Intro Gene regulation Synteny The End

Today

• Gene regulation• Synteny• Good bye!

Intro Gene regulation Synteny The End

Gene regulation

• What governs gene transcription?Genes active under different circumstances.

• Transcription factors bind to transcriptionfactor binding sites (TFBS).

• TFBS also known as regulatory elements(RE)

• TFBS can be grouped in regulatorymodules.

• cis-regulatory elements appear before thegene

Intro Gene regulation Synteny The End

Gene regulation

• What governs gene transcription?Genes active under different circumstances.

• Transcription factors bind to transcriptionfactor binding sites (TFBS).

• TFBS also known as regulatory elements(RE)

• TFBS can be grouped in regulatorymodules.

• cis-regulatory elements appear before thegene

Intro Gene regulation Synteny The End

Gene regulation

• What governs gene transcription?Genes active under different circumstances.

• Transcription factors bind to transcriptionfactor binding sites (TFBS).

• TFBS also known as regulatory elements(RE)

• TFBS can be grouped in regulatorymodules.

• cis-regulatory elements appear before thegene

Intro Gene regulation Synteny The End

Gene regulation

• What governs gene transcription?Genes active under different circumstances.

• Transcription factors bind to transcriptionfactor binding sites (TFBS).

• TFBS also known as regulatory elements(RE)

• TFBS can be grouped in regulatorymodules.

• cis-regulatory elements appear before thegene

Intro Gene regulation Synteny The End

Gene regulation

• What governs gene transcription?Genes active under different circumstances.

• Transcription factors bind to transcriptionfactor binding sites (TFBS).

• TFBS also known as regulatory elements(RE)

• TFBS can be grouped in regulatorymodules.

• cis-regulatory elements appear before thegene

Intro Gene regulation Synteny The End

Gene regulation

• Core promoter: about 35 bp prior to TSS,includes ”TATA box”

• Upstream promoter: 200 – 300 bp prior toTSS, activates transcription

• ”Enhancers” in a book: Up to 2000 bpbefore TSS.

• ”These experiments showed that, on average, the sequence

-300 to -50 bp of the TSS positively contributes to core

promoter activity. Interestingly, putative negative elements were

identified -1000 to -500 bp upstream of the TSS for 55 % of

genes tested.” (Cooper et al, Genome Res, 2005)

Intro Gene regulation Synteny The End

Gene regulation

• Core promoter: about 35 bp prior to TSS,includes ”TATA box”

• Upstream promoter: 200 – 300 bp prior toTSS, activates transcription

• ”Enhancers” in a book: Up to 2000 bpbefore TSS.

• ”These experiments showed that, on average, the sequence

-300 to -50 bp of the TSS positively contributes to core

promoter activity. Interestingly, putative negative elements were

identified -1000 to -500 bp upstream of the TSS for 55 % of

genes tested.” (Cooper et al, Genome Res, 2005)

Intro Gene regulation Synteny The End

Gene regulation

• Core promoter: about 35 bp prior to TSS,includes ”TATA box”

• Upstream promoter: 200 – 300 bp prior toTSS, activates transcription

• ”Enhancers” in a book: Up to 2000 bpbefore TSS.

• ”These experiments showed that, on average, the sequence

-300 to -50 bp of the TSS positively contributes to core

promoter activity. Interestingly, putative negative elements were

identified -1000 to -500 bp upstream of the TSS for 55 % of

genes tested.” (Cooper et al, Genome Res, 2005)

Intro Gene regulation Synteny The End

Gene regulation

• Core promoter: about 35 bp prior to TSS,includes ”TATA box”

• Upstream promoter: 200 – 300 bp prior toTSS, activates transcription

• ”Enhancers” in a book: Up to 2000 bpbefore TSS.

• ”These experiments showed that, on average, the sequence

-300 to -50 bp of the TSS positively contributes to core

promoter activity. Interestingly, putative negative elements were

identified -1000 to -500 bp upstream of the TSS for 55 % of

genes tested.” (Cooper et al, Genome Res, 2005)

Intro Gene regulation Synteny The End

Intro Gene regulation Synteny The End

Promoter and TSS

• Hard to recognize a TSS• Many attempts, little success• Recent understanding: several TSS

may exist

Intro Gene regulation Synteny The End

Correctness of TSS prediction

Fickett & Hatzigeorgiou, 1997

Intro Gene regulation Synteny The End

Regulatory elements

• Binding sites for transcription factors• Motifs, about 10 bp wide• Represent using PSSMs• Search strategy: use PSSM and look

upstream (2 kb – 5 kb) from gene.

Intro Gene regulation Synteny The End

Intro Gene regulation Synteny The End

Finding regulatory elements: ConSite• Problem: Overpredicting TFBS• Solution: Comparative genomics. Use

”nearby” species, look at conservation.

