Revised manuscript: M4:02424

A potential role of 15-deoxy-∆12,14-prostaglandin J2 for induction of human articular chondrocyte

apoptosis in arthritis

Zheng-Zheng Shan, Kayo Masuko-Hongo, Sheng-Ming Dai, Hiroshi Nakamura, Tomohiro Kato and

Kusuki Nishioka.

Department of Bioregulation, Institute of Medical Science, St Marianna University School of Medicine,

2-16-1 Sugao, Miyamae-ku, Kawasaki, Kanagawa 216-8512, Japan.

Corresponding Author: Kayo Masuko-Hongo, M.D., Ph.D., Department of Bioregulation, Institute of

Medical Science, St. Marianna University School of Medicine, 2-16-1 Sugao, Miyamae-ku, Kawasaki,

Kanagawa 216-8512 Japan Tel: 81-44-977-8111 (ext. 4209); Fax: 81-44-978-2036

E-mail: khongo@marianna-u.ac.jp

Running Title: Prostaglandin J2 induces chondrocyte apoptosis

The abbreviations used are: PGs, prostaglandins; 15d-PG J2, 15-deoxy-∆12,14-prostaglandin J2;

PPAR γ, peroxisome proliferator-activated receptor γ; IL-1β, interleukin 1β; TNF-α, tumor

necrosis factor-α; SNP, sodium nitroprusside; PGDS, PG D2 synthase; MAPK, mitogen-activated

protein kinase; MEK, mitogen-activated protein kinase/extracellular signal-regulated kinase;

ERK1/2, extracellular signal-regulated kinase; NF-κB, nuclear factor-κB; OA, osteoarthritis; RA,

rheumatoid arthritis

1

JBC Papers in Press. Published on June 22, 2004 as Manuscript M402424200

Copyright 2004 by The American Society for Biochemistry and Molecular Biology, Inc.

by guest on April 30, 2018

http://ww

w.jbc.org/

Dow

nloaded from

Summary

The cyclopentenone prostaglandin PG J2 is formed within the cyclopentenone ring of the

endogenous prostaglandin PG D2 by a non-enzymatic reaction. The PG J family is involved in mediating

various biological effects including the regulation of cell cycle progression and inflammatory responses.

Here we demonstrate the potential role of 15-deoxy-∆12,14-prostaglandin J2 (15d-PG J2) in human

articular chondrocyte apoptosis. 15d-PG J2 was released by human articular chondrocytes and found in

joint synovial fluids taken from osteoarthritis (OA) or rheumatoid arthritis (RA) patients.

Proinflammatory cytokines such as interleukin-1beta (IL-1β) and tumor necrosis factor-alpha (TNF-α)

upregulated chondrocyte release of 15d-PG J2. PG D2 synthase mRNA expression was upregulated by

IL-1β, TNF-α or nitric oxide. 15d-PG J2 induced apoptosis of chondrocytes from OA or RA patients as

well as control nonarthritic subjects, in a time- and dose-dependent manner, and in a peroxisome

proliferator-activated receptor (PPAR) γ-dependent manner. PPAR γ expression was upregulated by IL-

1β and TNF-α. Inhibition of NF-kappa B and the activation of p38 MAPK were also found to be

involved in 15d-PG J2-induced chondrocyte apoptosis. Such signal pathways led to the activation of the

downstream pro-apoptotic molecule p53 and caspase cascades. Together, these results suggest that 15d-

PGJ2 may play an important role in the pathogenesis of arthritic joint destruction via a regulation of

chondrocyte apoptosis.

Key words: Peroxisome proliferator-activated receptor, Interleukin-1 beta, Tumor necrosis factor-

alpha, Osteoarthritis, Rheumatoid arthritis, Signal transduction, Apoptosis

2

by guest on April 30, 2018

http://ww

w.jbc.org/

Dow

nloaded from

Introduction

An imbalance between destructive and reparative processes affecting components of the

extracellular matrix can result in destruction of articular cartilage. Because articular chondrocytes are the

only cells residing in cartilage tissue, matrix turnover is solely dependent on these cells and thus their

survival is essential for maintaining proper architecture of the articular cartilage.

In arthropathies such as osteoarthritis (OA) and rheumatoid arthritis (RA), hypocellularity and

matrix degeneration in cartilage are believed to contribute to joint degradation [1, 2]. In OA and RA

joints, chondrocytes showing characteristic features of apoptotic death, such as chromatin condensation,

nuclear fragmentation, cellular shrinkage and apoptotic body formation [3], have been observed.

Chondrocyte death by apoptosis may therefore be of pathogenic significance in the development of

arthritis [4, 5].

There are numerous mediators which potently induce apoptosis in chondrocyte cultures, although

the mechanisms involved are not yet fully elucidated. These mediators include Fas and its ligand FasL

[6,7], nitric oxide [8] and Bcl-2/Bax family members [9]. One member of the prostaglandins (PGs)

family, PG E2, was reported to induce bovine chondrocyte apoptosis [10], but whether such effects can be

identified for other members of the PGs family, for example, PG D2 or its metabolite, PG J2, is largely

unknown.

Cyclopentenone prostaglandins are important regulators of cellular function in a variety of tissues,

including bone and cartilage. PG D2 is a mediator of allergy and inflammation [11]. Its metabolite, PG J2

is formed within the PG D2 cyclopentenone ring by dehydration. PG J2 is metabolized further to yield

∆12-PG J2 and 15-deoxy-∆12,14 PG J2 (15d-PG J2). Members of the PG J series have been reported to

mediate various biological effects including inhibition of cell cycle progression, inhibition of cytokine

production in macrophages, and involvement in inflammatory responses[12]. In contrast to classical

prostaglandins, which bind to cell surface G protein coupled receptors, 15d-PG J2 is a natural ligand of a

3

by guest on April 30, 2018

http://ww

w.jbc.org/

Dow

nloaded from

nuclear receptor, the peroxisome proliferator-activated receptors (PPAR) γ. This receptor behaves as a

ligand-activated transcription factor through its DNA binding domain, which recognizes response

elements in the promoter of some target genes linked to apoptosis, cell proliferation and differentiation

and inflammation [13, 14]. Recent data have shown the presence of PPAR γ in rat cartilage and human

synovial tissues [15], and indicated that 15d-PG J2 is the most potent endogenous ligand for PPAR γ yet

discovered [16].

To date, ∆12-PG J2 has been detected in human plasma or serum [17]. However, little is known

about whether 15d-PG J2 can be released from human articular chondrocytes; and the significance of the

in vivo presence of 15d-PG J2 still remains controversial [18]. Accumulating evidence documents the

induction of apoptosis in various cells, especially in tumor cells, by 15d-PG J2; and this compound also

inhibits tumor growth [19]. Nevertheless, the effect of 15d-PG J2 on chondrocyte viability has not been

defined, although the implication of 15d-PG J2 in the pathogenesis of arthritis was demonstrated [20,

21].

Here we investigated the possible role of 15d-PG J2 in chondrocyte viability and apoptosis. 15d-

PG J2 was found to be secreted by human articular chondrocytes, and induced potent chondrocyte

apoptosis; this effect was PPAR γ-dependent. We also demonstrated that 15d-PG J2-induced

chondrocyte apoptosis is dependent on the inhibition of nuclear factor-κB (NF-κB) and activation of

mitogen-activated protein kinase (MAPK) pathway member p38 kinase.

Materials and Methods

Materials. 15-Deoxy-∆12,14-prostaglandin J2, ∆12-PG J2, PG J2, PG E2, ciglitazone, pioglitazone,

GW9662 and T0070907 were obtained from Cayman Chemical (Ann Arbor, MI, USA) and sodium

nitroprusside (SNP) from Sigma (St. Louis, MO, USA). Interleukin-1β (IL-1β), tumor necrosis factor-α

(TNF-α), transforming growth factor-β1 (TGF-β1) were obtained from Wako (Osaka, Japan). Z-Val-

4

by guest on April 30, 2018

http://ww

w.jbc.org/

Dow

nloaded from

Ala-Asp (OCH3)-fluoromethyl ketone (ZVAD-fmk) was purchased from R&D Systems (Minneapolis,

MN, USA). PD 98059 and SB 202190 were obtained from CALBIOCHEM (MERCK, Tokyo, Japan). All

other reagents were of analytical grade. The final concentration of organic solvent used to dilute 15d-PG

J2 or other reagents was not greater than 0.3%, which did not provoke any changes in cellular viability, as

demonstrated in a preliminary study (data not shown).

