31

Introduction to NGS - Course list- DTU Health Techteaching.healthtech.dtu.dk/material/22126/2020/1_Introduction_to_NGS_GR.pdf · 3. juni 2019 DTU Sundhedsteknologi Introduction to

  • Upload
    others

  • View
    7

  • Download
    0

Embed Size (px)

Citation preview

Page 1: Introduction to NGS - Course list- DTU Health Techteaching.healthtech.dtu.dk/material/22126/2020/1_Introduction_to_NGS_GR.pdf · 3. juni 2019 DTU Sundhedsteknologi Introduction to

1

Page 2: Introduction to NGS - Course list- DTU Health Techteaching.healthtech.dtu.dk/material/22126/2020/1_Introduction_to_NGS_GR.pdf · 3. juni 2019 DTU Sundhedsteknologi Introduction to

Introduction to NGS

Gabriel RenaudAssociate Professor

Section of BioinformaticsTechnical University of Denmark

[email protected]

DTU Health Technology Bioinformatics

Page 3: Introduction to NGS - Course list- DTU Health Techteaching.healthtech.dtu.dk/material/22126/2020/1_Introduction_to_NGS_GR.pdf · 3. juni 2019 DTU Sundhedsteknologi Introduction to

DTU Sundhedsteknologi3. juni 2019 Introduction to NGS

Menu• Why are you all here today?• Why NGS?• How?• Why do we need bioinformatics for NGS?

3

Page 4: Introduction to NGS - Course list- DTU Health Techteaching.healthtech.dtu.dk/material/22126/2020/1_Introduction_to_NGS_GR.pdf · 3. juni 2019 DTU Sundhedsteknologi Introduction to

DTU Sundhedsteknologi3. juni 2019 Introduction to NGS 5

Reading the order of bases in DNA fragments

DNA sequencing

Page 5: Introduction to NGS - Course list- DTU Health Techteaching.healthtech.dtu.dk/material/22126/2020/1_Introduction_to_NGS_GR.pdf · 3. juni 2019 DTU Sundhedsteknologi Introduction to

DTU Sundhedsteknologi3. juni 2019 Introduction to NGS

Page 6: Introduction to NGS - Course list- DTU Health Techteaching.healthtech.dtu.dk/material/22126/2020/1_Introduction_to_NGS_GR.pdf · 3. juni 2019 DTU Sundhedsteknologi Introduction to

DTU Sundhedsteknologi3. juni 2019 Introduction to NGS 9

AGCAATCTCAATTACAREADING

Page 7: Introduction to NGS - Course list- DTU Health Techteaching.healthtech.dtu.dk/material/22126/2020/1_Introduction_to_NGS_GR.pdf · 3. juni 2019 DTU Sundhedsteknologi Introduction to

DTU Sundhedsteknologi3. juni 2019 Introduction to NGS

Human genome3 billion letters

Page 8: Introduction to NGS - Course list- DTU Health Techteaching.healthtech.dtu.dk/material/22126/2020/1_Introduction_to_NGS_GR.pdf · 3. juni 2019 DTU Sundhedsteknologi Introduction to

DTU Sundhedsteknologi3. juni 2019 Introduction to NGS

Frederick Sanger 1918 - 2013

1000 bases x 96

197711

Page 9: Introduction to NGS - Course list- DTU Health Techteaching.healthtech.dtu.dk/material/22126/2020/1_Introduction_to_NGS_GR.pdf · 3. juni 2019 DTU Sundhedsteknologi Introduction to

DTU Sundhedsteknologi3. juni 2019 Introduction to NGS

First generation: Sanger

• Fragment DNA• Clone into plasmid and amplify• DNA polymerase and only 1 primer• Sequence using labeled dinucleotides which cap seqs.• Run capillary electrophoresis/gel and “read” DNA code• Low output, long reads (~800-1200 nt), high quality• Produces 96 reads / run

12

Page 10: Introduction to NGS - Course list- DTU Health Techteaching.healthtech.dtu.dk/material/22126/2020/1_Introduction_to_NGS_GR.pdf · 3. juni 2019 DTU Sundhedsteknologi Introduction to

DTU Sundhedsteknologi3. juni 2019 Introduction to NGS

3 key concepts

• Read length• Throughput• Types of errors

13

Page 11: Introduction to NGS - Course list- DTU Health Techteaching.healthtech.dtu.dk/material/22126/2020/1_Introduction_to_NGS_GR.pdf · 3. juni 2019 DTU Sundhedsteknologi Introduction to

DTU Sundhedsteknologi3. juni 2019 Introduction to NGS

HiSeq 2500

Illumina

Welcomeselection option

read length

Page 12: Introduction to NGS - Course list- DTU Health Techteaching.healthtech.dtu.dk/material/22126/2020/1_Introduction_to_NGS_GR.pdf · 3. juni 2019 DTU Sundhedsteknologi Introduction to

