Invades Chicken Erythrocytes during Infection ACCEPTED · 25 as parasites or commensals of eukaryotic hosts. Many of them are 26 pathogens for mammals, reptiles, fish, arthropods,

Mycoplasma gallisepticum Invades Chicken

Erythrocytes during Infection

Gunther Vogl1, Astrid Plaickner1, Susan Szathmary2,

László Stipkovits2, Renate Rosengarten1, Michael P.

Szostak1*

1 Institute of Bacteriology, Mycology and Hygiene, Department of

Pathobiology, University of Veterinary Medicine Vienna, Veterinaerplatz

1, A-1210 Vienna, Austria

2 Veterinary Medical Research Institute, Hungarian Academy of Science,

Krt 21, H-1143 Budapest, Hungary

* Corresponding author,

phone: +43-1-25077-2104,

fax: +43-1-25077-2190,

email: [email protected]

Running Title: Mycoplasma gallisepticum Invades Erythrocytes

ACCEPTED

Copyright © 2007, American Society for Microbiology and/or the Listed Authors/Institutions. All Rights Reserved.Infect. Immun. doi:10.1128/IAI.00871-07 IAI Accepts, published online ahead of print on 22 October 2007

on July 15, 2020 by guesthttp://iai.asm

.org/D

ownloaded from

http://iai.asm.org/

Mycoplasma gallisepticum Invades Erythrocytes 2

Abstract 1

Recently, it was demonstrated in in vitro assays that the avian pathogen 2

Mycoplasma gallisepticum has the capability of invading non-phagocytic 3

cells. It was further shown that the mycoplasmas can survive and multiply 4

intracellularly for at least 48 h and that this cell invasion capacity 5

contributes to the systemic spreading of M. gallisepticum from the 6

respiratory tract to the inner organs. With the gentamicin invasion assay 7

and a differential immunofluorescence technique combined with confocal 8

laser scanning microscopy, we were able to demonstrate in in vitro 9

experiments that M. gallisepticum is also capable of invading sheep and 10

chicken erythrocytes. The frequency of invasion of three well-defined 11

M. gallisepticum strains was examined over a period of 24 h, and a 12

significant increase in invasiveness occurred after 8 h of infection. In 13

addition, blood samples derived from chickens experimentally infected by 14

aerosol with the virulent M. gallisepticum strain Rlow were analyzed. 15

Surprisingly, M. gallisepticum Rlow was detected in the blood stream of 16

infected chickens by nested PCR as well as by differential 17

immunofluorescence and interference contrast microscopy showing 18

mycoplasmas not only on the surface but also inside chicken erythrocytes. 19

This finding gives novel insights into the pathomechanism of 20

M. gallisepticum and may have implications for the development of 21

preventive strategies. 22

ACCEPTED


.org/D

ownloaded from

http://iai.asm.org/


Introduction 23

Mycoplasmas are cell wall-less prokaryotes that are widespread in nature 24

as parasites or commensals of eukaryotic hosts. Many of them are 25

pathogens for mammals, reptiles, fish, arthropods, and plants (28) 26

causing a wide variety of diseases with a predilection for the respiratory 27

tract, the genital tract, and joints (30). Among the agents of infection and 28

disease in domestic poultry and wild birds, M. gallisepticum is the most 29

important mycoplasma species (18), causing great losses in the poultry 30

industry. Infections often remain asymptomatic, but commercial poultry 31

flocks are required to be M. gallisepticum-free, as infected birds become 32

life-long carriers with the means to horizontal and vertical transmission. 33

The clinical manifestation following infection which is characterized as 34

“Chronic Respiratory Disease (CRD)” in chickens and “Infectious Sinusitis” 35

in turkeys is mainly induced by stress (18). As the infection starts with the 36

colonization of the respiratory tract, tracheitis and air sacculitis are the 37

predominant symptoms of a localized infection in chickens. Occasionally, 38

M. gallisepticum infections are also associated with arthritis, salpingitis, 39

conjunctivitis, and fatal encephalopathy (25), indicating that the organism 40

is able to cross the mucosal epithelial barrier and reach distant locations in 41