Samples. Articular cartilage specimens were obtained from 9 OA patients (73±8 yr; Male/Female: 6/3)

and 7 rheumatoid arthritis (RA) patients (55±13 yr; Male/Female: 3/4) who were undergoing joint

replacement surgery. Synovial fluids were obtained by regular therapeutic arthrocentesis in an outpatient

clinic from a different panel of OA and RA patients (n = 25 and 29, respectively). All patients met the

American College of Rheumatology criteria for OA [22] and RA diagnosis [23]. Arthritis-free human

cartilage was collected from 4 patients (65±2 yr; Male/Female: 3/1) with no history of arthritis who were

undergoing joint surgery after traumatic fracture. All samples were obtained with informed consent from

the patients, and the study protocol was approved by the institutional ethics committee.

Isolation and culture of chondrocytes. Cartilage slices were removed from the femoral heads or knee, and

washed with Dulbecco’s modified Eagle’s medium (DMEM). Tissues were then minced and transferred

to a digestion buffer containing DMEM, anti-yeast (GIBCO), and 0.1% collagenase (type IV). Tissue

was incubated on a shaker at 37°C until the fragments were digested. The cells were filtered through a

nylon mesh with a pore diameter of 70 µm, and washed by suspension and centrifugation in DMEM. The

pellet was resuspended in DMEM supplemented with 10% fetal calf serum (FCS), 50 U/ml penicillin and

50 µg/ml streptomycin. Cells were then seeded in 10-cm dishes at a density of 5~7×105/ml. The cells

were incubated at 37°C in a humidified atmosphere of 95% air and 5% CO2 and the medium was

changed once a week. The confluent cells were dispersed by trypsinization and then transferred to new

dishes in a split ratio of 1:2~1:4. Monolayer cultured chondrocytes of the first passage were used

throughout the experiments. The chondrocytes were starved in DMEM with 0.5% FCS for 24 hour prior

5

by guest on April 30, 2018

http://ww

w.jbc.org/

Dow

nloaded from

to each experiment.

15d-PG J2 Assay. The levels of immunoreactive 15d-PG J2 in cultured chondrocyte supernatants were

determined by the enzyme-linked immunosorbent assay (ELISA) method according to the

manufacturer’s instructions using commercially available kits purchased from R&D Systems

(Minneapolis, MN, USA). The minimum detectable concentration of 15d-PG J2 in this assay is typically

less than 36.8 pg/ml. Cross-reactivity was only detectable for PG J2 (49.2%), ∆2-PG J2 (5.99%) or PG

D2 (4.92%), but was less than 0.01% for other PGs according to the manufacturer’s information.

Heparin (0.3 mg/ml) was added as an anticoagulant to the synovial fluid taken from 25 OA or 29 RA

patients. The synovial fluids were then centrifuged for 10 min at 1000×g to remove particulates. The

samples were extracted through a C18 reverse phase column, then washed with 15% ethanol and

deionized water, eluted from the column by ethyl acetate. The organic solvent was then evaporated under

a stream of nitrogen. Samples were reconstituted and ELISA performed according to the manufacturer’s

instructions.

Determination of Apoptosis.

(1) Nuclear morphology. The harvested primary passage chondrocytes were seeded into 8-well chamber

slides (300 µl of cell suspension/well). When confluent, nuclear morphology was assessed by labeling

stimulated or unstimulated adherent cells or 30 min at 37°C with 1 µM Hoechst 33342 (Sigma Chemical

Co. Ann Arbor, MI, USA). Cultures were then washed three times with PBS and examined by

fluorescence microscopy.

(2) Cell Viability Assay. The chondrocytes were seeded into 6-well microplates at a density of 1×105

cells per well. After serum starvation for 24 hours, they were treated with the indicated effectors.

Untreated cells served as controls. After medium was transferred to a 15-ml conical tube, the adherent

chondrocytes were removed by trypsin/EDTA treatment and transferred to the tube containing culture

medium. Cells, debris, and apoptotic bodies were pelleted by centrifugation and then washed once with

6

by guest on April 30, 2018

http://ww

w.jbc.org/

Dow

nloaded from

PBS. The washed pellet was subsequently labeled with Guava ViaCount Reagent (Guava, Hayward, CA,

USA). Viable, apoptotic and dead cell populations were analyzed using a small desktop Guava personal

cytometer with ViaCount and Express software (Guava, Hayward, CA, USA). The system counts the

stained nucleated events, then uses the forward scatter (FSC) properties to distinguish free nuclei and

cellular debris from cells to determine an accurate cell count[24]. The collected chondrocytes were also

labeled with 0.5 µg/ml annexin V-FITC (Wako, Osaka, Japan) and 2 µg/ml propidium iodide (Sigma

Chemical Co., Ann Arbor, MI, USA) to document early stages of chondrocyte apoptosis. The FITC signal

of annexin V was detected at 518 nm by FL1 (FITC detector), and propidium iodide fluorescence was

detected at 620 nm by FL2 (phycoerythrin fluorescence detector).

RT-PCR and real-time PCR analysis. Total cellular RNA was extracted from confluent chondrocytes by

a single-step guanidinium thiocyanate-phenol-chlorform method using ISOGEN (Nippon Gene,

Toyama, Japan). RNA was recovered in diethyl cyanophosphonated (DEPC) water and quantified by

spectrophotometry at 260 nm and 280 nm. For reverse transcriptase-polymerase chain reaction (RT-

PCR), RNA samples were reverse-transcribed to cDNA using reverse transcriptase (Invitrogen

Corporation, New York, NY) and random hexamers (TaKaRa Biomedicals, Osaka, Japan). The primer

sequences as well as the number of cycles are shown in Table 1. The PCR conditions were as follows:

initial denaturation at 94 °Cfor 5 min, 30~35 cycles of amplification (1 min at 94 °C, 1 min at 60 °C and 1

min at 72 °C) in an automated thermal cycler (TaKaRa Biomedicals, Osaka, Japan), followed by a final

extension step of 5 min at 72 °C. The PCR products were separated on 1% agarose gels and photographed

under ultraviolet excitation after ethidium bromide staining. PPAR γ and p53 mRNA expression levels

were also determined by quantitative real-time RT-PCR using fluorescence labeled (Light Cycler-Fast

Start DNA Master SYBR Green I, Roche Molecular Biochemicals) primers and LightCycler software

(Roche Molecular Biochemicals). Normalized gene expression was calculated as the ratio between PPAR

γ or p53 and GAPDH copy number.

7

by guest on April 30, 2018

http://ww

w.jbc.org/

Dow

nloaded from

Immunocytochemistry. Immunochemical staining was performed according to the manufacturer’s

protocol (ABC staining system, Santa Cruz, CA). Chondrocytes were cultured at a density of 5x104 cells

per well in 4-well chamber slides. Subconfluent chondrocytes were fixed with 10% methanol. The cells

were incubated with primary goat polyclonal antibody to PG D2 synthase (PGDS) or PPAR γ (Santa Cruz

Biotechnology, CA) at 4°C overnight. The cell-bound antibody complexes were then visualized by

development in a substrate solution containing 3, 3’ diaminobenzidine (DAB) to yield a red-brown

reaction product. A dilution of normal goat serum containing the same concentrations of nonspecific

immunoglobulin G as primary antibody served as a negative control.