DTU Sundhedsteknologi3. juni 2019 Introduction to NGS

HiSeq 2500

Illumina

Welcomeselection option

throughput def. 1

Page 13: Introduction to NGS - Course list- DTU Health Techteaching.healthtech.dtu.dk/material/22126/2020/1_Introduction_to_NGS_GR.pdf · 3. juni 2019 DTU Sundhedsteknologi Introduction to

DTU Sundhedsteknologi3. juni 2019 Introduction to NGS

HiSeq 2500

Illumina

Welcomeselection option

throughput def. 2

Page 14: Introduction to NGS - Course list- DTU Health Techteaching.healthtech.dtu.dk/material/22126/2020/1_Introduction_to_NGS_GR.pdf · 3. juni 2019 DTU Sundhedsteknologi Introduction to

DTU Sundhedsteknologi3. juni 2019 Introduction to NGS

T G A A T

con

fid

ence

HiSeq 2500

Illumina

Welcomeselection option

template

Page 15: Introduction to NGS - Course list- DTU Health Techteaching.healthtech.dtu.dk/material/22126/2020/1_Introduction_to_NGS_GR.pdf · 3. juni 2019 DTU Sundhedsteknologi Introduction to

DTU Sundhedsteknologi3. juni 2019 Introduction to NGS

AGCAATCTCAATTACAAATATACACCAACAAA

template

read

AGCAATCTCAATTACAGATATACACCAACAAA

mismatch

Page 16: Introduction to NGS - Course list- DTU Health Techteaching.healthtech.dtu.dk/material/22126/2020/1_Introduction_to_NGS_GR.pdf · 3. juni 2019 DTU Sundhedsteknologi Introduction to

DTU Sundhedsteknologi3. juni 2019 Introduction to NGS

AGCAATCTCAATTACA-AATATACACCAACAA

template

read

AGCAATCTCAATTACACAATATACACCAACAA

insert

Page 17: Introduction to NGS - Course list- DTU Health Techteaching.healthtech.dtu.dk/material/22126/2020/1_Introduction_to_NGS_GR.pdf · 3. juni 2019 DTU Sundhedsteknologi Introduction to

DTU Sundhedsteknologi3. juni 2019 Introduction to NGS

AGCAATCTCAATTACAAATATACACCAACAA

template

read

AGCAATCTCAATTACA-ATATACACCAACAA

deletion

Page 18: Introduction to NGS - Course list- DTU Health Techteaching.healthtech.dtu.dk/material/22126/2020/1_Introduction_to_NGS_GR.pdf · 3. juni 2019 DTU Sundhedsteknologi Introduction to

DTU Sundhedsteknologi3. juni 2019 Introduction to NGS

1977 1980 1983 1986 1989 1992 1995 1998 2001 2004 2007 2010 2013 2016 2019

454

Illumina

SOLiD

BGI

PacBio

Ion TorrentOxford Nanopore

Sanger

21

Page 19: Introduction to NGS - Course list- DTU Health Techteaching.healthtech.dtu.dk/material/22126/2020/1_Introduction_to_NGS_GR.pdf · 3. juni 2019 DTU Sundhedsteknologi Introduction to

DTU Sundhedsteknologi3. juni 2019 Introduction to NGS

1st generation to NGS

• 454 Life Sciences. – Bought by Roche 2007.

• Illumina/BGI is currently cheapest per GB• Long-read sequencing is revolutionizing assembly

22

Page 20: Introduction to NGS - Course list- DTU Health Techteaching.healthtech.dtu.dk/material/22126/2020/1_Introduction_to_NGS_GR.pdf · 3. juni 2019 DTU Sundhedsteknologi Introduction to

DTU Sundhedsteknologi3. juni 2019 Introduction to NGS

Sequencing costs

•Computer speed and storage capacity is doubling every 18 months and this rate is steady

•DNA sequence data is doubling faster than computer speeds!

23

Page 21: Introduction to NGS - Course list- DTU Health Techteaching.healthtech.dtu.dk/material/22126/2020/1_Introduction_to_NGS_GR.pdf · 3. juni 2019 DTU Sundhedsteknologi Introduction to

DTU Sundhedsteknologi3. juni 2019 Introduction to NGS

1990 - 2003 5G USD

20 research centers, 6 countries24

Picture: The Guardian

Page 22: Introduction to NGS - Course list- DTU Health Techteaching.healthtech.dtu.dk/material/22126/2020/1_Introduction_to_NGS_GR.pdf · 3. juni 2019 DTU Sundhedsteknologi Introduction to

DTU Sundhedsteknologi3. juni 2019 Introduction to NGS

Human sequencing

• First draft genome of human in 2001, final 2004• Estimated costs $5 billion USD, time 13 years

• Today:– 1000-2000$ for one genome– A couple of days!