the chicken. Experimentally, it has been shown that the pathogen is able 42

to spread throughout the body following aerosol infection as found by 43

reisolation of M. gallisepticum from the heart, brain, liver, spleen, and 44

kidneys of experimentally infected chickens (25). How this agent manages 45

to convert a local infection into a systemic one, still remains elusive. 46

ACCEPTED


.org/D

ownloaded from

http://iai.asm.org/


Until the end of the 1980s, mycoplasmas were considered exclusively as 47

extracellular pathogens. This dogma was retracted, when in 1989, Lo et 48

al. (20) published the first report of a cell-invasive mycoplasma which was 49

isolated from patients with AIDS and later identified as M. fermentans. In 50

the years afterwards, the cell-invasive property of M. fermentans was 51

confirmed by other investigators (31, 32), and three other human 52

mycoplasmas, M. genitalium, M. pneumoniae and M. penetrans, were 53

reported to be similarly invasive for non-phagocytic cells (2, 21, 23, 32, 54

36). After these first discoveries of the cell-invasive potential of 55

mycoplasmas which are pathogenic for humans, M. gallisepticum, which 56

phylogenetically belongs to the M. pneumoniae cluster, was also described 57

to be cell-invasive, as it was shown to invade HeLa cells and chicken 58

embryo fibroblasts (CEF) in vitro (7, 34). At least for this mycoplasma 59

species it was further shown that the cell-invasive capacity plays an 60

important role in systemic spreading, because only the cell-invasive strain 61

Rlow was reisolated from inner organs after aerosol challenge of chickens, 62

whereas the non-invasive strain Rhigh was not (25). 63

That cell invasiveness provides bacterial pathogens with a number of 64

advantages is a generally accepted view. These advantages include 65

protection from the immune system, reduction of the efficacy of antibiotics 66

during treatment, as well as nutritional benefits. Moreover, internalization 67

by the eukaryotic host cell may enable the pathogen to pass through cell 68

barriers such as the mucosal epithelium. Of the cell-invasive 69

mycoplasmas, so far only M. fermentans, M. penetrans, and M. genitalium 70

ACCEPTED


.org/D

ownloaded from

http://iai.asm.org/


have been found inside cells in vivo. Intracellular M. fermentans and 71

M. penetrans have been visualized in clinical samples or tissue material 72

from AIDS patients using electron microscopy (20, 21), whereas more 73

recently intracellular M. genitalium has been demonstrated in human 74

vaginal samples using confocal immunoanalysis (5). In contrast, no 75

intracellular residence in vivo has been described for M. pneumoniae and 76

M. gallisepticum to date, even though this has been implicated for 77

M. gallisepticum from the systemic spreading of cell culture invasion-78

positive organisms in the chicken host after experimental infection (25). 79

However, more recently, M. pneumoniae was detected by PCR in the 80

bloodstream of a substantial proportion of patients with mycoplasma 81

pneumonia (10). Since M. gallisepticum and M. pneumoniae are related 82

phylogenetically and have other features in common, including an 83

attachment organelle, homology of adhesins and adhesion-related 84

molecules, gliding motility, and the similarity of disease, this prompted us 85

to investigate the capability of M. gallisepticum to invade red blood cells 86

(RBCs). 87

In this report, we provide evidence for the first time that 88

M. gallisepticum is able to invade RBCs. Erythrocyte-invasive organisms 89

were not only detected after in vitro infection but also in vivo in blood 90

samples of experimentally infected chickens. These findings implicate an 91

infection strategy that was previously unknown for pathogenic 92

mycoplasmas. By invading the host’s RBCs during infection, 93

M. gallisepticum gains access to a perfect transportation system that 94

ACCEPTED


.org/D

ownloaded from

http://iai.asm.org/


allows the agent to colonize distant niches while concomitantly being 95

protected from the host’s immune system. 96

Materials and Methods 97

Mycoplasma strains and growth conditions. M. gallisepticum strains 98

Rlow and Rhigh used in this study were kindly provided by S. Levisohn, 99

Kimron Veterinary Institute, Bet Dagan, Israel. Rlow represents the 10th 100

passage of the prototype strain R (19), and Rhigh represents the 164th 101

passage in artificial medium. The vaccine strain 6/85 was kindly provided 102

by Intervet (Intervet Intl., Boxmeer, The Netherlands). 103

All M. gallisepticum strains were grown in modified Hayflick medium (35) 104

containing 20% (vol/vol) heat-inactivated horse serum (Gibco Products - 105

Invitrogen Ltd., Paisley, UK). To estimate the number of colony forming 106

units (CFU) in cultures, serial dilutions were plated on modified Hayflick 107

medium containing 1% (wt/vol) Difco Agar Noble (BD, Franklin Lakes, NJ) 108

and incubated at 37°C. CFU were counted 7-10 days later using a SMZ-U 109

stereomicroscope (Nikon Corp., Tokyo, Japan). 110

DNA extraction. DNA extractions from M. gallisepticum cultures were 111

performed following the phenol extraction-method of Bashiruddin (3). The 112

DNA concentration was measured photometrically with a Gene Quant II 113

RNA/DNA Calculator (Pharmacia Biotech, Cambridge, UK). For the 114

detection of M. gallisepticum in blood of infected chickens, DNA was 115

extracted from the blood-Alsever´s solution mixture with the DNeasy 116

ACCEPTED


.org/D

ownloaded from

http://iai.asm.org/


Blood & Tissue Kit (Qiagen, MD) following the manufacturer’s protocol. 117

Ten µl of blood was used per extraction, and DNA was eluted twice from 118

the column using 100 µl sterile H20 per elution. For subsequent nested 119

PCR analysis 50 µl of eluate were used. 120

Scanning electron microscopy. Sheep or chicken erythrocytes mixed 121

with M. gallisepticum cells for various periods of time were incubated 122

overnight on poly-L-lysine coated cover slips to allow binding of the red 123

blood cells. The cover slips were washed 3 times with PBS followed by 2 124

washes with cacodylate buffer (0.1 M sodium cacodylate, pH 7.4) for 10 125

min. Samples were then fixed in 2.5% glutaraldehyde in cacodylate buffer 126

for 2 h at 4°C, and washed 3 times in cacodylate buffer. After a 127

dehydration of the samples with graded series of ethanol concentrations, 128

the specimens were critical point-dried in a Bal-TEC CPD030 (BAL-TEC AG, 129

Balzers, Liechtenstein), and after mounting, they were sputter-coated with 130

gold/palladium in a Polaron SC7640 (Quorum Technologies Ltd., 131

Newhaven, UK). The samples were viewed using a JEOL JSM 5410LV 132

scanning electron microscope (Jeol Ltd., Tokyo, Japan), operated at 10 133

kV. 134

Nested PCR. A nested PCR covering the 5’ region of crmA was 135

developed to detect M. gallisepticum in chicken blood. The external 136

primers J3F/J3R were applied in a 20 cycle amplification reaction yielding 137

