THE JOURNAL OF BIOLOGICAL CHEMISTRY 0 1994 hy The American Society for Biochemistry and Molecular Biology, Inc.

Vol. 269, No. 51, Issue of December 23, pp. 32181-32186,1994 Printed in U.S.A.

Functional and Molecular Characterization of the Transcriptional Regulatory Region of the Proacrosin Gene*

(Received for publication, August 1, 1994)

Karim Nayernia, Sabine Nieter, Hannelore Kremling, Heike Oberwinkler, and Wolfgang EngelS From the Znstitute of Human Genetics, University of Gottingen, Gosslerstrasse 12d, D 37073 Gottingen, Germany

F’roacrosin, the zymogen form of the serine protease acrosin, is located within the acrosomal vesicle of mam- malian spermatozoa and has been suggested to be in- volved in the fertilization process. In mouse and rat, expression of the promrosin gene starts in pachytene spermatocytes and continues through the early stages of spermiogenesis. We have shown recently that 2.3 kilo- base pairs of the 5‘-flanking region of the rat proacrosin gene is sufficient to direct chloramphenicol acetyltrans- ferase gene expression in a germ cell-specific and devel- opmental stage-specific manner in the mouse. Addi- tional transgenic lines have been generated which include two deletions in the 5”flanking region and a tyrosinase minigene as marker for gene expression. Transgenic mice bearing these two truncated fragments showed different patterns of reporter gene expression. Transgenic lines (BM, B3, B2) harboring the 397-base pair (bp) fragment (from 45 to 442 bp upstream of ATG) showed no chloramphenicol acetyltransferase (CAT) ac- tivity in either testis or other tissues, but analysis via reverse transcription polymerase chain reaction con- firmed low levels of reporter gene transcription in tes- tis. Transgenic line TC bearing a longer fragment of 877 bp (from 45 to 922 bp upstream of ATG) showed a re- porter gene expression and chloramphenicol acetyl- transferase enzyme activity which was identical to that found in mice harboring the 2.3-kilobase pair 5”flanking region. The analysis of the CAT gene expression during testicular development showed diploid transcription and haploid translation. It can be concluded that all sequences required for a basic level of testis-specific transcription of transgene are present within the 397-bp fragment, and other DNA sequences located outside of the 397-bp fragment but present within the 877-bp frag- ment can function as enhancer elements. Two fragments within the 877-bp region were identified by gel retarda- tion assays as binding exclusively to nuclear factor(s) from testis protein extracts. In both fragments we iden- tified sequence elements which are present in the pro- moter region of the germ cell-specific genes for histone H2B and protamine I , respectively.

During spermatogenesis, mitotically dividing spermatogonia are first transformed into spermatocytes undergoing meiosis and subsequently into spermatozoa carrying a haploid nuclear content (Handel, 1987). The analysis of genes expressed in a restricted temporal and spatial manner during spermatogenesis

(En 84/20-1). The costs of publication of this article were defrayed in * This work was supported by the Deutsche Forschungsgemeinschaft

part by the payment of page charges. This article must therefore be hereby marked ”uduertisement” in accordance with 18 U.S.C. Section 1734 solely to indicate this fact.

j: To whom correspondence should be addressed: Institut fur Human- genetik, Goplerstrape 12d, D-37073 Gottingen, Germany. Tel.: 49-0551- 397590; Fax: 49-0551-399303.

has given some insight into different gene-regulatory mecha- nisms active in male germ cells (Willison and Ashworth, 1987). Most studies for understanding the mechanisms regulating and coordinating gene expression during spermatogenesis resort to the use of transgenic mice or DNA-protein-interaction experi- ments. Studies of the promoter region of the protamine 1 (Zam- browicz et al., 1993), protamine 2 (Stewart et al., 19881, the phos- phoglycerate kinase-2 (Robinson et al., 1989; Gebara and McCarrey, 1992) and the testis-specificH2B histone genes (Choi and Chae, 1991) have revealed DNAsequence motifs controlling transcriptional activity during spermatogenesis.

An important gene specifically expressed during mammalian spermatogenesis is that for the serine protease acrosin (EC 3.4.21.10). The enzyme is synthesized in a zymogen form, proacrosin, which is activated to the mature enzyme during the acrosome reaction. Acrosin has been implicated in the recogni- tion, binding, and penetration of the zona pellucida of the ovum (Klemm et al., 1991). The expression of the proacrosin gene is under translational control. While transcription of the proacro- sin gene occurs in diploid spermatogenic cells (Kashiwabara et al., 1990; Kremling et al., 1991a), translation only occurs in haploid germ cells (Florke et al., 1983; Kallajoki et al., 1986).

