lable at ScienceDirect

Journal of Human Evolution 79 (2015) 55e63

Contents lists avai

Journal of Human Evolution

journal homepage: www.elsevier .com/locate/ jhevol

Insights into hominin phenotypic and dietary evolution from ancientDNA sequence data

George H. Perry a, *, Logan Kistler a, Mary A. Kelaita b, Aaron J. Sams c

a Departments of Anthropology and Biology, Pennsylvania State University, University Park, PA 16802, USAb Department of Anthropology, University of Texas at San Antonio, San Antonio, TX 78249, USAc Department of Biological Statistics and Computational Biology, Cornell University, Ithaca, NY 14853, USA

a r t i c l e i n f o

Article history:Received 21 February 2014Accepted 28 October 2014Available online 3 January 2015

Keywords:PaleogenomicsHominin evolutionary ecologyGene content variationCopy number variation

* Corresponding author.E-mail address: ghp3@psu.edu (G.H. Perry).

http://dx.doi.org/10.1016/j.jhevol.2014.10.0180047-2484/© 2014 Elsevier Ltd. All rights reserved.

a b s t r a c t

Nuclear genome sequence data from Neandertals, Denisovans, and archaic anatomically modern humanscan be used to complement our understanding of hominin evolutionary biology and ecology through i)direct inference of archaic hominin phenotypes, ii) indirect inference of those phenotypes by identifyingthe effects of previously-introgressed alleles still present among modern humans, or iii) determining theevolutionary timing of relevant hominin-specific genetic changes. Here we review and reanalyze pub-lished Neandertal and Denisovan genome sequence data to illustrate an example of the third approach.Specifically, we infer the timing of five human gene presence/absence changes that may be related toparticular hominin-specific dietary changes and discuss these results in the context of our broader re-constructions of hominin evolutionary ecology. We show that pseudogenizing (gene loss) mutations inthe TAS2R62 and TAS2R64 bitter taste receptor genes and the MYH16 masticatory myosin gene occurredafter the hominin-chimpanzee divergence but before the divergence of the human and Neandertal/Denisovan lineages. The absence of a functional MYH16 protein may explain our relatively reduced jawmuscles; this gene loss may have followed the adoption of cooking behavior. In contrast, salivary amylasegene (AMY1) duplications were not observed in the Neandertal and Denisovan genomes, suggesting arelatively recent origin for the AMY1 copy number gains that are observed in modern humans. Thus, ifearlier hominins were consuming large quantities of starch-rich underground storage organs, as previ-ously hypothesized, then they were likely doing so without the digestive benefits of increased salivaryamylase production. Our most surprising result was the observation of a heterozygous mutation in thefirst codon of the TAS2R38 bitter taste receptor gene in the Neandertal individual, which likely wouldhave resulted in a non-functional protein and inter-individual PTC (phenylthiocarbamide) taste sensi-tivity variation, as also observed in both humans and chimpanzees.

© 2014 Elsevier Ltd. All rights reserved.

Ancient DNA-aided reconstruction of hominin evolutionarybiology and behavior

Nuclear DNA sequence data from individuals of extinct homininpopulations and species d and even archaic anatomically modernhuman populations d can be used to complement our paleoan-thropological and archaeological understandings of homininevolutionary biology and ecology. To date, high-coverage ancientDNA complete nuclear genome sequence data from two archaichominin individuals have been published: i) a Neandertal (Homoneanderthalensis) from Denisova Cave in the Siberian Altai

Mountains (~30x sequence coverage; Prüfer et al., 2014), and ii) arepresentative of a not-yet named but putatively distinct homininpopulation, herein referred to as a ‘Denisovan’ (~30x sequencecoverage; Meyer et al., 2012), whose existence has been inferredthrough genomic sequence data recovered from a distal finger boneand an upper molar that were also collected at the same DenisovaCave site (Krause et al., 2010; Reich et al., 2010). Medium-to high-coverage DNA sequence data fromnuclear gene coding regions only(the ‘exome’) are also now available from an additional twoNeandertal individuals, one from El Sidr�on Cave in Spain and onefrom Vindija Cave in Croatia (~12x and ~42x sequence coverage,respectively; Castellano et al., 2014).

Excitingly for paleoanthropologists, the discovery of relativelylow levels of nuclear genome introgression from Neandertal andDenisovan populations to a subset of surviving modern human

G.H. Perry et al. / Journal of Human Evolution 79 (2015) 55e6356

populations (Reich et al., 2010; Meyer et al., 2012; Prüfer et al.,2014; Sankararaman et al., 2014; Vernot and Akey, 2014) providesnot only an opportunity to study archaic admixture and populationhistory, but also the ability to reconstruct major aspects of Nean-dertal and Denisovan biology in a relatively straightforwardmanner. That is, we can now study modern human phenotypic andgenetic variation using genome wide association study (GWAS)approaches for any originally introgressed genome segment thatremains in the modern human gene pool in order to infer thebiological characteristics of Neandertals and Denisovans. While thevalue of this approach has been demonstrated on a case-by-casebasis, for example with potential light skin-associated alleles inNeandertals (Vernot and Akey, 2014) and a high altitude-relatedadaptation in Denisovans (Huerta-Sanchez et al., 2014), we expectthat anthropologists can look forward to the publication of muchmore comprehensive analyses along these lines in the comingyears.