a 349 bp product, while the internal primers J2F/J2R in a 30 cycle reaction 138

generated a 288 bp PCR product. The first amplification reaction was 139

performed in a total volume of 100 µl containing final concentrations of 3 140

ACCEPTED


.org/D

ownloaded from

http://iai.asm.org/


mM MgCl2, 0.2 mM dNTPs, 200 nM primers J3F (5’- 141

GCAATTAGTTAATCAAGCAAG -3’) and J3R (5’- 142

ATTACCAATTCTATTTGAGTTAG -3’), and 5 units of GoTaq polymerase 143

(Promega Corp., Madison, WI). Amplification conditions were 94°C for 3 144

min followed by 20 cycles of 94°C for 1 min, 55°C for 1 min, 72°C for 2 145

min, and a final extension step for 7 min at 72°C. For the nested PCR 146

reaction, 2 µl of the first PCR amplification reaction were used. The 147

reaction was performed in a total volume of 25 µl containing final 148

concentrations of 3 mM MgCl2, 0.2 mM dNTPs, 200 nM primers J2F (5’- 149

GAACGCTAGATGCTAATTCTG-3’) and J2R (5’- 150

GAACGTTAGCTTCATCATTAACC-3’), and 1.5 units of GoTaq polymerase. 151

The amplification conditions were similar to the first PCR, but included 30 152

instead of 20 cycles. Detection of amplification products was achieved by 153

electrophoresis of 3 µl of the reaction product in a 1.6% agarose gel 154

containing ethidium bromide and inspection under UV light. Gel pictures 155

were taken with the ChemiDocTM XRS Gel Documentation System (Bio-Rad 156

Laboratories Inc., Hercules, CA). 157

Gentamicin invasion assay. The number of intracellular 158

M. gallisepticum in HeLa-229 cells was analyzed using the gentamicin 159

invasion assay as described elsewhere (34) except for testing the efficacy 160

of gentamicin: briefly, mycoplasma cultures were centrifuged, washed, 161

and resuspended in Invitrogen’s minimum essential medium (MEM) to a 162

final density of 3-5 × 108 CFU per ml. Then, serial dilutions of gentamicin 163

were added to reach final concentrations from 25 to 400 µg/ml. After 3 h 164

ACCEPTED


.org/D

ownloaded from

http://iai.asm.org/


of incubation at 37°C, aliquots were plated onto agar plates without 165

gentamicin. As a gentamicin concentration of 100 µg/ml was shown to be 166

sufficient to kill all mycoplasmas in the medium, the gentamicin invasion 167

assays were performed with a gentamicin concentration of 400 µg/ml. 168

For quantification of intraerythrocytic M. gallisepticum, the protocol was 169

adapted as follows: Citrated chicken blood was centrifuged at 1,000 g for 170

3 min, and the pellet was washed at least two times in PBS while the buffy 171

coat layer containing white blood cells was removed. The remaining RBCs 172

were adjusted to 2 × 108 RBC/ml with PBS. M. gallisepticum strains Rlow, 173

Rhigh, and 6/85 were grown as described above to mid-exponential phase, 174

as indicated by the metabolic color change of the medium, followed by at 175

least 3 washings with PBS. During washing, the M. gallisepticum culture 176

was centrifuged at 12,000 g for 10 min, and after the final centrifugation 177

the pellet was resuspended in Invitrogen´s MEM mix containing L-178

glutamine, Earle’s balanced salts, and HEPES, supplemented with 179

Invitrogen´s 5% (vol/vol) tryptose phosphate broth, 0.1 mM non-180

essential amino acids, and 7.75% (vol/vol) fetal calf serum. Resuspended 181

M. gallisepticum cells were passed through a 23 G-injection needle with 182

high speed at least 20 times to disperse the mycoplasma cells. For 183

infection of RBCs, M. gallisepticum cultures were diluted to approximately 184

4-8 × 105 CFU/ml and mixed with RBCs to yield a final ratio of 185

erythrocytes:mycoplasmas of 125:1 to 500:1. After 1, 2, 4, 8, and 24 h of 186

infection at 37°C, 1 ml samples were removed and split into two parts: 187

One part was mixed with the same volume of MEM containing gentamicin 188

ACCEPTED


.org/D

ownloaded from

http://iai.asm.org/


to reach a final concentration of 400 µg/ml and incubated for 3 h at 37°C 189

to kill all extracellular mycoplasmas, whereas the second part received the 190

same treatment but without the antibiotic. After incubation, the samples 191

were washed at least 3 times with PBS by centrifugation at 12,000 g for 192

10 min. Finally, appropriate dilutions of both gentamicin-treated and 193

untreated RBC suspensions were plated onto modified Hayflick agar plates 194

to allow intraerythrocytic mycoplasmas to form colonies. The number of 195

colonies was determined 7-10 days later and the invasion frequencies 196

were calculated from the numbers of colonies with and without gentamicin 197

treatment. 198

Differential immunofluorescence assay. The presence of 199

mycoplasmas within RBCs either in the in vitro or the in vivo experiments 200

was investigated by a modified version of the double-immunofluorescence 201

(DIF) method described by Heesemann and Laufs (15). An adaptation of 202

this method for use with mycoplasmas and HeLa cells, and the generation 203

of polyclonal anti-M. gallisepticum rabbit antibodies (Abs) have been 204

described elsewhere (34). The DIF method was adapted for use with 205

erythrocytes as follows: Chicken or sheep RBCs were washed and infected 206

with M. gallisepticum cultures similar to the procedure described for the 207

gentamicin invasion assay. The infected RBCs were gently washed 3 times 208

with PBS containing 2% (wt/vol) bovine serum albumin (PBS-BSA), and 209

extracellular mycoplasmas were detected by incubating unpermeabilized 210

cells with rabbit anti-M. gallisepticum-hyperimmune serum diluted 1:200 211

in PBS-BSA for 30 min at room temperature (RT) and then with 1:2,000-212

ACCEPTED


.org/D

ownloaded from

http://iai.asm.org/


diluted fluorescein isothiocyanate (FITC)-labeled goat anti-rabbit-IgG 213

(Harlan Sera-Lab Ltd., Loughborough, UK) for 30 min at RT. The RBCs 214

were then placed into chambers of an 8-well Lab-Tek II chamber slide 215

(Nalge Nunc Intl., Rochester, NY) and air-dried. The RBCs were fixed and 216

permeabilized with ethanol washings of increasing concentration (50-217

96%) to allow intracellular antibody diffusion followed by two washings 218

with 100% methanol and air-drying. In order to stain all extracellular and 219

intracellular mycoplasma, each chamber was incubated with the same 220

anti-M. gallisepticum hyperimmune serum for 30 min, followed by an 221

incubation for 30 min with goat anti-rabbit-IgG labeled with Alexa Fluor 222

405 (Molecular Probes, Invitrogen). In the case of RBCs from 223

experimentally infected chickens, goat anti-rabbit-IgG labeled with Alexa 224

Fluor 633 (Molecular Probes, Invitrogen) was used. Finally, the chambers 225

were removed, and the samples were mounted under a glass cover slip in 226

1:1.7 (vol/vol) glycerol:PBS containing 13% (wt/vol) Mowiol (Clariant, 227

Muttenez, Switzerland) and 0.5% (wt/vol) n-propyl gallate (Sigma-Aldrich, 228

St. Louis, MO). Samples were examined with the confocal laser scanning 229

microscope LSM 510 Meta (Carl Zeiss MicroImaging GmbH, Jena, 230

Germany) using argon (488 nm), diode (405 nm), or helium-neon lasers 231