Earlier, we reported that 2.3 kb’ of the 5”flanking region of the rat proacrosin gene was sufficient to direct transcription of the bacterial chloramphenicol acetyltransferase (CAT) reporter gene in pachytene spermatocytes and translation in haploid spermatids (Nayernia et al., 1992). In this report we describe experiments that used chimeric constructs containing shorter 5”flanking regions of the rat proacrosin gene (397 and 877 bp upstream fragments) in order to define more narrowly the se- quences required for the regulation of proacrosin gene expres- sion. Two DNA fragments in the 877-bp flanking region were found to bind nuclear proteins of germ cells in gel retardation assay. This work is a step toward the identification and char- acterization of transcription factors critical for male germ cell- specific expression of the proacrosin gene.

EXPERIMENTAL PROCEDURES Construction of the Fusion Genes-The fusion gene constructs used

for microinjection are shown in Fig. 1. The construct prACRIII-CAT was cleaved from plasmid prACRII-pBLCAT3 (Nayernia et ul., 1992). This construct contains the rat proacrosin 5”flanking region from 45 to 922 bp upstream of the translation start site, the bacterial gene for CAT, and SV40 splice and polyadenylation sequences (Luckow and Schiitz, 1987). The 5”truncated construct prACRIV-CAT was obtained by cleaving the plasmid prACRII-pBLCAT3 with BstEIUSstI restriction enzymes. This construct contains the rat proacrosin 5“flanking region from 45 to 442 bp upstream of the translation start site. Both constructs were purified with the Geneclean Kit (BIO 101 Inc., La Jolla, CA) before injection. The constructs were coinjected with a mouse tyrosinase gene construct ptrTYFL5. The tyrosinase minigene was used as a marker and leads to pigmentation in the eyes and skin in the transgenic albino mouse strain NMRI (Beermann et al., 1991).

The abbreviations used are: kb, kilobase(s); bp, base paids); CAT, chloramphenicol acetyltransferase; RT-PCR, reverse transcriptase-po- lymerase chain reaction; CRE, CAMP responsive element.

32181

32182 Regulation of Proacrosin Gene

: I prACRIV CAT

CAT SV40 %

T W 4 6 ; I pracm C a r

A - B

FIG. 1. Map of the fusion constructs used to generate trans- genic mice. Selected restriction sites are shown. The construct prACRIII-CAT contains the 877-bp 5"flanking region (black line), cod- ing region of bacterial CAT gene (black bar), and the SV 40 splice and polyadenylation sequences (speckled bar). The construct prACRIV-CAT contains 397 bp of the 5"flanking region. The fragments that bind nuclear factor(s) are indicated as A (BstEII-StyI) and B (XhoI-BstEII).

Production and Characterization of Dansgenic Mice-Fertilized oo- cytes were obtained from superovulated NMRI females mated with NMRI males. 3-pg ml-I aliquots of a DNA solution in 10 mM Tris-HC1, pH 8.0, 1.5 mM EDTA were injected into male pronuclei using an Ep- pendorf micromanipulator (Eppendorf, Hamburg, Germany). The mi- croinjected zygotes were then transferred into oviducts of NMRI pseu- dopregnant foster mothers according to published procedures (Hogan et al., 1986). For preliminary identification of transgenic animals, the dot or Southern blot analyses were performed using 10 pg of DNA prepared from the tail tissues of the pups at the age of 3-4 weeks and :"P-labeled 1.6-kb CAT and tyrosinase gene fragments as probes. Copy number of the proacrosin-CAT transgene was estimated by comparing the blot intensity of CAT hybridization with that of known standards.

Cell Separation-Testes from mature transgenic mice were dissected and used for the preparation of testicular cell suspension by the collagenase/trypsin method of Romrell et al. (1976). Cell suspension from the testes of 7 animals was loaded onto a 1000-ml 2-496 bovine serum albumin gradient in a CELSEP chamber (Depart Inc., Washing- ton, D.C.) with a 10% bovine serum albumin cushion at the bottom. 50-ml fractions were collected. Purity of the 16 collected fractions was analyzed by phase-contrast microscopy. The highly enriched fractions with pachytene spermatocytes, round spermatids, and elongating sper- matids were used for the experiments.

