Journal of Biotechnology and Biosafetyjobb.co.in/docs/vol3_issue5/all.pdf · Journal of Biotechnology and Biosafety ... Dr. Kavita Sharma, Phd ... which is similar to that reported

Journal of Biotechnology and Biosafety Volume 3 Issue 5 September/October 2015

An International, Open Access, Peer reviewed, Bi-Monthly Journal

Editorial

Editor-in-Chief

Chethana G S [email protected] [email protected]

www.jobb.co.in

Advisory Board

Dr. S.M. Gopinath, Phd HOD, Dept of Biotechnology, Acharya Institute of Technology, Bangalore, INDIA

Dr. Vedamurthy A.B. Phd

Professor, P.G. Department of Studies in Biotechnology and Microbiology, Karnatak University, Dharwad, India

Dr. Hari Venkatesh K Rajaraman MD(Ay), PGDHM Manager, R&D, Sri Sri Ayurveda Trust, Bangalore, INDIA

R. Rajamani, M.Sc.,M.Phil.,B.Ed. Co-Principle Investigator, SSIAR, Bangalore, INDIA

Dr. Pravina Koteshwar, MBBS, MD Director, Academic Programs, ICRI, India

Editorial Board

Dr. Pushpinder Kaur, Phd Research Associate, CSIR-Institute of Microbial Technology Sector,

Chandigarh, INDIA

Dr. Kavita Sharma, Phd Senior Scientist, Research and Development, Pharmacology Division,

Sigma Test and Research Centre, New Delhi, INDIA

Dr. Kasim Sakran Abass, Phd Associate Professor, College of Nursing,

University of Kirkuk, Kirkuk, IRAQ

Dr. Ashutosh Chaturvedi (BAMS, PEC Diabetes care)

Resident & M.D Scholar, Department of Panchakarma, SDMCAH - Hassan

Index – JOBB, Volume 3, Issue 5 - September/October 2015 Microbiology INCIDENCE OF Staphylococcus aureus IN STREET VENDED PANIPURI AROUND THE GULBARGA CITY Deepa K. Chavan, Channappa T. Shivannavar , Manjula N.G, Subhaschandra M. Gaddad

303-307 Microbiology MOLECULAR ANALYSIS AND IDENTIFICATION OF VANCOMYCIN RESISTANT GENES (vanA, vanB) and Tn1546 LIKE ELEMENTS AMONG METHICILLIN RESISTANT Staphylococcus aureus (MRSA) ISOLATES FROM PATIENT SAMPLE IN KOLKATA- AN EMERGING THREAT Manisha Chakraborty, Anjan Kumar Basu 308-318

Journal of Biotechnology and Biosafety

Volume 3, Issue 5, September-October 2015, 303-307 ISSN 2322-0406


www.jobb.co.in International, Peer reviewed, Open access, Bimonthly Online Journal

INCIDENCE OF Staphylococcus aureus IN STREET VENDED PANIPURI AROUND THE GULBARGA CITY

Research article

______________________________________________ Deepa K. Chavan1, Channappa T. Shivannavar 2,

Manjula N.G3 Subhaschandra M. Gaddad*1

___________________________________________

1,3Research scholar, Department of P.G. Studies and Research in Microbiology, Gulbarga University, Kalaburagi-585106, Karnataka, India. 2Professor, Department of P.G. Studies and Research in Microbiology, Gulbarga University, Kalaburagi-585106, Karnataka, India. 1*Professor, Department of P.G. Studies and Research in Microbiology, Gulbarga University, Kalaburagi-585106, Karnataka, India *Corresponding author email id: [email protected]

ABSTRACT: Street side foods are becoming increasively popular in India, however very little information is available on the hygienic status of street foods. In the present study the incidence of Staphylococcus aureus in panipuri, one of the most popular chat from Gulbarga. A Total of 90 Panipuri samples were collected from various street venders and chat centers in Gulbarga, Among 90 samples 43 samples were contaminated with Staphylococcus aureus. About 40% of the samples from chat centers and 51.6% from Street venders showed the presence of Staphylococcus aureus. Significantly highest rate of contamination (80%) was found in Panipuri samples collected from near the hospital and College (70%)localities and lowest at shopping malls (20%). It is suggested that regular monitoring of quality of street food and self hygiene must be practiced to avoid any food born infections and diseases.

Key words: Panipuri, Street food, S.aureus , food-borne infections. ____________________________________________________________________________________

INTRODUCTION: In India Street food is prepared by venders on the street in the form of chats / beverages either ready to eat or prepared at home and consumed on the street without any further process. Chats like Panipuri, Samosa, Bhelpuri, Kachori etc are prepared and sold at public places and streets. Such street foods are not only appreciated for their unique flavors, also have become an important, essential for the maintenance of nutritional status of populations (Dardano 2003). In almost cases street foods are sold without any running water sources, or running water is not available at vending sites and markets; such times utensils and hands are washed in the buckets, without liquids and soap (Mensah et al., 2002). Venders can be the source and carriers for food pathogens like E.coli,

S.aureus, Salmonella and Shigella (Tambekar et al., 2011). Such street foods and chats provide a minimum nutritional source for the majority of the low-income group people in the developing countries (Muzaffar et al., 2009). Street foods are prepared under unhygienic and displayed openly lead to high rate of contamination. Thus from the consumer health point of view, the microbial quality of street vendeed foods becomes very important as food acts, as a major source for transmission of food intoxications. Such street foods are frequently associated with diarrheal infections due to their improper handling and poor serving practices (Barro et al., 2006). The link between street foods and diarrhea has been recorded. It has been noted that most of the street vendors use bare





hands to serve the food. Staphylococcus aureus grows in such conditions and causes a serious form of food poisoning. Some of the studies have shown that most of the street venders and chat makers are lack formal education and have a few years of basic schooling. Therefore they have inadequate knowledge on proper food handling and their role in the transmission of food pathogens. The plates and utensils used at vending sites and chat centers are often cross contaminated from the vendors hands when they touch the food ingredients and preparation areas, dish washers and water. Results in cross contamination of microbes between dishwater, food preparation surfaces and food itself (Mensah et al., 2002). Today street food has become one of the major concerns of consumer and public health (Feglo et al., 2012) and potential for the rate of contamination of street foods with pathogenic organisms has been recorded and well documented.