(633 nm) for specific excitation of the fluorescence dyes FITC, Alexa Fluor 232

405, and Alexa Fluor 633. The resulting fluorescence images were 233

superimposed by differential interference contrast (DIC) micrographs for 234

visualization of the RBCs. 235

Animal experiments. One-day old Ross 308 chickens originating from 236

ACCEPTED


.org/D

ownloaded from

http://iai.asm.org/


a commercial flock free of M. gallisepticum and M. synoviae as monitored 237

by monthly serological testings were selected for the infection experiment 238

which was performed at the Veterinary Medical Research Institute, 239

Budapest, Hugary, in accordance with the guidelines of the Hungarian Law 240

for protection of animal rights. The mycoplasma-free status was verified 241

by testing chicken sera with the MYGA and MYSY ELISA kits (Diagnosticum 242

Zrt., Budapest, Hungary) and by 14-day-cultivation of trachea swab 243

samples in modified Hayflick medium. Ten chickens were selected for the 244

animal experiment and raised under isolated conditions. At day 21, they 245

were placed in an aerosol chamber of 0.22 m3. For the experimental 246

infection, 10 ml of a freshly grown culture of M. gallisepticum strain Rlow 247

(5.6 x 107 CFU ml-1) was sprayed with 1 atm pressure for 100 sec into the 248

chamber and the birds were left exposed for another 20 min. Blood was 249

collected the day before challenge and then on days 6, 12, and 20 p.i. 250

from the chicken wing vein. Blood from all the chickens- sampled on the 251

same day- was pooled and mixed with an equal amount of Alsever´s 252

solution. After thorough mixing, the blood was kept at 4°C or frozen at 253

-20°C until further PCR analysis. 254

Statistical analysis of the gentamicin invasion assay. Numerical 255

data for gentamicin invasion assays were calculated from the means of at 256

least 5 independent experiments ± standard deviation. The normal 257

distribution of the data was tested with the Kolmogorov-Smirnov test. 258

Invasion frequencies of strains Rlow, Rhigh, and 6/85 at different times were 259

compared by one-way analysis of variance (ANOVA) using the statistical 260

ACCEPTED


.org/D

ownloaded from

http://iai.asm.org/


analysis program SPSS 14.0 (SPSS Inc., Chicago, IL). A P value of <0.05 261

was considered significant. 262

Results 263

Interaction of M. gallisepticum with Erythrocytes Visualized by 264

Scanning Electron Microscopy. In a first approach to examine the 265

erythrocyte-invasion properties of M. gallisepticum, the morphological 266

details of its interaction with erythrocytes was studied by scanning electron 267

microscopy after incubating sheep and chicken RBCs for various periods of 268

time with mycoplasma cells. As seen in Figure 1, showing an infected 269

sheep (Fig. 1A) and chicken (Fig. 1B) erythrocyte, some of the 270

mycoplasmas appeared to adhere with their tip structure to the RBC 271

surface. This observation was not unexpected, as the tip structure of 272

M. gallisepticum is considered as specialized multifunctional organelle that 273

mediates attachment to the respiratory epithelium of the chicken host 274

during infection (6). Some of the RBCs displayed a misshapen and twisted 275

morphology (Fig. 1B), as was also reported by Lam (17) and Razin et al. 276

(29). The most intriguing detail, however, were the imprints seen on the 277

otherwise smooth surface of selected RBCs, as shown in Figure 1A. The 278

form of these imprints resembled the pear-like shape of M. gallisepticum 279

cells that might have penetrated the RBC membrane at that point. This 280

finding encouraged us to further investigate whether M. gallisepticum is in 281

fact able to invade RBCs in vitro. 282

ACCEPTED


.org/D

ownloaded from

http://iai.asm.org/


M. gallisepticum Invades Erythrocytes In Vitro. To investigate the 283

presence of intracellular mycoplasma, a double immunofluorescence 284

technique (DIF) was used. The DIF staining was applied on sheep and 285

chicken erythrocytes incubated for different periods of time with the 286

virulent M. gallisepticum strain Rlow. Confocal laser scanning micrographs 287

of sheep RBCs infected for 24 h revealed the presence of intraerythrocytic 288

M. gallisepticum cells (data not shown). The RBCs contained only one 289

organism per cell, and the number of RBCs carrying intraerythrocytic 290

mycoplasmas was very low, estimated to be 1 out of 2,000. 291

M. gallisepticum Rlow was able to invade chicken erythrocytes after 292

infection for 24 h (Fig. 2). The superimposition of FITC- and Alexa Fluor 293

405-fluorescence with the differential interference contrast (DIC) 294

micrograph clearly showed both, surface and intracellular foci of 295

fluorescence corresponding to extracellular and intracellular mycoplasmas 296

(Fig. 2E). 297

In parallel studies, when scanning along a vertical Z-axis and taking 298

micrographs of each 0.5 µm slice (Fig. 2D-F), an extracellular mycoplasma 299

located at the erythrocyte’s surface (yellow) became visible, fading out as 300

the cross section layer was moved downwards. At the same time, an 301

intracellular mycoplasma (red) came into view showing the relative 302

difference in the localization of these two mycoplasma cells. Uninfected 303

RBCs treated with anti-M. gallisepticum antiserum and FITC- and Alexa 304

fluor 405 conjugated antibodies exhibited no fluorescence at all (not 305

shown). Interestingly, all intracellular mycoplasmas were located in the 306

ACCEPTED


.org/D

ownloaded from

http://iai.asm.org/


cytoplasm or perinuclear region, but never inside the nucleus of the 307

chicken RBCs. 308

The gentamicin invasion assay, a method first described by Kihlström 309

(16) was used to quantify the percentage of intracellular bacteria within 310

the whole population. Since gentamicin is not able to cross intact 311

eukaryotic cell membranes, it kills only extracellular mycoplasmas when 312

added to a M. gallisepticum-infected cell culture. A time course 313

experiment (Fig. 3) was used to compare the number of CFU in 314

gentamicin-treated and untreated M. gallisepticum-infected RBC 315

suspensions. After 30 min of infection, M. gallisepticum established 316

intracellular residence, therefore surviving the gentamicin treatment (data 317

not shown). Significant differences of cell invasiveness were observed 318

between the hemadsorption (HA)-positive strain Rlow and HA-negative 319

strains Rhigh and 6/85 (Fig. 3), with strain Rlow being the strain of highest 320

invasiveness. The mean invasion frequencies of Rlow ranged from 0.13% 321

after the first hour to 1.18% after 24 h, whereas the highest invasion rate 322

was found at 0.22% for strains Rhigh at 8 h and 0.09% for 6/85 at 4 h. At 323

all times examined, Rlow exhibited the highest invasion rate, while strain 324

6/85 had the lowest. The reduced invasion rate of 6/85 is statistically 325

significant compared to Rlow and Rhigh after 8 h (P < 0.05) and to Rlow after 326

