Isolation and characterization of lumpy skin disease virus …...2020/10/08 · 3 48 India. For the first time, we employed primary goat kidney (PGK) cells for the 49 isolation of

1

1 Isolation and characterization of lumpy skin disease virus from cattle in India

2

3 Naveen Kumara,*, Yogesh Chandera, Ram Kumara, Nitin Khandelwala, Thachamvally

4 Riyesha, Khushboo Chaudharya, Karuppusamy Shanmugasundarama, Sanjit

5 Kumarb, Anand Kumarc, Madhurendu K. Guptab, Yash Pala, Sanjay Baruaa,*,

6 Bhupendra N. Tripathia,*

7

8 aNational Centre for Veterinary Type Cultures, ICAR-National Research Centre on

9 Equines, Hisar, India

10

11 bDepartment of Veterinary Pathology, cDepartment of Veterinary Gynaecology and

12 Obstetrics, College of Veterinary Sciences, Birsa Agricultural University, Ranchi,

13 India

14

15 * Corresponding author

16 Email: [email protected] (N. Kumar), [email protected] (S. Barua),

17 [email protected] (B.N. Tripathi)

18

19 # These authors contributed equally to this work.

20

21

.CC-BY 4.0 International licensemade available under a(which was not certified by peer review) is the author/funder, who has granted bioRxiv a license to display the preprint in perpetuity. It is

The copyright holder for this preprintthis version posted October 8, 2020. ; https://doi.org/10.1101/2020.10.08.331124doi: bioRxiv preprint

https://doi.org/10.1101/2020.10.08.331124

http://creativecommons.org/licenses/by/4.0/

2

23 ABSTRACT

24 Lumpy skin disease (LSD) has devastating economic impact. During the last decade,

25 LSD had spread to climatically new and previously disease-free countries, which

26 also includes its recent emergence in the Indian subcontinent (2019). This study

27 deals with the LSD outbreak(s) from cattle in Ranchi (India). Virus was isolated from

28 the scabs (skin lesions) in the primary goat kidney cells. Phylogenetic analysis

29 based on nucleotide sequencing of LSD virus (LSDV) ORF011, ORF012 and

30 ORF036 suggested that the isolated virus (LSDV/Bos taurus-tc/India/2019/Ranchi)

31 is closely related to Kenyan LSDV strains. Further, we adapted the isolated virus in

32 Vero cells, an alternative cell line that was found suitable for LSDV propagation. In

33 addition, kinetics of viral DNA synthesis and one-step growth curve analysis

34 suggested that LSDV initiates synthesizing its genome at ~24 hours post-infection

35 (hpi) with a peak level at ~96 hpi whereas evidence of progeny virus particles was

36 observed at 36-48 hours (h) with a peak titre at ~120 h. This study reports the first

37 successful isolation of LSDV in India, besides describing alternative cells for virus

38 isolation (primary goat kidney cells) and in vitro propagation (Vero cells) as well as

39 providing some insights on LSDV life cycle.

40 Keywords

41 Lumpy skin disease, LSDV, India, virus isolation, Vero cells, primary goat kidney

42 cells

43 Author Summary

44 This study describes the first successful isolation of LSDV in India. Nucleotide

45 sequencing of LSDV ORF011, ORF012 and ORF036 suggested that the isolated

46 virus is closely related to Kenyan LSDV strains. This is in accordance with the

47 previous (only) study, thereby suggesting that a single LSDV strain is circulating in



https://doi.org/10.1101/2020.10.08.331124


3

48 India. For the first time, we employed primary goat kidney (PGK) cells for the

49 isolation of LSDV, where PGK cells were found more sensitive for LSDV isolation as

50 compared to the primary lamb testicle (PLT) and primary goat testicle (PGT) cells.

51 We also adapted the isolated virus in Vero cells and demonstrated that Vero cells

52 are also suitable for in vitro propagation of LSDV. Besides, we also provide some

53 insights on the LSDV life cycle.

54 Introduction

55 Lumpy skin disease (LSD) is a transboundary animal viral disease which

56 causes considerable financial losses to the livestock industry. It was observed for the

57 first time in Zambia in 1929 [1] and spread rapidly in the cattle population across

58 African countries [reviewed in reference [2]]. Until 1984, LSD was maintained within

59 the countries of sub-Sahara Africa [2]. The first confirmed transcontinental spread of

60 LSD from the African to Middle-East Asian countries occurred when the disease was

61 reported in Israel in 1989 [3]. In 2013, it was confirmed in Turkey. By 2015-16, the

62 disease was reported in South-East Europe, the Balkans and the Caucasus [4]. Of

63 late the disease was reported for the first time from India in November 2019 [5].

64 Clinically, LSD has been reported in cattle only. The incubation period of the

65 disease is 4-12 days. The clinical picture starts with fever (40-41.5°C) which persists

66 for 1-3 days [6]. This is accompanied by increased nasal and pharyngeal secretions,

67 lachrymation, enlargement of lymph nodes, anorexia, dysgalactia, general

68 depression and a disinclination to move [7]. The skin nodules appear within 1-2

69 days, which gradually become harder and necrotic thereby inducing severe

70 discomfort, pain and lameness. In 2-3 weeks, the nodules either regress, or

71 necrosis of the skin results in hard, raised areas (sit-fasts) clearly separated from

72 the surrounding skin. Some of the sit-fasts may slough away, leaving a full skin



https://doi.org/10.1101/2020.10.08.331124


4

73 thickness hole in the skin which usually gets infected by bacteria or becomes liable

74 to myasis [8]. Some animals become extremely emaciated, and euthanasia may be

75 warranted. Besides, the bulls may become temporarily or permanently infertile and

76 may secrete the virus for a prolonged period. The morbidity in LSD varies from 50-

77 100% [9]. The mortality rate is usually low (1-5%) but occasionally reported to be

78 much higher [10].