Western blotting analysis. Whole cell lysates were prepared from 1.5×106 chondrocytes stimulated with

the indicated effectors. The trypsinized adherent cells were pelleted by centrifugation and lysed with 0.1

ml of ice-cold lysis buffer containing 20 mM Tris-HCl, pH7.4, 250mM NaCl, 1% Nonidet P-40, and

0.1% SDS, supplemented with protease inhibitors and phosphatase inhibitors (10 mM NaF and 2 mM

Na3VO4). The lysates were transferred to Eppendorf tubes, and the protein concentration was determined by

Bradford assay. Similar amounts of protein were size-fractionated by 10% SDS-polyacrylamide gel

electrophoresis and transferred to polyvinylidene difluoride (PVDF) membranes. After blocking with 5%

skim milk in phosphate buffered saline (PBS)/0.1% Tween-20, the protein expression was determined

using specific antibodies purchased from the following sources: goat anti-phospho-ERK1/2, rabbit anti-

ERK1/2, rabbit anti-phospho-p38 and rabbit anti-p38 (Cell signaling Technology). The blots were

developed using a horseradish peroxidase-conjugated secondary antibody and an enhanced

chemiluminescent (ECL) system (Amersham Pharmacia Biotech, Piscataway, NJ).

Caspase-3 and NF-κB activity assay. Caspase-3 activity was assayed on whole cell lysates by

commercially available kit (Roche Molecular Biochemicals) according to the manufacturer’s protocols.

Briefly, after treatment of cells (1~2×106 cells in a 10-cm dish) with or without the indicated stimulation,

8

by guest on April 30, 2018

http://ww

w.jbc.org/

Dow

nloaded from

the adherent chondrocytes were harvested by trypsinization and lysed for 1 min on ice in 200 µl of lysis

buffer containing 10 mM dithiothreitol. The lysates were pooled and centrifuged, and the supernatant was

used to determine caspase-3 activity. The fluorescence intensity was measured with an excitation filter

420 nm and emission filter 535 nm. The whole cell lysates were also used for NF-κB p65 activity

determination using a commercially available kit (PIERCE Biotechnology, Rockford, IL, USA). Briefly,

the 96-well plate was coated with the bound NF-κB biotinylated-consensus sequence so that only the

active form of NF-κB will bind to the DNA sequence. Whole cell lysates were added to the plates and

incubated with the specific primary antibody (NF-κB p65) followed by the secondary antibody, and the

resulting signal was then captured by chemiluminescent detection.

Statistical analysis. For all results shown, at least three separate experiments with cells from different

donors were performed. Within experiments each individual measurement was performed in duplicate.

Except where specifically mentioned, one-way analysis of variance (AVOVA) was used to analyze the

differences between different groups for the production of 15d-PG J2 and the percentage of apoptosis.

The data on 15d-PG J2 concentrations in synovial fluids are nonparametric. Therefore, the Mann-

Whitney U test was used to compare the difference between OA and RA patients. p<0.05 was considered

significant.

Results

Production of 15d-PG J2 by chondrocytes and concentrations in synovial fluid. We first investigated

whether cultured human articular chondrocytes produce 15d-PG J2 in vitro. As shown in Fig. 1, both OA

and RA chondrocytes in the resting state released 15d-PG J2, as assayed by ELISA (OA: 221±14 pg/ml;

RA: 297±51 pg/ml). However, levels were lower than in normal chondrocyte cultures (579±49 pg/ml).

Stimulation with IL-1β (10 ng/ml) and SNP (2mM) led to a significantly increased production of 15d-

PG J2 in OA, RA and normal chondrocytes. We also found that 1 µM of PG E2 slightly but significantly

enhanced 15d-PG J2 production levels. TNF-α (25 ng/ml) did not significantly augment 15d-PG J2

9

by guest on April 30, 2018

http://ww

w.jbc.org/

Dow

nloaded from

production. On the other hand, 15d-PG J2 levels were significantly decreased by TGF β1 (10 ng/ml). In

particular, 15d-PG J2 levels in OA chondrocytes after TGF β1 treatment were below the levels of

detection (Fig. 1A).

15d-PG J2 was detectable by ELISA in synovial fluids of 25 OA and 29 RA patients whereby one of

the former had a much higher 15d-PG J2 concentration than any of the others. On the whole, however,

15d-PG J2 concentrations in synovial fluids were at picogram per ml levels, and no obvious difference

between OA and RA patients was observed (Fig. 1B).

PGD2 synthase expression and its regulation by proinflammatory cytokines. PG D2 is naturally and

rapidly converted into PG J2 by nonenzymatic pathways, and PG J2 itself is rapidly metabolized to ∆12-

PG J2 and 15d-PG J2 after elimination of one or two water molecules. Therefore, we assessed PGDS

expression as a measure of PG J2-synthesizing enzyme. The expression, at the RNA level, of two

subtypes of synthases, brain- and hematopoietic-PGDS, was evaluated using specific primers. Brain

PGDS mRNA was constitutively expressed in OA chondrocytes, at a level not influenced by

proinflammatory cytokine stimulation. In contrast, the proinflammatory cytokines IL-1β and TNF-α up-

regulated hematopoietic PGDS mRNA expression. 1 mM SNP treatment also induced increased levels of

hematopoietic PGDS mRNA in OA chondrocytes. Peak induction occurred 48 hours after stimulation

(Fig. 2A and B).

To confirm the expression and localization of PGDS in human articular chondrocytes,

immunohistochemistry was performed using polycolonal anti-PGDS antibody. We found markedly

enhanced expression of PGDS in OA chondrocytes stimulated with IL-1β (10 ng/ml, 48-hour

stimulation) or TNF-α (25 ng/ml, 48-hour stimulation). PGDS in OA chondrocytes was mainly localized

to the nucleus and cytoplasmic region (Fig. 2 D, E). OA chondrocytes treated with SNP (1 mM, 48-hour

stimulation) also upregulated PGDS, but the shape of the cells after treatment was irregular and PGDS

immunoreactivity appeared to be completely localized to the nucleus (Fig. 2F).

10

by guest on April 30, 2018

http://ww

w.jbc.org/

Dow

nloaded from

These data provide evidence that human chondrocytes are potent producers of PG J2 series molecules

upon activation of PGDS by inflammatory stimuli.

Prostaglandins of the J Series Induce Chondrocyte Apoptosis. Next we evaluated the potency of the PG J

series to induce chondrocyte apoptosis. First, the characteristic nuclear morphological changes, such as

nuclear condensation, cell shrinkage, appearance of small membrane-bound bodies (apoptotic bodies)

were observed by Hoechst staining (Fig. 3A). This suggests apoptotic nuclear changes of chondrocytes

after stimulation with PG J series molecules. Cytometry analyses were performed to quantify apoptosis

induced by 15d-PG J2, an end-product of the PG J series. OA chondrocyte apoptosis was first

demonstrated by Annexin V/PI staining. The inversion of phosphatidylserine from the inner to the outer

plasma membrane occurs early in the apoptotic program and is often used as a specific marker of cells

undergoing apoptosis. Flow cytometry analyses of FITC-conjugated annexin V binding to OA

chondrocytes are shown in Fig 3B. Chondrocytes were counter-stained with propidium iodide (PI) to

distinguish between viable cells (annexin V-/PI-, lower left quadrant of the histograms), early apoptotic

(annexin V+/PI-, lower right quadrant of the histograms) and late apoptotic or necrotic cells (annexin

V+/PI+, upper right quadrant of the histograms). Early (annexin V+/PI-) and late apoptotic (annexin V+/PI+)

chondrocytes constituted a much higher percentage of the total gated cells after stimulation with 10 µM

15d-PG J2, compared with unstimulated chondrocytes. The total apoptotic cell number counted by

Guava staining was in accordance with annexin V/PI staining (Fig 3B, C).

As summarized in Fig. 4, 15d-PG J2 induced chondrocyte apoptosis in a dose-dependent manner at

concentrations of 0~10 µM in RA, OA and normal samples (Fig. 4A), and in a time-dependent manner in

OA chondrocytes (Fig. 4B). The magnitude of apoptosis induction by 15d-PG J2 was similar in RA and

OA chondrocytes. The arthritic chondrocyte apoptosis was further documented by significantly increased

caspase-3 activity after stimulation with 15d-PG J2 (Fig 7E). Furthermore, the effects of PG E2, SNP

and several proinflammatory cytokines on cell viability were compared with the effect of 15d-PG J2.

