Upload
sheila-wood
View
221
Download
1
Tags:
Embed Size (px)
Citation preview
JM - http://folding.chmcc.org 1
Introduction to Bioinformatics: Lecture XIIIProfile and Other Hidden Markov Models
Jarek MellerJarek Meller
Division of Biomedical Informatics, Division of Biomedical Informatics, Children’s Hospital Research Foundation Children’s Hospital Research Foundation & Department of Biomedical Engineering, UC& Department of Biomedical Engineering, UC
JM - http://folding.chmcc.org 2
Outline of the lecture
Multiple alignments, family profiles and
probabilistic models of biological sequences From simple Markov models to Hidden
Markov Models (HMMs) Profile HMMs: topology and parameter
optimization Finding optimal alignments: the Viterbi
algorithm Other applications of HMMs
JM - http://folding.chmcc.org 3
Web watch: personalized predictive medicine
Targeting crucial signal transduction pathway in lung cancer:an inhibitor of the Epidermal Growth Factor Receptor (EGFR)catalytic activity that binds EGFRs with specific mutations.
Genotyping the EGFR gene appears to be sufficient to predictthe outcome of the therapy. Paez JG et. al. Science 304
JM - http://folding.chmcc.org 4
Hidden Markov Models for biological sequences
Problems with grammatical structure, such as gene finding, family profiles and protein function prediction, transmembrane domains prediction
In general, one may think of different biases in different fragments of the sequence (due to functional role for example) or of different states emitting these fragments using different probability distributions
Durbin et. al., Chapters 3 to 6
JM - http://folding.chmcc.org 5
Example: Markov chain model for CpG islands
Motivation: CpG dinucleotides (and not the C-G bas pairs across the two strands) are frequently methylated at C, with methyl-C mutating with a higherrate into a T; however, the methylation process is suppressed around regulatory sequences (e.g. promoters) where CpG islands occur more often.
A
C G
TTransition probabilities:
tT,G=P(ai=G | ai-1=T) etc.
The overall probability of a sequence defined as product of transition probabilities
JM - http://folding.chmcc.org 6
Example: Hidden Markov model for CpG islands
A*
C* G*
T*
Adding four more states (A*,C*,T*,G*) to represent the “island” model, as opposed to non-island model with unlikely transitions between the models one obtains a “hidden” MM for CpG islands.
There is no longer one-to-one correspondence between the states and the symbols and knowing the sequence we cannot tell state the modelwas in when generating subsequent letters in the sequence.
A
C G
T
JM - http://folding.chmcc.org 7
Probabilistic models of biological sequences
For any probabilistic model the total probability of observing a sequence a1a2…an may be written as:
P(a1a2…an) = P(an| an-1… a1) P(an-1| an-2… a1) … P(a1)
In Markov chain models we simply have:
P(a1a2…an) = P(an| an-1) P(an-1| an-2) … P(a1)
HMMs are generalization of Markov chain models, with some “hidden” states that “emit” sequence symbols according to certain probability distributions and (Markov) transitions between pairs of hidden states
JM - http://folding.chmcc.org 8
HMMs as probabilistic linguistic models
HMMs may be in fact regarded as probabilistic, finite automata that generate certain “languages”: sets of words (sentences etc.) with specific “grammatical” structure.
For example, promoter, start, exon, splice junction, intron, stop “states” will appear in a linguistic model of a gene, whereas column (sequence position), insert and deletion states will be employed in a linguistic model of a (protein) family profile.