24 h (P < 0.02). Statistical significant differences of invasiveness between 327

Rlow and Rhigh were only observed after 24 h of invasion (P < 0.05). 328

Overall, the invasion frequencies of all three M. gallisepticum strains were 329

drastically lower when RBCs were used instead of the HeLa-229 cell line. 330

ACCEPTED


.org/D

ownloaded from

http://iai.asm.org/


Concurring with the invasion rates for Rlow and Rhigh reported by Winner et 331

al. (34), we observed invasion frequencies after 2 h of infection of 5.7% 332

and 1.1%, respectively, whereas the vaccine strain 6/85 exhibited a lower 333

invasion rate of 0.5%. Comparing these frequencies with the invasion 334

frequencies found with RBCs, this means a 18-fold, 48-fold and 11-fold 335

higher invasion rate for Rlow, Rhigh and 6/85, respectively, when HeLa-cells 336

are used. 337

Interestingly, in the time course experiment the invasion frequencies of 338

Rlow did not follow a linear course from 1 to 24 h invasion time, but 339

increased only slightly during the first 8 h. Between 8 and 24 h the 340

invasion frequency of Rlow increased 6-fold whereas the invasion rate 341

stayed relatively constant for Rhigh and 6/85. 342

M. gallisepticum Invades Chicken Erythrocytes during In Vivo 343

Infection. Blood samples taken from chickens experimentally infected 344

with M. gallisepticum Rlow were analyzed for the presence of 345

M. gallisepticum by DIF microscopy and by nested PCR. The successful 346

infection and systemic spreading of the pathogen was proven by necropsy 347

including lesion scoring of typical M. gallisepticum-associated lesions and 348

reisolation of the pathogen from inner organs (data not shown). 349

When applying the same DIF technique on these blood samples as in the 350

in vitro experiments, M. gallisepticum cells residing not only on the 351

surface but also inside the chicken RBCs could be detected (Fig. 4). The 352

numbers of mycoplasmas found either inside or on the surface of RBCs in 353

blood samples of experimentally infected chickens was rather low. Only 354

ACCEPTED


.org/D

ownloaded from

http://iai.asm.org/


one out of 500 RBCs of the experimentally infected chickens carried a 355

M. gallisepticum cell either intra- or extracellularly as estimated from the 356

investigation of multiple samples. 357

For a highly sensitive detection of M. gallisepticum Rlow in chicken blood, 358

a PCR method based on the nested amplification of a sequence in the 5’ 359

region of the crmA gene was developed. The sensitivity of the nested PCR 360

approach was determined with both, serial dilutions of genomic DNA of 361

Rlow and with chicken blood mixed with dilutions of viable M. gallisepticum. 362

An amount as low as 16 fg of genomic DNA of Rlow tested positive with this 363

PCR approach calculated to correspond to 14.5 M. gallisepticum genome 364

equivalents. The calculation is based on the given genome size of 365

M. gallisepticum strain Rlow of 996,422 bp (27). When mixing viable Rlow 366

with erythrocytes, the detection limit of the nested PCR approach was 1.7 367

CFU. 368

With this highly sensitive PCR approach, blood samples from 369

experimentally infected chickens were analyzed (Fig. 5). Blood from 370

chickens taken before infection (day 0, negative control) did not result in 371

a PCR amplification product, indicating that no mycoplasma was present in 372

the blood before infection. The same sample mixed with 3.7 × 104 CFU 373

per ml of Rlow (positive control) led to the amplification of the 288 bp 374

fragment showing that no PCR-inhibitory compounds were present in the 375

blood samples. All samples taken 6, 12, and 20 days post infection (p.i.) 376

tested positive, indicating the presence of M. gallisepticum Rlow in the 377

blood stream of chickens as early as 6 days p.i. Based on the sensitivity of 378

ACCEPTED


.org/D

ownloaded from

http://iai.asm.org/


the nested PCR assay with mycoplasma-spiked erythrocytes (see above), 379

the PCR detection signal was calculated to correspond to at least 680 CFU 380

per ml of chicken blood. 381

Discussion 382

When analyzing the erythrocyte-adhesion properties of different 383

M. gallisepticum strains we made scanning electron micrographs of 384

M. gallisepticum-infected RBCs where we observed invaginations and 385

grooves containing structures that show the typical pear-like shape of 386

M. gallisepticum as the surface-attached mycoplasmas. Changes in the 387

surface of mycoplasma-infected chicken erythrocytes like the appearance 388

of dimples and grooves were already reported before by Lam (17), and 389

indentations of sheep erythrocyte membranes after exposure to 390

M. gallisepticum were described by Razin et al. (29). Such indentations 391

have also been described for M. penetrans in interaction with eukaryotic 392

cells (21) and for the erythrocyte-invasive bacterium Bartonella 393

bacilliformis (4). Lam even observed perforations on the surface of 394

M. gallisepticum-exposed erythrocytes and speculated that 395

M. gallisepticum may penetrate the RBCs (17). In this report we provide 396

evidence that M. gallisepticum indeed is able to invade RBCs, not only in 397

an experimental in vitro system, but also under in vivo conditions during 398

the course of experimental infection. 399

The erythrocyte invasion of M. gallisepticum was proven in vitro with 400

well-established approaches to identify intracellular bacteria in order not 401

ACCEPTED


.org/D

ownloaded from

http://iai.asm.org/


to rely on a single method only. The technical problems inherent in each 402

method might lead to an erroneous judgment on the cell invasiveness of a 403

given pathogen if only a single method is used. A common problem of the 404

gentamicin invasion assay is that the number of mycoplasma colonies 405

growing on the agar plates better represents the number of infected host 406

cells rather than the number of invasive mycoplasmas. Several 407

mycoplasmas simultaneously infecting one given RBC or intracellularly 408

multiplying mycoplasmas derived from a single infecting organism might 409

lead to the formation of only one single mycoplasma colony on Hayflick 410

agar. The same result can be expected if a single mycoplasma infects one 411

RBC without multiplying. The real invasion frequency of a given 412

M. gallisepticum strain therefore might be different. To minimize the 413

possible error, a low multiplicity of infection of erythrocytes: mycoplasmas 414

ranging from 125:1 to 500:1 was chosen, to reduce the possibility of 415

multiple infections of any given RBC. To rule out the effect of intracellular 416