Intro Gene regulation Synteny The End

Finding regulatory elements

• Need: de novo motif discovery• Solution: Phylogenetic footprinting

• The mathematics: Gibbs sampling• Popular software: MEME• What it does: Iteratively improve a motif

from naive start point

Intro Gene regulation Synteny The End

Finding regulatory elements

• Need: de novo motif discovery• Solution: Phylogenetic footprinting• The mathematics: Gibbs sampling• Popular software: MEME• What it does: Iteratively improve a motif

from naive start point

Intro Gene regulation Synteny The End

Case study: motifs for TPX2 genes

Input: five sequences, 3000 nt longMotif 1, E = 1.7 · 10−14, width 39 bp

Pt TGCATGAGAGGGAGATTTAATCAGAAAGTTTGGTGCATGAGAGCAt TGCATGAGTGGGAGGTTTAATCAGAAAGTTTGTTGCATGAGAGCMt TGATTGAGAAGGAAATTTAATCAGAAAGTTTGGTGCAAGAGAGCZm -----GATCGGGATATATACTCAGAAGTTTGAGTCCCACCGCCCOs -----GACGGCAACGTCTCATCAGATGGTTGGTAGTAACACCAC

Motif 2, E = 2.8 · 10−5, width 28 bp

Pt TTGAGCATGTTTGTGATGTAGCAACAGAAt TAAAGCTTGTTGCTGATGTAGCAACAGAMt TAGAGCATGTTTGTGATGTAGCAACAGAZm TAGAGCTAGCTAGCTAGGTGGTCGCAAAOs TGGGGATGGCTGGTGAAGTGGCAGATTA

Intro Gene regulation Synteny The End

Case study: upstream analysis

ATG

ATG−1065−1682−2813

−125−297−819

−1616 −1212 −499 −112

−2149−2522−2642 −987−1072 −185

−233 −175

−1092−1535−1591 −378

ATG

ATG

ATG

−100

Intro Gene regulation Synteny The End

Comparative Genomics: Synteny

• Synteny: Preserved gene order

• Syntenic regions: Orthologous regionswith genes in synteny

• Applications:• Species phylogeny• Understandning evolution• Gene finding, regulatory elements• Support for orthology

Intro Gene regulation Synteny The End

Comparative Genomics: Synteny

• Synteny: Preserved gene order• Syntenic regions: Orthologous regions

with genes in synteny

• Applications:• Species phylogeny• Understandning evolution• Gene finding, regulatory elements• Support for orthology

Intro Gene regulation Synteny The End

Comparative Genomics: Synteny

• Synteny: Preserved gene order• Syntenic regions: Orthologous regions

with genes in synteny• Applications:

• Species phylogeny• Understandning evolution• Gene finding, regulatory elements• Support for orthology

Intro Gene regulation Synteny The End

Synteny background

• Macro-genomic mutations:• Transpositions

Segment moved• Reversals/inversions

Segment reversed• Transversals

End segment reversed

Intro Gene regulation Synteny The End

Populus chromosomesScience, 2006

Intro Gene regulation Synteny The End

Mouse chromosomes

Nature, 2002

Intro Gene regulation Synteny The End

Synteny explained by reversals

PNAS, 2003

Intro Gene regulation Synteny The End

Synteny explained by reversals

PNAS, 2003

Intro Gene regulation Synteny The End

Computational problems• How recognize ”orthologous regions”?• How recognize a syntenic region?

Intro Gene regulation Synteny The End

Computational problems• How recognize ”orthologous regions”?• How recognize a syntenic region?

Intro Gene regulation Synteny The End

Computational problems

• How many mutations separate two regions?• Which phylogeny explains synteny best?

Human

Sea urchin

Nematode

Fruit fly1

20 6

5

mtGenome, reversals

Intro Gene regulation Synteny The End

Computational problems

• How many mutations separate two regions?• Which phylogeny explains synteny best?

Human

Sea urchin

Nematode

Fruit fly1

20 6

5

mtGenome, reversals

Intro Gene regulation Synteny The End

Synteny in day-to-day work

• ”Are these two really orthologous?”

• ”Where is my gene? I cannot find it!”

Solutions

1. Look at neighbor genes2. Look at synteny map

Intro Gene regulation Synteny The End

Synteny in day-to-day work

• ”Are these two really orthologous?”• ”Where is my gene? I cannot find it!”

Solutions

1. Look at neighbor genes2. Look at synteny map

Intro Gene regulation Synteny The End

Synteny in day-to-day work

• ”Are these two really orthologous?”• ”Where is my gene? I cannot find it!”

Solutions

1. Look at neighbor genes2. Look at synteny map

Intro Gene regulation Synteny The End

Case study: Testatin

Intro Gene regulation Synteny The End

Case study: Testatin

Intro Gene regulation Synteny The End

Case study: Testatin

Intro Gene regulation Synteny The End

Case study: functional pseudogenes?

Target:

Intro Gene regulation Synteny The End

Case study: functional pseudogenes?

Must avoid:

Intro Gene regulation Synteny The End

Filtering with synteny

Require two predicted pseudogenes to be fromthe same syntenic region.

Intro Gene regulation Synteny The End

Intro Gene regulation Synteny The End

For the exam

• No pre-registration• Part 1: 15 p, bonus points apply

Minimum 10 points.• Part 2: 15 p, no bonus points• Pass exam at 15 points.