JM - http://folding.chmcc.org 9
HMMs for gene prediction: an exon model
JM - http://folding.chmcc.org 10
HMMs and the supervised learning approach
Given a training set of aligned sequences find optimal transition and emission probabilities that maximize probability of observing the training sequences – Baum-Welch (Expectation Maximization) or Viterbi training algorithm
In recognition phase, having the optimized probabilities, we ask what is the likelihood that a new sequence belongs to a family i.e. it is generated by the HMM with sufficiently high probability. The Viterbi algorithm, which is in fact dynamic programming in a suitable formulation, is used to find an optimal path through the states, which defines the optimal alignment
JM - http://folding.chmcc.org 11
Ungapped profiles and the corresponding HMMs
Beg Mj End… …
Example
AGAAACTAGGAATTTGAATCT
P(AGAAACT)=16/81P(TGGATTT)=1/81
1 2 3 4 5 6 7
A 2/3 0 2/3 1 2/3 0 0
T 1/3 0 0 0 1/3 1/3 1
C 0 0 0 0 0 2/3 0
G 0 1 1/3 0 0 0 0
Each blue square represents a match state that “emits” each letter withcertain probability ej(a) which is defined by frequency of a at position j:
Typically, pseudo-counts are added in HMMs to avoid zero probabilities.
JM - http://folding.chmcc.org 12
HMMs and likelihood optimization
JM - http://folding.chmcc.org 13
Likelihood optimization …
JM - http://folding.chmcc.org 14
Insertions and deletions in profile HMMs
Beg Mj End
Ij
Insert states emit symbols just like the match states, however, theemission probabilities are typically assumed to follow the backgrounddistribution and thus do not contribute to log-odds scores.
Transitions Ij -> Ij are allowed and account for an arbitrary numberof inserted residues that are effectively unaligned (their order withinan inserted region is arbitrary).
JM - http://folding.chmcc.org 15
Insertions and deletions in profile HMMs
Beg Mj End
Dj
Deletions are represented by silent states which do not emit any letters.A sequence of deletions (with D -> D transitions) may be used to connectany two match states, accounting for segments of the multiple alignmentthat are not aligned to any symbol in a query sequence (string).
The total cost of a deletion is the sum of the costs of individual transitions(M->D, D->D, D->M) that define this deletion. As in case of insertions, bothlinear and affine gap penalties can be easily incorporated in this scheme.
JM - http://folding.chmcc.org 16
Gap penalties: evolutionary and computational considerations
Linear gap penalties:
(k) = - k d
for a gap of length k and constant d
Affine gap penalties:
(k) = - [ d + (k -1) e ]
where d is opening gap penalty and e an extension gap penalty.
JM - http://folding.chmcc.org 17
Profile HMMs as a model for multiple alignments
Beg Mj End
Ij
Dj
ExampleAG---CA-AG-CAG-AA---AAACAG---C** *
JM - http://folding.chmcc.org 18
Observed emission and transition counts
C0 C1 C2 C3
A - 4 0 0
C - 0 0 4
G - 0 3 0
T - 0 0 0
Beg Mj End
Ij
Dj
AG...CA-AG.CAGAA.---AAACAG...C
C0 C1 C2 C3
A 0 0 6 0
C 0 0 0 0
G 0 0 1 0
T 0 0 0 0
Match emissions Insert emissions
4 23 4
1
1
1
21
41
12
C0 C1 C2 C3
JM - http://folding.chmcc.org 19
Computing emission and transition probabilities
JM - http://folding.chmcc.org 20
Optimal alignment corresponds to a path with the highest probability (or log-odds score)
Beg Mj End
Ij
Dj
Problem Given the above model, with emission and transition probabilities obtained previously, find the optimal path (alignment) for the query sequence AGAC
Problem Find emission and transition counts assuming that the 4th column in the example of multiple alignment in slide 15 corresponds to another match state (and not an insert state)
JM - http://folding.chmcc.org 21
Outline of the Viterbi algorithm
Beg Mj End
Ij
Dj
JM - http://folding.chmcc.org 22
Profile HMMs for local alignments
Mj
Ij
Dj
Beg End
Q Q
The trick consists of adding additional insert states Q that model flankingunaligned sequences using background frequencies qa and large tQ,Q
JM - http://folding.chmcc.org 23
Summary
In general, when the states generating training sequences (alignments) are not known an iterative procedure
Problem with local minima, topology choice (length of the profile)
Excellent results in family assignment (SAM, PFAM), gene prediction, trans-membrane domain recognition etc.
JM - http://folding.chmcc.org 24
Outline of the lecture