Several outbreaks have been traced to consumption of contaminated street foods (Abdussalam et al., 1993). Street chats like Panipuri, Bhelpuri and Samosa sold in almost all the cities and towns throughout the country and widely consumed and frequently associated with diarrohoeal diseases due to their poor handling and serving practices. The present study aims to establish the rate of contamination of S.aureus and hygienic status of

street food panipuri at different localities of Gulbarga city, Karnataka, India.

MATERIALS AND METHODS: Selection of the sample collection Area: The study included 9 areas in Gulbarga where the number of panipuri consumers and vendors are concentrated. Sample collection and Processing: A total of 90 samples were collected from venders and chat centers in sterile screw capped bottles and transported immediately to the laboratory enriched in peptone broth by incubating at 37°C for 24 hrs. Isolation and Identification: The Pre-incubated samples were streaked on the surface of Baird-Parker (BPA) medium supplemented with Egg-yolk Tellurite Emulsion and Mannitol salt Agar (MSA) (Hi-Media), a selective media for S.aureus and incubated at 37°C for 24-48 hours. Black jet colonies formed on BPA and yellow colonies on MSA were considered presumptive S.aureus, Morphological identification of isolated bacterial colonies was done by using microscopic methods of (Sasidharan et al., 2011), confirmed with Coagulase and other biochemical tests. Other Biochemical tests were performed as per methodology described by Parkash (2007), Gundogan ( 2010) and Sasidharan (2011).

Figure:1. Characteristics of S.aureus colonies on MSA AND BPA media.





Table 1:Percentage incidence of S.aureus in various panipuri samples

Place Sample Size (n)

No. of Positive Isolates

1 Basaveshwar Hospital 10 08 2 Darga Road 10 07 3 Industrial Road 10 06 4 Jaya Nagar 05 01 5 Kusnoor Road 05 02 6 PDA Eng.College 10 04 7 Shopping Malls 05 01 8 University campus 05 02 9 Chat Centers 30 12 Total n=90 43

Figure 2: incident rate at different places

RESULTS AND DISCUSSION A Total of 90 samples were examined for the presence of S.aureus. About 47.7% of Panipuri samples showed typical black jet colonies on Baird-Parker Agar and yellow colour colonies on Mannitol salt agar, indicating the presence of S.aureus (Fig 1). Alarming the (80%) highest, incidence rate of S.aureus in the samples collected from Hospital surrounding areas followed by Darga road (70%) and least at shopping Malls (20%) (Table-1). The findings revealed that the prevalence of

S.aureus in panipuri collected at hospital area is highest (80%) which is similar to that reported by (Tambekar et al., 2011). This might be due to cross infection from hospital because of skin infections and contaminated water, utensils or through poor hygienic conditions, And least incidence was found (20%) at shopping malls which might be due to good hygienic and handling practices and the quality of ingredients and water used in the preparation of Panipuri. Even around the Darga road

0

20

40

60

80

8070

20

40 40

20

40

60

40

Incidence Rate %





incidence rate is 70% due to dusty road and overcrowded place consisting of many slaughterhouses. As we know the prevalence of MRSA occurs in meat and meat products that may be directly introduced in to the food by street venders by skin lesions or sneezing or coughing (Jay et al., 1997). We found 60% incidence rate at industrial road where the consumer rate was high. Which might be due to the dust and heavy pollutants in the air. As the locality indicates industrial area consists of workers and laborers might be due to Poor serving practices and poor quality water. Few reports say that potato masala is more contaminated than the khata pani. It could be due to high pH and more nutrients content of potato masala than khatta pani. The contamination of

Panipuri is high because of the conditions under which it is prepared and vended (Madhuchhanda Das et al., 2011). Our findings reveal the significant incidence ratio between streets vended panipuri and panipuri served in chat centers. Our study reveals (40%) incidence rate at Chat centers samples which is lesser than Street vended samples (51.6%), which may be due to the concern towards their chat centers, popularity and competition with other chat centers, made them to adopt good servicing practices (Fig 2).

CONCLUSION This study clearly indicates the rate of contamination of S.aureus is high in street vended panipuri in Gulbarga city. The presence of S.aureus in panipuri water may be due to skin lesions of workers or sneezing and coughing at public places. The location of the foodstuffs plays an important role in the rate of contamination. Our findings reveal that high rate of contamination occurred at hospital region and industrial area which may be due to the dusty area and heavy air particles posing a risk of food poisoning. Continous monitoring of street chats will help to improve their quality and creates the awareness of microbiological status of vended foods. This is an important hazard to human health. Provision of health education and Good handling practices to the venders and chat makers would improve a risk of bacterial contamination. Our findings indicate that need to be a strict monitoring and implementation of food serving practices in trade them.

REFERENCES Abdussalam M, Käferstein FK (1993). Safety of street foods. World Health Forum.14:191-194 Barro N, Bello AR, Savadogo A, Ouattara CAT, Ilboudo AJ, and Traore AS (2006). Hygienic status assessment of dish washing waters, utensils, hands and pieces of money from street food processing sites in Ouagadougou (Burkina Faso). African Journal of Biotechnology. 5(11): 1107-1112. Dardano C. 2003. Carribbean regional working group on

street food vendors. Report of FAO, PAHO and BNSI.

(Online) Available:

ftp:ftp.fao.org/es/esn/food/carribean_report.pdf.

Feglo P, Sakyi K.(2012). Bacterial contamination of street vending food in Kumasi. Ghana J Med Biomed Sci. 1:1-8. Gundogan, N., Devren, A., (2010). Protease and lipase activity of Staphylococcus aureus obtained from meat, chicken and meatball samples. GU J Sci. 23(4):381-384.