It is otherwise also possible, but considerably more difficult dueto the need for functional or experimental validation, to makephenotypic inferences about Neandertals and Denisovans from thedirect study of their nuclear genome sequences. The best currentexample is work on a Neandertal-specific melanocortin 1 receptor(MC1R) gene variant that likely conferred light skin and red hairphenotypes (Lalueza-Fox et al., 2007). A recent analysis identified asignificant enrichment for Neandertal-specific nonsynonymous(amino acid-changing) substitutions within genes involved inskeletal development, specifically lordotic curvature (Castellanoet al., 2014). The potential phenotypic consequences of these ge-netic changes have not yet been identified.

Finally, analyses of ancient DNA sequence data may benefit ourreconstructions of hominin evolutionary biology and behavior byletting us infer the timing of relevant genetic changes that distin-guish humans (Homo sapiens) from chimpanzees. Based on ana-lyses of nuclear genome sequence data, Neandertals andDenisovans are more closely related to each other than either is tohumans, with estimated Neandertal-Denisovan divergence of~380 kya (thousands of years ago) and divergence of that lineagefrom the human lineage of ~550e590 kya (Prüfer et al., 2014).Medium-coverage ancient DNA nuclear genome sequence datahave also been published for anatomically modern humans datedto ~12.6 kya from Montana, USA (~14x sequence coverage;Rasmussen et al., 2014), ~4 kya from Greenland (~20x sequencecoverage; Rasmussen et al., 2010), ~7 kya and ~8 kya from Europe(~19x and ~22x sequence coverage, respectively; Lazaridis et al.,2014), with other nuclear genomes from similarly-dated or evenolder modern human individuals published at lower coverage (e.g.,Keller et al., 2012; Lazaridis et al., 2014; Olalde et al., 2014;Raghavan et al., 2014). Thus, this particular approach has limitedresolution d we are presently only able to determine whether thehominin-specific gene changes in question occurred prior to ormore recently than ~600 kya, or between this time and the rela-tively recent past. Yet, such analyses still have the potential toprovide insight into the timing of hominin phenotypic evolutionand behavioral ecology transitions.

Hominin dietary evolution

In this article, we illustrate the method and potential value ofthe evolutionary timing approach through consideration of pub-lished ancient DNA nuclear genome sequence data for genes andgenetic changes with hypothesized relevance to outstandingquestions of hominin dietary evolution. A number of major dietarytransitions have occurred during the ~6 million years of homininevolution, including substantial increases in the consumption ofmeat and starch, the cooking of food, and the domestication of

plants and animals (Wrangham and Conklin-Brittain, 2003; Ungaret al., 2006; Luca et al., 2010). These transitions, in turn, are hy-pothesized to have played critical roles in other major aspects ofhominin evolution, including encephalization, molar size reduc-tion, dispersals out of Africa, pair bonded social structure, andsedentism (e.g., Leonard and Robertson, 1992; Aiello and Wheeler,1995; Milton, 1999; Stanford, 1999; Wrangham et al., 1999; Mann,2000; Diamond, 2002; Carmody and Wrangham, 2009;Wrangham and Carmody, 2010). Therefore, understanding the na-ture and timing of these major dietary transitions is important forour broader reconstruction of hominin evolutionary ecology.However, with the exception of the agricultural transition, giventhe rarity or absence of direct evidence from the hominin fossilrecord there is considerable uncertaintyd or even strong debatedabout the time periods during which these dietary shifts occurred(de Heinzelin et al., 1999; Laden andWrangham, 2005; Bunn, 2006;McPherron et al., 2010; Roebroeks and Villa, 2011; Gowlett andWrangham, 2013).

The relationship between DNA sequence and phenotype isrelatively simple for some diet-related genes. This is due, at least inpart, to the specific functional roles of digestive enzymes and tastereceptors. Multiple diet-related gene presence/absence sub-stitutions distinguish modern humans from chimpanzees; func-tional interpretations are made more readily for these moleculardifferences than for individual nucleotide substitutions at non-synonymous (amino acid changing) or regulatory sites. The timingsof associated phenotypic changes in our evolutionary history thatmay inform our understanding of hominin dietary transitions arethus readily interpretable through the analysis of ancient DNAsequence data. Here we review or determine the evolutionarytiming of all non-olfactory receptor, hominin-specific diet-relatedgene function gain and loss changes that are known to us, discussthe potential significance of these results, and look forward to po-tential future extensions of this approach.

Diet-related gene losses in hominin evolution

First consider a gene whose functionality has been conservedand maintained by purifying selection (i.e., functional constraint)across most or all studied mammals, over hundreds of millions orbillions of years of combined evolutionary history, but then lostsometime during hominin evolution. Based on our knowledge ofthe single nucleotide and small insertion/deletion mutation rateswe can infer that potential gene inactivating mutations d thosethat i) introduce a premature stop codon, ii) obliterate a criticalexon/intron splice site, iii) alter the start codon, or iv) result in acoding sequence frameshift and thereby alter all downstreamamino acidsd occur regularly (e.g., Yamaguchi-Kabata et al., 2008;Yngvadottir et al., 2009; MacArthur and Tyler-Smith, 2010; Mac-Arthur et al., 2012). Typically, functional gene loss via one of thesemutational mechanisms would be detrimental to individual fitnessand therefore the mutationwould be removed from the populationby purifying natural selection. However, changes in an organism'senvironment or behavior (or, possibly, compensatory evolution atother genes) may obviate the function of the gene's encoded pro-tein product or make it less critical to individual fitness, such thatpseudogenizing mutations may then increase in frequency andbecome fixed in a population or species.