79 The occurrence of LSD causes decreased milk production, loss of hide and

80 draft. An economic loss of 20.9 million Euros was estimated in the 2016 outbreak of

81 LSD in Balkan countries, i. e. Albania, Bulgaria, Macedonia [10]. In several African

82 countries, LSD causes serious problems because it occurs during season, a time

83 when draught oxen are required for cultivation of crops and thereby resulting in

84 failure to cultivate and plant crops [11]. This constituted a serious hazard to the food

85 security of the people in the affected areas [11].

86 LSD virus (LSDV) belongs to the genus capripoxvirus within the family

87 Poxviridae. LSDV genome is ~151 kbp in length [12]. Two other capripoxviruses,

88 sheepox virus (SPV) and goatpox virus (GPV) which cause devastating disease in

89 sheep and goats respectively, are also antigenically similar to LSDV[13].

90 Capripoxviruses are cross-reactive within the genus; therefore SPV- or GPV-based

91 vaccines have been used to provide cross protection against LSDV [13-15]. LSDV is

92 usually isolated and quantified (tissue culture infective dose; TCID50) in primary cells.

93 LSDV also infects Madin-Darby bovine kidney (MDBK) cells where it forms foci

94 (multifocal areas of hyperplastic cells). These foci can be counted under microscope

95 in an agar-overlay medium. However, a plaque assay to precisely quantify infectious

96 LSDV is still lacking.



https://doi.org/10.1101/2020.10.08.331124


5

97 The recent and unprecedented spread of LSD in India and several other

98 countries has highlighted the need for better research efforts into this rapidly

99 emerging pathogen. Our study describes alternative cells for isolation and in vitro

100 propagation of LSDV, besides providing insights on LSDV life cycle.

101 Materials and Methods

102 Ethics Statement

103 The study involves collection of biological specimens from cattle (field animals).

104 Scabs and blood samples (3 ml each) were collected from the LSD suspected cattle

105 (n=22) as per the standard practices without using anaesthesia. College of

106 Veterinary Sciences, Birsa Agricultural University, Ranchi (India) granted the

107 permission to collect the biological specimens. A due consent was also taken from

108 the farmer (animal owner) before collection of the specimens.

109 Cells

110 Primary goat testicle (PGT) cells [16], primary goat kidney (PGK) cells [17],

111 primary lamb testicle (PLT) cells [16] and Madin-Darby bovine kidney (MDBK) cells

112 [18] were available at National Centre for Veterinary Type Cultures (NCVTC), Hisar

113 and grown in Dulbecco’s Modified Eagle’s Medium (DMEM) supplemented with

114 antibiotics and 10% foetal calf serum.

115 Clinical specimens

116 The samples were collected from in and around Ranchi, Jharkhand (India) which

117 includes an organized cattle dairy farm and small dairy units in villages namely

118 Tussum, Nagri, Khemra and Gadgaon. The first evidence of the disease was

119 reported about 2 months prior to the sampling. Scabs from the nodular lesions were

120 collected in 3 ml Minimum Essential Medium (MEM, transport medium) and

121 transported on ice to the laboratory. The samples (scabs) were triturated to make



https://doi.org/10.1101/2020.10.08.331124


6

122 ~10% suspension in MEM followed by filtration through 0.45 µM syringe filter and

123 storage at -80OC until use. Serum/blood samples were also collected from infected

124 as well as apparently healthy animals after taking a due consent from the farmers.

125 Identification of the agent (s)

126 Typical nodular lesions on the body surface were primarily suggestive of LSD.

127 Therefore, initially we investigated for the presence of capripoxvirus and LSDV-

128 specific gene segments by PCR (Table 1). Briefly, total DNA was extracted from

129 swab samples by DNeasy Blood & Tissue Kits as per the instructions of the

130 manufacturer (Qiagen, Valencia, CA, USA) and resuspended in nuclease free water.

131 The DNA was subjected to amplify capripoxvirus-specific and LSDV-specific DNA

132 segments by PCR. Primers, melting temperatures and extension times for

133 amplification of various agents are given in Table 1. For PCR amplification, each

134 reaction tube of 20 µl contained 10 µl of Q5 High-Fidelity 2× Master Mix (New

135 England BioLabs Inc.), 20 pmol of forward and reverse primer, and 5 µl of DNA

136 (template). The thermocycler conditions were as follows: a denaturation step of 5

137 min at 98oC followed by 35 cycles of amplification [(30 sec at 98oC, 30 s at 52-55oC

138 (Table 1) and 30-80 s (Table 1) at 72oC], and a final extension step at 72oC for 10

139 min. The PCR products were separated in a 1% agarose gel.