Parkash, M., Rajasekar, K. and Karmegam, N. (2007). Bacterial population of raw milk and their poroteolytic and lipolytic activities. Research Journal of Basic and Applied Sciences. 3(6):848-851. Madhuchhanda Das & Chandi C. Rath & U. B. Mohapatra (2012). Bacteriology of a most popular street food (Panipuri)and inhibitory effect of essential oils on bacterial growth. J Food Sci Technol. 49(5): 564–571. Mensah P, Manu DY, Darko KO, and Ablordey A (2002). Streets foods in Accra, Ghana: how safe are they? Bulletin of World Health Organization. 80(7): 546-554. Muzaffar AT, Huq I, and Mallik BA (2009). Entrepreneurs of the streets: an analytical work on the street food vendors of Dhaka city. International Journal of Business and Management. 4(2): 80-88. Sasidharan S, Prema B., Yoga, L.L. (2011). Antimicrobial drug resistance of Staphylococcus aureus in dairy products. Asian Pacific Journal of Tropical Biomedicine, 130-132.





Tambekar, D. H., Kulkarni, R. V., Shirsat, S. D. and Bhadange, D. G. (2011). Bacteriological quality of street vended food panipuri: A case study of Amaravati City (MS) India. Bioscience Discovery 2(3): 350-354.

Citation of this article: Deepa K. Chavan, Channappa T. Shivannavar , Subhaschandra M. Gaddad (2015). INCIDENCE OF Staphylococcus aureus IN STREET VENDED

PANIPURI AROUND THE GULBARGA CITY. Journal of Biotechnology and Biosafety. 3(5):303-307.

Source of Support: Nil Conflict of Interest: None Declared




MOLECULAR ANALYSIS AND IDENTIFICATION OF VANCOMYCIN RESISTANT GENES (vanA, vanB) and Tn1546 LIKE ELEMENTS AMONG

METHICILLIN RESISTANT Staphylococcus aureus (MRSA) ISOLATES FROM PATIENT SAMPLE IN KOLKATA- AN EMERGING THREAT

Research article

Manisha Chakraborty1, Anjan Kumar Basu1* _________________________

1M.Sc, West Bengal State University, Microbiology, Kolkata, West Bengal, India. 1*PhD, Demonstrator, Department of Biochemistry and Medical Biotechnology, School of Tropical Medicine, Kolkata, India. Corresponding author email: [email protected]

ABSTRACT Vancomycin is a glycopeptides antibiotic and important antimicrobial agent to treat pathogenic methicillin resistant Staphylococcus aureus (MRSA) but resistance finally emerges. This may be due to either presence of orf2 (resolvase) gene along with vanA gene or the presence of a truncated Tn1546 lacking orf2 or thickened cell wall. Orf2 is a transposable element, mostly found in glycopeptides resistant Enterococcus spp. and is transferred in other bacteria by plasmid or large chromosomal fragments. The rare vancomycin resistant Staphylococcus aureus (VRSA) carry transposon Tn1546 like element, acquired from vancomycin resistant Enterococcus faecalis which is responsible for altered cell wall structure and metabolism. The study was carried out to postulate the emergence of vancomycin resistant Staphylococcus aureus among isolates of human origin. This study also presents the type of resistance pattern that the Staphylococcus spp. has obtained in the course of the analysis. VanB gene, which is also highly responsible for the resistance, was also found in some VRSA isolates. Clinical isolates of Staphylococcus aureus (n= 151) were collected from OPD of Dermatology and Dept. of Microbiology. Species identification was confirmed by standard biochemical tests and other molecular tests like PCR amplification of gap gene and 16S-23S rDNA intergenic spacer region (ISR) analysis. The antibiotic-resistance profile of the Staphylococcal species was determined by the Disc Agar Diffusion (DAD) technique (against 16 antibiotics) and Minimum Inhibitory Concentration (MIC) testing (against vancomycin). The presence of all vancomycin resistant Staphylococcal isolates was determined by PCR amplification of mecA, vanA, vanB and orf2 genes. Out of n=151 isolates, n=108 isolates were found gram positive Staphylococcal strain and out of n=108 isolates, 10 isolates were resistant to methicillin and vancomycin (MIC ≥ 40µg ml-1 to ≥ 360µg ml-1). Out of 10 isolates all yielded mecA and vanB amplicons but only 4 isolates yielded vanA amplicon and 4 isolates showed the presence of orf2 genes. In this present study, orf2 was found in some VRSA isolates which may be transferred via plasmid conjugation from a glycopeptides resistant Enterococcus spp.. But all the VRSA isolates did not demonstrate vanA and orf2 (resolvase) gene. This study also presents the type of resistance pattern that the Staphylococcus spp. has obtained in the course of the analysis. VanB gene, which is also highly responsible for the resistance, was also found in some VRSA isolates.

Key words: VRSA, MRSA, Tn1546, PCR analysis, vanA, vanB. _________________________________________________________________________________




INTRODUCTION Staphylococcus aureus is a common cause of human disease ranging in severity from skin and soft tissue infections to osteomyelitis, bacteraemia and infective endocarditis (Noto et al., 2006). Staphylococcus aureus has developed resistance to most classes of antimicrobial agents. In India, 70% of strains show resistance to methicillin (Anupurba et al., 2003). Vancomycin, a glycopeptides antibiotic on times to be an important antimicrobial agent to treat MRSA but resistance finally emerges. Most gram-positive bacteria are naturally susceptible to glycopeptides antibiotics such as vancomycin and teicoplanin. Resistance to these agents is an intrinsic property of some Enterococcus spp. such as Enterococcus casseliflavus and Enterococcus flavescens (Woodford et al., 1995). Since antibiotics have been found and used for the treatment of infectious diseases, there was an enormously successful period in medical history during the last fifty years. However, the situation is now threatened by the indiscriminate use of antimicrobials by health providers or by way of self-prescribing and over-the- counter availability. There are major risk factors for the development of high levels of antimicrobial resistance, which is common in rural India and other developing countries. Now, it is well known that bacterial antibiotic resistance is mostly caused by the acquisition of new genes rather than by mutation, defined as Horizontal Gene Transfer. Many mobile genetic elements, such as plasmids, transposons, phages and integrons are responsible for the horizontal transfer of antibiotic resistant genes (Zong et al., 2010, Gagnon et al., 2011). The genetic exchange of resistance determinants between organisms of the same or different species is believed to play a crucial part in the evolution of antibiotic-resistant bacteria. Acquisition of glycopeptides resistance was first described in Enterococci in 1988 and is mediated by either of the three classes of related gene clusters: i) high levels of vancomycin and teicoplanin (vanA) ii) inducible resistance to various level of vancomycin (vanB) or iii) resistance to vancomycin and low levels of teicoplanin (vanD) (Ligozzi et al., 1998) VanA type Enterococci harbours a transposon Tn1546 like element, which is 10.8 kb and is the principal genetic element for vancomycin resistance. Tn1546 is predominantly found in plasmids and is composed of nine genes: vanR, vanS, vanH, vanA and vanX, which are required for the expression of resistance, orf1 and orf2, which encode transposase and resolvase enzymes respectively, vanY, that encodes a carboxypeptidase and vanT, which is arrested with teicoplanin resistance (Clark et al., 2005). The vanB cluster is mostly carried by large conjugative elements and less frequently by