A good example of this phenomenon is the convergent func-tional loss of the blue opsin gene (OPN1SW) in many nocturnalmammals, including some nocturnal primates, resulting in mono-chromatic vision (Jacobs et al., 1996; Tan et al., 2005; Bowmakerand Hunt, 2006). Under this framework, if we have knowledgeabout the function of a gene in question and can make inferencesabout the environmental or behavioral changes that likely

G.H. Perry et al. / Journal of Human Evolution 79 (2015) 55e63 57

preceded or were associated with its functional loss, then studies ofthe timing of those gene losses can help to reconstruct the evolu-tionary and ecological history of a species inways that complementand extend information available through the fossil record.

We analyzed the Neandertal and Denisovan high-coveragecomplete nuclear genome sequence data (Supplementary OnlineMaterial [SOM]) to study the evolutionary history of four poten-tial diet-related genes harboring hominin lineage-specific pseu-dogenizing substitutions or function-eliminating mutations:MYH16, TAS2R62, TAS2R64, and TAS2R38. As an anatomicallymodern human ancient DNA control, we assessed the medium-coverage nuclear genome sequence data from the ~12.6 kya Mon-tana individual using identical methods. The sarcomeric myosingeneMYH16 is expressed specifically in the masticatory muscles ofnon-human primates, but the full protein cannot be produced inhumans due to an invariant 2 bp (base pair) deletion in exon 18that results in a frameshift of the downstream amino acid sequenceand a subsequent premature stop codon (Stedman et al., 2004).Presumably as a result, temporalis muscle Type II fibers aresignificantly smaller in humans than in macaques, and the loss ofthis gene may at least partly explain the greatly reduced mastica-tory muscle apparatus in humans relative to other catarrhine pri-mates (Stedman et al., 2004). We hypothesize that the functionalloss of a gene that otherwise encodes an important masticatorymuscle proteinmay very well have followed hominin control of fireand the advent of consistent cooking behavior, which results insubstantial food softening and reduces demand on the masticatoryapparatus (Wrangham and Conklin-Brittain, 2003; Dominy et al.,2008).

TAS2R62, TAS2R64, and TAS2R38 are bitter taste receptors. InTAS2R62 and TAS2R64 there are two and one premature stopcodon mutations, respectively, that are observed among allhumans and are hominin-specific among studied primates,although orangutans do have a different premature stop codonmutation that likely also inactivates their TAS2R64 gene (Parryet al., 2004; Go et al., 2005; Wang et al., 2006). To the best ofour knowledge, the specific bitter molecules targeted by thefunctional versions of these receptors are not yet known. Such afunctional assessment would be of potential value for the recon-struction of hominin dietary evolution, because those TAS2R pro-teins possibly target substances that are common in the diets ofmost or all great ape species but were absent from or less prev-alent in the hominin environment or dietary intake over at leastpart of our evolutionary history.

In contrast, the hominin-specific functional mutations in theTAS2R38 gene are not fixed among humans, and they also do notresult in a true pseudogene. Rather, there is a common haplotype atthis gene containing nonsynonymous mutations corresponding toamino acid positions 49, 262, and 296. The protein encoded by theancestral haplotype responds to the bitter compound phenylthio-carbamide (PTC), whereas that encoded by the derived haplotypedoes not (Bufe et al., 2005). The functional variation at this locusexplains the majority of human phenotypic variance in PTC sensi-tivity (Kim et al., 2003). The two functional haplotypes are bothobserved at intermediate frequencies in human populations andare associated with a pattern of genetic variation that suggests ahistory of balancing selection (Wooding et al., 2004). Interestingly,the chimpanzee TAS2R38 gene is also functionally variable due to adifferent intermediate frequency haplotype (in this case, a startcodon-altering mutation) that helps to explain similar variation inchimpanzee PTC sensitivity (Wooding et al., 2006). This findingsuggests the intriguing possibility of convergent balancing selec-tion at this bitter taste receptor locus in humans and chimpanzees,related to an unknown factor that may be common to the envi-ronments and diets of both species.

MYH16, TAS2R62, and TAS2R64 pseudogenizing mutations occurredprior to ~600 kya

We aligned the Neandertal and Denisovan sequence reads to thehominin-specific pseudogenes MYH16, TAS2R62, and TAS2R64. Thepseudogene-causing substitutions are a 2 bp frameshift deletion inthe sarcomeric myosin gene MYH16, and two and one stop codonmutations in the TAS2R62 and TAS2R64 bitter taste receptor genes,respectively. Both the Neandertal and Denisovan consensus se-quences were identical to the human reference sequence in allcases (Fig. 1), with no evidence of any variation within either in-dividual at these sites. Thus, the functionality of these three geneswas likely lost prior to the ~550e590 kya divergence of the humanand Neandertal/Denisovan lineages. We note the remote possibil-ity, which we consider very unlikely given the age and location ofthe sequenced archaic hominins, that the derived Neandertal andDenisovan variants at these genes reflect admixture with anatom-ically modern humans, rather than the shared ancestry of pseu-dogenizing mutations that occurred earlier in hominin evolution.This possibility could be formally excluded once nuclear genomesequences become available from Neandertal or Denisovan popu-lation samples.