RNA Isolation and Analysis-Total RNA was isolated from different tissues or cell populations enriched with specific spermatogenic cell types using RNaid-Kit, according to the manufacturer's instructions (Dianova, Hamburg, Germany). Genomic DNA contamination was eliminated from RNAby DNase I treatment. RT-PCR was carried out by the rTth Kit from Perkin-Elmer (Vatterstetten, Germany) and run in a Perkin Elmer Thermal Cycler. "No template" and "no reverse tran- scriptase'' controls were run for each experiment to rule out template contamination in reaction components or DNA contamination in RNA samples, respectively, as a source of positive amplification signals. 200- 400 ng of total RNA was reverse transcribed into cDNA at 72 "C for 10 min. The amplification profile involved 2 min at 95 "C for 1 cycle, 1 min a t 95 "C, and 1 min at 60 "C each for 25-35 cycles, and 7 min a t 60 "C for 1 cycle. To test the RNAin each sample, the products of each reverse transcriptase reaction were divided into two aliquots. One aliquot was then subjected to 25 cycles of PCR to amplify a 230-bp fragment of mouse p-actin cDNA using 22-mer primers (upstream primer: 5'- GGACGACATGGAGAAGATCTGG-3'; downstream primer: 5"CTCCG- GAGTCCATCACAATGCC-3'). The other aliquot was subjected to 35 cycles of PCR to amplify a 380-bp fragment of the CAT coding region using 20-mer primers (upstream primer: 5"CGTTCAGCTGGATAT- TACGG-3'; downstream primer: 5'-GTTGTCCATATTGGCCACGT-3'). The PCR reaction products were run on a 2% agarose gel, blotted to nitrocellulose filter, and hybridized with a 32P-labeled CAT DNA probe. For Northern blot analysis 20-pg RNA samples were denatured in a formaldehyde/formamide buffer and electrophoresed on 1.5% agarose gels. RNA was then transferred to nitrocellulose and probed with a 32P-labeled CAT probe. For the proof of intact RNA in each lane, North- ern blots were stripped and rehybridized to actin cDNAprobe (Hanauer et al., 1983).

CAT Enzyme Assay-Protein extracts for CAT assays were made by freeze-thawing tissue homogenates or spermatogenic cells in 0.25 M

Tris-HC1, pH 7.8. Protein concentrations of extracts were measured using the Bio-Rad protein assay kit (Bio-Rad). After heat inactivation for 10 min at 65 "C, CAT enzymatic activity was assayed according to Gorman et al. (1982). To quantitate the CAT activity in individual samples, signals on the autoradiograph corresponding to the acetylated forms of chloramphenicol were scraped from the silica gel plate and

counted by liquid scintillation counter. Gel Retardation Assay-Nuclear extracts were prepared from rat

testis and brain (Tamura et al., 1989) and from highly enriched sper- matocytes and spermatids (Dignam et al., 1983). 5-10 pg of each protein extract was incubated in a total volume of 20 p1 with 2-10 pg of poly(d1,dC) as a nonspecific inhibitor, 10 mM Tris-HC1, pH 7.5, 50 mM NaCl, 1 mM EDTA, 5 mM MgCl,, 5% glycerol for 15 min on ice. A 1.7-kb CAT DNA fragment was used as a nonspecific competitor. Different nonlabeled double-stranded oligonucleotides were used as specific com- petitor for precise identification of the binding site(s) of nuclear fac- tor(s). 10,000 cpm of a 32P-end labeled DNA fragment (A and B in Fig. 1) was added to the reaction mixture and incubated for 25 min on ice. The protein-DNAcomplexes were separated from the free DNAprobe by electrophoresis on a nondenatured polyacrylamide gel. The gel was dried and autoradiographed.

Indirect Immunofluorescence Method-Testis cell smears of mature transgenic mice of the line TC were prepared according to Florke et al. (1983) and fixed in acetone/methanol (1:l). Indirect immunofluores- cence was performed using the reagents and suggested protocols of an immunofluorescence kit from ABCR (Karlsruhe, Germany). A rabbit polyclonal antibody raised against proacrosidacrosin from boar was generously provided by Dr. Topfer-Petersen (Andrological Department, University of Hannover).

RESULTS

Generation of Transgenic Mice Containing prACRIII-CAT and prACRIV-CAT Fusion Genes-The hybrid constructs were coinjected with a 11.2-kb tyrosinase minigene ptrTYR5 into fertilized eggs of the albino mouse strain NMRI. We have used the tyrosinase minigene as a marker for visual identification of transgenic mice and as a control of the position effect on trans- gene expression (Beermann et al., 1991). Three transgenic mice (All , A32, TC) for the prACRIII-CAT construct (877-bp 5' re- gion) were identified from a total of 36 offspring using a CAT DNAprobe. These transgenic mice contained 2,8, and 20 copies of the transgene, respectively. One of the founder animals (All) produced no transgenic F1 offspring, suggesting that this foun- der was mosaic with respect to germ line integration. DNA analyses of F1 animals of founder mice A32 and TC showed that the coinjected DNAs (prACRII1-CAT and tyrosinase mini- gene ptrTYR5) are integrated in the same chromosomal sites. Neither the transgene prACRIII-CAT nor ptrTYR5 were ex- pressed in transgenic mouse line A32. One possible explanation for this result could be integration into an inactive region of the genome. The transgenic mouse TC was pigmented, indicating that this mouse expresses the ptrTYR5 minigene. Founder mouse TC was bred to nontransgenic NMRI mice and the off- spring screened for cotransmission of the injected DNAs. These screenings indicated that all pigmented F1 offspring were transgenic for both ptrTYR5 minigene and prACRIII-CAT.

Of 24 animals generated by coinjection of prACRIV-CAT (397-bp 5' region) and ptrTYR5, dot blot analysis of tail DNA revealed that three pigmented mice (B2, BM, B3) contained 3, 8, and 14 copies of prACRIV-CAT, respectively. Progeny analy- sis of transgenic mice B3 and BM indicated that both trans- genes are integrated in the same chromosomal sites. The trans- genic mouse B2 was infertile.

