Inward rectifying currents stabilize the membrane ... · distal dendrites [20,21], where I (H) shortens the decay time course of excitatory post-synaptic potentials (EPSP) and af-fects

Molecular Vision 2004; 10:328-40 <http://www.molvis.org/molvis/v10/a42>Received 2 March 2004 | Accepted 13 May 2004 | Published 13 May 2004

Many previous studies of the electrophysiology of ama-crine cells have used vertical slices or dissociated cells. Theseinclude starburst amacrine cells [1-3], dopaminergic amacrinecells [4], AII amacrine cells [5,6], and GABAergic amacrinecells [7,8]. However, the dendrites of amacrine cells are dam-aged in the process of vertical slice preparation or dissocia-tion, a concern because dendrites of amacrine cells are reportedto have many kinds of active conductances [8,9]. The inputresistances of amacrine cells, which determine the passivespread of voltage changes into the dendrites [8], are often re-ported to be high (over 2 GΩ in dissociated dopaminergicamacrine cells [4]). If there is a large conductance at dendrites,however, the spread of voltage changes along dendrites wouldbe restricted [8]. In support of this possiblity, Euler et al. [10]suggested, from observations using imaging of Ca2+ move-ments in the dendrites, that dendrites of starburst amacrinecells might be electrically isolated from each other. This couldbe due to specialized conductances localized in the dendrites.One candidate for the dendritic conductance is inward-recti-fying current (I

IR). In the retina, I

IR is classically observed in

photoreceptors [11], horizontal cells [12], and bipolar cells[13]. I

IR was thought to contribute to the amplification of light

responses [11] in these non-spiking neurons. Previous reportson the electrophysiology of amacrine cells found only a small

IIR

[4,14]. We wondered if this was, at least in part, becausedendrites of amacrine cells are removed or damaged in thesepreparations. I

IR consists of multiple types of currents that show

inward rectification, such as inward-rectifying K+ current andH currents (I

(H)). The inward rectifying K+ current is activated

at more negative potentials than the K+ equilibrium potentialand is selectively carried by K+ [15]. In contrast, I

(H) also shows

inward rectification but is carried by K+ and also other cat-ions. Recently, from physiological and molecular biologicalstudies, I

(H) has been identified in photoreceptors and bipolar

cells [16-18]. Muller et al. [17] suggested the existence ofhyperpolarization-activated cyclic nucleotide gated channels(HCN channels) in amacrine cells of rat retina by immunohis-tochemical studies. In hippocampal and neocortical pyrami-dal neurons, dendritic I

(H) controls spontaneous spiking activ-

ity and modifies synaptic integration. A family of four mam-malian genes, known as HCN1, 2, 3, and 4, contribute to I

(H)

[19]. HCN channels are expressed at especially high levels indistal dendrites [20,21], where I

(H) shortens the decay time

course of excitatory post-synaptic potentials (EPSP) and af-fects synaptic integration [22-25]. In those studies, the den-drites were an important source of I

(H). An aim of the present

study was to explore the electrophysiology of amacrine cellswhen their dendrites are well preserved, concentrating on I

IR,

and more specifically the possible existence of I(H)

in the den-drites of amacrine cells. We invented a horizontal slice prepa-ration of the mouse retina and made whole-cell patch-clamprecordings from individual amacrine cells. We found that allrecorded amacrine cells had I

IR, which increased the resting

©2004 Molecular Vision

Inward rectifying currents stabilize the membrane potential indendrites of mouse amacrine cells: Patch-clamp recordings andsingle-cell RT-PCR

Amane Koizumi, Tatjana C. Jakobs, Richard H. Masland

Howard Hughes Medical Institute, Massachusetts General Hospital, Wellman 429, Boston, MA

Purpose: To explore the possible existence of inward rectifying currents in the distal dendrites of amacrine cells.Methods: Patch-clamp recordings were made from amacrine cells in a new horizontal slice preparation of mouse retina.Single-cell RT-PCR studies were performed after the patch-clamp recordings.Results: In contrast to results from vertical slices or dissociated cells, all amacrine cells tested demonstrated inwardrectifying currents, I

IR. Within the limits of our sample, this current did not depend on the morphological and physiological

type of the amacrine cell. Amacrine cells from which the dendrites had been removed did not possess detectable amountsof I

IR. Pharmacological experiments with ZD7288 (100 µM) and single-cell RT-PCR from recorded cells revealed that I

IR

includes an h-current (I(H)

) carried by hyperpolarization-activated cyclic nucleotide gated channels (HCN), HCN1 and/orHCN2 subtypes. In the presence of extracellular Cs+ (5 mM), which greatly suppressed I

IR, the resting membrane conduc-

tance was reduced. IIR

suppressed the generation of oscillatory potentials. Intracellular cAMP (8-cpt-cAMP, 1 mM) acti-vated I

IR.

Conclusions: IIR

appears to occur within dendrites of many amacrine cells, where it tends to stabilize the resting mem-brane potential. HCN1 and/or HCN2 channels contribute to I

IR in amacrine cells. Dendritic I

IR would be expected to

contribute to functional independence of the distal dendrites of amacrine cells that express it.

Correspondence to: Amane Koizumi, Howard Hughes Medical In-stitute, Massachusetts General Hospital, Wellman 429, Boston, MA,02114; Phone: (617) 726-3888; FAX: (617) 726-5336; email:[email protected]

328

membrane conductance and stabilized the resting membranepotential. I

(H) partially contributes to I

IR, because ZD7288, a

specific blocker for I(H)

, suppressed IIR

. The types of HCN chan-nels were evaluated with single-cell RT-PCR and were corre-lated with the observed recordings. Because of recent evidenceof electrically isolated dendrites in some amacrine cells [10],the possible contribution of I

IR was studied by computer simu-

lation.