In the absence of information on the compounds recognized bythe proteins encoded by the TAS2R62 and TAS2R64 bitter taste re-ceptors, we are currently unable to make specific inferences abouthominin dietary history or evolutionary ecology on the basis of thisinformation. However, the functional MYH16 protein is expressedin masticatory muscles; its absence in humans may explain ourrelatively reduced jaw muscles and Type II muscle fiber size(Stedman et al., 2004). We suggest that the hominin-specific loss ofthis protein may have followed the adoption of cooking behavior,which would have reduced constraints on the masticatory appa-ratus. Reductions in molar and gut size are commensurate with amarked increase in brain size beginning ~1.9 mya (millions of yearsago; Aiello and Wheeler, 1995; Organ et al., 2011). This time periodhas been inferred as the potential origin of hominin cookingbehavior (Wrangham et al., 1999; Wrangham and Carmody, 2010),despite the absence of direct evidence from the fossil record.

Previously, Stedman et al. (2004) studied the rates of human-specific nonsynonymous (amino acid changing) and synonymousMYH16 substitutions to algebraically estimate a ~2.4 mya date forthe MYH16 frameshift deletion. Specifically, their dating methodassumed steady functional constraint on nonsynonymous muta-tions prior to pseudogenization followed by an equal rate of non-ysynonymous and synonymous substitution after gene loss.However, their analysis was based on human-chimpanzee differ-ences at only one codon, surveyed from only a very short segmentof MYH16 (Perry et al., 2005). Thus, additional approaches, such asthe one applied in this study, are necessary to obtain more confi-dence in the time period in which this pseudogenizing mutationoccurred. Our finding that the Neandertal and Denisovan in-dividuals shared with humans the MYH16 frameshift deletion isconsistent with both Stedman et al.'s (2004) ~2.4 mya estimate forthe loss of this gene and the ~1.9 mya inference for the origins ofhominin cooking behavior. The addition of nuclear genomesequence data from other archaic hominin species (see below)would provide a more precise estimate of the timing of the MYH16gene loss, which in turn would have implications for different hy-potheses concerning the origins of hominin cooking behavior.

The Neandertal individual is heterozygous for a novel TAS2R38 startcodon-disrupting mutation

In humans, three common amino acid polymorphisms in theTAS2R38 bitter taste receptor gene explain the majority of human

T T L H S T A P H F V R C I I P N EACCACCCTCCATAGCACCGCACCCCATTTTGTCCGCTGTATTATCCCCAATGAG T T L H S R T P F C P L Y Y P Q * ACCACCCTCCATAG--CCGCACCCCATTTTGTCCGCTGTATTATCCCCAATGAGACCACCCTCCATAG--CCGCACCCCATTTTGTCCGCTGTATTATCCCCAATGAGACCACCCTCCATAG--CCGCACCCCATTTTGTCCGCTGTATTATCCCCAATGAGACCACCCTCCATAG--CCGCACCCCATTTTGTCCGCTGTATTATCCCCAATGAG

Chimpanzee

Human hg19MontanaNeandertalDenisovan

chr7:98,862,740

MYH16

ChimpanzeeHuman hg19MontanaNeandertalDenisovan

TAS2R62 S L C W Q L G Q/* M R D L R P GTCACTGTGCTGGCAGTTGGGGCAGATGAGGGACCTCAGGCCCGGCTCACTGTGCTGGCAGTTGGGGTAGATGAGGGACCTCAGGCCCGGCTCACTGTGCTGGCAGTTGGGGTAGATGAGGGACCTCAGGCCCGGCTCACTGTGCTGGCAGTTGGGGTAGATGAGGGACCTCAGGCCCGGCTCACTGTGCTGGCAGTTGGGGTAGATGAGGGACCTCAGGCCCGGCchr7:143,134,731

N H W H W A W E/* V L I Y A N IAATCACTGGCACTGGGCCTGGGAAGTGCTAATCTATGCCAACATCAATCACTGGCACTGGGCCTGGTAAGTGCTAATCTATGCCAACATCAATCACTGGCACTGGGCCTGGTAAGTGCTAATCTATGCCAACATCAATCACTGGCACTGGGCCTGGTAAGTGCTAATCTATGCCAACATCAATCACTGGCACTGGGCCTGGTAAGTGCTAATCTATGCCAACATC

ChimpanzeeHuman hg19MontanaNeandertalDenisovan

TAS2R62

chr7:143,134,899

I T L T W N L W/* T Q Q N K L VATCACATTAACCTGGAATCTTTGGACACAGCAGAACAAACTTGTAATCACATTAACCTGGAATCTTTGAACACAGCAGAACAAACTTGTAATCACATTAACCTGGAATCTTTGAACACAGCAGAACAAACTTGTAATCACATTAACCTGGAATCTTTGAACACAGCAGAACAAACTTGTA

ChimpanzeeHuman hg19NeandertalDenisovan

TAS2R64

chr12:11,230,106

Figure 1. Analysis of Neandertal and Denisovan hominin DNA sequences at positions in the MYH16, TAS2R62, and TAS2R64 genes with hominin-specific inactivating substitutions.Neandertal and Denisovan consensus sequences aligned to human (hg19) and chimpanzee (panTro4) reference genome sequences, plus consensus sequences from the ~12.6 kyaanatomically modern human from Montana, highlighting the positions with hominin-specific pseudogenizing substitutions. In each case, the loss-of-function mutations occurredprior to the divergence of the modern human and archaic hominin lineages. The Montana human had insufficient coverage at the TAS2R64 SNP of interest (1 read �20 nt) and istherefore omitted. Information on mapped read count and depth at these regions is provided in the SOM.