Expression Pattern of the prACRIII-CAT Fusion Gene-CAT assays were conducted on extracts of different organs of adult TC transgenic mice and CAT activity was found only in testis extract (Fig. 2). To determine if the testis-specific expression of the CAT gene is regulated at the transcriptional level, we performed a Northern blot analysis with RNA from a variety of tissues. A CAT transcript was detected only in testicular tissue, indicating appar- ent testis-specific transcription of the CAT gene (Fig. 3).

To identify the spermatogenic cell type in which translation of the transgene mRNA occurs, we have performed CAT assays with extracts from highly enriched populations of specific sper- matogenic cell types. We first detected the CAT enzymatic ac- tivity in round spermatids with increasing of the CAT activity

Regulation of Proacrosin Gene 32183

.m L . . I . ". :::I t w o -

0 - 0 - - testis liver kidney lung heart spleen muscle brain uterus ovar

male (M) and female (F) transgenic mice TC (prACRII1-CAT). As FIG. 2. CAT enzyme activity in extracts from different tissues of

control, CAT enzyme activity was measured in extracts from different tissues ofnontransgenic mice (N). CAT enzyme activity could be detected only in testis extract of transgenic mice. CAT activity is given as the number of counts (cpm) in the acetylated forms of chloramphenicol.

T L i K H LU T L i K H Lu

1.3kbl) -

1200 CPm

1000

800

600

400

200

rs I'S KS KS t:s ES

FIG. 4. CAT enzyme activity in extracts from isolated germ cells of transgenic mice TC. The CAT enzyme activity was first detected in the extract from round spermatids with increasing activity during spermatid differentiation. The CAT activity is given as the num- ber of counts (cpm) in the acetylated forms of chloramphenicol. CM indicates CAT assay without any tissue extract as a negative control. PS, pachytene spermatocyte; RS, round spermatids; ES, elongating spermatids.

C 11 13 15 R 19 20 21 25 - + - +- +- + - +- + - + - +

0 L, 0 a + 3 m b P

A

prACRlll prACR IV TC of various ages. The age in days is shown above each'iine (day of birth = day 0). PCR was performed with 200400 ng of total RNA. The

F,G, 3. Northern blot of total mAfrom various tissues of male first CAT RNA was detected in testicular RNA of i7-day-old mice, re-

A hybridization kb) was obtained only with the testicular CAT primers. A, RT-PCR with actin primers. +, reverse transcription

fragment and rehybridized with an actin cDNA (upper part). T , testis; reverse transcription as for DNA

transgenic mice TC ( lef t ) and m& transgenic mice BM ( l ight) . flecting the appearance Of pachytene spermatocytes. c* RT-PCR with

RNA of transgenic mice TC, The blot was probed by a :jzp-labeled CAT and PCR with testicular RNA. -, PCR with testicular RNA without

Li,liver; K, kidney, H, heart; Lu, lung. .. .

during spermatid differentiation (Fig. 4). The developmental regulation of the prACRII1-CAT fusion gene was assayed by monitoring the appearance of CAT transcript and CAT enzyme activity in testes of transgenic line TC between days 11 and 40 of postnatal development. The first CAT transcript was de- tected in RNA from testes a t day 15-17 (Fig. 5) with increasing transcriptional activity during testicular development. CAT ac- tivity was first found in extracts from testes a t day 20 (Fig. 6). The CAT activity remains constant a t a low level in testicular extract of 20-, 21-, and 23-day-old mice. Thereafter, from day 25, an increasing of CAT enzyme activity was observed. Day 15-17, 20, and 25 coincide with the appearance of pachytene spermatocytes, round spermatids, and elongating spermatids, respectively (BellvB, 1979). These results demonstrate that the transgene prACRII1-CAT is transcriptionaly active and that mRNA is subjected to post-transcriptional regulation.

We have used the indirect immunofluorescence procedure to localize the proacrosidacrosin and CAT protein in spermato- genic cells of the transgenic line TC. Proacrosidacrosin could be localized in the acrosome of spermatids and sperms (Fig. 7A). Using the antibody against CAT protein, the whole cyto- plasm of the spermatids and cytoplasmic droplets of testicular sperms stained positive (Fig. 7C).

Expression Pattern of the prACRN-CAT Fusion Gene-We also performed a CAT assay on extracts from different tissues of the transgenic lines BM, B3, and B2 which contain the

15 17 19 20 21 23 25 27 30 40 CM CAT FIG. 6. CAT enzyme activity during testicular development of

transgenic mice TC. The ages in days are shown below each line (day of birth = day 0). For each assay, 50 pg of testicular protein extract was used. The first CAT enzyme activity was obtained in testicular extract of 20-day-old mice, which coincide with the appearance of haploid sper- matids. The CAT activity remains constant in testicular extracts of 20-, 21-, and 23 day-old mice. Thereafter an increase of CAT enzyme activity was observed. CAT, CAT assay with CAT enzyme as positive control. CM, CAT assay without protein extract as negative control.