plasmids (Quintiliani et al., 1994). In 1992, Noble et al., demonstrated in-vitro transfer of glycopeptide resistance from Enterococcus faecalis to Staphylococcus aureus, but report on natural transfer is rare.

The aim of the present study is to identify the emergence of vancomycin resistant MRSA among isolates of human origins by PCR amplification of vanA and vanB genes. The study also entails the findings of Tn1546 like elements (Enterococcus faecalis origin, Gene Bank accession no M. 97297) in vancomycin resistant Staphylococcus aureus by PCR amplification of the orf2, which is a resolvase gene.

METHODS

Human Isolates Clinical isolates of Staphylococcus aureus (n= 151), responsible for pyogenic skin infection, were collected from OPD of Dermatology, School of Tropical Medicine and Dept. of Microbiology, R.G.Kar Medical College and Hospital, Kolkata. All these strains were collected to study the antibiotic resistance profile of Staphylococcus aureus. All cultures were grown on nutrient agar (NA) medium and purified by a single colony isolates technique or NA containing 10% sodium. Vancomycin Resistant Enterococci (VRE) were obtained from Dept. of Bacteriology, School of Tropical Medicine, Kolkata. Identification of Isolates by Biochemical Methods Identification of the clinical isolates of Staphylococcus aureus was performed by traditional biochemical tests, including Catalase, Coagulase and Mannitol Salt Agar (MSA) fermentation test and Gram Staining methods. The molecular analysis of Staphylococcus aureus (previously confirmed by biochemical tests) was followed by PCR amplification of gap gene (Yugueros et al., 2000, Yugueros et al., 2001, Bal et al., 2010) as molecular identification tools. PCR analysis of 23S and 16S rDNA (Mendoza et al., 1998) intergenic spacer region analysis was also performed. Methicillin Resistant Staphylococcus aureus (MRSA) strain was characterized by PCR amplification of mecA gene (Khan et al., 2007). Antibiotic Susceptibility by Disc Agar Diffusion (DAD) Test The antibiotic-resistance profile was determined by the Disc Agar Diffusion (DAD) technique according to manual of Antimicrobial Susceptibility Testing (Coyle, 2005). The test bacterium taken from overnight cultures (inoculate from a single colony of MSA medium) were adjusted to 0.5 McFarland approximately 1.5×108




CFU/mL and diluted within 15 minutes to get inoculums of approximately 5×105 CFU/mL. With this culture, a bacterial lawn was prepared on Muller-Hinton Agar. The antibiotic discs were obtained commercially from Bio-disc, India and Himedia, India. For antibiotic-resistance profile 16 members of discs were used namely, Amoxicillin/Clavulanicacid(30µg/mL), Ciprofloxacin(5µg/mL), Azithromycin(15µg/mL), Ceftazidime(30µg/mL), Methicillin(5µg/mL), Norfloxacin(10µg/mL), Chloramphenicol(30µg/ml), Levofloxacin(5µg/ml), Amikacin(30µg/ml), Ofloxacin(5µg/ml), NaldixicAcid(30µg/mL), Streptomycin(10µg/mL), Cotrimoxazole(25µg/mL), Oxacillin(5µg/mL), Tetracycilne(30µg/mL), Vancomycin (30µg/mL). The diameter of the zone of bacterial growth inhibition surrounding the disc gave a profile of drug susceptibility vis-a-vis antibiotic resistance. Staphylococcus aureus MTCC 96 was used as all sensitive reference strain. Determination of MIC The MIC of vancomycin was determined by a broth micro dilution method using Muller-Hinton Broth (MHB; Himedia, India). The cultures grown overnight were adjusted to 0.5 McFarland approximately 1.5×108

CFU/mL and diluted to get inoculums of approximately 5×105 CFU/mL recommended by Clinical and Laboratory Standards Institute, 2007 (formerly NCCLS) (Wayne, 2007). Isolation of Plasmid DNA The plasmid of clinical isolates of Staphylococcus aureus (VRSA) was prepared by alkaline lysis with SDS: midi preparation method (Sambrook et al., 2007). Appropriate concentration of vancomycin was used as

selective pressure during the isolation of plasmids. The precipitated plasmid DNA was collected by centrifugation for 30 minutes at 12,000 r.p.m. The supernatant was discarded. The pellet was dried in a drier at 45oC for 45 minutes. The dried DNA was dissolved in 30 µL Tris-EDTA buffer and stored at -20

oC. Preparation of Genomic DNA 10mL over night clinical isolates of Staphylococcus aureus (VRSA) and MTCC 96 (all sensitive to antibiotics) were taken for genomic DNA extraction. Genomic DNA was extracted by sonication using the Optic Ivyman System CY500, connected to the horn, using the protocol mentioned by Zhang et al., (2005). Polymerase Chain Reaction (PCR) PCR amplification was performed with gradient thermal cycler, Takara Bio Inc, Japan (Model no.Tp 600) in a volume of 25µL. For all gene amplification, same 10X PCR buffer containing 120mM Tris-HCl (pH 8.8), 500mM KCl, 1% Triton® X-100, 100mM Lysine and 25mM MgSO4, was used. i) PCR Amplification of gap gene: For identification of Staphylococcus spp. PCR amplification of gap gene was done and gap gene oligonucleotide primers (Yugueros et al., 2001) were used as mentioned in Table 1. Bacterial genomic DNA (5mg) was added as template DNA to PCR mixture consisting of 10X PCR buffer, with trial concentration of 400µM dNTP and 0.8 µM of each primer. This mixture was supplemented with 1.25U of Taq DNA Polymerase. A total of 40 PCR cycles were run under the following conditions: DNA denaturation at 94oC for 20 seconds, annealing at 55oC for 30 seconds and DNA extension at 72oC.