METHODSHorizontal slice preparation of the mouse retina: All experi-ments were performed on horizontal slices of the mouse retina.Mice (C57BL/6) were deeply anesthetized and sacrificed be-fore their eyes were removed, in accordance with NationalInstitutes of Health guidelines for animal use. The retina waspeeled away from the pigment epithelium and placed vitreousside up on a piece of filter paper (cellulose nitrate, 0.2 µmpore size, 13 mm diameter; Advantec Toyo, Japan). The retinawas firmly attached to the filter paper and flattened by apply-ing suction. The retina on filter paper was placed on an agar

block (0.03 mg/ml; Sigma, St. Louis, MO) and covered withlow-temperature-melting agarose (Agarose type VII-A; melt-ing points 33 °C, 0.025 mg/ml; Sigma). After the agarose wascompletely solidified, the retina with the agarose was slicedhorizontally by a vibratome (VT1000S; Leica, Germany) atthe level of the inner nuclear layer (Figure 1A). With thismethod, sections may be cut at the level of different layers ofthe retina (Figure 1B-E). In slices sectioned at the outer nuclearlayer (Figure 1B), the somas of photoreceptors were visible ina regular mosaic with consistent size. At the ganglion cell layer,we observed relatively large somas and large blood vessels(Figure 1D). For the work described here, a slice containedthe inner part of the retina, from the nerve fiber layer to theinner third of the inner nuclear layer. At the inner nuclear layer,somas with a variety of sizes were located seemingly randomly(Figure 1C). These can include both bipolar cells and ama-crine cells, but amacrine cells could be distinguished by boththeir relatively larger somas and their location at the borderbetween the inner plexiform layer and inner nuclear layer. Afterpatch-clamp recordings, Lucifer yellow was injected into the

©2004 Molecular VisionMolecular Vision 2004; 10:328-40 <http://www.molvis.org/molvis/v10/a42>

Figure 1. Horizontal slice preparation of the mouse retina. The retina was prepared and sliced horizontally as shown in the schematic andimages. A: The retina was isolated from the eyecup and attached to filter paper, which was flattened on an agar block and covered by low-temperature melting agarose gel. The retina was cut at the level of the inner nuclear layer with a vibratome. The slice was mounted in arecording chamber and whole-cell patch-clamp recordings were made. In this preparation, the dendrites of amacrine cells were well preserved,and the whole dendritic field could be visualized with Lucifer yellow. B-E: Views of the horizontally sliced retina at different levels. All scalebars represent 50 µm.

329


TABLE 1. RT-PCR PRIMERS

SizePrimer name Primer sequence (bp)------------ ---------------------------------- ----HCN1 outer Forward: GTCTCTTGCGGTTATTACGCCTT - Reverse: CACGAAATTGGGATCGGCGTTAG

HCN2-4 outer Forward: GTGGGCATCACTTTCTTCAAGGA - Reverse: CGGGCAGCTTGTGGAAGGACATGTA

HCN1 inner Forward: CGCCTTTCAAGGTTAATCAGATA 404 Reverse: CTTGAAGAGTCCAAAGACTGG

HCN2 inner Forward: TCCGCACCGGCATTGTTATT 658 Reverse: TGCTTGTACTTCTCCTGGTA

HCN3 inner Forward: CGCCAAGGGCCATCCGAACGCGT 619 Reverse: TGCTTGTACTTCTCCTGGTA

HCN4 inner Forward: TCAAGATGAAGTACCTGAAA 604 Reverse: TGCTTGTACTTCTCCTGGTA

The outer primers were used for reverse transcription and the first-round PCR. A common outer primer pair was used to amplify mRNAsfor HCN2-4. The inner primers were used for the nested second-round PCR. HCN2-4 were amplified using gene specific forwardprimers and a common reverse primer.

cell to identify the dendritic morphology of recorded ama-crine cells.

Patch-clamp recordings: We performed whole-cell patch-clamp recordings on amacrine cells in the horizontal slicepreparation. Patch pipettes were made by pulling Pyrex tub-ing on a micropipette puller (P-97; Sutter Instrument, Novato,CA). The tip diameter of the patch pipette was 1-2 µm, givinga resistance of approximately 10-15 MΩ when filled with thepipette solution (in mM): 125 K-gluconate, 5 KCl, 10 HEPES,1 CaCl

2, 1 MgCl

2, and 11 EGTA (pH adjusted to 7.2 with

KOH). Lucifer yellow (0.1%; Sigma) was included to stainand visualize the recorded cells. Slices were continuously per-fused at a rate of 2 ml/min with an extracellular solution con-taining (in mM): 125 NaCl, 2.5 KCl, 2 CaCl

2, 1 MgCl

2, 26

NaHCO3, 1.25 KH

2PO

4, and 12 glucose. The extracellular so-

lution was continuously oxygenated with 5% CO2/95% O

2 and

kept between 32 and 35 °C. Slices were viewed using a mi-croscope (Axioscope, Zeiss, Germany) equipped with a 60xwater-immersion objective lens (LUMPLF L60x; NA 0.9, WD2 mm; Olympus, Japan) and infra-red differential interferencecontrast optics. The recording pipette was connected to theinput stage of a patch-clamp amplifier (PC-501A; Warner In-struments, Hamden, CT). Signals were sampled at 10 kHz witha DigiData 1322A interface and pCLAMP8 software (AxonInstruments, Foster City, CA). The liquid junction potentialwas corrected by (V

membrane = V

pipette -11 mV). Recorded data

were analyzed with Igor Pro 4.0 software (WaveMetrics, LakeOswego, OR) and additional user-written routines (AK).

Space clamp considerations: In our patch-clamp record-ings, the space clamp was poor under voltage-clamp configu-rations. Evidence that the recorded cell was not a single com-partment was that capacitive charging and discharging cur-rents produced by voltage pulses were not fit with a single

exponential. The slow capacitive components, following tran-sient charging and discharging currents, indicate that dendritesof our recorded cells were not completely voltage-clamped.This was to be expected, as it has previously been reportedthat dendrites of amacrine cells are weakly voltage-clampedby a somatic patch-clamp pipettes [8]. In the present experi-ments this precluded quantitative examination of the electro-physiological characteristics of the channels.