397-bp fragment construct prACRIV-CAT. None of the three lines exhibited CAT activity in any tissue assayed. To increase the specificity of the CAT assay we have measured the CAT enzyme activity in extracts from specific spermatogenic cells of the transgenic lines BM and B3. No CAT activity was found in any cell type assayed. We observed no CAT hybridization in any of the three transgenic mice with Northern blot analysis (Fig. 3). By contrast, a low level of specific transcription of the CAT gene was obtained by RT-PCR analysis in testicular RNA and in RNA isolated from spermatocytes and spermatids (Figs. 8

32184 Regulation of Proacrosin Gene

B3 BM

A

C

FIG. 7. Indirect immunofluorescence staining of spermatids ( S t ) and sperms ( S p ) from transgenic mice TC using CAT ( C ) and proacrosidacrosin ( A ) antibodies. Acrosin protein is located in the acrosome and CAT protein is distributed in the whole spermatid cytoplasm and in cytoplasmic droplet of testicular sperm x 4000.

T Li K + - + - + " c BM

B3

B2 FIG. 8. RT-PCR with RNAfrom testis (T), liver (Li), and kidney

(K) of transgenic mice BM, B3, and B2 (prACRIV-CAT). 400 ng of isolated RNA was used for the RT-PCR with CAT specific primers. The PCR products were electrophoresed, transferred to nitrocellulose filter, and probed with a :'*P-labeled CAT fragment. A weak hybridization signal was observed only with testicular RNA. c, RT-PCR without RNA as negative control; +, reverse transcription and PCR with RNA, -, PCR without reverse transcription as control for DNA contamination.

and 91, with an increase of transcriptional activity in sperma- tids. These results indicate that fusion gene prACRIV-CAT lacks the regulatory elements necessary for the efficient ex- pression of the CAT gene.

Sequences in the Promoter of Proacrosin Gene That Bind Nuclear Factor(s)-Expression analysis of transgenic mice showed that the 877-bp 5"flanking region contains the se- quence information necessary for efficient tissue-specific ex- pression of the transgene. To search for potential regulatory elements which bind specific nuclear factors, gel retardation assays were performed. Various 5' fragments of the 877-bp 5"flanking region of the proacrosin gene were assayed. Specific binding with testicular extracts and extracts from spermato- cytes- and spermatid-enriched fractions were observed with 200-bp fragment BstELL-StyZ (A in Fig. 1)) and 150-bp frag- ment XhoI-BstEII ( B in Fig. 1). The BstEII-Sty1 fragment (Fig. 1OA) formed one complex with proteins from testis. The same complex was identified after incubation of this DNA fragment with nuclear extracts from separated germ cells. This retarded band could be eliminated only by a 50-fold excess of the unla- beled oligonucleotide OAl (Fig. 1OA). OAl contains the se- quence element ACGTCA which is found in the promoter region of testis-specific histone H2B (Choi and Chae, 1991). This com- plex could not be obtained with nuclear extract from the so-

FIG. 9. RT-PCR with isolated pachytene spermatocytes (P) and round spermatids ( R ) of transgenic mice B3 and BM (prACRIV- CAT). 400 ng of isolated RNA were used for the RT-PCR with CAT- specific primers. The PCR products were electrophoresed, transferred to nitrocellulose filter, and probed with a :'2P-labeled CAT fragment. CAT transcript was detected in RNA from pachytene spermatocytes with increasing transcriptional activity during germ cell differentiation. 0, RT-PCR without RNA as negative control; C, RT-PCR with CAT primers; A, RT-PCR with actin primers.

matic tissue. The gel retardation assay with the XhoI-BstEII fragment yielded four retarded bands (a, b, c, and d) with nu- clear protein from testis and nuclear extracts from separated pachytene spermatocytes and spermatids, but not with nuclear proteins from brain (Fig. 10B). The retarded bands could be eliminated completely or partly by a 50-fold excess of the un- labeled oligonucleotide OBl,OB2,OB3, and OB5 (Fig. 1OB). In oligonucleotides OB1 and OB2 we have found the sequence AACTTCAAAA, which has an 80% homology to the binding site of testis-specific transcription factor Tet-1 (Tamura et al., 1992). We have not found these DNA-protein complexes with nuclear extracts from cultured Sertoli and HeLa cells (data not shown). These results suggest that these complexes represent DNA-protein interactions with germ cell-specific nuclear fac- tors. At present, it is unknown whether the multiple retarded bands formed by the XhoI-BstEII fragment represent the bind- ing of different proteins or binding of the same protein as mo- nomeric and multimeric units.