Added as an exogenous donor of nitric oxide (NO), 2mM SNP exerted a potent apoptotic effect. 1µM PG

E2 also induced chondrocyte apoptosis. However, no significant apoptotic effect of IL-1β (10 ng/ml),

11

by guest on April 30, 2018

http://ww

w.jbc.org/

Dow

nloaded from

TNF-α (25 ng/ml) or TGF-β1 (20 ng/ml) on chondrocytes was observed (Fig 4C). We next explored

whether a low dose of 15d-PG J2 (0.1 µM) could enhance NO-induced chondrocyte apoptosis. Neither

0.1 µM 15d-PG J2 nor 0.2 mM SNP alone could induce chondrocyte apoptosis. Nevertheless, a

synergistic effect was obtained in OA chondrocytes following combined 15d-PG J2 and SNP treatment

(Fig 4D).

Induction of OA chondrocyte apoptosis by PPAR γ ligands. The above data clearly demonstrated a

proapoptotic effect of 15d-PG J2. Because 15d-PG J2 is a known ligand of PPAR γ, we hypothesized

that 15d-PG J2-induced apoptosis might depend on the PPAR γ pathway. To investigate whether

apoptosis is induced by PPAR γ activation, we tested three different classes of PPAR γ agonists, 15d-PG

J2, ciglitazone and pioglitazone; and the PPAR γ antagonists GW9662 and T0070907, for their capacity

to induce or alter chondrocyte apoptosis. The two synthetic compounds ciglitazone and pioglitazone did

induce OA chondrocyte apoptosis, but were not as potent as 15d-PG J2 (Fig 5A). Although apoptosis

could still be observed when a much higher concentration of 15d-PG J2 (50 µM) was added to the cell

cultures, a large amount of dead cells was present (unpublished data). This implies a cytotoxic effect at

this high dose of 15d-PG J2. Here we show that pretreatment of OA chondrocytes with the PPAR γ

antagonists T0070907 (1 µM) decreased chondrocyte apoptosis by almost 50% (Fig 5B). Moreover, 15d-

PG J2-induced chondrocyte apoptosis was almost completely prevented by GW9662 (Fig 5C), another

PPAR γ antagonist which is more potent than any of the other antagonists, according to the manufacturer.

Taken together, these data suggested that activation of PPAR γ is involved in chondrocyte apoptosis, and

that PPAR γ might mediate the apoptotic effect induced by 15d-PG J2.

PPAR γ expression in human chondrocytes. First, immunocytochemistry using the polyclonal anti-human

PPAR γ antibody was performed to evaluate the constitutive expression of PPAR γ in human

chondrocytes. Fig. 6A shows the nuclear localization of PPAR γ in OA chondrocytes, while the negative

controls treated with non-immune serum showed no positive reaction. Effects of the proinflammatory

12

by guest on April 30, 2018

http://ww

w.jbc.org/

Dow

nloaded from

cytokines IL-1β and TNF-α on PPAR γ mRNA expression were next investigated. Both IL-1β and

TNF-α stimulation up-regulated the expression of PPAR γ. Induction appeared after 1 hour, peaked at 6

hours, and thereafter decreased with time (Fig. 6B, C). 15d-PG J2 stimulation also increased PPAR γ

expression level. The peak fold-increase occurred at 6 hours, and lasted until 12 hours after stimulation

(Fig 6D).

Evaluation of the signaling pathway involved in 15d-PG J2-induced apoptosis. NF-κB is a transcription

factor interfering with the induction of apoptosis [25, 26]. To determine the involvement of NF-κB in

15d-PG J2-induced chondrocyte apoptosis, three approaches were used in the present study. First, we

assayed the active form of NF-κB p65 in OA chondrocytes stimulated with 15d-PG J2 for different

periods of time. Significantly decreased NF-κB p65 activity was found after treatment with 10 µM 15d-

PG J2. Inhibition became noticeable 1 hour after treatment and lasted up to 6 hours, after which p65

activity began to be restored, as compared with the control group (Fig 7A). Second, we measured the

effect of NF-κB pathway inhibitors on 15d-PG J2-induced chondrocyte apoptosis. Bay11-7085, which

specifically inhibits IκB-α phosphorylation and degradation from NF-κB complex, significantly

enhanced the apoptotic effects induced by 10 µM 15d-PG J2 (Fig 9A). Third, western blot analysis was

used as a reliable readout of NF-κB pathway proteins. As shown in Fig. 7B, 15d-PG J2 downregulated

the level of phosphorylated IκB-α protein whereas it had no significant effect on the level of NF-κB in

OA chondrocytes. These data show that inhibition of NF-κB activity is involved in chondrocyte

apoptosis induced by 15d-PG J2.

We further studied the effects of 15d-PG J2 on MAPK activation pathways by focusing on

extracellular signal-regulated kinase (ERK) and p38 kinase, the two key kinases involved in cellular

apoptosis [27]. Changes in the activities of ERK1/2 and p38 kinase were assessed by Western blot

analysis. Interestingly, 15d-PG J2 was found to differentially regulate the activities of the two subtypes

of MAPK. p38 kinase activity was transiently increased, whereas ERK1/2 was inhibited following

stimulation with 15d-PG J2, as determined by the phosphorylation status of the proteins. Levels of

13

by guest on April 30, 2018

http://ww

w.jbc.org/

Dow

nloaded from

phosphorylated-p38 kinase protein expression began to increase at 30 min, reached peak levels at 6 hours

and were maintained up to 12 hours after stimulation. Phosphorylated ERK1/2 protein expression began

to decrease from 6 hours after 15d-PG J2 stimulation, and remained depressed for 24 hours (Fig 7B).

Confluent OA chondrocytes were then challenged with MAPK inhibitors to evaluate which kinases are

involved in the chondrocyte apoptosis induced by 15d-PG J2. OA chondrocytes were preincubated for 1

hour with PD98059 (25 µM), a specific inhibitor of mitogen-activated protein kinase/extracellular

signal-regulated kinase (MEK). Thereafter, the cells were challenged with 10 µM of 15d-PG J2 for 48

hours. PD98059 was found to enhance apoptosis induced by 15d-PG J2, whereas 10 µM of SB202190, a

specific p38 MAPK inhibitor, significantly counteracted the apoptotic effect induced by 15d-PG J2 (Fig

9B).

To further elucidate the mechanism of 15d-PG J2-induced OA chondrocyte apoptosis, RT-PCR and

quantitative real-time PCR analyses were performed to quantify the transcriptional expression of p53, a

signaling molecule which is downstream of MAPK [27]. p53 mRNA expression began to increase 30

minutes after 15d-PG J2 stimulation and was maintained up to 6 hours after treatment (Fig 7C). Western

blotting analysis showed that p53 protein expression level began to increase from 30 min after 15d-PG J2

stimulation and persisted up to 12 hours (Fig 7B). Significantly decreased p53 expression was found

following the chemical inhibition of p38 MAPK, while no such effect was obtained after ERK1/2

inhibition (Fig 8), suggesting that only p38 MAPK contributed to the activation of the downstream

molecule p53. We also examined caspase-3 activity, an important pro-apoptotic protease that was

reported to be downstream of p53 [27]. Compared with the control group, caspase-3 activity was

significantly increased when 10 µM of 15d-PG J2 was added to both RA and OA chondrocyte cultures

(Fig 7E). The observation that chondrocyte apoptosis was almost completely abrogated by the general

caspase inhibitor ZVAD-fmk further demonstrated that 15d-PG J2-induced chondrocyte apoptosis is

caspase-dependent (Fig 9C).

Discussion

14

by guest on April 30, 2018

http://ww

w.jbc.org/

Dow

nloaded from

Our present study is the first to report the in vitro- and in vivo-production of 15d-PG J2 by human

articular chondrocytes, and that 15d-PG J2 potently induces apoptotic death in these cells, thus

suggesting an important contribution of this eicosanoid to the pathogenesis and/or pathophysiology of

arthritis in humans.