Table 1: Primers used to amplify capripoxvirus- and LSDV-specific gene segments

Oligos Gene/ORF Primers

Product size (bp)

Thermocycler

Forward: 5'-GGAATGATGCCRTCTARATTC-3' Annealing = 55OCCapripoxvirus P32

Reverse: 5'-CCCTGAAACATTAGTATCTGT-3'199

Extension = 30 s

Forward: 5'-ATGAATTATACTCTTAGYACAGTTAG-3' Annealing = 52OCORF 011 Reverse: 5'-TTATCCAATGCTAATACTACCAG-3'

1134Extension = 80 s

Forward: 5’- ATGGAAAAGGAAAAATTATGTAGCG -3’ Annealing = 52OCORF 012 Reverse: 5’- TTATTGTTTGTCAAAAAAGGTGAGATTTC -3’

636Extension = 40 s

Forward: 5’- ATGGATGATGATAATACTAATTCATATAG -3’ Annealing = 52OC

LSDV

ORF 036 Reverse: 5’- TTATTTTTCTACAGCTCTAAACTTCG -3’

606Extension = 40 s

140



https://doi.org/10.1101/2020.10.08.331124


7

141 Nucleotide sequencing

142 In order to further confirm the identity of the virus (LSDV/India/2019/Ranchi),

143 ORF011, ORF012 and ORF036 encoding G-protein-coupled receptors (GPCRs),

144 Ankyrin repeat (ANK) and RNA polymerase subunit (RPO30) respectively, were

145 amplified by PCR, gel purified using QIAquick Gel Extraction Kit (Qiagen, Hilden,

146 Germany) and subjected to direct sequencing using both forward and reverse PCR

147 primers. Duplicate samples were submitted for sequencing and only high-quality

148 sequences were deposited in GenBank database with Accession Numbers of

149 MN967004 (ORF011), MN967004 (ORF12) and MN967004 (ORF036).

150 Phylogenetic Analysis

151 The nucleotide sequences from LSDV ORF011, ORF012 and ORF036 were

152 edited to 1029, 622 and 579 bp fragments respectively using BioEdit version 7.0.

153 These sequences, together with the representative nucleotide sequences of LSDV,

154 sheeppox virus (SPV) and goatpox virus (GPV) available in the public domain

155 (GenBank) were subjected to multiple sequence alignments using CLUSTALW

156 (http://www.ebi.ac.uk/clustalw/index.html). Phylogenetic analysis was carried out by

157 constructing a concatemeric Neighbor-Joining tree. Test of phylogeny was

158 performed using Maximum Composite Likelihood method and the confidence

159 intervals were estimated by a bootstrap algorithm applying 1,000 iterations.

160 Virus isolation

161 For virus isolation, an aliquot of the virus (500 µl filtrate) was used to infect

162 confluent monolayer of PGT, PGK and PLT cells for 2 h followed by addition of fresh

163 growth medium. The cells were observed daily for the appearance of cytopathic

164 effect (CPE).

165 Adaptation of LSDV to Vero cells



https://doi.org/10.1101/2020.10.08.331124


8

166 In order to adapt LSDV to Vero cells, 500 µl inoculum of the PGK amplified virus

167 was used to infect Vero cells for 4 h followed by addition of fresh growth medium and

168 observance of CPE during sequential passage(s). Fifteen sequential passages in

169 Vero cells were made. The growth curve and kinetics of synthesis of LSDV genome

170 of the P15 virus was studied in Vero and MDBK cells. Virus titers were determined

171 by TCID50 assay and converted to estimated plaque-forming units (PFU) by the

172 conversion TCID50 ≈ 0.7 PFU as described previously [19].

173 Plaque assay

174 Plaque was performed as per the previously described methods along with

175 some modifications [17,20]. The confluent monolayers of Vero cells, grown in 6 well

176 tissue culture plates, were infected with 10-fold serial dilutions of virus for 1 h at

177 37oC, after which the infecting medium was replaced with an agar-overlay containing

178 equal volume of 2X L-15 medium and 1% agar. Upon development of plaques, the

179 agar-overlay was removed, and the plaques were stained by 1% crystal violet.

180 Virus neutralization assay

181 Serum samples were initially heated at 56oC for 30 min to inactivate the

182 complements. PGK cells were grown in 96 well tissue culture plates at ~90

183 confluency. Two-fold serum dilutions (in 50 µl volume) were made in phosphate

184 buffer saline (PBS) and incubated with equal volume of LSDV (104 PFU/ml) for 1 h.

185 Thereafter, virus-antibody mixture was used to infect PGK cells. The cells were

186 observed daily for the appearance of CPE. Final reading was taken at 96 hours post-

187 infection (hpi) for the determination of antibody titers.

188 Kinetics of LSDV genome synthesis (qRT-PCR)

189 Vero cells, in triplicates, were infected with LSDV at MOI of 5 for 2 h followed by

190 washing with PBS and addition of fresh DMEM. Cells were scraped at various times



https://doi.org/10.1101/2020.10.08.331124


9

191 post-infection. The levels of viral DNA in the infected cells were quantified by qRT-

192 PCR. Viral RNA/DNA Purification Kit (Thermoscientific, Vilnius, Lithunia) was used

193 for extraction of viral DNA from the infected cell lysate. qRT-PCR was carried out

194 with a 20 µl reaction mixture containing LSDV ORF036 or specific primers (Table 1),

195 template and Sybr green DNA dye (Promega, Madison, USA). Thermalcycler

196 conditions were as follows: a denaturation step of 5 min at 940C followed by 40

197 cycles of amplification (30 s at 940C, 30 s at 520C, and 40 s at 720C). The levels of

198 LSDV DNA, expressed as threshold cycle (Ct) values, were normalized with β-actin

199 gene to determine relative fold-change in copy number of viral DNA [21].