DISCUSSION In previous studies we have generated transgenic mice bear-

ing the fusion gene prACRII-CAT. This fusion gene contained 2.3 kb of the 5"flanking region of the rat proacrosin gene and was capable of targeting CAT reporter gene expression exclu- sively in mouse testicular germ cells (Nayernia et al., 1992). CAT gene was first transcribed in pachytene spermatocytes while enzyme activity was first detected in isolated round sper- matids. The mRNAs for the proacrosin-CAT transgene and the endogenous mouse proacrosin gene were found for the first time in the testis of 17-day-old mice but the CAT protein was first observed in testis of 21-day-old mice. This correlates with the appearance of pachytene spermatocytes and early sperma- tids (Bellve, 19791, respectively, which is in accordance with the reported onset of transcription and translation of proacrosin gene during spermatogenesis (Florke et al., 1983; Kashiwabara et al., 1990). The results demonstrate that the spatial and temporal expression of the prACRI1-CAT fusion gene mimics the expression of the endogenous mouse proacrosin gene.

The studies described here represent a detailed dissection of the proacrosin promoter region. Two truncated fusion genes, prACRII1-CAT and prACRIV-CAT (Fig. l), were generated in consideration of the transcription start points of rat and mouse proacrosin gene. Kremling et al. (1991a, 1991b) identified one transcription initiation site in rat and mouse a t positions 564 and 581 bp upstream of ATG, respectively, by primer extension analysis. In contrast, Watanabe et al. (1991) have reported that the mouse proacrosin gene has five heterogeneous transcrip- tion initiation sites (6, 11, 16,21, and 30 bp) upstream from the

FIG. 10. Gel retardation assays with DNA fragments BstEII-StyI (A) and XhoI-BstEII ( B ) . For localization of frag- ments A and B in the 5”flanking region see Fig. 1. Using nuclear extracts from testis (I), brain (21, separated pachytene spermatocytes (P), and spermatids (S), germ cell-specific complexes could be identified. The complexes are marked by arrows. 0, without proteins. + indicates the presence of non-self competing DNA (1.7 kb of the CAT vector), while - is with- out non-self competing DNA. DNA-pro- tein complexes could not be eliminated by nonspecific competition. The unlabeled double-stranded oligonucleotides used for specific competition are shown (OA1-OA3 for fragment Aand OB1-OB6 for fragment B). A competition was obtained with OAl oligonucleotide for fragment A and with OBl.OB2.OB3, and OB5 for fragment B.

Regulation of Proacrosin Gene 32185

0 1 1 2 2 O P S OAl O M OA3

” - + - + + +

b = a C-

E In A

OA3

OAZ

TAAAGTGAGACGTCAGAAGGTCGCAAGG

1 1 2 2 0 0 P S OB1 OB2083 0B4OB5 OB6

- + - 4. + +

OB0 OB5

OB4 OB3

OB2

ATG start codon. Using the more sensitive method of rapid amplification of cDNA ends-RCR we have found two transcrip- tion initiation sites about 100 and 700 bp upstream from ATG in mouse and rat.2 The fusion genes prACRII1-CAT and prACRIV-CAT contain 877 and 397 bp of the 5”flanking region of the rat proacrosin gene, respectively. Therefore the construct prACRIV-CAT lacks the putative transcription start point which is located about 700 bp upstream of ATG and the con- struct prACRII1-CAT contains all suggested transcription start points, except those reported by Watanabe et al. (1991).

We have generated three transgenic mice (All, A32, and TC) with the construct prACRII1-CAT and three transgenic mice (B2, BM, and B3) with the construct prACRIV-CAT. These chi- meric genes were coinjected with a tyrosinase minigene ptrTYR5. The tyrosinase minigene, when introduced into an al- bino mouse strain leads to pigmentation in eyes and skin with high penetrance. DNA analyses of F1 transgenic mice revealed

K. Nayernia, S. Nieter, H. Kremling, H. OberwinMer, and W. Engel, unpublished results.

that the tyrosinase minigene and the proacrosin-CAT fusion genes are integrated in the same chromosomal site in transgenic linesA32, TC, BM, B2, and B3. The transgenic mice TC, BM, B2, and B3 are pigmented. In spite of cointegration of ptrTYR5 and prACRII1-CAT in the genome of transgenic mouse A32, this mouse was not pigmented. This is an indication for the inte- gration of both transgenes in an inactive chromosomal site.

Expression analysis of the fusion genes in transgenic mice serves to define the extent of the sequences that encode tran- scriptional control elements. The expression pattern of the prACRIII-CAT fusion gene in transgenic mouse line TC revealed that the 877-bp fragment contains information essential for di- recting male germ cell-specific and developmentally regulated expression. The expression pattern of prACRII1-CAT (877-bp 5’ region) compared with that of prACRII-CAT (2.3-kb 5’ region) in transgenic mice suggests that sequences located upstream of the 922-bp fragment are not essential for proacrosin gene ex- pression. None of the three pigmented transgenic mice contain- ing prACRIV-CAT (397-bp 5‘ region) fusion gene exhibited CAT activity in any tissue assayed. We only found a testis-specific

32186 Regulation of Proacrosin Gene

transcription detectable by RT-PCR. These results indicate that the 387-bp fragment contains sequence elements that are prob- ably essential for basal expression of the CAT gene in testis of transgenic mice. However, these elements clearly require the sequences located between 442 and 992 bp upstream ofATG for efficient expression of the CAT gene. Interestingly in mouse protamine 1 gene the region between 150 and -37 bp is sufficient to direct gene transcription while sequences 5’ of 150 bp are required for high level transcription (Zambrowicz et al., 1993).