Single-cell RT-PCR: Directly after patch-clamp record-ing, the contents of the cell were aspirated into the patch elec-trode. The electrode tip was then broken off into a thin-wallPCR reaction tube containing 10 µl ice cold reaction bufferand stored on dry ice until use. Reverse transcription and thefirst PCR were carried out for all four HCN subtypes and β-actin simultaneously using the Access PCR system fromPromega (Madison, WI) according to the manufacturer’s in-structions. The reaction conditions were: 50 min at 48 °C forreverse transcription, followed by 28 cycles of 1 min at 94 °C,1 min at 59 °C, 2 min at 68 °C, and a final extension of 7 minat 68 °C. Reaction products were diluted 20 fold and 1 µl wasused for a secondary PCR of 32 rounds for each HCN channelsubtype individually, using pairs of nested primers. Primerswere used at a concentration of 2 µM, and all primers weredesigned to span at least one intron/exon boundary. Primerswere used at a concentration of 2 µM, and all primers weredesigned to span at least one intron/exon boundary. For primersequences see Table 1. Actin was used as a positive control,with the same primers for both rounds of PCR [26]. The pre-dicted size (in bp) of the amplicons were as follows: HCN1404; HCN2 658; HCN3 619; HCN4 604; actin 255. Reactionproducts were resolved on 2% agarose gels and photographed.Occasionally, bands were chosen at random, purified withQiaexII (Qiagen, Hilden, Germany) and subjected to diagnosticrestriction enzyme digestions. The restriction enzymes and siteswere PstI/157 for HCN1, PstI/363 for HCN2, BglII/229 forHCN3 and BglII/211 for HCN4. The protocol for single-cellRT-PCR from dissociated retina is described in detail else-where [27]. In brief, after isolation the retinas were kept inoxygenated Ames’ medium. Small pieces of retina were cutoff and dissociated in Hank’s balanced salt solution (HBSS)containing 0.5 mg/ml papain for 10 min at 37 °C. The papainreaction was quenched with MEM/10% horse serum contain-ing 200 U/ml DNAseI (Sigma). The tissue was gently tritu-rated and approximately 50 µl of the suspension was put intoone ring of a Gold Seal slide (Gold Seal Products, Portsmouth,NH). Individual cells were identified by morphology using aZeiss IM35 inverted microscope, and aspirated into amicrocapillary tube under microscopic control, then transferredto the other ring for washing in Ringer’s solution containing0.5% BSA. The cell was aspirated again and transferred into athin-wall PCR tube containing 10 µl PCR buffer and 5 µl GeneReleaser (BioVentures, Portland, ME), also under microscopiccontrol. A negative control for every cell was obtained by as-pirating about 0.5 µl of the washing medium and processing itstrictly in parallel to the cell. A fresh preparation of dissoci-ated cells was used for every cell transfer. For some experi-ments, the dissociated cells were incubated with a FITC-la-

330


Figure 2. IIR

in amacrine cell dendrites. Ama-crine cells were recorded in a horizontal slicepreparation and then injected with Lucifer yel-low. A: Example of an amacrine cell with singleslow action potentials, injected with Luciferyellow at the end of recording. Scale bar, 10µm. B: Current-clamp experiment. Injected cur-rents were from -20 pA to 160 pA, in 20 pAsteps, for 200 msec. Resting membrane poten-tial was -69 mV. This cell generated single slowaction potentials (arrow), but their thresholdswere very high (around -30 mV). C: Voltage-clamp experiment. Voltages were clamped from-91 mV to +19 mV, in 10 mV steps, for 200msec. Arrow with TI, transient inward current.Arrow with TO, transient outward current. As-terisk, hyperpolarization-induced I

IR. D: I

IR is

not observed in amacrine cells whose dendritesare removed in the process of preparation. Cur-rent-clamp experiment. Injected currents werefrom -40 pA to +60 pA, in 20 pA steps, for 200msec. E: Voltage-clamp experiment. Voltageswere clamped from -111 mV to -41 mV, in 10mV steps, for 200 msec. F: Comparison betweenamacrine cells with intact dendrites (n=33) andthose without dendrites (n=7). Amacrine cellswithout dendrites have higher input resistance(2545±992 MΩ, n=7) than those with dendrites(526±351 MΩ, n=33). Resting membrane con-ductance in amacrine cells without dendrites(328±173 pS, n=7) were lower than in those withdendrites (3356±1893 pS, n=33). *Significantdifference by student t-test, p<0.001.

beled anti CD15 antibody (BD PharMingen, San Diego, CA)and CD15+ amacrine cells were identified by their fluores-cence.

Computer simulation: We used the NEURON simulator(version 4.3.1) [28] to model dendritic responses and voltagespreads in amacrine cells.

Morphology: We reconstructed a mouse starburst ama-crine cell from a photomicrograph after DiOlistic filling asper Rockhill et al. [29]. The reconstructed starburst amacrinecell was divided into 721 compartments.

Passive membrane parameters: Passive membrane pa-rameters were obtained from dual-whole cell patch-clampexperiment on cultured amacrine cells described previously[30]. Membrane capacitance, cytoplasmic resistance and pas-sive membrane conductance were determined as 1 µF/cm2,150 Ω-cm, and 3x105 S/cm2, respectively. These passive pa-rameters were evenly distributed in a whole cell. In this study,to examine effects of passive membrane conductance to syn-aptic responses, passive membrane conductance was variedfrom 5x106 to 5x104 S/cm2.

331

Synaptic stimulation: Synaptic stimulation was calcu-lated as alpha functions, described by the following equations:

Istim

= gs(t) * (V - Estim

)

gs(t) = gsbar * (t/τ) * exp(1 - t/τ)

The reversal potential (Estim

) was set to 0 mV, maximumconductance (gsbar) was 1x104 S/cm2, and tau was 5 msec. To

stimulate a dendritic branch, five points within the dendriticbranch were selected randomly as synaptic input sites and theywere stimulated simultaneously. The total maximum conduc-tance was set to 1x104 pS/cm2.