200 Results

201 Clinical findings

202 In the initial stages, the affected animals showed fever (up to 41.5oC) which

203 persisted for 3-4 days which was followed by oedema (swelling) of legs, enlarged

204 lymph node, lameness and anorexia. The most prominent clinical finding was the

205 appearance of skin nodules all over the body surface (Fig. 1a) immediately after

206 the febrile stage. The nodules were well circumscribed, round, slightly raised, firm,

207 painful and were 1-3 cm in size (Fig. 1b). Some of the nodules ruptured to create a

208 deep-seated wound (Fig. 1c, 1d). Wounds were frequently invaded by secondary

209 bacterial infections which led to extensive suppuration and sloughing. The lesions

210 were particularly extensive in the fetlock region, extended up to the underlying

211 subcuitis and muscle (Fig. 1e). Some of the nodules regressed and in some the

212 necrosis of the skin resulted in hard, raised areas (sit-fasts) clearly separated from

213 the surrounding skin (Fig. 1f). Nasal discharge was apparent only in few animals.

214 Few pregnant animals aborted. Morbidity was ~8% in the organized dairy farm

215 (college dairy farm) and up to ~25% in small dairy units in the villages. Most of the



https://doi.org/10.1101/2020.10.08.331124


10

216 animals recovered except few which died due to extensive lesions, anorexia and

217 emaciation. During the course of writing this manuscript, the disease has spread

218 into several states in India including Kerala, Tamil Nadu, Andhra Pradesh,

219 Telangana, Odisha, Jharkhand, West Bengal, Assam, Chhattisgarh, Maharashtra

220 and Madhya Pradesh (Fig. 2).

221 Identification of the agent

222 In order to demonstrate the etiological agent, DNA was extracted from the scabs

223 and subjected to amplification of capripoxvirus-specific and LSDV-specific DNA

224 segments by PCR. An amplification of 199 bp DNA fragment with capripoxvirus-

225 specific primers indicated the presence of capripoxvirus in the scabs (Fig. 3). All

226 except two scab specimens were positive for capripoxvirus genome (Table 2).

227 However, viremia could not be detected; neither in the clinically affected animals with

228 skin nodules nor in the healthy in-contact susceptible animals (Table 2).

229 Furthermore, the scabs were positive for LSDV-specific, rather than SPV- or GPV-

230 specific genome (data not shown). Collectively, based on characteristic clinical signs,

231 and amplification of capripoxvirus- and LSDV-specific genome, the identity of the

232 virus was confirmed as LSDV.

Table 2: Detection of virus and virus-specific antibodies in clinically affected and in-contact healthy animalsS. No. Place Skin nodules LSDV genome

(scab)Viremia Antibody

titter1 Tussum (+) (+) (-) 64

2 Tussum Healthy* NA (-) 16

3 Tussum (+) (-) (-) 128

4 Tussum (+) (+) (-) 32

5 Tussum (+) (+) (-) >1024

6 Tussum Healthy* NA (-) 128



https://doi.org/10.1101/2020.10.08.331124


11

7 Nagri (+) (+) (-) >1024

8 Nagri (+)# (-) (-) 128

9 Khemra (+)# (+) (-) 512

10 Khemra (+)# (+) (-) 512

11 Gadgaon (+) (+) (-) 512

12 Gadgaon (+)# (-) (-) >1024

13 Gadgaon Healthy* NA (-) <4

14 Gadgaon (+)# (+) (-) 128

15 Ranchi (+) (+) (-) 128

16 Ranchi (+) (+) (-) >1024

17 Ranchi (+) (+) (-) 32

18 Ranchi Healthy* NA (-) <4

19 Ranchi Healthy* NA (-) <4

20 Ranchi (+) (+) (-) 64

21 Ranchi Healthy* NA (-) 128

22 1 month later

Recovered NA (-) >1024

233

234 Phylogenetic analysis

235 In order to compare and determine the phylogenetic relationship of

236 LSDV/India/2019/Ranchi with other LSDV/SP/GPV strains, ORF011, ORF012 and

237 ORF036 were amplified by PCR and subjected to direct sequencing. The sequences

238 were edited to 1029, 622 and 579 bp and deposited to GenBank with Accession

239 Number of MN967004 (ORF011), MN967004 (ORF12) and MN967004 (ORF036).

240 These sequences together with the corresponding nucleotide sequences from other

241 LSDV/SPV/GPV strains retrieved from the GenBank were used to prepare a



https://doi.org/10.1101/2020.10.08.331124


12

242 consensus linear phylogenetic tree (Fig. 4). Nucleotide sequences of

243 LSDV/India/2019/Ranchi showed highest similarity to the Kenyan LSDV strains.

244 Virus isolation

245 The virus recovered from the scabs was used to infect PGT, PGK and PLT cells.

246 One scab sample positive for LSDV-specific gene segment in PCR was considered

247 for virus isolation. Infection of the clinical specimen did not reveal any CPE up to 7

248 days post-infection in any of the cell lines tested except in PGK cells which showed

249 cell shrinking but no clear CPE. Thereafter, the infected cells were freeze-thawed

250 twice and the resulting supernatant (called first blind passage) was used to infect

251 fresh cells. Upon second blind passage, PGK cells started showing shrinking at 48-

252 72 hpi and a clear CPE, characterized by cell rounding, ballooning and degeneration

253 was evident at 96-120 hpi (Fig. 5a). The other cell types did not produce any CPE in

254 second blind pasasage, even up to 5-7 days post infection (dpi). PLT cells produced

255 CPE in third blind (Fig. 5a) passage whereas PTC cells did not show CPE even up

256 to the fourth blind passage, suggesting PGK cells are the most sensitive cells for

257 LSDV isolation (among the three primary cells employed in this study). As in case of

258 clinical samples, the LSDV genome could also be amplified in cell culture

259 supernatant from the virus-infected cells (data not shown). The virus was amplified in

260 PGK cells at a titer of ~107 PFU/ml. The virus was deposited in the repository at

261 NCVTC with an Accession Number VTCCAVA288 and named as LSDV/Bos taurus-

262 tc/India/2019/Ranchi.