Table 1: Primer Sequences of specific genes and amplicon sizes of PCR-amplified products of different genes of. Staphylococcus aureus

Specific gene for

amplification

Primer

Primer sequence (5’- 3’)

Expected Site of

Amplicon

Product obtained

Reference

gap

GF1 GR2

ATGGTTTTGGTAGAATTGGTCGTTTA GACATTTCGTTATCATACCAAGCTG

933 bp

933 bp

(Yugueros et al., 2000)

23SrDNA- 16SrDNA

ISR

G1 L1

GAAGTCGTAACAAGG CAAGGCATCCACCGT

Variable Variable (Mendoza et al., 1998)

mecA MF1 MR1

AGTTGTAGTTGTCGGGTTT AGTGGAACGAAGGTATCAT

645 bp 645 bp (Khan et al., 2007)

vanA VanA F VanA R

ATGAATAGATAAAAGTTGC TCACCCCTTTAACGCTAATA

1032 bp 474 bp

1029 bp 474 bp

215 bp

(Saha et al., 2008) (Chakraborty et al., 2011)

Present study

vanB VanB F VanB R

GTGACAAACCGGAGGCGAGGA CCGCCATCCTCCTGCAAAAAA

800 bp 800 bp 400 bp

200 bp

(Chakraborty et al., 2011) Present study Present study




ii) 16S – 23S rDNA intergenic Spacer PCR (ITS – PCR) analysis: 16S – 23S rDNA ITS – PCR polymorphisms were performed for the identification of Staphylococcus strains as mentioned by Mendoza et al., (1998).

iii) PCR Amplification of mecA gene: For amplification of mecA, oligonucleotide primers (Table 1) were used (Khan et al., 2007). PCR conditions for mecA comprised of a thermal temperature of 94oC for 30 seconds, annealing at 55oC for 30 seconds and extension at 72oC for 60 seconds. These parameters were maintained for a total of 30 cycles of reaction.

iv) PCR Amplification of vanA, vanB gene: The PCR amplification of mixture contained the following components: 1X PCR buffer, 2.5mM MgSO4, 400µM dNTP mix, 0.4µM of each primer, 0.1µg template DNA (plasmid DNA), 0.75 µL DMSO, 1 U taq Polymerase. Oligonucleotide primer was used as in Table 1. The amplification conditions were initial denaturation at 98oC for 2 minutes followed by 35 cycles of denaturation at 98oC for 10 seconds, annealing at 50oC for 1 minute and extension at 72oC for 90 seconds for vanA. For vanB (Table 1), the amplification conditions were optimized as, initial denaturation at 94oC for 10 minutes, 30 cycles with denaturation step at 94oC for 30 seconds, annealing 50oC for 45 seconds and extension at 72oC for 30 seconds.

v) PCR Amplification of Orf2 (resolvase): The primers for the amplification of orf2 (resolvase) were designated according to the sequence of Tn1546 (Genbank accession number M 97297) by IDT PrimerQuest software. The primer dimer, loop formation and annealing temperature were also calculated from the software. The oligonucleotide primers used in this reaction are mentioned in Table 1. The condition of the PCR amplification was standardized by Takara Gradient Thermal Cycler with varying temperature. The concentration of different constituents was also standardized and the experiment was done with the following optimized reaction mixture: 2.5µL of 10X PCR Buffer, 400µM dNTP mix, 0.2µM of each primer, 2ng template DNA (plasmid DNA), 1 U taq Polymerase and Nuclease Free Water as added to make the reaction volume 25µL, the optimized reaction condition is as followed: initial denaturation at 94oC for 90 seconds, followed by 35 cycles of danaturation at 94oC for 10 seconds; annealing at 60oC; elongation at 72oC for 90 seconds and final extension at

72oC for 4mintutes. For positive control, plasmid DNA of VRE was selected as template. Template DNA of E. coli (DH 5 alpha) was used as negative control in all PCR experiments.

vi) Genetic Transfer: Transformation was subjected as demonstrated by the following procedure of Honahan (1983), using vancomycin resistant plasmid isolated from Staphylococcal strain and vancomycin sensitive staphylococcal strain as recipient. Transformation resistant plasmid to vancomycin sensitive Staphylococcal strains was determined by preparing a lawn of recipient staphylococcal stains on Muller-Hinton Agar against the vancomycin antibiotic disc (30g/mL). Transformation was confirmed as positive only when resistant transformants were shown to contain a plasmid(s) of a size to that found in the resistant isolates.

V) Plasmid curing: Acridine orange treatment method described by Vivyan et al., 1972 was used for the curing of the resistant plasmids of the bacterial isolates.

RESULTS The clinical isolates (n=151) were identified using standard biochemical tests. Morphological analysis was performed by Gram staining method. Out of n=151 isolates, n=108 isolates (71%) were gram positive and n=43 (29%) isolates were gram negative. Out of n=108 isolates, 80% isolates showed Catalase positive. But all Catalase positive isolates were not Coagulase positive, only 53% of Catalase positive isolates were observed as Coagulase Positive Staphylococcus (COPS) and 47% were Coagulase Negative Staphylococcus (CONS). Out of n=108 isolates, 78% of isolates gave yellow colony in Mannitol Salt Agar medium.

PCR amplification of Glyceraldehyde 3-phosphate dehydrogenase (gap) gene using chromosomal DNA as template and specific primer (Table 1) yielded a 933 bp amplicon as envisaged (data not shown). These results confirmed that the clinical isolates i.e. n=108 were Staphylococcus strains.

PCR analysis of 16S-23S rDNA intergenic spacer sequence of Staphylococcal strains (n=108) showed 9 different types of band patterns (data not shown) using the primer in Table 1 for the samples collected from Kolkata (India) regions.

orf2

Tn F Tn R

GGGCCACATCCATGAGTAAA CGTCCTGCCGACTATGATTATT

540 bp

540 bp

Present study




PCR amplification of mecA gene yielded 645 bp amplicon (Fig. 1) using the specific primer (Table 1) for

all Oxacillin/Methicillin resistant isolates.