It is known that the sequences proximal to the transcription initiation site normally control the position and frequency of initiation by RNA polymerase I1 in eukaryotic promoters. One of the sequences necessary and sufficient for proper initiation by RNApolymerase I1 is the TATAbox (Latchman, 1992). Kremling et al. (1991a, 1991b) detected a putative TATA box at position 607 bp upstream of the ATG translation start codon in mouse and 588 bp in the rat. In our studies with transgenic mice we have found a basal level of transcription with the construct prACRIV-CAT which contains only a 387-bp 5”flanking region and lacks any typical TATA box. Many genes regulated devel- opmentally or during cell differentiation do not contain a TATA box and transcription initiation occurs at any one of a number of start sites. The testis-specific genes lacking TATA sequences include those for farnesyl pyrophosphate synthetase, metallo- thionein (Salehi-Ashtiani et al., 1993), mouse pgk-2 (Boer et al., 19871, cytochrome ct (Virbasius and Scarpulla, 19881, and rat proenkephalin (Zinn et al., 1991). As is the case in these genes, it is possible that an initiator element present in the 387-bp fragment regulates the transcriptional initiation of the CAT gene in transgenic mice lines BM, B3, and B2.

It can be suggested that genes expressed in male germ cells are activated by a common regulatory or signaling mechanism, pos- sibly involving identical transcriptions factors. If this is the case, germ cell-specific genes would be expected to share common DNA- binding sites for such factors. The genes for Zfp-35 (CunlifFe et al., 1990), PGk-2 (Robinson et al., 1989), Tcp-lObt (Ewulonu et al., 1993), histone H2B (Choi and Chae, 1991), and histone H l t (Kre- mer and Kistler, 1992) have similar expression patterns as that of the rat and mouse proacrosin gene. The transcription of these genes begins in pachytene spermatocytes. The 5”flanking region of these genes and the rat proacrosin gene share similar sequence elements. One of these sequence elements that is highly conserved between many testis-specific genes is the 8-bp motif TGAGGTCA. This motif is homologous to the CRE ( C A M P responsive element) consensus sequence TGACGTCA (Roesler et al., 1988). Recently, a novel CREM (CRE modulator) isoform, C R E q , was discovered in adult testis (Foulkes et al., 1992). C R E q activates transcription in response to CAMP. Premeiotic cells express low levels of the CREM gene in the antagonist form. During the pachytene stage, a switch in splicing pattern results in the exclusive production of high levels of CREq . I t is possible that this factor is involved in the activation of gene expression in pachytene spermatocytes and also in proacrosin gene regulation. A reverse complementary se- quence to the motif TGAGGTCA is present in fragment A.

Fragment A which is located in the 442-bp 5”flanking region and fragment B which is located in the region between 442 and 922 bp upstream of ATG were found to bind specifically germ cell nuclear proteins in an electrophoretic mobility shift assay (Fig. 10). This results together with the observation that only basal expression of the construct prACRIV-CAT indicates that the cooperation of sequence elements in both regions (A and B fragment in Fig. 1) is required for appropriate temporal and germ cell-specific expression of rat proacrosin gene. The pro- moter studies in transgenic mice, together with sequence com- parisons of promoter regions of genes that have a similar pat- tern of expression to the proacrosin gene, led to the

identification of potential regulatory sequences. Fragment A was found to form a DNA-protein complex with nuclear ex- tracts from germ cells, which could be eliminated with the oligonucleotide OAl (Fig. 1OA). The oligonucleotide OAl con- tains the sequence ACGTCA, which is present as the binding site of a testis-specific transcription factor in the promoter re- gion of histone H2B (Choi and Chae, 1991). Both, the proacro- sin and the histone H2B genes are first transcribed in pachytene spermatocytes. In fragment B we have found the sequence AACTTCAAAA which is identical in 8 of 10 positions to the sequence GACTTCATAA. This sequence was found in the promoter of the mouse protamine 1 gene as the binding site for the testis-specific trans-acting factor Tet-1 (Tamura et al., 1992). Further detailed deletion analysis using a transgenic animal system is necessary to functionally dissect the proacro- sin gene promoter structure and identify discrete elements and factors involved in germ cell-specific regulation.

Acknowledgments-We thank Stefanie Bunkowski for technical assistance, Derek Murphy for reading the manuscript, and Angelika Winkler for secretarial help.

REFERENCES

Beermann, E , Ruppert, S., Hummler, E., and Schutz, G. (1991) Nucleic Acids Res.