multiplication on the results, the CFU of treated and untreated 417

M. gallisepticum/RBC- suspensions were compared. This is in contrast to 418

Winner et al. (34) who compared CFU values before and after gentamicin 419

treatment, which in our case gave slightly higher invasion rates (data not 420

shown), an effect that could also be due to extracellular multiplication of 421

M. gallisepticum during incubation in the untreated control group. 422

The time-course experiment for the in vitro invasion capabilities of the 423

three M. gallisepticum strains included in this study was followed for 24 h. 424

Longer infection periods resulted in falsely negative results as the 425

ACCEPTED


.org/D

ownloaded from

http://iai.asm.org/


erythrocytes apparently started to lyse after that period of time. 426

Interestingly, the invasion rates of the virulent strain Rlow increased only 427

slightly during the first 8 h but then increased by a factor of nearly 6 428

during the next 16 h. A possible explanation might be that after the first 429

contact with the RBCs, M. gallisepticum responds by producing certain 430

gene products which enable the pathogen to enter the RBC more 431

efficiently. Another explanation might be that the small percentage of 432

M. gallisepticum that successfully invades the RBCs in the first few hours 433

have multiplied intracellularly, and after escaping the originally invaded 434

RBC, they again invaded previously uninfected RBCs de novo. The ability 435

of M. gallisepticum to multiply inside cells has already been described for 436

HeLa-229 cells (34). 437

Mycoplasma species other than M. gallisepticum were also reported to 438

propagate intracellularly, as it has been described for M. penetrans and for 439

the closely related species M. pneumoniae and M. genitalium (2, 8, 23). 440

The apparent advantages of entering eukaryotic cells are protection from 441

the host’s immune system, while getting easy access to nutrients. In the 442

case of erythrocyte invasion the additional benefit might be the iron found 443

inside the erythrocytes in large amounts in the form of hemin or other 444

trace metals. The requirement of iron for bacterial growth is a common 445

theme in pathogenicity (13), and hemin is known to support the growth of 446

invasive bacteria like Bartonella quintana (26) and Haemophilus influenzae 447

(1). An influence of hemin on growth of mycoplasmas has, however, not 448

been described to date. 449

ACCEPTED


.org/D

ownloaded from

http://iai.asm.org/


Another main advantage of entering erythrocytes might be the means to 450

reach new sites of infection. M. gallisepticum causes acute and chronic 451

infections in birds (18) and chronicity of mycoplasma infections is 452

speculated to be due to intracellular persistence of the pathogen (2, 8). 453

M. gallisepticum has been reisolated from different chicken organs 454

including the brain after experimental in vivo infection (25). The systemic 455

spreading via the blood stream, however, might explain how the pathogen 456

reaches its distant niches after the first colonization of the air sacs by 457

causing a transient bacteremia of at least 20 days post infection, as 458

indicated by the nested PCR experiments. After a certain time of 459

intraerythrocytic residence, M. gallisepticum may escape by lysing the 460

erythrocyte with the help of the membrane-bound hemolysin activity 461

reported by Minion and Jarvill-Taylor (24). 462

The cell invasion process of mycoplasmas is still poorly understood. 463

Fibronectin-binding proteins as detected in other facultative intracellular 464

bacteria (11, 12) have been identified also in M. penetrans (14), 465

M. pneumoniae (9), and more recently also in M. gallisepticum (22). 466

However, the mechanism of M. gallisepticum invasion into non-phagocytic 467

eukaryotic cells is still not clear at present. In M. pneumoniae it has been 468

speculated that adhesion and invasion are independent features, because 469

cytadherence-positive but invasion-negative strains were detected (2). In 470

the strains used in our experiments, we observed that erythrocyte 471

invasion of M. gallisepticum correlates with hemadsorption, therefore 472

concluding that cytadherence, and expression of the hemadsorption-473

ACCEPTED


.org/D

ownloaded from

http://iai.asm.org/


mediating genes gapA and crmA (7, 33) is at least a prerequisite for cell 474

invasion if not directly correlated. 475

Although host cell invasion has been reported for a few mycoplasma 476

species, including M. gallisepticum (2, 7, 20, 23, 31, 32, 34, 36), this is to 477