Fig. 1: PCR Amplification of mecA gene. Lane 1: Dermatological (DER) Samples, Lane 2: Methicillin Resistant Staphylococcus aureus (MRSA) Samples, Lane 3: OPD Bacteriology (BAC) Samples and Lane 4: Positive control represents all mecA positive isolates, the band size is 645 bp, Lane 5: E. coli (Negative control), Lane M: Molecular marker of 100 bp size. Antibiotic Susceptibility Tests: Many isolates that were found to be Staphylococcus spp., were resistant to many antibiotics namely Chloramphenicol, Ofloxacin, Norfloxacin, Ceftazidime, Nalidixic acid, Streptomycin, Amoxicillin, Levofloxacin, Methicillin, Azithromycin, Co-trimoxazole, Oxacillin and Vancomycin. The antibiotic resistance profile, as determined by DAD test, revealed that out of n=108 gram positive isolates, 79% were resistant to Oxacillin, 67% to Ceftazidime, 79% to Nalidixic acid and 82% to Amoxicillin (Fig. 2). These results indicate that the strains were multi drug resistant.

Fig. 2: Multidrug resistance pattern of Staphylococcus isolates (n=151).




From the DAD test only 10% of clinical isolates showed resistance to vancomycin (Table 2). Confirmation of vancomycin resistance was obtained from the DAD test since no zone of inhibition surrounding the vancomycin disc (30µg/mL) was observed (Fig. 3). Zone of inhibition around the vancomycin disc were observed in many Staphylococcal isolates were found to be susceptible to vancomycin (Fig. 4). The MIC of vancomycin for the Vancomycin Resistant Staphylococcus aureus (VRSA) isolates were found to range from 40 µg/mL to 360 µg/mL (Table 2).

Fig. 3: Staphylococcal isolates found to be vancomycin resistant since no zone of inhibition was observed. Fig. 4: Staphylococcal isolates found to be vancomycin susceptible since zone of inhibition was observed surrounding the vancomycin disc.

Table 2: Biochemical and Molecular Study of Vancomycin Resistant Staphylococcus aureus (VRSA)

Analysis of vanA, vanB and orf2 (resolvase) genes: Only 4 isolates out of 10 VRSA isolates yielded vanA amplicons in three different positions viz. 1029 bp (Saha et al., 2008), 474 bp (Chakraborty et al., 2011) and a new band position i.e. 215 bp was observed in this present study (Fig. 5) when plasmid DNA was used as template and all VRSA isolates yielded 800 bp, 400 bp and 200 bp vanB amplicons from Chromosomal DNA preparation (Fig. 6). Two new band positions of vanB were observed in this present study i.e. 400 bp and 200 bp.

Isolates Gram staining

Catalase Coagulase MSA mec-A gene resistance

MIC VanA VanB Orf2

DER 4 +ve, Staph +ve +ve +ve +ve 40µg mL-1 +ve +ve +ve

DER7 +ve, Staph +ve -ve +ve +ve 360 µg mL-1 -ve +ve +ve

DER 10 +ve, Staph +ve +ve +ve +ve 60 µg mL-1 +ve +ve -ve DER12 +ve,Staph +ve +ve +ve +ve 140 µg mL-1 +ve +ve -ve DER14 +ve,Staph +ve -ve +ve +ve 60 µg mL-1 -ve +ve +ve

MRSA 27 +ve,Staph +ve -ve -ve +ve 80 µg mL-1 -ve +ve -ve

MRSA 28 +ve,Staph -ve +ve +ve +ve 60 µg mL-1 -ve +ve -ve MRSA 49 +ve,Staph +ve -ve +ve +ve 40µg mL-1 -ve +ve +ve MRSA 56 +ve,Staph +ve +ve +ve +ve 280 µg mL-1 +ve +ve -ve

BAC 6 +ve,Staph +ve -ve +ve +ve 60 µg mL-1 -ve +ve -ve




Fig. 5: PCR Amplification of vanA gene of the vancomycin resistant Staphylococcus aureus (VRSA) isolates. Lane 1: DER 4, Lane 2: DER 10, Lane 3: DER 12, Lane 4: MRSA 56, Lane 5: E. coli (Negative control), Lane M: Molecular marker of 100 bp size.

Fig. 6: PCR Amplification of vanB gene of the VRSA isolates. Lane 1: DER 4, Lane 2: DER 7, Lane 3: DER 10, Lane 4: DER 12, Lane 5: DER 14, Lane 6: MRSA 27, Lane 7: MRSA 28, Lane 8: MRSA 49, Lane 9: MRSA 56, Lane 10: BAC 6, Lane 11: E. coli was considered as negative control.

The presence of resolvase gene of the vanA cluster in the clinical isolates was investigated by PCR performed with primers of orf2 (Table 1). Out of 10 VRSA isolates only 4 isolates showed the presence of orf2 genes (Fig. 7) from which 3 isolates did not contain vanA gene. Only one isolate contained both orf2 and vanA genes together.




Fig. 7: PCR Amplification of orf2 (resolvase) gene of the VRSA isolates. Lane 1: Vancomycin Resistant Enterococci (VRE, Positive control), Lane 2: DER 4, Lane 3: DER 7, Lane 4: DER 14, Lane 5: MRSA 49, represents all orf2 positive isolates, the band size is 540 bp; Lane 6: E. coli (Negative control), Lane M: Molecular marker of 100 bp size.

Genetic Transfer: The recipient vancomycin sensitive Staphylococcal strain, that undergone the transformation process, was found vancomycin resistant. Presence of transformation positive vancomycin resistance Staphylococcus aureus was obtained from the DAD test since no zone of inhibition surrounding the vancomycin disc (30µg/mL) was observed.