Prostaglandins are derived from fatty acids. The main sources of prostaglandins are arachidonates,

which are released from membrane phospholipids by the action of phospholipases. Arachidonic acid is

first converted to the unstable endoperoxide intermediate PG H2 by cyclooxygenases and subsequently

converted to related products, including PG D2, PG E2, PG F2, PG I2 and thromboxane A2, by the action

of specific PG synthases. PG D2 is short-lived and is rapidly metabolized in vivo through different

pathways including conversion to PG J series molecules. The apparent half-life of PG D2 in the blood

has been reported to be 1.5 min [28]. 15d-PG J2 is abundantly produced by mast cells, platelets and

macrophages and has been proposed as a key immunoregulatory lipid mediator [29]. Recently Shibata et

al.[30] reported the endogenous production of 15d-PG J2 in human atherosclerotic lesions and

hypothesized that this compound is involved in atherosclerotic inflammation. In the present study, we

clarified the ability of human articular chondrocytes to produce 15d-PG J2, a regulatory lipid involved in

inflammatory responses. We found that both two types of PGDS, an enzyme that regulates PG J2

synthesis, are expressed in OA chondrocytes (Fig. 2). Increased levels of mRNA following stimulation

with IL-1β or TNF-α were observed only for hematopoietic-PGDS, which was originally recognized as

a splenic enzyme expressed by antigen-presenting dendritic cells as well as in mast cells [31]. On the

other hand, mRNA for brain-PGDS, which is reported to be involved in the regulation of sleep and pain

responses [32], was not altered after cytokine stimulation. These data suggest that hematopoietic PGDS is

enhanced in the inflammatory milieu of joint diseases, whereas the brain-type PGDS is not induced. The

expression of PGDS was also documented by immunocytochemistry, which demonstrated the localization

of PGDS in cartilage. Because PGDS is abundant in arthritic chondrocytes, especially when challenged

with inflammatory cytokines, it is likely that the cyclopentenone-type PG D2 metabolites are locally

15

by guest on April 30, 2018

http://ww

w.jbc.org/

Dow

nloaded from

produced, may reach functionally significant levels during inflammation, and may play a role in cartilage

destruction. The finding that significant amounts of 15d-PG J2 accumulated in the culture medium of

human arthritic chondrocytes when challenged with an inflammatory stimulus (Fig. 1A), suggests a

potential autocrine action of 15d-PG J2, which might be involved in chondrocyte destruction. In this

regard, recent data suggest that 15d-PG J2 is a key regulator of negative feedback in the arachidonate

cascade of the cyclooxygenese (COX) pathway [33]. Our study also showed that another prostaglandin

analogue, PG E2, enhanced the release of 15d-PG J2 by chondrocytes (Fig. 1A), suggesting interactions

between different members of the PG family. These findings may provide new insights into the feedback

mechanism of the arachidonate cascade and the regulatory role of 15d-PG J2 in inflammatory responses.

Thus far, controversy still remains regarding the role of 15d-PG J2 in inflammatory responses [21,

34]. Moreover, the in vivo significance of endogenous 15d-PG J2 has even been questioned [18], because

of the technical difficulties in determining its in vivo levels. However, our present study demonstrated the

presence of 15d-PG J2 in arthritic synovial fluids, though at picomolar levels, using a recently-

developed ELISA assay (Fig. 1B). Hence, technical improvements to the experimental system, especially

regarding sensitivity, will help our better understanding of the role of the cyclopentenone prostaglandins

in vivo. In addition, it should be noted that arachidonate metabolism is greatly increased under several

pathogenic conditions, including hyperthermia and inflammation, and local PG concentrations in the

micromolar range have been detected at the sites of the acute inflammation [30]. Systemic or local

administration of non-steroidal anti-inflammatory drugs may prevent PG secretion in patients. In

particular, it is very important that articular chondrocytes secrete PG J2 in an autocrine fashion, because

these cells are embedded in the extracellular matrix, which prevents them from having contact with pro-

apoptotic stimuli in synovial fluids or synovial tissues. Thus, autocrine release of PG J2 might play a

pivotal role in inducing chondrocyte apoptosis.

It has been proposed that 15d-PG J2 might act as a "dual agent" regulating COX-2 expression in

human chondrocytes [35]. It is therefore possible that 15d-PG J2 might have diverse effects on

16

by guest on April 30, 2018

http://ww

w.jbc.org/

Dow

nloaded from

chondrocyte metabolism, depending on the different cellular circumstances. Thus, the role of 15d-PG J2

in the regulation of cartilage metabolism is complex and remains under intense investigation. Our present

study demonstrated the pro-apoptotic effect of 15d-PG J2 in articular chondrocytes, suggesting a

catabolic role of 15d-PG J2 in the cartilage. The potency of apoptosis induction by 15d-PG J2 is

consistent with reports on various cell lines, such as human hepatic myofibroblasts[36], vascular

endothelial cells[16] and synoviocytes[21]. However, it has been claimed that the in vitro dose used in

these experiments is far higher than the levels of 15d-PG J2 detectable in vivo. In this context, we

demonstrated that a low dose of 15d-PG J2 cooperated with low dose SNP treatment to enhance the

apoptotic effect (Fig. 4D). Specifically, in a comparative study, neither IL-1β nor TNF-α alone could

induce chondrocyte apoptosis. Instead, these cytokines induced the release of 15d-PG J2 by the

chondrocytes. However, the amount of 15d-PG J2 secretion was unlikely to have been high enough to

induce chondrocyte apoptosis by itself. Similarly, levels of 15d-PG J2 in synovial fluid were insufficient

for apoptosis induction. Nevertheless, 15d-PG J2 was shown to cooperate with other proinflammatory

factors such as NO, which together would be able to mediate enhanced apoptotic effects. In addition, we

confirmed that not only 15d-PG J2 but also PG J2 and ∆12-PG J2 show pro-apoptotic effects (data not

shown), implying that the concomitant presence of these factors might mutually enhance their catabolic

effects. These results collectively emphasize that there could be a hitherto unrecognized role of 15d-PG

J2 and other cyclopentenones in cartilage degradation in arthropathies such as OA and RA, despite their

very low levels thus far detected.

Of the naturally occurring PPAR γ agonists, 15d-PG J2 is among the most potent for both

transactivating PPAR γ [13, 37] and inducing apoptosis [38]. We therefore sought to determine whether

15d-PG J2 exerted its effects via activation of PPAR γ. Constitutive expression of PPAR γ in human

articular chondrocytes was documented here (Fig. 6A) and has also been reported by others [21].

Furthermore, we showed that the PPAR γ mRNA expression level was up-regulated by the

proinflammatory cytokines IL-1β or TNF-α (Fig. 6B, C). Our present study provided evidence that the

17

by guest on April 30, 2018

http://ww

w.jbc.org/

Dow

nloaded from

transcriptional activation of PPAR γ is a critical event in 15d-PG J2-induced chondrocyte apoptosis (Fig.

5). Specifically, the two synthetic PPAR γ agonists ciglitazone and pioglitazone both induced

chondrocyte apoptosis, although the effects of these two compounds were not as potent as 15d-PG J2. On

the other hand, 15d-PG J2-induced chondrocyte apoptosis was abrogated by the PPAR γ antagonist

GW9662 or T0070907. These data provided pharmacological evidence that PPAR γ is critical for

chondrocyte apoptosis. In this regard, however, controversy still exists as to the molecular mechanisms of

15d-PG J2 activity. It can also exert effects that are independent of PPAR γ, for example, induction of

formation of reactive oxygen species that lead to cell death [39]. For this reason, pharmacological

activation of PPAR γ by highly selective synthetic compounds did not completely reproduce the potency

of 15d-PG J2. Thus, there might be different mechanisms, some involving PPAR γ and some

independent of it, by which 15d-PG J2 induces chondrocyte apoptosis.