263 Adaptation to Vero cells

264 Primary cells usually do not survive for long time. Therefore, it is desirable to

265 adapt the virus in established cell lines. For adaptation to Vero cells, 500 µl inoculum

266 of the PGK amplified virus was used to infect Vero cells but no CPE was observed



https://doi.org/10.1101/2020.10.08.331124


13

267 up to 8 days post-infection after which the cells were freeze-thawed twice and used

268 to reinfect fresh Vero cells. CPE characterized by cell clustering (foci) (Fig. 5b) was

269 observed at 6 days post-infection on 4th passage (P4) in Vero cells. However, P4

270 virus did not form plaques. At P15, rather than producing only foci, the virus began

271 producing a clear CPE, characterized by clustering, cell rounding and degeneration

272 (Fig. 5b). Unlike P4, P15 virus also formed plaques but were of small size (Fig. 5c).

273 LSDV life cycle

274 Little is known about the life cycle of LSDV. In order to determine the length of

275 LSDV life cycle, Vero/MDBK cells were infected with LSDV and the progeny virus

276 particles released in the infected cell culture supernatant at various time points post-

277 infection were quantified. As shown in Fig. 6a no significant progeny virus particles

278 were observed at 6 hpi and 24 hpi (Vero cells). The small amount of virus particles at

279 these time points represents the input used to infect cells which remained attached

280 with the cells/flask even upon washing. However, a sudden increase in the viral titers

281 (progeny virus particles) was observed at 36 hpi which further increased from 48 hpi

282 to 120 hpi finally becoming stable at 144 hpi onward and then declining at 192 hpi.

283 The kinetics of virus replication was somewhat similar in MDBK cells, however the

284 first evidence of progeny virus particles in infected cell culture supernatant was

285 observed at 48 hpi. In addition, LSDV in MDBK cells did not attain a stationary phase

286 even up to 192 hpi and the overall viral titers were ~10-fold lower compared to the

287 Vero cells (compare Fig. 6a and 6b).

288 In order to provide insights on the kinetics of LSDV genome synthesis,

289 Vero/MDBK cells were infected with LSDV and the viral DNA was quantified in the

290 infected cells (pellet) at various time points post-infection. As shown in Fig. 6c (Vero

291 cells) and Fig. 6d (MDBK cells), the levels of LSDV DNA were comparable at 6 hpi,



https://doi.org/10.1101/2020.10.08.331124


14

292 12 hpi and 18 hpi (Fig. 6c and 6d). However, the levels of viral DNA progressively

293 increased from 24 hpi to 96 hpi and finally stabilizing at 120 hpi (Fig. 6c and 6d).

294 Reactivity of LSDV to the sera from LSDV-infected animals

295 Serum samples from all the clinically affected animals (showed presence of

296 skin nodules) and some in-contact susceptible animals were also subjected for

297 determination of anti-LSDV antibody titer in a virus neutralization assay. Clinically

298 affected animals showed an antibody titer of 64-1024 (Table 2). However, few

299 healthy in-contact susceptible animals were also found positive for anti-LSDV

300 antibodies suggesting subclinical infection (Table 2).

301 Discussion

302 For several decades, lumpy skin disease was restricted to Africa wherein it

303 led to several devastating pandemics in several countries, thereby threatening food

304 security and consequently increasing poverty [22,23]. Since the year 2000, it

305 spread to several countries of the Middle East and was confirmed in Turkey in

306 2013. In 2015-16, the disease was reported in several European countries, viz;

307 Bulgaria, Macedonia, Serbia, Kosovo, Montenegro and Albania [4,12]. LSD was

308 reported for the first time from India In 2019 [5]. The disease has already spread to

309 several states viz; Kerala, Tamil Nadu, Andhra Pradesh, Telangana, Odisha,

310 Jharkhand, West Bengal, Assam, Chhattisgarh, Maharashtra and Madhya Pradesh

311 (until this paper is being written) of the country and has caused considerable

312 economic losses to the livestock industry. This recent and unprecedented spread of

313 LSDV in India and several other countries has highlighted the need for better

314 research efforts into this rapidly emerging pathogen. India is currently lacking in the

315 reagents required to develop diagnostic/therapeutic/prophylactic reagents, besides

316 lacking established laboratories for LSDV research.



https://doi.org/10.1101/2020.10.08.331124


15

317 Clinically, all classical symptoms of LSD viz; fever, generalized skin nodules,

318 enlargement of lymph nodes, anorexia, oedema of legs and lameness [6] were

319 observed in most of the cases we observed in the outbreak in Ranch (India).

320 Disease was not observed in buffaloes; however, a deer exhibited skin nodules. The

321 morbidity was ~25% without any significant mortality which is in agreement with the

322 previous findings [9,10]. Presence of anti-LSDV neutralizing antibodies in some of

323 the healthy in-contact susceptible animals (Table 2) suggests that certain animals

324 may undergo subclinical infection in a typical LSD outbreak. Most of the collected

325 scabs revealed the presence of LSDV genome (Table 2), however viremia was not

326 apparent in any animal. The duration of viremia in LSDV varies between 1 to 10

327 days, though the virus may survive in the skin lesions for 4-6 months or longer [4]. It

328 is quite possible that the viremic phase would have been over by the time the

329 samples were collected.