DISCUSSION Our report indicates the finding of VRSA from the isolates that recovered from OPD of Dermatology, School of Tropical Medicine and Dept. of Microbiology, R.G. Kar Medical College and Hospital, Kolkata. From the morphological and biochemical analysis we obtained that out of n=151 isolates n=46 isolates were Staphylococcal strain since all gave positive result in all the biochemical tests. Molecular methods that facilitate identification of Staphylococcus to the species level thus the gap gene amplification was performed as confirmatory test of Staphylococcus spp. which was found to be positive. PCR amplification of 16S – 23S rDNA intergenic Spacer sequence has been evaluated as determination methods for Staphylococcus aureus and gave positive result (data not shown). PCR amplification of mecA confirmed the presence of Methicillin Resistant Staphylococcus aureus (MSRA). On the basis of our study the DAD test confirms the presence of multi drug resistant Staphylococcus aureus. These multi drug resistant isolates can be treated by the glycopeptide antibiotics such as vancomycin and

teicoplanin in case of severe infections. However, these have shown to have attained glycopeptide resistance in our study. We found n=10 Staphylococcal isolates to be resistant to vancomycin by obtaining no zone of inhibition surrounding the vancomycin disc (30µg/mL) from the DAD test and determining the MIC of vancomycin ranging from ≥ 40µg/ml to ≥ 360 µg/mL. This high value of MIC was may be due to the presence of vanA gene cluster carried by Tn1546 like transposable genetic element (Clark et al., 2005) which can induce resistance to high levels of Glycopeptides or the presence of thicker, more irregular cell walls than the glycopeptides susceptible ones (Daum et al., 1992). However, on treatment with these Glycopeptides, antibiotics may increase a type of bacterial infection that has inducible resistance to high levels of the antibiotics which itself would be a clinical hazard, and might even be fatal for patients. In our present study, PCR analysis identified the presence of vanA, vanB and orf2 genes in vancomycin-resistant Staphylococcal isolates. VanA type




Enterococci harbours a transposon Tn1546 like element. In vitro conjugative transfer of the vanA gene from Enterococci to Staphylococcus aureus was demonstrated in 1992 (Noble et al., 1992). According to previous studies the possibility of the occurrence of vancomycin resistance gene (vanA) in Staphylococcus aureus is due to the horizontal gene transfer of vanA from Vancomycin Resistant Enterococcus spp. (VRE). According to our study, all VRSA isolates yielded amplicon of vanB gene but only 4 strains containing both vanA and vanB genes were found by PCR. VanA and vanB clusters encode vancomycin, dipeptide like termini (D-Ala- D-Lac) which plays a crucial role in resistance mechanism to glycopeptides (Malathum et al., 1999). Some isolates did not amplify vanA gene but were found to be resistant to Vancomycin. The resistance pattern of VRSA isolates in vanA negative isolates may be due to an intrinsic mechanism of augmented cell-wall synthesis. It was reported that the resistance mechanism of VRSA isolates in vanA negative samples can be explained by three findings: i) the cell wall appeared twice as thick as the wall of control strains on electron microscopy (Tiwari et al., 2006) ii) threefold increase in the production of both Penicillin and Penicillin-binding protein and iii) threefold increase in production of cell wall murein precursors compared with vancomycin susceptible MRSA strain (Hiramatsu et al., 1997).

Our report indicates that all VRSA isolates did not contain orf2. Out of 4 isolates containing orf2, only 1 isolate was found containing both orf2 and vanA gene and rest were vanA negative but vanB positive. All vanA containing isolates 3 isolates did not show the presence of orf2. The possibility that the clinical isolates contained a truncated Tn1546 lacking orf2 was excluded by the very low level of identity in the sequence downstream from vanZ and the lack of the right terminal (IRR) which ends Tn1546 like transposons (Ligozzi et al., 1998).

Genetic transfer of plasmid validates that the Tn1546 that carries vanA gene is one of the reasons for the resistance of Staphylococcus aureus against Vancomycin.

These results indicate that transposition plays an important role in dissemination of the van gene cluster among Staphylococcal isolates from clinical isolates of Enterococci by exchanging genetic information which leads to reduce susceptibility.

CONCLUSION Transfer of vancomycin resistance from one Staphylococcus aureus to another Staphylococcus aureus or from Enterococcus faecalis to Staphylococcus aureus has threatening implications for the global dissemination of such high level glycopeptides resistance in clinical isolates. Although the origin of Tn1546 like genetic element /VanA gene cluster is Enterococcus spp, but the alarming rise of resistance pattern of Staphylococcus spp through these transposable genetic elements is quite worrisome. In the present study, the transformation experiment confirmed that the vancomycin resistant Staphylococcal strains that harboured plasmids were able to transfer their resistance plasmids to vancomycin susceptible Staphylococcal strain. Plasmid–determined resistance to vancomycin was found. We have also found vanA negative VRSA isolates to be present in Kolkata region; it may be due to the thickness of cellwall which acts as a barrier for the entry of antibiotics into cell. We observed a truncated version of Tn1546 like element lacking orf2 (resolvase) in Kolkata region. A further study is needed for the quantification of vanA/vanB gene cluster to correlate the increasing MIC value by Real Time PCR analysis. Infection–control precautions should be initiated by the scientists and clinicians to prevent the spread of VRSA as it may soon become a global concern, unless antimicrobial agents are used more prudently.

Acknowledgement We are very thankful to our Director Prof. Nandita Basu for allowing us to complete this research work with the financial support from faculty fund of Calcutta School of Tropical Medicine. We are also thankful to Dr. Reena Ghosh, Dept. of Microbiology, R.G.Kar Medical College, Kolkata and Smt. Ananya Tarafder for the assistance in acquiring the MRSA isolates. We have no conflict regarding the commercial or financial support.

REFERENCES

Anupurba, S., Sen, M. R., Nath, G., Sharma, B. M., Gulati, A. K., Mohapatra, T. M.( 2003) Prevalence of methicillin resistant Staphylococcus aureus in a tertiary referral hospital in eastern Uttar Pradesh. Indian J Med. Microbiol. 21:49-51.

Bal, E. B. B., Bal, M. A., Isevi, T., Yula, E. (2010) Application of PCR-RFLP of gap gene method as a molecular typing tool for coagulase negative Staphylococci from bovine and human origin identified with VITEK2. African J Microbiol Res. 4:775-782.