Mounting evidence indicates that NF-κB regulates apoptosis, in most cases exerting a protective

effect [40, 41]. However, it was also reported that NF-κB had pro-apoptotic function, depending on cell

type and extracellular stimuli [42]. Therefore, we evaluated the role of NF-κB in 15d-PG J2-induced

chondrocyte apoptosis. The findings of decreased NF-κB p65 activity (Fig 7A, B) and enhanced

apoptotic effects after NF-κB inhibition (Fig 9A) strongly support the role of NF-κB activation in

rescuing chondrocytes from apoptosis.

MAPK pathways play a key role in a variety of cellular responses, such as cell proliferation,

differentiation, and cell death [43, 44], including NO-induced chondrocyte apoptosis [27]. In the present

study, we established that 15d-PG J2 treatment activated the MAPK pathway in chondrocytes. However,

two subtypes of MAPK, i.e. ERK1/2 and p38, showed divergent responses (Fig 7B). Specifically, the

activation of p38 kinase appeared to play a predominant role in apoptosis induction, whereas ERK1/2

acted rather to inhibit apoptosis (Fig. 9B). Such opposing regulatory effects are in accordance with reports

by Kim et al.[27] and Shakibaei et al. [45]. In fact, previous reports indicated that ERK1/2 activation was

mainly involved in cellular dedifferentiation and phenotype maintenance, rather than inducing cellular

18

by guest on April 30, 2018

http://ww

w.jbc.org/

Dow

nloaded from

apoptosis [45, 46]. To further elucidate the precise mechanism involved in 15d-PG J2-induced

chondrocyte apoptosis, we focused on the expression of the pro-apoptotic molecules p53, and caspase-3,

which was reported to be downstream of p53 [27, 47]. Increased p53 expression levels and caspase-3

activity were found in our present study (Fig 7B-E); also caspase inhibitor completely blocked the

increased caspase-3 activity (Fig. 9C). The effect of MAPK inhibition on p53 expression confirmed the

interrelationship of MAPK and p53. In our study, p38 kinase contributed to activation of the downstream

p53, while ERK1/2 seemed not to have such an effect (Fig 8). Kim et al. [27] previously reported that

increased p53 expression was accompanied by ERK1/2 inhibition in rabbit chondrocytes after stimulation

with SNP, so use of different cell types or stimuli might account for the different regulatory effects

observed. The above results collectively suggest that 15d-PG J2-induced chondrocyte apoptosis is

accomplished via a p53 and caspase-3-dependent pathway, as depicted in Figure 10.

In conclusion, our present study demonstrated the ability of human articular chondrocytes to

produce PG J2 in an autocrine fashion, and a potential role of 15d-PG J2 in the induction of chondrocyte

apoptosis. Because this implies an involvement of chondrocyte apoptosis in the pathogenesis of arthritis,

pathways affected by prostaglandin analogues may be an important focus of investigation to establish

novel therapeutic strategies for preventing cartilage degradation in joint diseases, in the pathogenesis of

which the COX/PG system is closely involved.

19

by guest on April 30, 2018

http://ww

w.jbc.org/

Dow

nloaded from

Acknowledgments

The authors gratefully acknowledge Ms. Toshiko Mogi, Ms. Hiroe Ogasawara for their excellent

technical assistance. We thank Dr. Atsuyuki Shibakawa and Prof. Haruhito Aoki, Department of

Orthopedic Surgery, St. Marianna University School of Medicine, for providing clinical samples.

This study was partly supported by grants-in-aids from the Ministry of Health, Labour and Welfare

of Japan and the Japan Rheumatism Foundation.

20

by guest on April 30, 2018

http://ww

w.jbc.org/

Dow

nloaded from

References

1. Hashimoto, S., Ochs, R.L., and Koniya, S. (1998) Arthritis Rheum. 41,1632-1638

2. Choy, E.H., and Panayi, G.S., (2001) N Engl J Med. 344, 907-916

3. Green, D.R. (2003) Immunological Rev. 193, 5-9

4. Blanco, F.J., Guitian, R., Vazquez-Martul, E., de Toro, F.J. and Galdo, P. (1998) Arthritis Rheum

41, 284-289

5. Kim, H.A., and Song, Y.W. (1999) Arthritis Rheum. 42, 1528-1537

6. Lotz. M., Hashimoto, S. and Kuhn, K. (1999) Osteoarthritis Cart. 7, 389-391

7. Hashimoto, H., Tanaka, M. Suda, T., Tomita, T., Hayashida, K., Takeuchi, E. et al. (1998) Arthritis

Rheum 41, 57-62

8. Blanco, F.J., Ochs, F.L., Schwarz, H. and Lotz, M. (1995) Am J Pathol. 146, 75-85.

9. Feng, L., Precht, P., Balakir, R., Horton, W.E. Jr. (1998) J Cell Biochem. 71, 302-309.

10. Miwa, M., Saura, R., Hirata, S., Hayashi, Y., Mizuno, K. and Itoh, H. (2000) Osteoarthritis Cart 8,

17-24.

11.Matsuoka, T., Hirata, M. and Tanaka, H. (2000) Science. 287, 2013-2017

12. Cuzzocrea, S., Wayman, N.S., Mazzon, E., Dugo, L., Paola, R.D. Serraino, I. et al. (2002) Mol

Pharmacol. 61, 997-1007.

13. Kliewer, S,A., Lenhard, J.M. and Willson, T.M. (1995) Cell 83, 813-819.

14. Tugwood, J.D. and Montague, C.T. (2002) Hum Exp Toxicol. 21, 429-437.

15. Bordji, K., Grillasca, J.P., Gouze, J.N., Magdalou, J., Schohn, H. Keller, J.M. et al. (2000) J Biol

Chem 275, 12243-12250.

16. Bishop-Bailey, D. and Hla, T. (1999) J Biol Chem 274, 17042-17048.

17. Fukushima, M., Sasaki, H. and Fukushima, S. (1994) Ann N Y Acad Sci. 744, 161-165.

18. Bell-Parikh, L.C., Ide, T. and Lawson, J.A. (2003) J Clin. Invest. 112, 945-955.

19. Hashimoto, K., Ethridge, R.T. and Evers, B.M. (2002) Int J Gastrointest Cancer 32, 7-22.

20. Fahmi, H., Di Battista, J.A., Pelletier, J.P., Mineau, F., Ranger, P. and Martel-Pelletier, J. (2001)

21

by guest on April 30, 2018

http://ww

w.jbc.org/

Dow

nloaded from

Arthritis Rheum 44, 595-607.

21. Kawahito, Y., Kondo, M., Tsubouchi, Y. et al. (2000) J Clin Invest. 106, 189-197.

22. Altman, R., Asch, E., Bloch, D., Bole, G., Borenstein, D., Brandt, K., et al. (1986) Arthritis Rheum

29, 1039–1049.

23. Arnett, F.C., Edworthy, S.M., Bloch, D.A., McShane, D.J., Fries, J.F., Cooper, N.S. et al. (1988)

Arthritis Rheum 31, 315-324.

24. Phi-Wilson, J., Harvey, J. and O’Neill, R. (2001) Am Biotechnol. Lab. May: 34-36.

25.Ward, C., Chilvers, E.R., Lawson, M.F., Pryde, J.G., Fujihara, S. and Farrow, S.N. et al. (1999) J Biol

Chem. 274, 4309-4318.

26.Van Antwerp, D.J., Martin, S.J., Kafri, T., Green, D.R. and Verma, I.M. (1996) Science 274, 787-789.

27.Kim, S.J., Ju, J.W., Oh, C.D., Yoon, Y.M., Song, W.K. Kim, J.H. et al. (2002) J Biol Chem. 277,

1332-1339.

28.Heinemann, A., Schuligoi, R., Sabroe, I., Hartnell, A. and Peskar, B.A. (2003) J Immunol. 170, 4752-

4758.

29. Ito, S., Narumiya, S. and Hayaishi, O. (1989) Prostaglandins Leukotrienes Essent. Fatty Acids. 37,

219-234.