G.H. Perry et al. / Journal of Human Evolution 79 (2015) 55e6358

variation in PTC taste sensitivity (Kim et al., 2003). Independently,chimpanzees are variable for a T-G polymorphism in the secondnucleotide of the first codon of TAS2R38, which would typicallyeffect an amino acid change from Methioinine to Arginine in theencoded protein. However, since this Methionine represents thestart codon of TAS2R38, the T-G polymorphism results in theexpression of a greatly truncated, non-functional protein that alsoexplains variable PTC taste sensitivity in chimpanzees (Woodinget al., 2006).

We examined all nucleotide positions in the TAS2R38 gene fromthe Neandertal and Denisovan aligned reads in order to identify allvariants of potential functional significance (Fig. 2). Both theNeandertal and Denisovan individuals were homozygous for theancestral chimpanzee nucleotides at the positions of the humanfunctional polymorphisms. Of course, we cannot exclude the pos-sibility that these nucleotides were variable in the Neandertal andDenisovan populations, given our sample size of only n ¼ 2 chro-mosomes in each case. In fact, a previous ancient DNA candidategene analysis of a Neandertal from El Sidr�on, Spain, found that thisindividual was heterozygous for one of the three common modernhuman amino acid polymorphisms (the other two could not beamplified; Lalueza-Fox et al., 2009). We additionally observed ahomozygous nonsynonymous mutation in the first nucleotide ofthe codon at amino acid position 36 of the Denisovan individual,which would effect a ValineeIsoleucine amino acid change. Theprogram PolyPhen (Adzhubei et al., 2010) predicts that this sub-stitution had a benign functional impact on the TAS2R38 protein(PolyPhen score ¼ 0.001).

Surprisingly, we found that the Siberian Altai Neandertal indi-vidual was heterozygous for a mutation in the second nucleotide of

the first codon of the TAS2R38 gene, similar to the common variantobserved in chimpanzees, but here a T-C rather than a T-G poly-morphism. Of the 19 aligned sequence reads at this position, 11 ¼ Tand 8 ¼ C (Fig. 2), providing strong evidence of a true poly-morphism rather than a sequencing error. This single nucleotidepolymorphism (SNP) would typically effect a Methionine to Thre-onine substitution, but again, since this is the start codon we canpredict that this mutation results in a truncated and non-functionalprotein, similar to the chimpanzee variant (Wooding et al., 2006).Thus, human, chimpanzee, and Neandertal populations may allhave had variable PTC taste sensitivity, in each case due to differentfunctional mutations.

In the absence of nuclear genome sequence data from betterpopulation samples of archaic hominins, we cannot determinewhether this Neandertal allele occurred at intermediate fre-quency, similar to the chimpanzee mutation and the humanTAS2R38 functional polymorphisms. We also cannot yet excludethe possibility that similar variation existed in the Denisovanpopulation. Still, this very interesting result raises at least twohypotheses for further testing, including with populationgenomic analyses: i) balancing selection for TAS2R38 functionalpolymorphism is common for hominins and non-human apes d

although specific adaptive hypotheses are largely lacking(Wooding, 2006), and ii) the TAS2R38 gene is subject to only veryweak purifying selection, such that mutations with major func-tional effects have attained intermediate frequency but notbecome fixed in any of these lineages. Either finding could helpadvance our understanding of hominin dietary evolution, espe-cially if we could comprehensively catalog the natural food itemstargeted by this receptor.

ChimpanzeeHuman hg19MontanaNeandertalDenisovan

A B

ChimpanzeeModern humanMontanaNeandertalDenisovan

ChimpanzeeModern humanMontanaNeandertalDenisovan

ChimpanzeeHuman hg19MontanaNeandertalDenisovan

ChimpanzeeModern humanMontanaNeandertalDenisovan

Nucleotide ambiguity codes :

K - G or TS - C or GR - A or GY - C or T

chr7:141,673,480; TAS2R38 CDS:pos 1

chr7:141,673,360; TAS2R38 CDS:pos 130

chr7:141,672,590; TAS2R38 CDS:pos 871

chr7:141,673,399; TAS2R38 CDS:pos 91

chr7:141,672,692; TAS2R38 CDS:pos 769

Local alignment at Neandertal start codon mutation

M L T L T R IAGTGACATCAKGTTGACTCTAACTCGCATC M/RAGTGACATCATGTTGACTCTAACTCGCATCAGTGACATCATGTTGACTCTAACTCGCATCAGTGACATCAYGTTGACTCTAACTCGCATC M/TAGTGACATCATGTTGACTCTAACTCGCATC

V V K R Q P/A L S N SGTAGTGAAGAGGCAGCCACTGAGCAACAGTGTAGTGAAGAGGCAGSCACTGAGCAACAGTGTAGTGAAGAGGCAGCCACTGAGCAACAGTGTAGTGAAGAGGCAGCCACTGAGCAACAGTGTAGTGAAGAGGCAGCCACTGAGCAACAGT