330 Upon phylogenetic analyses, LSDV/India/2019/Ranchi showed the highest

331 similarity to the Kenyan LSDV strains. The only previous study on LSDV from India

332 also reported that Indian LSDV strains (from Odisha state of India) were closely

333 related with Kenyan LSDV strains [5], suggesting a single LSDV strain is circulating

334 in the country. The disease is primarily transmitted mechanically by arthropod

335 vectors [24] and is capable of spreading across countries or even across continents

336 by the movement of live animals [22]. It is likely that the disease could have been

337 introduced in India by way of import of animals or animal products from Africa. There

338 is potential for further geographic spread of LSD which necessitates increased

339 surveillance. Although the virus isolated in this study was ~100% identical with the

340 Kenyan LSDV strains, its complete genetic characterization (whole genome



https://doi.org/10.1101/2020.10.08.331124


16

341 sequencing) as well as its ability to produce clinical disease needs to be further

342 elucidated which is beyond the scope of this manuscript.

343 LSDV has traditionally been grown in primary cells derived from caprine, ovine

344 or bovine origin [4]. However, primary bovine dermis and PLT cells are considered to

345 be the most susceptible [4]. In this study, PGK cells exhibited CPE in the very first

346 passage. PLT cells showed CPE in third blind passage whereas PGT cells did not

347 exhibit any CPE even up to the fourth blind passage. Taken together, it can be

348 concluded that the PGK cells are the most sensitive for LSDV isolation among the

349 three primary cell lines employed. However, primary cells are prone to

350 contamination, time consuming and expensive to produce and are not considered

351 appropriate with current efforts to reduce the use of animals in science.

352 LSDV quantitation is currently based on determination of TCID50 in primary cells

353 [25]. However, TCID50 may not represent the accurate virus titer as manual

354 observation of CPE under microscope could lead to deviations in the results partly

355 due to the possible subjective (eye) effect. Emerging evidences also suggest use of

356 MDBK cell line for propagation of LSDV [26-29]. A focus forming assay (in MDBK

357 cells) has been described for LSDV [29,30] but precise counting of foci under

358 microscope is a tedious task. In this study, we for the first time adapted the LSDV in

359 an alternative continuous cell line, the Vero cell line. No CPE could be observed

360 upon immediate infection of LSDV (isolated in PGK cells) to Vero cells. Later on,

361 CPE characterized by cell clustering (foci), like those observed previously in MDBK

362 cells [29] was observed at P4. However, virus did not form any plaques at this stage

363 (P4). On subsequent passage (P15), virus started producing a clear CPE,

364 characterized by cell clustering, rounding and degeneration. P15 virus also produced

365 plaques but were of small size and could not be precisely counted after crystal violet



https://doi.org/10.1101/2020.10.08.331124


17

366 staining. Vero cell adapted LSDV grown at a titre of ~107 PFU/ml which is similar to

367 the virus titre obtained in primary cells [30] and MDBK cells [29], suggesting their

368 suitability for the propagation of LSDV. Further passage(s) of LSDV (P>15) and

369 some modifications in the plaque assay protocol are underway to enhance the

370 plaque size.

371 LSDV has been relatively poorly studied and very little is known about its life

372 cycle. In this study, we also provided some insights on the life cycle of LSDV. In one-

373 step growth curve analysis, LSDV was shown to start synthesizing its DNA at ~24

374 hpi with peak level of viral DNA at ~96 hpi. Concomitantly the progeny virus particles

375 started appearing in the infected cell culture supernatant at ~36 hpi with a peak viral

376 titer at ~120 hpi. The kinetics of virus replication was somewhat similar in MDBK

377 cells, however first evidence of progeny virus particles in infected cell culture

378 supernatant was observed at 48 hpi. In addition, LSDV titres in MDBK infected cell

379 culture supernatant did not attain a stationary phage even up to 192 hpi and overall

380 viral titres were ~10-fold lower than Vero cells suggesting suitability of Vero cells for

381 the propagation of LSDV. Taken together, these lines of evidence in both Vero and

382 MDBK cells suggest that the life cycle of LSDV is 36-48 h in cultured cells. These

383 finding on LSDV which were lacking in the literature are likely to facilitate our

384 understanding about various aspects of virus replication and pathogenesis.

385 This study describes first successful isolation of LSDV in India, besides

386 describing alternative cells for virus isolation (PGK cells) and in vitro propagation

387 (Vero cells) as well as providing some insights on LSDV life cycle. The isolated

388 virus would be useful for developing diagnostics, prophylactics and therapeutic

389 agents to combat this economically important disease in India.

390 Acknowledgement



https://doi.org/10.1101/2020.10.08.331124


18

391 This work was supported by the Science and Engineering Research Board

392 (Grant number CRG/2018/004747 and CVD/2020/000103), Department of Science

393 and Technology, Government of India and Indian Council of Agricultural Research,

394 Grant Number IXX11882.

395 Author contribution

396 N-Ku, K-S, A-K, S-K, M-KG collected the samples from field outbreak. N-Ku

397 and R-T designed the experiments. N-Ku, Y-C, N-Kh, R-K and K-C performed the

398 experiments. N-Ku, S-B, Y-P, R-T and B-NT wrote the manuscript.