RESULTSI

IR of amacrine cells in a horizontal slice preparation: We

recorded from and successfully injected 33 cells. Their den-dritic field diameters ranged from 50 to 300 µm, a range from


Figure 3. IIR

in other amacrine cells. IIR

is observed albeit with a variety of depolarization properties. A: Current-clamp experiment. Exampleof an amacrine cell with oscillatory potentials. Injected currents were from -40 pA to 180 pA, in 20 pA steps, for 200 msec. Resting membranepotential was -74 mV. +80 pA current injection evoked a slow depolarization with oscillatory potentials (arrow). B: Voltage-clamp experi-ment. Voltages were clamped from -111 mV to -1 mV, in 10 mV steps, for 200 msec. Voltage-clamp at -51 mV evoked low-amplitude, high-frequency transient inward currents. C: Example of a non-spiking amacrine cell. Current-clamp experiment. Injected currents were from -40pA to 180 pA, in 20 pA steps, for 200 msec. Resting membrane potential was -69 mV. No obvious action potential was seen, but slowpotentials were evoked. D: Voltage-clamp experiment. Voltages were clamped from -111 mV to -1 mV, in 10 mV steps, for 200 msec.

332

the narrowest found for amacrine cells to the smaller of wide-field amacrine cells. Albeit with several varieties of responsesto current injection (Figure 2A,B and Figure 3), all recordedcells showed a large membrane conductance around the rest-ing membrane potential and I

IR at more negative potentials.

Figure 2A,B shows an amacrine cell that generated a singleslow action potential (n=10), recorded under voltage-clampand current-clamp conditions (resting membrane potential, -69 mV). Under current-clamp, a single slow action potentialwas evoked by +100 pA current injection (Figure 2B, arrow).The threshold of such action potentials was above -30 mV.Under voltage-clamp (Figure 2C), they showed a hyperpolar-ization-induced I

IR (asterisk), as well as a transient inward

current (arrow with TI), a transient outward current (arrowwith TO), and a delayed outward current. In some amacrinecells (Figure 2D,E), dendrites were removed in the process ofpreparation, as shown by Lucifer yellow injection. These ama-crine cells without dendrites showed only small resting mem-brane conductance, and especially I

IR was not observed (Fig-

ure 4B). We compared amacrine cells with dendrites and thosewithout dendrites in regard to the input resistance and the con-ductance of I

IR. The input resistance was calculated under cur-

rent-clamp configuration by current injection of -20 or -40pA. The conductance of I

IR was determined in voltage-clamp

configuration by voltage pulses to negative to the holding po-tential (-71 mV). The input resistances of amacrine cells with-out dendrites (2545±992 MΩ, mean±standard deviation, n=7)were significantly higher than amacrine cells with dendrites(526±351 MΩ, n=33). The conductances of I

IR in amacrine

cells without dendrites (328±173 pS, n=7) were lower than inthose with dendrites (3356±1893 pS, n=33). These results sug-gest that main portion of I

IR is evoked at the dendrites of ama-

crine cells rather than the somas, whether or not the somashave I

IR. Other amacrine cells with different electrophysiologi-

cal properties possessed IIR

. Figure 3A,B shows an amacrinecell with oscillatory potentials (n=14). In this cell, the low-amplitude oscillatory potentials were observed in a steadydepolarized state (+80 pA current injection) under current


Figure 4. Cs+ suppresses IIR.

IIR

decreases input resistance and increases the current required to evoke oscillatory potentials. A: Voltage-clampexperiment in the control condition. Voltage steps were from -111 mV to -1 mV, in 10 mV steps, for 200 msec. B: The same voltage-clampexperiment as in panel A with Cs+ (5 mM) in the extracellular solution. C: The I-V relationship in the sustained state for panels A and B. Filledcircles, control; Open squares, Cs+. D: Current-clamp experiment in the control condition. Injected currents were from -40 pA to 80 pA, in 20pA steps, for 200 msec. Input resistance of this cell was calculated as 465 MΩ. Current injection of +80 pA evoked oscillatory potentials(arrow). E: The same current clamp experiment as in panel D with Cs+ (5 mM) in the extracellular solution. Input resistance of this cell wasincreased to 3927 MΩ. Oscillatory potentials are indicated by an arrow. F: Line plots for all nine cells examined.

333

clamp (Figure 3A, arrow). Transient inward currents wereobserved when a depolarizing voltage pulse (from -40 mV to-20 mV) was applied under voltage-clamp (Figure 3B). Un-der voltage clamp, a hyperpolarization-activated inward rec-tifying current was observed (Figure 3B, asterisk). Non-spik-ing amacrine cells (n=9) generated slow potentials that mightbe mediated by slow inward current (Figure 3C,D). For thesecells, I

IR was also prominent (Figure 3D, asterisk). Amplitudes

and kinetics of IIR

were variable among recorded cells, but nocorrelation was apparent, within the limits of our sample, withthe morphological and electrophysiological type of the cell.I

IR was suppressed markedly by external cesium ion (Cs+, 5

mM), which is known as non-selective blocker of any inwardrectifying K+ channels (Figure 4A and Figure 4B). Thus, I

IR is

mainly carried by K+. In summary, amacrine cells with intactdendrites possess I

IR, which appears to be located on dendrites

of amacrine cells. The IIR

observed in these purely electro-physiological experiments might be a sum of classical inwardrectifying K+ channels, I

(H) channels, and leak conductances.

IIR

decreases the input resistance and stabilizes the rest-ing membrane potential: To evaluate the effect of I

IR on input

resistances and membrane potential stability, Cs+ (5 mM) wasadded to the extracellular solution. Under voltage-clamp, ex-tracellular Cs+ greatly suppressed I

IR (Figure 4A and Figure

4B). The steady state I-V relationship (arrows, Figure 4A andFigure 4B) showed that Cs+ mainly suppressed the hyperpo-larization-activated inward rectifying component. Under cur-rent-clamp, Cs+ application increased input resistance calcu-lated by current injection of -40 pA from 465 MΩ to 3927MΩ (Figure 4D and Figure 4E) and amplified voltage changes.Under current-clamp in the control condition, +80 pA currentinjection was required to evoke oscillatory potentials (Figure4D and Figure 4E, arrows), but during Cs+ application, as littleas +20 pA current injection could evoke these oscillatory po-tentials. This is probably because external Cs+ applicationchanged the efficiency of space clamp and modified the acti-vation of other currents on the dendrites. We obtained similarresults in all 9 cells tested (Figure 4F). I

IR thus decreases the


Figure 5. ZD7288 partially suppresses IIR.