30.Shibata, T., Kondo, M., Osawa, T., Shibata, N., Kobayashi, M. and Uchida, K. (2002) J Biol Chem.

277, 10459-10466.

31. Murakami, Y., Akahoshi, T., Hayashi, I., Endo, H., Hashimoto, A., Kono, S. et al. (2003) Arthritis

Rheum. 48, 2931-2941.

32.Urade, Y. and Hayaishi, O. (2000) Biochim Biophys Acta. 1482, 259-271.

33. Tsubouchi, Y., Kawahito, Y., Kohno, M., Inoue, K., Hla, T., and Sano, H. (2001) Biochem Biophys

Res Commun. 283, 750-755

34. Harris, S.G., Smith, R.S. and Phipps, R.P. (2002) J Immunol. 168, 1372-1379.

35. Fahmi, H., Pelletier, J.P., Mineau, F. and Martel-Pelletier, J. (2002) Osteoarthritis Cartilage. 10,

845-848.

22

by guest on April 30, 2018

http://ww

w.jbc.org/

Dow

nloaded from

36. Li, L., Tao, J., Davaille, J., Feral, C., Mallat, A., Rieusset, J., Vidal, H., Lotersztajn, S. et al. (2001) J

Biol Chem. 276, 38152-38158.

37. Forman, B.M., Tontonoz, P., Chen, J., Brun, R.P., Spiegelman, B.M. and Evans, R.M. (1995) Cell

83, 803-812.

38. Clay, C.E., Namen, A.M., Astumi, G., Willingham, M.C., High, K.P. Kute, T.E. et al. (1999)

Carcinogenesis; 20, 1905-1911.

39. Kondo, M., Oya-Ito, T., Kumagai, T., Osawa, T. and Uchida, K. (2001) J Biol. Chem. 276, 12076-

12083.

40. Kühn, K. and Lotz, M. (2001) Arthritis Rheum. 44, 1644-1653.

41.Kim, S.J., Hwang, S.G., Shin, D.Y., Kang, S.S. and Chun, J.S. (20020 J Biol Chem. 277, 33501-

33508.

42. Su, B. and Karin, M. (1996) Curr Opin Immunol. 8, 402-411.

43. Egan, S.E., Giddings, B.W., Brooks, M.W., Buday, I., Sizeland, A.M. and Weinberg, R.A. (1993)

Nature 363, 45-51.

44. Shakibaei, M., Schulze-Tanzil, G., de Souza, P., John, T., Rahmanzadeh, M., Rahmanzadeh, R. et

al. (2001) J Biol Chem. 276, 13289-13294.

45. Yoon, Y.M., Kim, S.J., Oh, C.D., Ju, J.W., Song, W.K., Yoo, Y.J. et al. (2002) J Biol Chem. 277,

8412-8420.

46. Kondo, M., Shibata, T., Kumagai, T., Osawa, T., Shibata, N. Kobayashi, M. et al. (2002) Proc Natl

Acad Sci U S A. 99, 7367-7372.

23

by guest on April 30, 2018

http://ww

w.jbc.org/

Dow

nloaded from

Figure Legends

Fig 1. 15d-PG J2 concentrations in osteoarthritis (OA) and rheumatoid arthritis (RA) patients. (A) 15d-

PG J2 production by OA, RA and normal chondrocytes. Chondrocytes were stimulated with IL-1β (10

ng/ml), TNF-α (25 ng/ml), TGF β1 (10 ng/ml), PG E2 (1 µM) or SNP (2 mM). Cell culture supernatants

were collected and subjected to ELISA 48 h after stimulation. Data are expressed as mean ± SD. *p<0.05,

**p<0.01 vs control. The data represent the results of three separate experiments conducted with at least

three different donors. (B) Concentrations of synovial fluid 15d-PG J2 were measured by ELISA in OA

(n = 25) and RA (n = 29) patients. Boxes represent 25th and 75th percentiles; horizontal lines within

boxes represent 50th percentiles; vertical lines below and above boxes represent 10th and 90th

percentiles; solid dots represent values outside 10th and 90th percentiles. P=0.840, OA patients versus

RA patients excluding the values (solid dots) outside 90th percentiles, according to the Mann-Whitney U

test.

Fig 2. Prostaglandin D synthase (PGDS) expression in osteoarthritic chondrocytes. (A) RT-PCR results

of brain-PGDS expression in OA chondrocytes stimulated with IL-1β (10 ng/ml), TNF-α (25 ng/ml) or

SNP (1 mM) for the indicated time. (B) RT-PCR results of hematopoietic-PGDS expression in OA

chondrocytes stimulated with IL-1β (10 ng/ml), TNF-α (25 ng/ml) or SNP (1 mM) for the indicated

time. (C-F) Immunocytochemistry confirms the expression of PGDS in OA chondrocytes. Less

immunoreactivity was found in untreated chondrocytes (C). The nuclear localization of PGDS

immunoreactivity (arrows) in IL-1β (D) and TNF-α (E)-treated chondrocytes. Chondrocytes appeared

to have an irregular shape with potent nuclear translacation of PGDS after stimulation with SNP (F).

Fig 3. Induction of nuclear morphological changes and apoptosis by 15d-PG J2 in human articular

chondrocytes. (A) Normal, RA and OA chondrocytes were incubated with or without 15d-PG J2 (10 µM)

for 48 h and then stained with Hoechst 33342. Cells with morphological changes such as condensed

nuclei are suggested to be apoptotic. (B) Representative data of Annexin V/PI staining of OA

24

by guest on April 30, 2018

http://ww

w.jbc.org/

Dow

nloaded from

chondrocytes. Serum-starved OA chondrocytes were treated with solvent only or 10 µM 15d-PG J2 for

48 hours. The harvested adherent cells including culture medium and washings were pelleted for analyses

of Annexin V and PI staining by flow cytometry. Annexin V and PI staining is represented on the X-axis

(FL1) and Y-axis (FL2), respectively. Analyses represent data collected on 10000 gated cells. Values in

the quadrants represent the percentage of total gated cells. Similar data were obtained in two additional

independent experiments. (C) Representative histogram data of Guava ViaCount assay of OA

chondrocytes. Cell culture and 15d-PG J2 stimulation were the same as for Annexin V/PI staining. The

harvested adherent cells including culture medium and washings were pelleted prior to labeling for Guava

ViaCount assay. Analyses represent data collected on 5000 gated cells. The viability marker (red)

separating viable cells (left) from apoptotic cells (right). Apoptosis marker (purple) separating apoptotic

cells (left) from dead cells (right).

Fig 4. 15d-PG J2 induces chondrocyte apoptosis of OA, RA and normal samples. Chondrocytes were

plated in monolayer cultures in DMEM supplemented with 10% FCS. After 24 h-starvation (culture

medium was changed to DMEM supplemented with 0.5% FCS), chondrocytes were incubated with the

different concentrations of 15d-PG J2 for 48 h. Untreated cells served as controls. (A) The harvested

adherent cells including culture medium and washings were pelleted and labeled with the Guava

ViaCount reagent for analysis of the percentage of apoptotic cells. (B) OA chondrocytes were incubated

with 10 µM 15d-PG J2 for the indicated time. (C) Effects of inflammatory mediators on chondrocyte

apoptosis. Chondrocytes were incubated with PG E2 (1 µM), SNP (2 mM), IL-1β (10 ng/ml), TNF-α

(25 ng/ml), TGF β1 (10 ng/ml) and 15d-PG J2 (10 µM) for 48 h, and then were collected to perform

Guava ViaCount apoptosis assay. (D) The effect of 15d-PG J2 (0.1 µM) together with SNP (0.2 mM) on

OA chondrocyte apoptosis. Data are expressed as mean ± SD, *p<0.05, **p<0.01 vs control. #p<0.05 vs

15d-PG J2 treatment alone. The data represent the results of three separate experiments conducted with at

least three different donors.