M T N A F V/I F L V NCTGACCAATGCCTTCGTTTTCTTGGTGAATCTGACCAATGCCTTCGTTTTCTTGGTGAATCTGACCAATGCCTTCGTTTTCTTGGTGAATCTGACCAATGCCTTCGTTTTCTTGGTGAATCTGACCAATGCCTTCATTTTCTTGGTGAAT

V I S S C A/V A F I SGTGATATCATCCTGTGCTGCCTTCATCTCTGTGATATCATCCTGTGYTGCCTTCATCTCTGTGATATCATCCTGTGCTGCCTTCATCTCTGTGATATCATCCTGTGCTGCCTTCATCTCTGTGATATCATCCTGTGCTGCCTTCATCTCT

S G H A A V/I L I S GTCTGGGCATGCAGCCGTCCTGATCTCAGGCTCTGGGCATGCAGCCRTCCTGATCTCAGGCTCTGGGCATGCAGCCGTCCTGATCTCAGGCTCTGGGCATGCAGCCGTCCTGATCTCAGGCTCTGGGCATGCAGCCGTCCTGATCTCAGGC

AGTGACATCAYGTTGACTCTAACTCGCATC..........C.............................T................... ..........T................... .........C.............................T......... ....C.............................T................... .T..............a..............T.......................C.............................T.............................C.............................T.............................C.............................T.............................T.............................C................... C................... T...................

Figure 2. Analysis of Neadertal and Denisovan hominin DNA sequences at TAS2R38 gene positions with nonsynonymous variants linked to loss-of-function. (A) TAS2R38 genesequence alignments for chimpanzee, human, the ~12.6 kya anatomically modern human from Montana, and the archaic hominins at selected regions containing nonsynonymousvariation. From top: independent start-codon polymorphisms in chimpanzees and the Neandertal individual, a Denisovan-specific nonsynonymous substitution inferred to effect aValine to Isoleucine amino acid substitution, and the three common human nonsynonymous polymorphisms that explain the majority of PTC taste sensitivity variation. (B)Alignment of individual sequence reads for the Neandertal individual that were used to determine the consensus Neandertal sequence shown in the top panel of (A), including theC-T heterozygosity in the second position of the start codon. Information on mapped read count and depth at this region is provided in the SOM.

G.H. Perry et al. / Journal of Human Evolution 79 (2015) 55e63 59

Diet-related gene functional gains in hominin evolution

On the other side of the gene content spectrum, duplications orregulatory sequence changes affecting diet-related genes, espe-cially digestive enzymes, may provide a selective advantage undercertain environments or behaviors if they lead to functional in-creases in gene and protein expression. However, the evolutionaryreconstructions and interpretations that can be made based on thetiming of gene duplications and individual sequence changes areless direct than those from gene losses. Specifically, whole geneduplications or very specific regulatory mutations must first occur(randomly) before selection can potentially act to maintain them.For single-copy DNA sequence these mutational mechanisms aremuch less commonplace than the expectedly steady rate of pseu-dogenizing mutations (as described above). Thus, we cannot makestrong ecological conclusions from the absence of gene duplicationor functionally relevant regulatory mutation at a given point inevolutionary history. However, the evolutionary origins of geneduplications and known regulatory sequence changes are stilluseful to consider because (depending on the duplication) theseresults may still help us make inferences about the fitness potentialof a species under hypothesized environments or behaviors.

The origins of lactase persistence mutations are consistent with theagricultural transition

Lactase, encoded by the LCT gene, is the enzyme responsible forthe digestion of themilk sugar lactose. Expression of the LCTgene inthe small intestine is typically abolished sometime after weaning inmammals, including for themajority of modern human individuals.However, modern humans in multiple agriculturalist and pasto-ralist populations have continued expression of LCT, or ‘lactase

persistence,’ throughout adulthood (Ingram et al., 2009). At leastthree independent mutations in a regulatory region located up-stream of the LCT gene are responsible for the developmental gainin enzyme expression in different populations (Bersaglieri et al.,2004; Tishkoff et al., 2007; Heyer et al., 2011; Gallego Romeroet al., 2012; Peng et al., 2012). These mutations are associatedwith genomic backgrounds that suggest past histories of strongpositive selection occurring within the past 10 kya or less(Bersaglieri et al., 2004; Tishkoff et al., 2007; Ranciaro et al., 2014),consistent with the origins of agriculture.

Since the specific mutations that confer the lactase persistencephenotype in modern human populations are known, it has beenpossible to study the presence or absence of these mutations inancient DNA nuclear genome sequence data from Europeananatomically modern humans in order to more precisely estimatethe origins and spread of this phenotype (Itan et al., 2009). Thesestudies have revealed an absence or relatively low frequency of thecommon European LCT persistence allele across ~10e5 kya andeven more recent time periods (Burger et al., 2007; Nagy et al.,2011; Plantinga et al., 2012; Sverrisdottir et al., 2014), but then afrequency of ~70% by AD 1200 in at least one population in Ger-many (Kruttli et al., 2014). Thus, nuclear ancient DNA data haveconfirmed a likely relatively recent and agriculture/pastoral-associated origin for at least one of the mutations conferring hu-man lactase persistence.