IIR

was partially suppressed by ZD7288, a blocker of HCN channels. A: Voltage-clamp experimentin the control condition. Voltage steps were from -111 mV to -31 mV, in 10 mV steps, for 200 msec. B: The same voltage-clamp experiment asin A with ZD7288 (100 µM) in the extracellular solution. C: The I-V relationship in the sustained state for panels A and B. Filled circles,control; Open squares, ZD7288. D: Current-clamp experiment in the control condition. Injected currents were from -40 pA to 40 pA, in 20 pAsteps, for 200 msec. Input resistance of this cell was calculated as 533 MΩ. Oscillatory potentials are indicated by an arrow. E: The samecurrent clamp experiment as in panel D with ZD7288 (100 µM) in the extracellular solution. Input resistance of this cell was increased to 739MΩ. Oscillatory potentials are indicated by an arrow. F: Line plots for all six cells examined. G: Maximum conductances of I

IR. External Cs+

suppresd IIR

to 38±21% (n=9), and ZD7288 suppressed it to 52±20% (n=6).

334

input resistance and increases the current required to evokeoscillatory potentials.

I(H)

contributes to IIR

: To examine whether or not I(H)

con-tributes to I

IR, we carried out pharmacological experiments to

isolate I(H)

. ZD7288 (100 µM), a selective blocker for I(H)

, wasadded to the extracellular solution. Under voltage-clamp,ZD7288 partially suppressed I

IR (Figure 5A and Figure 5B);

the sustained component of IIR

was the most suppressed. Un-der current-clamp, ZD7288 application increased the inputresistance calculated by current injection of -40 pA from 533MΩ to 739 MΩ (Figure 5D and Figure 5E) and amplified thevoltage changes. We obtained similar results in all 6 cells tested(Figure 5F). In all cases, ZD7288 partially suppressed I

IR. We

compared the suppression ratios of IIR

by external Cs+ and byZD7288 in Figure 5G. External Cs+ suppressed I

IR to 38±21%

(n=9), and ZD7288 suppressed it to 52±20% (n=6). This re-

sult shows that I(H)

contributes to about half of IIR

, which ismainly carried by K+. The residual Cs+ insensitive portion ofI

IR might be carried by other cations and non-selective leak

conductances due to slice procedure. To examine the effect ofintracellular cAMP to I

IR, we bath-applied a membrane-per-

meable analogue of cAMP (8-cpt-cAMP, Sigma, 1 mM, n=4).During cAMP application, I

IR amplitude was increased slightly

and the neuron’s input resistance was decreased. The inputresistance decrease made it difficult to generate oscillatorypotentials. In control conditions, current injection of +80 pAreliably evoked oscillatory potentials (Figure 6C, arrow); aminimum of +140 pA was required to evoke oscillatory po-tentials during the cAMP application (data not shown). Thesubstantially higher threshold of oscillatory potentials was seenin the face of relatively small changes in input resistance andin the amplitude of total currents evoked by voltage steps (Fig-


Figure 6. Cyclic AMP enhances IIR.

IIR

was enhanced by 8-cpt-cAMP8cptcAMP application. A: Voltage-clamp experiment in the controlcondition. Voltage steps were from -111 mV to -21 mV, in 10 mV steps, for 200 msec. B: The same voltage-clamp experiment as in panel A,with 8-cpt-cAMP (1 mM) in the extracellular solution. I

IR was slightly increased. C: The I-V relationship in the sustained state for panels A and

B. Filled circles, control; Open squares, 8-cpt-cAMP. D: Current-clamp experiment in the control condition. Injected currents were from -40pA to 100 pA, in 20 pA steps, for 200 msec. The input resistance of this cell was calculated as 441 MΩ. E: The same current-clamp experimentas in panel D with 8-cpt-cAMP (1 mM) in the extracellular solution. The input resistance of this cell was decreased slightly to 362 MΩ, and itbecame difficult to evoke action potentials. At least +140 pA current injection was required to evoke action potentials (data not shown). F:Line plots of all four cells examined.

335

ure 6E). In other systems, I(H)

can be enhanced by intracellularcAMP or cGMP [19,23,31]. Therefore, these pharmacologi-cal results in amacrine cells support the idea that I

(H) contrib-

utes to IIR

to some extent. However, we cannot rule out theeffect of cAMP application on other K+ currents and leak cur-rents. Because of space clamp problems described in Meth-ods, it is difficult to voltage-clamp the cell to characterize elec-trophysiological properties of I

(H). For example, time course

of I(H)

has well known as slowly sigmoid activating proper-ties, but in some of our experiments we did not observe clearlythese typical properties even when ZD7288 suppressed thecurrent. Therefore, we identified I

(H) in amacrine cells by mo-

lecular techniques instead of further electrophysiological ex-periments.

To molecularly characterize the responsible HCN chan-nels, we carried out single-cell RT-PCR on the cytoplasmiccontents of the cell, which were aspirated at the end of somerecording sessions (n=9). HCN1 and/or HCN2 subunit mRNAswere found in the amacrine cells (Figure 7A-F). Some testedcells had both HCN1 and HCN2 mRNAs (n=5; Figure 7A-C); while the others had HCN2 mRNA only (n=2; Figure 7D-F). No correlation was observed between types of HCN sub-unit mRNAs and the electrophysiological types of amacrinecells described above. HCN3 and HCN4 channel mRNAs werefound in none of the amacrine cells from which we recorded.In two cells out of 9 cells tested, we did not find any HCNmRNA-positive bands, although we observed I

(H) in those cells

electrophysiologically. This is probably because we failed to


Figure 7. RT-PCR for HCN channels. HCN1 and/or HCN2 contrib-ute to I

IR in amacrine cells. A-F: Voltage-clamp recordings of I

IR.

Currents in control condition (A and D) and during external Cs+ (5mM) application (B and E). Voltage pulses from -111 mV to -71 mV,in 10 mV steps, for 200 msec. C: Single cell RT-PCR of the cell withI

IR in A-C showed HCN1- and HCN2-positive bands. F: Single-cell

RT-PCR of the cell with IIR

in D-F showed only HCN2-positive band.G: Single-cell RT-PCR of isolated retinal neurons. HCN1-4 and ac-tin mRNAs were coamplified from freshly dissociated single retinalcells. Lanes 1,2: rod bipolar cells; note the faint bands in the HCN2panel. Lanes 3-5: cone bipolar cells. Lanes 6+7: CD15+ amacrinecells. Lanes 8,9: amacrine cells negative for CD15. Lanes 10-12:ganglion cells; M, molecular weight marker; +, positive control fromwhole-retina RNA. The lowest panel shows the matched negativecontrol for every cell, tested for actin.