our knowledge the first report that provides evidence that M. gallisepticum 478

invades red blood cells in vitro and in vivo, a fact which has not been 479

shown for any mycoplasma species so far. A more thorough investigation 480

about the mechanism underlying erythrocyte invasion will be addressed in 481

the near future. 482

Acknowledgements 483

We thank M. Skalicky and C. Binter for assistance with the statistical 484

calculations, and C. Neubauer for providing chicken blood for the in vitro 485

assays. 486

Funding 487

This work was supported in part by grant P16538 (to RR) from the 488

Austrian Science Fund (FWF), and by a pilot project grant (to MPS) from 489

the University of Veterinary Medicine Vienna through its research focus 490

programme. GV was financially supported by the FWF and by a doctoral 491

fellowship from the University of Veterinary Medicine Vienna. AP was 492

supported by Mycosafe Diagnostics GmbH. 493

ACCEPTED


.org/D

ownloaded from

http://iai.asm.org/


References 494

1. Artman, M., E. Domenech, and M. Weiner. 1983. Growth of 495

Haemophilus influenzae in simulated blood cultures supplemented with 496

hemin and NAD. J. Clin. Microbiol. 18:376-379. 497

2. Baseman, J. B., M. Lange, N. L. Criscimagna, J. A. Giron, and C. 498

A. Thomas. 1995. Interplay between mycoplasmas and host target 499

cells. Microb. Pathog. 19:105-116. 500

3. Bashiruddin, J. B. 1998. Extraction of DNA from Mycoplasmas, p. 501

141-144. In R. Miles and R. Nicholas (ed.), Mycoplasma Protocols, vol. 502

104. Humana Press, Totowa, New Jersey. 503

4. Benson, L. A., S. Kar, G. McLaughlin, and G. M. Ihler. 1986. Entry 504

of Bartonella bacilliformis into erythrocytes. Infect. Immun. 54:347-505

353. 506

5. Blaylock, M. W., O. Musatovova, J. G. Baseman, and J. B. 507

Baseman. 2004. Determination of infectious load of Mycoplasma 508

genitalium in clinical samples of human vaginal cells. J. Clin. Microbiol. 509

42:746-752. 510

6. Carson, J. L., P.-C. Hu, and A. M. Collier. 1992. Cell Structural and 511

Functional Elements, p. 63-72. In J. Maniloff, R. N. McElhaney, L. R. 512

Finch, and J. B. Baseman (ed.), Mycoplasmas - Molecular Biology and 513

Pathogenesis. American Society for Microbiology, Washington, D.C. 514

7. Citti, C., G. F. Browning, and R. Rosengarten. 2005. Phenotypic 515

diversity and cell invasion in host subversion by pathogenic 516

mycoplasmas, p. 439-483. In A. Blanchard and G. F. Browning (ed.), 517

ACCEPTED


.org/D

ownloaded from

http://iai.asm.org/


Mycoplasmas: Pathogenesis, molecular biology, and emerging 518

strategies for control. Horizon Bioscience, Wymondham, Norfolk, UK. 519

8. Dallo, S. F., and J. B. Baseman. 2000. Intracellular DNA replication 520

and long-term survival of pathogenic mycoplasmas. Microb. Pathog. 521

29:301-309. 522

9. Dallo, S. F., T. R. Kannan, M. W. Blaylock, and J. B. Baseman. 523

2002. Elongation factor Tu and E1 beta subunit of pyruvate 524

dehydrogenase complex act as fibronectin binding proteins in 525

Mycoplasma pneumoniae. Mol. Microbiol. 46:1041-1051. 526

10. Daxboeck, F., G. Khanakah, C. Bauer, M. Stadler, H. Hofmann, 527

and G. Stanek. 2005. Detection of Mycoplasma pneumoniae in serum 528

specimens from patients with mycoplasma pneumonia by PCR. Int. J. 529

Med. Microbiol. 295:279-285. 530

11. Duensing, T. D., J. S. Wing, and J. P. van Putten. 1999. 531

Sulfated polysaccharide-directed recruitment of mammalian host 532

proteins: a novel strategy in microbial pathogenesis. Infect. Immun. 533

67:4463-4468. 534

12. Dziewanowska, K., J. M. Patti, C. F. Deobald, K. W. Bayles, W. 535

R. Trumble, and G. A. Bohach. 1999. Fibronectin binding protein and 536

host cell tyrosine kinase are required for internalization of 537

Staphylococcus aureus by epithelial cells. Infect. Immun. 67:4673-538

4678. 539

13. Finlay, B. B., and S. Falkow. 1997. Common themes in microbial 540

pathogenicity revisited. Microbiol. Mol. Biol. Rev. 61:136-169. 541

ACCEPTED


.org/D

ownloaded from

http://iai.asm.org/


14. Giron, J. A., M. Lange, and J. B. Baseman. 1996. Adherence, 542

fibronectin binding, and induction of cytoskeleton reorganization in 543

cultured human cells by Mycoplasma penetrans. Infect. Immun. 544

64:197-208. 545

15. Heesemann, J., and R. Laufs. 1985. Double immunofluorescence 546

microscopic technique for accurate differentiation of extracellularly and 547

intracellularly located bacteria in cell culture. J. Clin. Microbiol. 22:168-548

175. 549

16. Kihlstrom, E. 1977. Infection of HeLa cells with Salmonella 550

typhimurium 395 MS and MR10 bacteria. Infect. Immun. 17:290-295. 551

17. Lam, K. M. 2003. Mycoplasma gallisepticum-induced alterations in 552

chicken red blood cells. Avian Dis. 47:485-488. 553

18. Ley, D. H. 2003. Mycoplasma gallisepticum Infection, p. 722-743. 554

In Y. M. Saif (ed.), Diseases of Poultry, 11 ed. Iowa State Press, Ames. 555

19. Lin, M. Y., and S. H. Kleven. 1984. Evaluation of attenuated 556

strains of Mycoplasma gallisepticum as vaccines in young chickens. 557

Avian Dis. 28:88-99. 558

20. Lo, S. C., M. S. Dawson, D. M. Wong, P. B. Newton, 3rd, M. A. 559

Sonoda, W. F. Engler, R. Y. Wang, J. W. Shih, H. J. Alter, and D. 560

J. Wear. 1989. Identification of Mycoplasma incognitus infection in 561

patients with AIDS: an immunohistochemical, in situ hybridization and 562

ultrastructural study. Am. J. Trop. Med. Hyg. 41:601-616. 563

21. Lo, S. C., M. M. Hayes, H. Kotani, P. F. Pierce, D. J. Wear, P. B. 564

Newton, 3rd, J. G. Tully, and J. W. Shih. 1993. Adhesion onto and 565

ACCEPTED


.org/D

ownloaded from

http://iai.asm.org/


invasion into mammalian cells by Mycoplasma penetrans: a newly 566

isolated mycoplasma from patients with AIDS. Mod. Pathol. 6:276-280. 567

22. May, M., L. Papazisi, T. S. Gorton, and S. J. Geary. 2006. 568

Identification of fibronectin-binding proteins in Mycoplasma 569

gallisepticum strain R. Infect. Immun. 74:1777-1785. 570

23. Mernaugh, G. R., S. F. Dallo, S. C. Holt, and J. B. Baseman. 571

1993. Properties of adhering and nonadhering populations of 572

Mycoplasma genitalium. Clin. Infect. Dis. 17 Suppl 1:S69-78. 573

24. Minion, F. C., and K. Jarvill-Taylor. 1994. Membrane-associated 574