399 References

400 1. RAS M (1931) Pseudo-Urticaria of Cattle. Government of Northern Rhodesia: Department 401 of Animal Health: 20-21.402 2. Tuppurainen ES, Oura CA (2012) Review: lumpy skin disease: an emerging threat to 403 Europe, the Middle East and Asia. Transbound Emerg Dis 59: 40-48.404 3. Yeruham I, Nir O, Braverman Y, Davidson M, Grinstein H, et al. (1995) Spread of lumpy 405 skin disease in Israeli dairy herds. Vet Rec 137: 91-93.406 4. OIE (2017) Lumpy skin Disease OIE Terrestrial Mannual 2017 Chapter 2.4.13.407 5. Sudhakar SB, Mishra N, Kalaiyarasu S, Jhade SK, Hemadri D, et al. (2020) Lumpy skin 408 disease (LSD) outbreaks in cattle in Odisha state, India in August 2019: 409 Epidemiological features and molecular studies. Transbound Emerg Dis.410 6. Woods JA (1988) Lumpy skin disease--a review. Trop Anim Health Prod 20: 11-17.411 7. Tasioudi KE, Antoniou SE, Iliadou P, Sachpatzidis A, Plevraki E, et al. (2016) Emergence 412 of Lumpy Skin Disease in Greece, 2015. Transbound Emerg Dis 63: 260-265.413 8. Edelsten M (2014) Threat to European cattle from lumpy skin disease. Vet Rec 175: 330.414 9. Molla W, de Jong MCM, Gari G, Frankena K (2017) Economic impact of lumpy skin 415 disease and cost effectiveness of vaccination for the control of outbreaks in Ethiopia. 416 Prev Vet Med 147: 100-107.417 10. Casal J, Allepuz A, Miteva A, Pite L, Tabakovsky B, et al. (2018) Economic cost of 418 lumpy skin disease outbreaks in three Balkan countries: Albania, Bulgaria and the 419 Former Yugoslav Republic of Macedonia (2016-2017). Transbound Emerg Dis 65: 420 1680-1688.421 11. CABI (2019) Lumpy skin Disease. https://wwwcabiorg/isc/datasheet/76780.422 12. Lojkic I, Simic I, Kresic N, Bedekovic T (2018) Complete Genome Sequence of a Lumpy 423 Skin Disease Virus Strain Isolated from the Skin of a Vaccinated Animal. Genome 424 Announc 6.425 13. Abutarbush SM, Tuppurainen ESM (2018) Serological and clinical evaluation of the 426 Yugoslavian RM65 sheep pox strain vaccine use in cattle against lumpy skin disease. 427 Transbound Emerg Dis 65: 1657-1663.428 14. Kitching RP (2003) Vaccines for lumpy skin disease, sheep pox and goat pox. Dev Biol 429 (Basel) 114: 161-167.



https://doi.org/10.1101/2020.10.08.331124


19

430 15. Tuppurainen ES, Pearson CR, Bachanek-Bankowska K, Knowles NJ, Amareen S, et al. 431 (2014) Characterization of sheep pox virus vaccine for cattle against lumpy skin 432 disease virus. Antiviral Res 109: 1-6.433 16. Kumar N, Wadhwa A, Chaubey KK, Singh SV, Gupta S, et al. (2014) Isolation and 434 phylogenetic analysis of an orf virus from sheep in Makhdoom, India. Virus Genes 435 48: 312-319.436 17. Kumar N, Khandelwal N, Kumar R, Chander Y, Rawat KD, et al. (2019) Inhibitor of 437 Sarco/Endoplasmic Reticulum Calcium-ATPase Impairs Multiple Steps of 438 Paramyxovirus Replication. Front Microbiol 10: 209.439 18. Khandelwal N, Chander Y, Rawat KD, Riyesh T, Nishanth C, et al. (2017) Emetine 440 inhibits replication of RNA and DNA viruses without generating drug-resistant virus 441 variants. Antiviral Res 144: 196-204.442 19. Coves-Datson EM, King SR, Legendre M, Gupta A, Chan SM, et al. (2020) A 443 molecularly engineered antiviral banana lectin inhibits fusion and is efficacious 444 against influenza virus infection in vivo. Proc Natl Acad Sci U S A 117: 2122-2132.445 20. Kumar R, Khandelwal N, Chander Y, Riyesh T, Tripathi BN, et al. (2018) MNK1 446 inhibitor as an antiviral agent suppresses buffalopox virus protein synthesis. Antiviral 447 Res 160: 126-136.448 21. Kumar N, Barua S, Riyesh T, Chaubey KK, Rawat KD, et al. (2016) Complexities in 449 Isolation and Purification of Multiple Viruses from Mixed Viral Infections: Viral 450 Interference, Persistence and Exclusion. PLoS One 11: e0156110.451 22. Sprygin A, Pestova Y, Wallace DB, Tuppurainen E, Kononov AV (2019) Transmission 452 of lumpy skin disease virus: A short review. Virus Res 269: 197637.453 23. Saegerman C, Bertagnoli S, Meyer G, Ganiere JP, Caufour P, et al. (2019) Risk of 454 introduction of Lumpy Skin Disease into France through imports of cattle. 455 Transbound Emerg Dis 66: 957-967.456 24. Tuppurainen ES, Venter EH, Coetzer JA, Bell-Sakyi L (2015) Lumpy skin disease: 457 attempted propagation in tick cell lines and presence of viral DNA in field ticks 458 collected from naturally-infected cattle. Ticks Tick Borne Dis 6: 134-140.459 25. House JA, Wilson TM, el Nakashly S, Karim IA, Ismail I, et al. (1990) The isolation of 460 lumpy skin disease virus and bovine herpesvirus-4 from cattle in Egypt. J Vet Diagn 461 Invest 2: 111-115.462 26. Moller J, Moritz T, Schlottau K, Krstevski K, Hoffmann D, et al. (2019) Experimental 463 lumpy skin disease virus infection of cattle: comparison of a field strain and a vaccine 464 strain. Arch Virol 164: 2931-2941.465 27. Wallace DB, Viljoen GJ (2002) Importance of thymidine kinase activity for normal 466 growth of lumpy skin disease virus (SA-Neethling). Arch Virol 147: 659-663.467 28. Munyanduki H, Douglass N, Offerman K, Carulei O, Williamson AL (2020) Influence of 468 the lumpy skin disease virus (LSDV) superoxide dismutase homologue on host 469 transcriptional activity, apoptosis and histopathology. J Gen Virol 101: 645-650.470 29. Fay PC, Cook CG, Wijesiriwardana N, Tore G, Comtet L, et al. (2020) Madin-Darby 471 bovine kidney (MDBK) cells are a suitable cell line for the propagation and study of 472 the bovine poxvirus lumpy skin disease virus. J Virol Methods 285: 113943.473 30. Babiuk S, Parkyn G, Copps J, Larence JE, Sabara MI, et al. (2007) Evaluation of an ovine 474 testis cell line (OA3.Ts) for propagation of capripoxvirus isolates and development of 475 an immunostaining technique for viral plaque visualization. J Vet Diagn Invest 19: 476 486-491.