AMY1 duplications are human-specific and likely occurred withinthe past ~600 kya

Amylase is the enzyme responsible for the initial stages of thedigestion of starch, which is a major dietary component for modernhuman agricultural populations (up to 70% of caloric intake;

chr1:104,036,928 chr1:104,186,928

Diploid control region Region for CNV estimate

16.6x

82.9x

Denisovan

Neandertal

Montana ~12.6kya Human

Human NA18504

Human NA18507

Human NA18542

25.9x

129.3x

11.6x

58.1x

6.1x

52x

83.3x

416x

8.7x

43.4x

0x

0x

0x

0x

0x

0x

RNPC3 AMY2B AMY2A AMY1

A

B

C

0

2

4

6

8

10

12

14

NA06985

NA11994NA18504

NA19238

NA18912

NA18526

NA12891

NA12154

NA18558

NA18508

NA18507

NA18943NA18542

NA18561

NA19239

−0.5 0.0 0.5 1.0

2

4

6

8

10

12

14

Nea

nder

tal

Den

isov

an

NA

0698

5

Mon

tana

NA

1199

4

NA

1215

4

NA

1289

1

NA

1850

4

NA

1850

7

NA

1850

8

NA

1852

6

NA

1854

2

NA

1855

8

NA

1856

1

NA

1891

2

NA

1894

3

NA

1923

8

NA

1923

9

aCGH relative intensity log2 ratios for AMY1-mapped clone Chr1tp-6D2

AM

Y1

read

dep

th d

iplo

id c

opy

num

ber e

stim

ate

AM

Y1

read

dep

th d

iplo

id c

opy

num

ber e

stim

ate

Seq

uenc

e re

ad d

epth

of A

MY

1 re

gion

Figure 3. Salivary amylase (AMY1) gene copy number analysis. (A) Plots of read depthacross the AMY1 region. Light shading indicates regions analyzed to estimate AMY1

G.H. Perry et al. / Journal of Human Evolution 79 (2015) 55e6360

Copeland et al., 2009) and some hunter-gatherer populations(Vincent, 1984; Schoeninger et al., 2001). Humans have an averageof approximately six total copies of the salivary amylase gene(AMY1), whereas chimpanzees, who consume relatively smallamounts of dietary starch compared with most human populations(Hohmann et al., 2006), have only two diploid copies, or one perchromosome (Perry et al., 2007).

The variable number of AMY1 gene copies observed amonghumans is positively correlated with salivary amylase protein levels(Bank et al., 1992; Perry et al., 2007), suggesting that the human-chimpanzee copy number difference likewise explains the sub-stantial between-species difference in salivary amylase proteinexpression (McGeachin and Akin, 1982). Differences in the averagenumber of AMY1 copies between modern human populations withrelatively higher versus lower levels of dietary starch intake and thepattern of variation relative to other copy number variable locisuggests that a greater number of AMY1 copies may have beenadaptive under conditions of high starch consumption (Perry et al.,2007). The presence of AMY1 duplications in hunter-gatherers andin all studied worldwide populations (Perry et al., 2007; Prüferet al., 2014) suggests that the initial gene copy number increasepre-dates the agricultural transition (an assessment also supportedby the recent ancient DNA-based report of AMY1 duplications infour 7e8 kya European hunter-gatherers; Lazaridis et al., 2014;Olalde et al., 2014) and may pre-date modern human origins.However, it is unknown how early in hominin evolution the initialAMY1 duplications occurred, and specifically whether this eventcoincided with the hypothesized importance of starch-rich un-derground storage organs (USOs) to archaic hominins such asHomoerectus (Wrangham et al., 1999).

We used a sequence read depth analysis to estimate AMY1diploid copy number for both the Neandertal and Denisovan in-dividuals and a comparative sample of 15 modern humans bycomparing the average number of reads per bp mapped to theAMY1 duplication region to that of a nearby non-duplicated, non-deleted control region (SOM; Fig. 3A). We selected these specificindividuals due to the availability of both high-coverage DNAsequence data and an independent, array-based comparativegenomic hybridization (aCGH) estimate of copy number at theAMY1 locus (Redon et al., 2006) for these individuals, which we useto assess the accuracy of our approach. Prior studies have reportedsubstantial AMY1 copy number variation among modern humans(Groot et al., 1989; Iafrate et al., 2004; Perry et al., 2007). Weobserved similar diversity among the 15 sampled humans, with arange from 4.31 to 14.25 AMY1 copies. Our mean estimate of 7.34AMY1 copies (s.d. ¼ 2.61) is similar to that of a previous, quanti-tative PCR-based study of AMY1 copy number variation (Perry et al.,2007). In contrast, our estimates for the Neandertal (1.83 diploidcopies) and Denisovan (1.76 diploid copies) individuals are lowerthan those for each of the modern humans (Fig. 3B) and suggestthat, similar to chimpanzees, both of the archaic hominin in-dividuals had only one copy of the AMY1 gene per chromosome. A

copy number, via comparison of the AMY1 duplicated region (‘region for CNV esti-mate’) to the non-duplicated, non-deleted control region (‘diploid control region’).Dashed lines indicate the median read depth across the diploid control region, and y-axes scale to 5x the median. Sequence read coverage for each individual was capped at1.5x the median for the duplicated AMY1 segment in order to remove repetitiveelement artifacts. For the plots only (not for the copy number estimation), the coveragecurves were smoothed using a rolling median in a window equal to 1% of the contiglength, then a 500 nt rolling window mean. Every 100th base position is representedon the curve. (B) Barplot of AMY1 copy number estimates derived by comparing AMY1duplicated segment and diploid control region read depths. (C) Comparison of AMY1read depth copy number estimates to array-based comparative genomic hybridization(aCGH) relative intensity log2 ratios for AMY1-mapped clone Chr1tp-6D2 for themodern human samples (Redon et al., 2006).