336


Figure 8. Simulating the effects of IIR

on amacrine cell den-drites. Electrical isolation of the stimulated dendrite is en-hanced by I

IR. A: a starburst amacrine cell was reproduced in

the Neuron simulator with realistic dimensions. B: a volt-age-clamp experiment was applied to the model cell (from -100 mV to -40 mV, in 10 mV steps, for 200 msec, holdingpotential was -60 mV). The resting membrane conductancewas changed to several values, and the cases with 5x105 S/cm2 (G1) and 5x106 S/cm2 (G2) were shown. C: Synapticstimulation was applied to the dendritic branch “a”. Voltagechanges were recorded at the distal tip of the stimulated den-dritic branch (filled circle “1”), the distal tip of the oppositedendritic branch (filled circle “3”) and the soma (filled circle“2”). The simulation was performed in both the G1 modeland the G2 model in B. D: Relationship of conductancechanges with half durations and peak amplitudes of voltagechanges at the opposite dendritic branch (filled circle “3”).

337

aspirate the cytoplasm into a narrow glass pipette after re-cording. To avoid these technical limits of single-cell RT-PCRafter patch-clamp recordings and compare the subsets of HCNchannel mRNAs with those of other cell types, we conducteda control experiment with freshly dissociated retinal neurons.In a sample of 12 dissociated cells, we found expression ofHCN1 mRNA in 3/5 bipolar cells and 3/4 amacrine cells,HCN2 mRNA was expressed in 2 bipolar cells and 2/4 ama-crine cells (Figure 7G). The CD15+ amacrine cells, which areamong the wide-field amacrine cells, possessed both HCN1and HCN2 mRNAs (Figure 7G, line 6 and 7). HCN3 or HCN4mRNAs were not found in any bipolar or amacrine cells. Allganglion cells in our sample expressed HCN1, HCN2, and atleast one of either HCN3 or HCN4 mRNAs. Taken together,our RT-PCR data from patch-clamp and dissociated cells in-dicate that HCN1, HCN2 or both are expressed in most ama-crine cells, although we cannot rule out the possibility thatthere may be a small subpopulation among these highly di-verse cells that does not express any HCN channels.

Functional consequences: IIR

sharpens the dendritic re-sponse temporally and spatially: What is the function of I

IR in

amacrine cells? We conducted a computer simulation to ex-plore whether I

IR would have a substantial effect on the elec-

trical isolation of the stimulated dendrite in a morphologicallyrealistic amacrine cells. We used the morphology of the mousestarburst amacrine cell. This cell has a size and general den-dritic character representative of medium/wide-field amacrinecells. It has the advantage of an extremely well studied geom-etry, which is depicted in Figure 8A. Computer simulationswere run on the virtual cell with a variety of passive mem-brane conductances (see Methods). To examine the effects ofI

IR on synaptic responses, the passive membrane conductance

was varied from 5x106 to 5x10 S/cm2. Two examples of volt-age-clamp experiments with large passive membrane conduc-tance (5x105 S/cm2, G1) and small conductance (5x106 S/cm2,G2) are shown in Figure 8B. The resting membrane potentialof this cell was set to the reversal potential of passive mem-brane conductance (-66 mV). We simulated synaptic stimula-tion of the reconstructed starburst amacrine cell at dendriticbranch “a” (Figure 8A). Voltage changes were calculated atthe soma (filled circle “2”), the distal tips of dendritic branch“a” (filled circle “1”) and the opposite dendritic branch (filledcircle “3”). When dendritic branch “a” was stimulated, volt-age changes that spread to the soma and the opposite den-dritic branch were temporally sharpened and quantitativelysuppressed in the cell with large passive membrane conduc-tance compared with that with low conductance (Figure 8C).The amplitudes of local potentials in the dendritic branch “a”were not affected by conductance changes (Figure 8C, filledcircle “1”). Figure 8D shows relationships of conductancechanges with half durations and peak amplitudes of voltagechanges at the opposite dendritic branch (filled circle “3”).Increasing the passive membrane conductance shortened thetime course (half duration) of voltage changes and reducedtheir amplitudes. I

IR would thus enhances electrical isolation

of dendritic responses in amacrine cells with middle-size den-dritic fields, such as the starburst amacrine cells. If the cells

have thick dendrites or small dendritic fields, the effect of IIR

should be much smaller.

DISCUSSION We carried out patch-clamp experiments on mouse amacrinecells in a horizontal slice preparation that preserves their den-dritic structures. Across a wide variety of amacrine cell shapesand physiologies, almost all possessed I

IR. I

IR contributes to

membrane potential stability and modifies dendritic responses.I

(H) contributes to I

IR. Single-cell RT-PCR studies suggest that

the I(H)

in amacrine cells was carried through HCN1 and/orHCN2 channels.

IIR

and I(H)

in amacrine cells: In contrast to previous re-ports on mouse amacrine cells in retina slices [14], or dissoci-ated amacrine cells [4], we found all of our recorded cells inhorizontal slice preparations to have I

IR. Its major component

was I(H)

. The input resistance of isolated dopaminergic ama-crine cells has been reported to be over 2 GΩ, very similar toour results in which I

IR was markedly suppressed when exter-

nal cesium was applied or when dendrites were removed in aprocess of preparation. We therefore suspect that I

IR was par-

tially lost in the previous reports of dissociated dopaminergicamacrine cells, when their distal dendrites were truncated.Taken together, these results suggest that I

IR may be prefer-

ably localized in distal dendrites in amacrine cells. Similardifferences exist between the currents detected in the cerebel-lar slice preparation and these in isolated Purkinje cells. Inacutely dissociated Purkinje neurons, I

(H) contributes little in-

ward current at membrane potentials near the action potentialthreshold, and pharmacological blockade of I

(H) does not alter

the frequency of tonic action potential firing [32]. However,in the cerebellar slice preparation, I

(H) is much more activated,

and plays an important role in the control of tonic action po-tential firing in Purkinje neurons [33].