25

Page 23: Introduction to NGS - Course list- DTU Health Techteaching.healthtech.dtu.dk/material/22126/2020/1_Introduction_to_NGS_GR.pdf · 3. juni 2019 DTU Sundhedsteknologi Introduction to

DTU Sundhedsteknologi3. juni 2019 Introduction to NGS

Storage and analysis• Cost of sequencing is almost less than the cost of storage

and analysis• One Illumina HiSeq X Ten system: 18,000 human genomes

per year!• A standard human (30-40x) whole-genome sequencing exp.

would create 150 Gb of data

26

Page 24: Introduction to NGS - Course list- DTU Health Techteaching.healthtech.dtu.dk/material/22126/2020/1_Introduction_to_NGS_GR.pdf · 3. juni 2019 DTU Sundhedsteknologi Introduction to

DTU Sundhedsteknologi3. juni 2019 Introduction to NGS

Distributed data production

• World wide >900 centers• >60 Pb pr year (2014)• Data transfer and storage becomes an issue

27

Page 25: Introduction to NGS - Course list- DTU Health Techteaching.healthtech.dtu.dk/material/22126/2020/1_Introduction_to_NGS_GR.pdf · 3. juni 2019 DTU Sundhedsteknologi Introduction to

DTU Sundhedsteknologi3. juni 2019 Introduction to NGS

The X Genomes projects

•Human population projects–1000 genomes project (2500 individuals)–Genomics England (100k individuals)–US Precision Medicine (1 million individuals)

•100K pathogens project, Earth Microbiome project, Cancer genome project, Plants and animals, Insects,…

28

Page 26: Introduction to NGS - Course list- DTU Health Techteaching.healthtech.dtu.dk/material/22126/2020/1_Introduction_to_NGS_GR.pdf · 3. juni 2019 DTU Sundhedsteknologi Introduction to

DTU Sundhedsteknologi3. juni 2019 Introduction to NGS

NGS in the clinic• Diagnostics of patients (+ fetus)• Focused treatment of cancer patients• Sequencing of bacterial isolates• Country-wide projects:

– UK, US, UAE, Qatar, Finland, China, …– DK: Danish regions want to sequence 100k individuals

29

Page 27: Introduction to NGS - Course list- DTU Health Techteaching.healthtech.dtu.dk/material/22126/2020/1_Introduction_to_NGS_GR.pdf · 3. juni 2019 DTU Sundhedsteknologi Introduction to

DTU Sundhedsteknologi3. juni 2019 Introduction to NGS

Personalized medicine

• Personalized medicine initiative in DK• Up to 70% of medicine does not work!• Sequence 100,000 patients on hospitals• Use extensive registry data• Current: 100 mill DKK (estimated 2 bill DKK)• National Genomics Institute

30

Page 28: Introduction to NGS - Course list- DTU Health Techteaching.healthtech.dtu.dk/material/22126/2020/1_Introduction_to_NGS_GR.pdf · 3. juni 2019 DTU Sundhedsteknologi Introduction to

DTU Sundhedsteknologi3. juni 2019 Introduction to NGS

NGS & bioinformatics

• Extreme data size causes problems• Just transferring and storing the data• Standard comparisons fail (N*N)• Standard/old tools can not be used• Think in fast and parallel programs

31

Page 29: Introduction to NGS - Course list- DTU Health Techteaching.healthtech.dtu.dk/material/22126/2020/1_Introduction_to_NGS_GR.pdf · 3. juni 2019 DTU Sundhedsteknologi Introduction to

DTU Sundhedsteknologi3. juni 2019 Introduction to NGS

What can we use it for?

• Whole genome re-sequencing• Population genomics• Diagnostics • Cancer genomics• Ancient genomes• Metagenomics• RNA sequencing• Single cell sequencing• Genomic Epidemiology• anything with DNA

33

Page 30: Introduction to NGS - Course list- DTU Health Techteaching.healthtech.dtu.dk/material/22126/2020/1_Introduction_to_NGS_GR.pdf · 3. juni 2019 DTU Sundhedsteknologi Introduction to

DTU Sundhedsteknologi3. juni 2019 Introduction to NGS

reseq

uenc

ing

de no

vo

Page 31: Introduction to NGS - Course list- DTU Health Techteaching.healthtech.dtu.dk/material/22126/2020/1_Introduction_to_NGS_GR.pdf · 3. juni 2019 DTU Sundhedsteknologi Introduction to

DTU Sundhedsteknologi3. juni 2019 Introduction to NGS

Summary

• Since 2006, the amount of data generated has drastically increased

• Bioinformatic knowledge is needed to handle the amount/type of data

• Sequencing technology keeps getting better, both in wet and dry labs

36