Fig 5. PPAR γ ligands induce chondrocyte apoptosis. (A) OA chondrocytes were grown in the presence of

25

by guest on April 30, 2018

http://ww

w.jbc.org/

Dow

nloaded from

vehicle or the indicated PPAR γ agonists. Chondrocyte apoptosis was induced by 15d-PG J2, ciglitazone

or pioglitazone. (B) Pharmacologic antagonism of PPAR γ by1 µM T0070907 counteracted the apoptotic

effect of 15d-PG J2. (C) Pharmacologic antagonism by GW9662 (25 µM) completely blocked the

apoptotic effect of 15d-PG J2. Serum-starved OA chondrocytes were incubated with PPAR γ agonists

for 48 h; or with antagonists for 1 h, followed by coincubation with 15d-PG J2 (10 µM) for 48 h.

Untreated cells served as controls. The number of apoptotic cells was determined by flow cytometry

using the Guava ViaCount Assay. Values are expressed as mean±SD of three separate experiments.

*p<0.05, **p<0.01 vs control. #p<0.05, ##p<0.01 vs 15d-PG J2 alone. The data represent the results of

three separate experiments conducted with at least three different donors.

Fig 6. Expression of PPAR γ in human articular chondrocytes. (A) Immunocytochemistry showed that

PPAR γ was constitutively expressed in OA chondrocytes. (a) No immunoreactivity was found in

chondrocytes treated with non-immune serum. (b) Immunoreactive PPAR γ was localized to the nuclear

region in OA chondrocytes. (B) RT-PCR analysis showed PPAR γ mRNA expression in OA

chondrocytes stimulated with 10ng/ml IL-1β, 25 ng/ml TNF-α or 10 µM 15d-PG J2 for the indicated

periods of time. Total RNA was isolated as described in Materials and Methods, RT-PCR conditions

were as reported in Table 1. (C) Quantitative real-time RT-PCR analysis showed that PPAR γ mRNA

expression was up-regulated by IL-1β or TNF-α, and that peak induction occurred at 6 h after

stimulation. 15d-PG J2 also upregulated PPAR γ mRNA expression levels, with peak induction 6 h after

stimulation.

Fig 7. Signaling pathways involved in chondrocyte apoptosis induced by 15d-PG J2. Serum-starved OA

chondrocytes were incubated with 15d-PG J2 (10 µM) for the indicated time periods. Chondrocytes

treated with vehicle served as controls. (A) DNA binding activity of NF-κB p65 was determined by

chemiluminescent assay as described in Materials and Methods. (B) NF-κB, phosphorylated IκB-α

(pIκB-α), ERK1/2, phosphorylated ERK1/2 (p-ERK1/2), p38, phosphorylated p38 (p-p38) and p53

26

by guest on April 30, 2018

http://ww

w.jbc.org/

Dow

nloaded from

expression were detected by Western blotting analysis. (C) RT-PCR analysis of p53 expression. (D)

Real-time RT-PCR analysis of p53 expression. (E) Caspase-3 activity of OA and RA chondrocytes was

increased after stimulation with 15d-PG J2. Values are expressed as mean±SD of three separate

experiments. **p<0.01 vs control.

Fig 8. p38 MAPK contributed to the activation of p53. OA chondrocytes were incubated with PD98059

(25 µM) or SB202190 (10 µM) for 1 hour, then with 15d-PG J2 (10 µM) for a further 6 h. (A) Real-time

RT-PCR analysis of p53 expression. (B) Western blotting analysis of p53 protein expression. *p<0.05 vs

15d-PG J2 treatment only.

Fig 9. Effect of pharmacological antagonism of NF-κB, MAPK and caspase-3 on chondrocyte apoptosis

induced by 15d-PG J2. (A) Effect of specific IκB-α inhibitor Bay11-7085 (20 µM) on OA chondrocyte

apoptosis. (B) Divergent effects of ERK inhibitor PD98059 (25 µM) and p38 kinase inhibitor SB202190

(10 µM) on OA chondrocyte apoptosis. (C) Caspase inhibitor ZVAD-fmk completely blocked the

apoptotic effects of 15d-PG J2 on OA chondrocytes. Serum-starved OA chondrocytes pretreated with

antagonists for 1 h, followed by coincubation with 10 µM 15d-PG J2 for 48 h. Apoptotic cell number

was quantified by the Guava ViaCount Assay. *p<0.05, **p<0.01, vs control; #p<0.05, ##p<0.01, vs

15d-PG J2 treatment alone. The data represent the results of three separate experiments conducted with

three different donors.

Fig 10. Schematic summary of the potential role of 15d-PG J2 in human articular chondrocyte apoptosis.

15d-PG J2 is released from human articular chondrocytes and its production is stimulated by

inflammatory mediators such as IL-1β, TNF-α, nitric oxide and PG E2. 15d-PG J2 induces human

arthritic chondrocyte apoptosis and the effect is dependent on PPAR γ activation. PPAR γ is constitutively

expressed in human articular chondrocytes and its expression is up-regulated by inflammatory cytokines

such as IL-1β and TNF-α. Inhibition of NF-κB and ERK1/2, and activation of p38 kinase are involved

27

by guest on April 30, 2018

http://ww

w.jbc.org/

Dow

nloaded from

in chondrocyte apoptosis induced by 15d-PG J2. 15d-PG J2-induced chondrocyte apoptosis is

dependent on the activation of p53 and caspase-3, which are downstream of p38 MAPK.

28

by guest on April 30, 2018

http://ww

w.jbc.org/

Dow

nloaded from

Table 1. Sequences of primers used for PCR amplification of cDNA, product sizes, and PCR cycle

numbers

Gene Primer Seqence Size (bp) Cycle Accession number

PGDS-Hematopoietic 5’ GAACAAGCTGACTGGC 273 35 NM_014485

3’ AGGCGCATTATACGTG

PGDS-Brain 5’ CACCGACTACGACCAG 204 35 BC005939

3’ TGTTCCGTCATGCACTTATC

PPAR γ 5’ TTCCCGCTGACCAAAG 356 35 BC006811

3’ CCCTCGGATATGAGAACC

P53 5’ AGCATCTTATCCGAGTGG 300 35 NM_000546

3’ TCTTGCGGAGATTCTCTT

GAPDH 5’ CCCTCGGATATGAGAACC 226 30 NM_002046

3’ GAAGATGGTGATGGGATTTC

29

by guest on April 30, 2018

http://ww

w.jbc.org/

Dow

nloaded from

by guest on April 30, 2018

http://ww

w.jbc.org/

Dow

nloaded from

by guest on April 30, 2018

http://ww

w.jbc.org/

Dow

nloaded from

by guest on April 30, 2018

http://ww

w.jbc.org/

Dow

nloaded from

by guest on April 30, 2018

http://ww

w.jbc.org/

Dow

nloaded from

by guest on April 30, 2018

http://ww

w.jbc.org/

Dow

nloaded from

by guest on April 30, 2018

http://ww

w.jbc.org/

Dow

nloaded from

by guest on April 30, 2018

http://ww

w.jbc.org/

Dow

nloaded from

by guest on April 30, 2018

http://ww

w.jbc.org/

Dow

nloaded from

by guest on April 30, 2018

http://ww

w.jbc.org/

Dow

nloaded from

by guest on April 30, 2018

http://ww

w.jbc.org/

Dow

nloaded from

by guest on April 30, 2018

http://ww

w.jbc.org/

Dow

nloaded from

by guest on April 30, 2018

http://ww

w.jbc.org/

Dow

nloaded from

Kato and Kusuki NishiokaZheng-Zheng Shan, Kayo Masuko-Hongo, Sheng-Ming Dai, Hiroshi Nakamura, Tomohiro

articular chondrocyte apoptosis in arthritisA potential role of 15-deoxy-delta12,14-prostaglandin J2 for induction of human

published online June 22, 2004J. Biol. Chem. 

  10.1074/jbc.M402424200Access the most updated version of this article at doi:

 Alerts:

  When a correction for this article is posted• 

When this article is cited• 

to choose from all of JBC's e-mail alertsClick here

by guest on April 30, 2018

http://ww

w.jbc.org/

Dow

nloaded from