Is the membrane conductance of amacrine cells dynami-cally regulated?: In our present study, I

(H) contributes to I

IR in

amacrine cells and increases membrane conductance. An in-teresting and important question involves the regulation of I

(H)

in the inner plexiform layer in vivo. In other systems [23,31].many neurotransmitters and modulators are known to modu-late I

(H) via intracellular cAMP and cGMP activities. Increases

in intracellular cAMP or cGMP, such as during β-adrenoceptoractivation or application of nitric oxide, shift the I

(H) activa-

tion curve in a depolarized direction. An increase in restingI

(H) activation with increased cAMP concentrations has been

reported in dendrites of CA1 pyramidal neurons [23].DiFrancesco and Tortora [34] reported that I

(H) channel gating

is directly regulated by cAMP binding to a site on the cyto-plasmic surface of the channel, and cGMP also binds to thissite to activate I

(H) channels. In the retina, intracellular cAMP

is reported to modulate several phenomena. For example, inthe developing retina, intracellular cAMP is key to sustainingdevelopmental retinal waves [35]. In amacrine cells, GABAresponses are enhanced by dopamine via an intracellular cAMPincrease [36]. In the present study, we found that cAMP en-hances I

IR and modulates the resting membrane properties of

amacrine cells. Thus, intracellular cyclic-nucleotides such as


338

cAMP (and cGMP [37]) may regulate the membrane conduc-tance dynamically in retinal amacrine cells.

Function of IIR

in amacrine cell dendrites: The “dendrite”of an amacrine cell is both an input and output structure andthese has been much discussion of possibly independent func-tion by individual amacrine cell dendrites [10,38-40]. In hip-pocampal and cortical pyramidal neurons, I

(H) channels par-

ticipate in generating a spatial gradient of EPSP and IPSP, andin shortening the length constant of the distal dendrite [22,41-43]. The presence of I

(H) in the distal dendrite is thought to

modify the EPSP and IPSP time courses by enhancing the lo-cal resting membrane conductance. I

(H) provides a leakage path

for current flow that decreases the local membrane time con-stant and speeds the decay of the distal EPSP. However, theseare classically polarized neurons, and they are more than tentimes larger than amacrine cells. Because differences of scalecan have different electrotonic consequences, we carried outa computer simulation, using an anatomically realistic modelof an amacrine cell, to verify that the prediction from brainneurons would hold for the very different geometry of ama-crine cells. Our simulation on a reconstructed starburst ama-crine cell confirmed that high membrane conductances shouldenhance the electrical isolation of dendritic voltage changesgenerated by synaptic input (as it does for the other neurons).This could contribute to the observed independence of evokedCa2+ fluxes in different dendritic branches of starburst ama-crine cells [10] and to dendritic independence in other ama-crine cells.

ACKNOWLEDGEMENTS The authors appreciate technical advice from Drs. RyosukeEnoki and Taro Azuma (Department of Physiology, Keio Uni-versity School of Medicine, Tokyo, Japan) during develop-ment of the horizontal slice preparation of the mouse retina.We would also thank Drs. Steve Stasheff, Guenther Zeck, andMs. Kate Harmon for careful reading and discussion. Thisstudy is partly supported by the Japan Society for Promotionof Science (AK). RHM is a Senior Investigator of Research toPrevent Blindness.

REFERENCES 1. Cohen ED. Voltage-gated calcium and sodium currents of starburst

amacrine cells in the rabbit retina. Vis Neurosci 2001; 18:799-809.

2. Peters BN, Masland RH. Responses to light of starburst amacrinecells. J Neurophysiol 1996; 75:469-80.

3. Zhou ZJ, Fain GL. Starburst amacrine cells change from spikingto nonspiking neurons during retinal development. Proc NatlAcad Sci U S A 1996; 93:8057-62.

4. Feigenspan A, Gustincich S, Bean BP, Raviola E. Spontaneousactivity of solitary dopaminergic cells of the retina. J Neurosci1998; 18:6776-89.

5. Habermann CJ, O’Brien BJ, Wassle H, Protti DA. AII amacrinecells express L-type calcium channels at their output synapses.J Neurosci 2003; 23:6904-13.

6. Veruki ML, Hartveit E. AII (Rod) amacrine cells form a networkof electrically coupled interneurons in the mammalian retina.Neuron 2002; 33:935-46.

7. Koizumi A, Watanabe SI, Kaneko A. Persistent Na+ current andCa2+ current boost graded depolarization of rat retinal ama-crine cells in culture. J Neurophysiol 2001; 86:1006-16.

8. Yamada Y, Koizumi A, Iwasaki E, Watanabe S, Kaneko A. Propa-gation of action potentials from the soma to individual dendriteof cultured rat amacrine cells is regulated by local GABA input.J Neurophysiol 2002; 87:2858-66.

9. Cook PB, Werblin FS. Spike initiation and propagation in widefield transient amacrine cells of the salamander retina. J Neurosci1994; 14:3852-61.

10. Euler T, Detwiler PB, Denk W. Directionally selective calciumsignals in dendrites of starburst amacrine cells. Nature 2002;418:845-52.

11. Fain GL, Quandt FN, Bastian BL, Gerschenfeld HM. Contribu-tion of a caesium-sensitive conductance increase to the rodphotoresponse. Nature 1978; 272:466-9.

12. Tachibana M. Ionic currents of solitary horizontal cells isolatedfrom goldfish retina. J Physiol 1983; 345:329-51.

13. Kaneko A, Tachibana M. A voltage-clamp analysis of membranecurrents in solitary bipolar cells dissociated from Carassiusauratus. J Physiol 1985; 358:131-52.

14. Frech MJ, Perez-Leon J, Wassle H, Backus KH. Characterizationof the spontaneous synaptic activity of amacrine cells in themouse retina. J Neurophysiol 2001; 86:1632-43.