477



https://doi.org/10.1101/2020.10.08.331124


20

479 Figure legends

480 Fig. 1: Clinical findings. (a) Nodules all over the body surface in cattle (b) Nodules

481 are circumscribed, round, slightly raised, firm, painful and are 1-3 cm in size. (c)

482 Ruptured nodules that created a deep-seated wound. (d). Wounds invaded by

483 secondary bacterial infection leading to suppuration and sloughing. (e) Extensive

484 lesions in the fetlock region extending up to the underlying subcuitis and muscle.

485 (f) Necrosis of the skin nodule resulting in hard, raised areas “sit-fasts”.

486

487 Fig. 2: Distribution of LSD in India

488

489 Fig. 3: Identification of LSDV. Virus was recovered from the scabs in DMEM

490 followed by DNA extraction and PCR to amplify capripoxvirus-specific P32 gene.

491

492 Fig. 4. Phylogenetic analysis: ORF011, ORF012 and ORF036 of

493 LSDV/India/2019/Ranchi encoding GPCRs, Ank and RPO030 proteins respectively,

494 were amplified by PCR and subjected to direct nucleotide sequencing. The

495 sequences were edited to 1029, 622 and 579 bp fragments respectively using

496 BioEdit version 7.0. For evolutionary analysis, corresponding sequences of other

497 LSDV strains, SPV stains and GPV strains were retrieved from GenBank.

498 Phylogenetic analyses were carried out by constructing a concatemeric Neighbor-

499 Joining tree. Test of phylogeny was performed using Maximum Composite

500 Likelihood method and the confidence intervals were estimated by a bootstrap

501 algorithm applying 1,000 iterations. The tree is drawn to scale, with branch lengths in

502 the same units as those of the evolutionary distances used to infer the phylogenetic

503 tree.



https://doi.org/10.1101/2020.10.08.331124


21

504 Fig. 5: Virus isolation (a) Virus isolation. An aliquot of the virus (500 µl filtrate)

505 was used to infect confluent monolayer of PGT, PGK and PLT cells for 2 h followed

506 by addition of fresh growth medium. The cells were observed daily for appearance of

507 the CPE. The CPE observed in PGK, PLT and MDBK cells is shown. (b) Adaptation

508 to Vero cells. An aliquot (500 µl) of the LSDV isolated in PGK cells was used to

509 infect confluent monolayers of Vero cells for 2 h followed by followed by addition of

510 fresh growth medium without serum. The cells were observed daily for appearance

511 of CPE. The CPE observed at P4 and P15 is shown. (c). Plaque assay. The

512 confluent monolayers of Vero cells were infected with 10-fold serial dilutions of the

513 virus for 1 h at 37oC, after which the infecting medium was replaced with an agar-

514 overlay containing equal volume of 2X L-15 medium and 1% agar. Upon

515 development of plaques, the agar-overlay was removed, and the plaques were

516 stained by 1% crystal violet.

517

518 Fig. 6: LSDV life cycle. Vero/MDBK cells, in triplicates, were infected with LSDV at

519 MOI of 5 for 2 h followed by washing with PBS and addition of fresh DMEM. (a)

520 Growth curve. Supernatant was collected from the infected cells at indicated time

521 points and quantitated by determination of TCID50 (expressed as PFU/ml) in Vero

522 cells. Values are means ± SD and representative of the result of at least 3

523 independent experiments. (b) Kinetics of genome synthesis. Cells were scraped

524 at indicated times points and the levels of viral DNA/β-actin (house-keeping control)

525 gene in the infected cells (pellet) were measured by qRT-PCR. The levels of BPXV

526 DNA, expressed as threshold cycle (Ct) values, were normalized with β-actin to

527 determine relative fold-change in copy number of viral DNA. Values are means ± SD

528 and representative of the result of at least 3 independent experiments.



https://doi.org/10.1101/2020.10.08.331124




https://doi.org/10.1101/2020.10.08.331124




https://doi.org/10.1101/2020.10.08.331124




https://doi.org/10.1101/2020.10.08.331124




https://doi.org/10.1101/2020.10.08.331124




https://doi.org/10.1101/2020.10.08.331124




https://doi.org/10.1101/2020.10.08.331124


Documents

Isolation and characterization of lumpy skin disease virus …...2020/10/08 · 3 48 India. For the first time, we employed primary goat kidney (PGK) cells for the 49 isolation of