Bellv6, A. R. (1979) in Oxford Reuiews of Reproductive Biology (Finn, C. A., ed) pp. 19,958

159-261, Oxford University Press, Oxford

3107-3112 Boer, P. H., Adra, C. N., Lau, Y. F., and McBurney, M. W. (1987) Mol. Cell. Biol. 7 ,

Choi, Y. C., and Chae, C. B. (1991) J. Biol. Chem. 266, 20504-20511

Dignam, J. D., Lebovitz, R. M., and Roeder, R. G. (1983) Nucleic Acids Res. 11, Cunliffe, V., Williams, S., and Trowsdale, J. (1990) Genomics 8, 331-339

Ewulonu, U. K., Buratynski, T. J., and Schimenti, J. C. (1993) Development 117,

Florke, S., Phi-van, L., Muller-Esterl, W., Scheuber, H. P., and Engel, W. (1983)

Foulkes, N. S., Mellstrom, B., Benusigio, E., and Sassone-Corsi, P. (1992) Nature

Gebara, M. M., and McCarrey, J. R. (1992) Mol. Cell. Biol. 12, 1422-1431 Gorman, C. M., Moffat, L. F., and Howard, B. H. (1982) Mol. Cell. Biol. 2, 1044-

Hanauer, A,, Levin, M., Heilig, R., Daegelon, D., Kahn, A,, and Mendel, J. L. (1983) 1051

Handel, M. A. (1987) in Spermatogenesis, Genetic Aspects (Henning, W., ed) pp. Nucleic Acids Res. 11, 3505-3515

Hogan, B., Constantini, F., and Lacy, E. (1986) Manipulating the Mouse Embryo:A 1-62, Springer, Berlin

Laboratory Manual, pp. 151-205, Cold Spring Harbor Laboratory, Cold Spring

Kallajoki, M., Parvinen, M., and Suominen, J. J. (1986) Biol. Reprod. 36, 157-165 Harbor, NY

Kashiwabara, S., Arai, Y., Kodairo, K., and Baba, T. (1990) Biophys. Res. Commun.

Klemm, U., Muller-Esterl, W., and Engel, W. (1991) Hum. Genet. 87,635-641 Kremer, E. J., and Kistler, W. S. (1992) Gene (Amst. 110, 167-173 Kremling, H., Keime, S., Wilhelm, K., Adham, I. M., Hameister, H., and Engel, W.

Kremling, H., Flake, A,, Adham, I. M., Radtke, J., and Engel, W. (1991b) DNA

Latchman, D. S. (1992) Eukaryotic Zkanscription Factors, pp. 16-41, Academic

Luckow, B., and Schutz, G. (1987) Nucleic Acids Res. 16, 5490 Nayernia, K. , Burkhardt, E., Beimesche, S., Keime, S., and Engel, W. (1992) Mol.

1475-1489

89-95

Diferentiation 24,250-256

366 ,8044

173,240-245

(1991a) Genomics 11,828-834

Sequence 2 , 5 7 4 0

Press, Harcourt Brace Jovanovich Publishers, London

Robinson, M. O., McCarrey, J. R., and Simon, M. I. (1989) Proe. Natl. Acad. Sci. Reprod. Deu. 31,241-248

U. S. A. 86.84374441 h a l e r , W. J.,‘Vandenbark, G. R., and Hanson, R. W. (1988) J. Biol. Chem. 263,

Romrell, L. J., BellvB, A. R., and Fawcett, D. (1976) Dew Biol. 49, 119-131 Salehi-Ashtiani, K., Widrow, R. J., Markert, C. L., and Goldberg, E. (1993) Proc.

Stewart. T. A,. Hecht. N. B., Hollingshead, P. G., Johnson, J. A. C., and Pitts, S. L.

9063-9066

Natl. Acad. Sci. U. S. A. 90, 888G8890

Tamura, T., Ohy,A. Y., Miura, M., Aoyama, A,, h u e , T., and Mikoshiba, K. (1989) (1986) Moll Cell. Biol. 8, 1748-1755

Tamura, T., Makino, Y., Mikoshiba, K., and Muramatsu, M. (1992) J. Biol. Chem. Technique 1, 33-36

267.4327-4332 Virbasjus, J. V., and Scarpulla, R. C. (1988) J. Biol. Chem. 263,67614796 Watanabe, K., Baba, T., Kashiwabara, S., Okamoto, A., and &ai, Y (1991)

Willison, K., and Ashworth, K. (1987) %rids Genet. 3, 351-355 Zambrowicz, B. P., Harendza, C. J., Zimmennann, J. W., Brinster, R. L., and

Zinn, S. A,, Ebert, K. M., Mehta, N. D., Joshi, J., and Kilpatrick, D. L. (1991)

J. Biochem. (Tbkyo) 109,828-833

Palmiter, R. D. (1993) Proc. Natl. Acad. Sci. U. S. A. 90, 5071-5075

J. Biol. Chem. 266,23850-23855