Chakraborty, S. P., Mahapatra, S. K., Bal, M., Roy, S. (2011) Isolation and identification of vancomycin resistant Staphylococcus aureus from post operative pus samle. Al Ameen J Med Sci. 4:152-168. Clark, N. C., Weigel, L. M., Patel, J. B., Tenover, F. C. (2005) Comparison of Tn1546 like elements in vancomycin-resistant Staphylococcus aureus isolates from Michigan and Pennsylvania. Antimicrob Agents Chemother. 49:470-472.

Coyle, M. B. (2005) Manual of antimicrobial susceptibility testing. American Society for

Microbiology. Washington.

Daum, R. S., Gupta, S., Sabbagh, R., Milewski, W. M. (1992) Characterization of Staphylococcus aureus isolates with decreased susceptibility to vancomycin and teicoplanin: isolation and purification of a constitutively produced protein associated with decreased susceptibility. J Infect Dis. 166:1066–1072. Gagnon, S., Levesque, S., Lefebvre, B., Bourgault, A.

M., Labbé, A. C., Roger, M. (2011) VanA-containing Enterococcus faecium susceptible to vancomycin and teicoplanin because of major nucleotide deletions in Tn1546. J Antimicrob Chemother. 66:2758-2762.

Hiramatsu, K., Hanaki, H., Ino, T., Yabuta, K., Oguri,

T., Tenover, F. C. (1997) Methicillin-resistant Staphylococcus aureus clinical strain with reduced vancomycin susceptibility. J Antimicro Chemother. 40:135-146.

Honahan, D. (1983) Studies in Transformation of Escherichia coli with plasmids. J Mol Biol. 166:557-580.

Ligozzi, M., Lo, C. G., Fontana, R. (1998) VanA gene cluster in a vancomycin resistant clinical isolate of Bacillus circulans. Antimicrob Agents Chemother. 42:2055-2059.

Malathum, K., Murray, BE. (1999) Vancomycin-resistant Enterococci: recent advances in genetics, epidemiology and therapeutic options. Dru Resist Updat. 2:224-243. Mendoza, M., Meugnier, H., Bes, M., Etienne, J., Freney, J. (1998) Identification of Staphylococcus species by 16S-23S rDNA intergenic spacer PCR analysis. Int J Syst Bacteriol.48:1049-1055.

Noble, W. C., Virani, Z., Cree, R. G. (1992) Co-transfer of vancomycin and other resistance genes from

Enterococcus faecalis NCTC 12201 to Staphylococcus aureus. FEMS Microbiol Lett. 72:195-198.

Noto, M. J., Archer, G. L. ( 2006) A subset of Staphylococcus aureus strains harboring Staphylococcal cassette chromosome mec (SCC mec) type IV is deficient in CcrAB- mediated SCC mec excision: Antimicrob Agents Chemother.50:2782-2788.

Quintiliani, R (JR.). (1994) Courvalin P. Conjugal transfer of the vancomycin resistance determinant VanB between Enterococci involves the movement of large genetic elements from chromosome to chromosome. FEMS. Microbiol Lett. 119:359-363.

Khan, A. U., Sultan, A., Tyagi, A., Zahoor, S., Akram,

M., Kaur, S. et al. (2007) Amplification of mecA gene in multi-drug resistant Staphylococcus aureus strains from hospital personnel. J Infect Dev Ctries. 1:289-295.

Saha, B., Singh, A. K., Ghosh, A., Bal, M. (2008) Identification and characterization of a vancomycin-resistant Staphylococcus aureus isolated from Kolkata (South Asia). J Med Microbiol. 57:72-79.

Sambrook, J., Russell, D. W. (2007) Molecular Cloning: A laboratory Manual, third ed. Vol 1. Spring harbour laboratory press. New York.

Tiwari, H. K., Sen, M. R. (2006) Emergence of vancomycin resistant Staphylococcus aureus (VRSA) from a tertiary care hospital from northern part of India. BMC Infect Dis. 6:156-161.

Vivyan, E., Hedges, R.W., Datta, N. (1972). Two modes of curing transmissible bacterial plasmids. J Gen Microbiol.70:443-452.

Wayne, P. A. (2007) Clinical and Laboratory Standards Institute (Formally NCCLLS) Performance standards for antimicrobial susceptibility testing; Seventeenth Informational Supplement. CLSI document M100-S17.19087-1898, USA.

Woodford, N., Johnson, A. P., Morrison, D., Speller, D. C. (1995) Current perspectives on glycopeptide resistance. Clin Microbiol Rev. 8:585-615.

Yugueros, J., Temprano, A., Berzal , B., Sanchez, M.,

Hernanz, C., Luengo, J. M. (2000) Glyceraldehyde-3-phosphate dehaydrogenase-encoding gene as a useful taxonomic tool for Staphylococcus spp. J Clin Microbiol.; 38:4351-4355.

Yugueros, J., Temprano, A., Sanchez, M., Luengo, J. M, Naharro, G. (2001) Identification of Staphylococcus




spp. by PCR-restriction fragment length polymorphism of gap gene. J Clin Microbiol. 39:3693-3695.

Zhang, L., Foxman, B., Gilsdorf, JR., Marrs, C. F. (2005) Bacterial genomic DNA isolation using sonication for microarray analysis. Bio Technic. 39:640-644.

Zong, M., Alam, M. J., Shinoda, S., Shi, L. (2010) Occurrence and characteristics of class 1 and 2 integrons in clinical bacterial isolates from patients in South China. J Health Sci. 56:442-450.

Citation of this article: Manisha Chakraborty, Anjan Kumar Basu (2015). MOLECULAR ANALYSIS AND IDENTIFICATION OF VANCOMYCIN RESISTANT GENES (vanA, vanB) and Tn1546 LIKE ELEMENTS AMONG METHICILLIN RESISTANT Staphylococcus aureus (MRSA) ISOLATES FROM PATIENT SAMPLE IN KOLKATA- AN EMERGING THREAT. Journal Of Biotechnology and Biosafety. 3(5):308-318

Source of Support: Nil Conflict of Interest: None Declared

Documents

Journal of Biotechnology and Biosafetyjobb.co.in/docs/vol3_issue5/all.pdf · Journal of Biotechnology and Biosafety ... Dr. Kavita Sharma, Phd ... which is similar to that reported