hemolysin activities in mycoplasmas. FEMS Microbiol. Lett. 116:101-575

106. 576

25. Much, P., F. Winner, L. Stipkovits, R. Rosengarten, and C. 577

Citti. 2002. Mycoplasma gallisepticum: Influence of cell invasiveness 578

on the outcome of experimental infection in chickens. FEMS Immunol. 579

Med. Microbiol. 34:181-186. 580

26. Myers, W. F., L. D. Cutler, and C. L. Wisseman, Jr. 1969. Role of 581

erythrocytes and serum in the nutrition of Rickettsia quintana. J. 582

Bacteriol. 97:663-666. 583

27. Papazisi, L., T. S. Gorton, G. Kutish, P. F. Markham, G. F. 584

Browning, D. K. Nguyen, S. Swartzell, A. Madan, G. Mahairas, 585

and S. J. Geary. 2003. The complete genome sequence of the avian 586

pathogen Mycoplasma gallisepticum strain R(low). Microbiology 587

149:2307-2316. 588

28. Razin, S. 1992. Mycoplasma taxonomy and ecology, p. 3-22. In J. 589

ACCEPTED


.org/D

ownloaded from

http://iai.asm.org/


Maniloff, R. N. McElhaney, L. R. Finch, and J. B. Baseman (ed.), 590

Mycoplasmas: Molecular Biology and Pathogensis. American Society for 591

Microbiology, Washington, D.C. 592

29. Razin, S., M. Banai, H. Gamliel, A. Polliack, W. Bredt, and I. 593

Kahane. 1980. Scanning electron microscopy of mycoplasmas 594

adhering to erythrocytes. Infect. Immun. 30:538-546. 595

30. Simecka, J. W., J. K. Davis, M. K. Davidson, S. E. Ross, C. T. 596

Städtlander, H. Kirchhoff, and G. H. Cassell. 1992. Mycoplasma 597

Diseases of Animals, p. 391 - 415. In J. Maniloff (ed.), Mycoplasmas, 598

Molecular Biology and Pathogenesis. American Society for Microbiology, 599

Washington D.C. 600

31. Stadtlander, C. T., H. L. Watson, J. W. Simecka, and G. H. 601

Cassell. 1993. Cytopathogenicity of Mycoplasma fermentans (including 602

strain incognitus). Clin. Infect. Dis. 17 Suppl 1:S289-301. 603

32. Taylor-Robinson, D., H. A. Davies, P. Sarathchandra, and P. 604

M. Furr. 1991. Intracellular location of mycoplasmas in cultured cells 605

demonstrated by immunocytochemistry and electron microscopy. Int. 606

J. Exp. Pathol. 72:705-714. 607

33. Winner, F., I. Markova, P. Much, A. Lugmair, K. Siebert-Gulle, 608

G. Vogl, R. Rosengarten, and C. Citti. 2003. Phenotypic switching in 609

Mycoplasma gallisepticum hemadsorption is governed by a high-610

frequency, reversible point mutation. Infect. Immun. 71:1265-1273. 611

34. Winner, F., R. Rosengarten, and C. Citti. 2000. In vitro cell 612

invasion of Mycoplasma gallisepticum. Infect. Immun. 68:4238-4244. 613

ACCEPTED


.org/D

ownloaded from

http://iai.asm.org/


35. Wise, K. S., and R. K. Watson. 1983. Mycoplasma hyorhinis GDL 614

surface protein antigen p120 defined by monoclonal antibody. Infect. 615

Immun. 41:1332-1339. 616

36. Yavlovich, A., M. Tarshis, and S. Rottem. 2004. Internalization 617

and intracellular survival of Mycoplasma pneumoniae by non-618

phagocytic cells. FEMS Microbiol. Lett. 233:241-246. 619

620

ACCEPTED


.org/D

ownloaded from

http://iai.asm.org/


Figure Legends 621

FIG. 1. Scanning electron micrographs of sheep (A) and chicken (B) 622

erythrocytes after in vitro-infection with a clonal derivative of 623

M. gallisepticum strain Rlow. The arrows indicate mycoplasmas or imprints 624

of mycoplasmas appearing to sink into the erythrocyte surface. 625

FIG. 2. Confocal Z-scan of a chicken RBCs in vitro-infected with 626

M. gallisepticum strain Rlow after DIF staining. 627

The same area of a confocal microscopic picture after DIF staining is 628

analyzed for extracellular M. gallisepticum labeled with FITC (green 629

fluorescence, A) and for extra- and intracellular M. gallisepticum labeled 630

with Alexa Fluor 405 (red fluorescence, B). Superimposition (D-F) of the 631

green and red fluorescence with the differential interference contrast 632

(DIC) micrograph (C) results in yellow fluorescence indicating extracellular 633

M. gallisepticum, while the red fluorescent focus indicates an 634

intraerythrocytic mycoplasma cell. When scanning from top to bottom (D-635

F) of the erythrocyte, first an extracellular mycoplasma cell located at the 636

surface (yellow label) is visible, slowly fading out as the cross section 637

layer is moving downwards (E,F). At the same time the intracellular 638

mycoplasma cell is coming to the fore (E,F) showing the relative difference 639

in the localization of these two mycoplasma cells. 640

FIG. 3. Chicken RBC invasion frequencies of M. gallisepticum strains Rlow, 641

Rhigh, and 6/85 at different times. 642

Each value represents the mean ± standard deviation of a minimum of 5 643

ACCEPTED


.org/D

ownloaded from

http://iai.asm.org/


independent gentamicin invasion assays. The asterisk symbol indicates 644

statistical significant differences of RBC invasiveness between Rlow (white 645

bars) and Rhigh (grey bars) or 6/85 (black bars), the plus symbol 646

represents statistical significance between Rhigh and 6/85. 647

FIG. 4. RBCs from an experimentally M. gallisepticum-infected chicken 648

after DIF staining. 649

Superimposed picture after FITC- and Alexa Fluor 633-labeling showing 650

M. gallisepticum attached to the RBC’s surface (yellow label) and inside 651

the chicken RBC (red label) after experimental in vivo infection. The 652

erythrocytes were visualized by differential interference microscopy. 653

FIG. 5. Agarose gel electrophoresis of nested PCR products from blood 654

samples of experimentally infected chickens. 655

Blood samples were taken before experimental infection of chickens (lane 656

0), on day 6 p.i. (lanes 1,2), day 12 p.i. (lanes 3-5), and day 20 p.i. 657

(lanes 6-8). A positive control using M. gallisepticum-spiked chicken blood 658

(+) and a PCR negative control (-) were included. M, molecular size 659

marker (1 kb ladder, Invitrogen). 660

ACCEPTED


.org/D

ownloaded from

http://iai.asm.org/

ACCEPTED


.org/D

ownloaded from

http://iai.asm.org/

ACCEPTED


.org/D

ownloaded from

http://iai.asm.org/

ACCEPTED


.org/D

ownloaded from

http://iai.asm.org/

ACCEPTED


.org/D

ownloaded from

http://iai.asm.org/

ACCEPTED


.org/D

ownloaded from

http://iai.asm.org/

Documents

Invades Chicken Erythrocytes during Infection ACCEPTED · 25 as parasites or commensals of eukaryotic hosts. Many of them are 26 pathogens for mammals, reptiles, fish, arthropods,