15. Lu Z. Mechanism of rectification in inward-rectifier K+ chan-nels. Annu Rev Physiol 2004; 66:103-29.

16. Kim IB, Lee EJ, Kang TH, Chung JW, Chun MH. Morphologicalanalysis of the hyperpolarization-activated cyclic nucleotide-gated cation channel 1 (HCN1) immunoreactive bipolar cells inthe rabbit retina. J Comp Neurol 2003; 467:389-402.

17. Muller F, Scholten A, Ivanova E, Haverkamp S, Kremmer E,Kaupp UB. HCN channels are expressed differentially in reti-nal bipolar cells and concentrated at synaptic terminals. Eur JNeurosci 2003; 17:2084-96.

18. Demontis GC, Moroni A, Gravante B, Altomare C, Longoni B,Cervetto L, DiFrancesco D. Functional characterisation andsubcellular localisation of HCN1 channels in rabbit retinal rodphotoreceptors. J Physiol 2002; 542:89-97.

19. Robinson RB, Siegelbaum SA. Hyperpolarization-activated cat-ion currents: from molecules to physiological function. AnnuRev Physiol 2003; 65:453-80.

20. Santoro B, Grant SG, Bartsch D, Kandel ER. Interactive cloningwith the SH3 domain of N-src identifies a new brain specificion channel protein, with homology to eag and cyclic nucle-otide-gated channels. Proc Natl Acad Sci U S A 1997; 94:14815-20.

21. Monteggia LM, Eisch AJ, Tang MD, Kaczmarek LK, Nestler EJ.Cloning and localization of the hyperpolarization-activated cy-clic nucleotide-gated channel family in rat brain. Brain Res MolBrain Res 2000; 81:129-39.

22. Magee JC. Dendritic Ih normalizes temporal summation in hip-pocampal CA1 neurons. Nat Neurosci 1999; 2:848.

23. Magee JC. Voltage-gated ion channels in dendrites. In: Stuart G,Spruston N, Hausser M, editors. Dendrites. Oxford: OxfordUniversity Press; 1999. p. 139-60.

24. Magee JC. Dendritic hyperpolarization-activated currents modifythe integrative properties of hippocampal CA1 pyramidal neu-rons. J Neurosci 1998; 18:7613-24.

25. Williams SR, Stuart GJ. Site independence of EPSP time courseis mediated by dendritic I(h) in neocortical pyramidal neurons.J Neurophysiol 2000; 83:3177-82.

26. Paarmann I, Frermann D, Keller BU, Hollmann M. Expressionof 15 glutamate receptor subunits and various splice variants in


339

tissue slices and single neurons of brainstem nuclei and poten-tial functional implications. J Neurochem 2000; 74:1335-45.

27. Jakobs TC, Ben Y, Masland RH. CD15 immunoreactive ama-crine cells in the mouse retina. J Comp Neurol 2003; 465:361-71.

28. Hines ML, Carnevale NT. NEURON: a tool for neuroscientists.Neuroscientist 2001; 7:123-35.

29. Rockhill RL, Daly FJ, MacNeil MA, Brown SP, Masland RH.The diversity of ganglion cells in a mammalian retina. J Neurosci2002; 22:3831-43.

30. Koizumi A, Hayashida T, Kiuchi T, Takayanagi T, Yamada Y,Yagi T, Kaneko A. Nonlinear spread of graded potential in thedendrite of retinal amacrine cells. The 31st Annual Meeting ofthe Society for Neuroscience; 2001 November 10-15; San Di-ego, CA.

31. Pape HC. Queer current and pacemaker: the hyperpolarization-activated cation current in neurons. Annu Rev Physiol 1996;58:299-327.

32. Raman IM, Bean BP. Ionic currents underlying spontaneous ac-tion potentials in isolated cerebellar Purkinje neurons. J Neurosci1999; 19:1663-74.

33. Williams SR, Christensen SR, Stuart GJ, Hausser M. Membranepotential bistability is controlled by the hyperpolarization-acti-vated current I(H) in rat cerebellar Purkinje neurons in vitro. JPhysiol 2002; 539:469-83.

34. DiFrancesco D, Tortora P. Direct activation of cardiac pacemakerchannels by intracellular cyclic AMP. Nature 1991; 351:145-7.


35. Stellwagen D, Shatz CJ, Feller MB. Dynamics of retinal wavesare controlled by cyclic AMP. Neuron 1999; 24:673-85.

36. Feigenspan A, Bormann J. Facilitation of GABAergic signalingin the retina by receptors stimulating adenylate cyclase. ProcNatl Acad Sci U S A 1994; 91:10893-7.

37. Kajimura M, Shimoyama M, Tsuyama S, Suzuki T, Kozaki S,Takenaka S, Tsubota K, Oguchi Y, Suematsu M. Visualizationof gaseous monoxide reception by soluble guanylate cyclase inthe rat retina. FASEB J 2003; 17:506-8.

38. Miller RF, Bloomfield SA. Electroanatomy of a unique amacrinecell in the rabbit retina. Proc Natl Acad Sci U S A 1983; 80:3069-73.

39. Poznanski RR. Modelling the electrotonic structure of starburstamacrine cells in the rabbit retina: a functional interpretation ofdendritic morphology. Bull Math Biol 1992; 54:905-28.

40. Tauchi M, Masland RH. Local order among the dendrites of anamacrine cell population. J Neurosci 1985; 5:2494-501.

41. Berger T, Larkum ME, Luscher HR. High I(h) channel density inthe distal apical dendrite of layer V pyramidal cells increasesbidirectional attenuation of EPSPs. J Neurophysiol 2001; 85:855-68.

42. Fernandez N, Andreasen M, Nedergaard S. Influence of the hy-perpolarization-activated cation current, I(h), on the electrotonicproperties of the distal apical dendrites of hippocampal CA1pyramidal neurones. Brain Res 2002; 930:42-52.

43. Williams SR, Stuart GJ. Voltage- and site-dependent control ofthe somatic impact of dendritic IPSPs. J Neurosci 2003; 23:7358-67.

340

The print version of this article was created on 13 May 2004. This reflects all typographical corrections and errata to the article through thatdate. Details of any changes may be found in the online version of the article.

Documents

Inward rectifying currents stabilize the membrane ... · distal dendrites [20,21], where I (H) shortens the decay time course of excitatory post-synaptic potentials (EPSP) and af-fects