . , Beasley, E. M., and Schatz, G . (1992) DendsEiochem. Sei. 17,453-459 Haid, A., and Suissa, M. (1983) Methods Enzymol. 93, 192-205 Hartl, F.-U., Pfanner, N., Nicholson, D. W., and Neupert, W. (1989) Biochim. Bio-

Hase, T., Riezman, H., Suda, K, and Schatz, G. (1983) EMBO J. 2, 2169-2172

Hase, T., Nakai, M., and Matrrubara, H. (1986) FEBS Lett. 197, 199-203 Hase, T., Muller, U., Riezman, H., and Schatz, G. (1984) EMBO J. 3,3157-3164

Hase, T., Harabayashi, M., Kawai, K., and Matsubara, H. (1987a) J. Biochem.

Hase, T., Harabayashi, M., Kawai, K., and Matsubara, H. (1987b) J. Biochem.

Hines, V., and Schatz, G. (1993) J. Biol. Chem. 288, 44M54 Hines, V., Brandt, A,, Griffiths, G., Horstmann, H., Brutsch, H., and Schatz, G.

Hurt, E. C., and van Loon, A. P. G. M. (1986) %rids Biochern. Sei. 11, 204-207 Johnson, L. M., Snyder, M., Chang, L. M. S. , Davis, R. W., and Campbell, J. L.

Kiebler, M., Pfaller, R., Sollner, T., Griffiths, G., Horstmann, H., Pfanner, N., and

Kyte, J., and Dwlittle, R. F. (1982) J. Mol. Bid . 167, 105-132 Li, J.-M., and Shore, G. C. (1992) Biochim. Biophys. Acta 1106, 233-241

609

Kunau, W.-H. (1991) Cell 64,49%510

(1991) J. Cell Biol. 114, 443-453

phys. Acta 988, 1-45

(Tokyo) 102,401-410

(Tokyo) 102,411419

(1990) EMBO J. 9,3192-3200

(1985) Cell 43, 369-377

Neupert, W. (1990) Nature 348, 610-616

Lisowsky, T. (1992) Mol. & Gen. Genet. 232, 58-64 Lowry, 0. H., Rasebrough, N. J., Farr, A. L., and Randall, R. J. (1951)J. Biol. Chem.

Maarse, A. C., Blom, J., Grivell, L. A,, and Meijer, M. (1992) EMBO J. 11, 3619-

McBride, H. M., Millar, D. G., Li, J.-M., and Shore, G. C. (1992) J. Cell Biol. 119,

Mitoma, J., and Ito, A. (1992) J. Biochem. (7bkyo) 111,2&24 Murakami, H., Blobel, G., and Pain, D. (1990) Nature 347,486491

Nakai, M., Harabayashi, M., Hase, T., and Matsubara, H. (1989b) J. Biochem. Nakai, M., Hase, T., and Matsubara, H. (1989a)J. Biochem. (Ibkyo) 105,513-519

Neblock, P., Dillon, P. J., Perkins, A,, and Rosen, C. A. (1990) Science 248, 1650-

Nobrega, F. G., Nobrega, M. P., and Tzagoloff, A. (1992) EMBO J. 11,3821-3829

Peters, J.-M., Walsh, M. J., and Franke, W. W. (1990) EMBO J . 9,1757-1767 Pain, D., Murakami, H., and Blobel, G. (1990) Nature 347,444-449

Pfaller, R., Steger, H. F., Rassow, J., F'fanner, N., and Neupert, W. (1988) J. Cell

F'fanner, N., Sollner, T., and Neupert, W. (1991) %rids Biochem. Sci. 16,63-67 Pon, L., Moll, T., Vestweber, D., Marshallsay, B., and Schatz, G. (1989) J. Cell Biol.

109,2603-2616 Sambrook, J., Fritsch, E. F., and Maniatis, T. (1989) Molecular Cloning: A Labo-

ratory Manual, Second Ed., Cold Spring Harbor Laboratory, Cold Spring Har- bor, NY

Sanger, F., Coulson, A., Barrell, B., Smith, A., and Roe, B. (1980) J. Mol. Biol., 143,

Schatz, G. (1987) Eur. J . Biochem. 185,1-6 161-178

Sherman, F., Fink, G. R., and Hicks, J. B. (1986) Laboratory Course Manual for Methods in Yeast Genetics, Cold Spring Harbor Laboratory, Cold Spring Harbor, NY

1061-1070

193,265-275

3628

6, 1451-1457

(7bkyo) 108, 181-187

1653

Biol. 107, 2483-2490

Solher, T., Griffiths, G., Pfaller, R., Pfanner, N., and Neupert, W. (1989) Cell 69,

Veshueber, D., Brunner, J., Baker, A., and Schatz, G. (1989) Nature 341, 205-209 Vieira, J., and Messing, J. (1987) Methods Enzymol. 163, 3-11 yaffe, M. P., Jensen, R. E., and Guido, E. C. (1989) J. Biol. Chem. 264,21091-21096 Yanisch-Perron, C., Vieira, J., and Messing, J. (1985) Gene (Amst.) 33, 103-119

Documents

Intramitochondrial Protein Sorting