G.H. Perry et al. / Journal of Human Evolution 79 (2015) 55e63 61

similar observation was also noted in the supplementary infor-mation of the Prüfer et al. (2014) Neandertal genome paper.

To validate our AMY1 copy number sequence read depthmethod, we compared our modern human results to those from aprevious aCGH study conducted on the same individuals. Specif-ically, we compared our diploid copy number estimates to therelative intensity log2 ratios for the Chr1tp-6D2 clone that ismapped to the AMY1 locus from Redon et al. (2006). The ratiosreflect the relative fluorescence intensities from a competitive hy-bridization experiment in which dye-labeled DNA from each indi-vidual is separately co-hybridized to a microarray with the dye-labeled DNA (using a different dye) of a common reference sam-ple. In regions of the genome in which an individual has a highercopy number than the reference sample (and vice versa for lowercopy number), relatively more DNA from that individual will hy-bridize to the clones on the array containing DNA complementaryto that region, resulting in a measurable skew in the intensities ofthe two fluorescent dyes. Thus, the Chr1tp-6D2 log2 ratios reflectthe relative AMY1 copy number among the 15 samples. Thesevalues are strongly and significantly correlated with our sequenceread depth-based estimates of AMY1 diploid copy number in thesame individuals (Fig. 3C; Pearson correlation test; r2 ¼ 0.84;P ¼ 1.73 � 10�6), confirming the reliability of this approach.

Finally, we performed two analyses to test the sensitivity of thismethod to detect duplications in the archaic hominins. First, weselected four additional genomic regions containing both asegment with known duplication in the human genome and a non-duplicated, non-deleted control region. In each case, clear relativecopy number gains were observed in the Neandertal and Denisovanindividuals, similar to the modern human samples (SOM Figure 1).Second, we used identical methods to estimate 3.54 diploid AMY1copies from the medium coverage nuclear genome sequencedataset of the anatomically modern human individual from Mon-tana (Fig. 3). Thus, the absence of Neandertal and Denisovan AMY1relative copy number gain signals reflects the absence of AMY1duplications in the archaic hominins, rather than any lack of powerto detect duplications with ancient DNA sequence data and thismethod. We can therefore conclude that AMY1 gene duplicationsare likely human-specific and that they occurred following thedivergence of our lineage from the Neandertal/Denisovan lineage~550e590 kya.

The three copies of AMY1 that are annotated in the humanreference genome sequence are very similar to each other, whichwould seem to imply an origin within the past ~200 kya (Perryet al., 2007). However, tandem duplication sequence divergencemay not scale with age, due to ongoing duplication and deletionand potential gene conversion mechanisms among the copies.Thus, an independent assessment of the likely origin of theseduplications was necessary. Our ancient DNA results d only twodiploid AMY1 copies in both the Neandertal and Denisovan in-dividuals d are consistent with a relatively recent date for theAMY1 duplications (but one prior to the origins of agriculture, asevidenced by the presence of duplications in all anatomicallymodern human hunter-gatherers thus far studied with ancientDNA). This timing is not consistent with the hypothesizedimportance of starch-rich underground storage organs beginningin much earlier time periods of hominin evolution (Coursey, 1973;Wrangham et al., 1999; Laden and Wrangham, 2005). However, asnoted in the Introduction, we cannot make strong inferences fromthe absence of gene duplications at a particular time in homininevolutionary history. We can only conclude that if early homininswere consuming large quantities of starchy foods, as hypothe-sized, then they were likely doing so without the digestive ben-efits of increased salivary amylase production (Mandel andBreslin, 2012).

Concluding remarks

Looking forward, there are several ways in which the ancientDNA evolutionary timing of diet-related genetic changesapproach could be expanded in order to better complement thelimited information from the fossil record concerning hominindietary transitions. Similar discussion points would also gener-ally apply to investigations of other, non-diet-related homininphenotypes (Sams et al., 2014). First, nuclear DNA sequence datafrom representatives of additional hominin lineages wouldfacilitate more precise dating of hominin-specific DNA sequencechanges. One interesting candidate is Homo floresiensis, whichsurvived until ~18 kya in Indonesia, where the relatively hot andwet climate is not conducive to DNA preservation. However,with continuing advances in sequencing technology and ancientDNA methods such as single-strand DNA library preparation(Meyer et al., 2012) and ultra-short read sequencing (Dabneyet al., 2013; Meyer et al., 2014), success may be possible in thefuture.

Second, our inferences will become stronger with betterfunctional knowledge of specific taste receptors, including thosethat have been lost along the hominin lineage. Likewise, we wouldlike to generally extend our analysis to specific nonsynonymousand gene regulatory substitutions of many potential diet-relatedgenes in the genome, instead of focusing more heavily onhominin-specific gene gains and losses. However, functionalknowledge of such changes is severely lacking for fixed human-chimpanzee differences, due to the difficulty in predictingphenotype from genotype in the absence of within-speciesvariation.

Finally, the timing of olfactory receptor gene gains and lossesand functional changes could provide insights into hominin dietaryevolution and evolutionary ecology. This analysis is currentlychallenged by our limited understanding of the specific functionalconsequences of olfactory receptor variation and by the shortsequence reads typically obtained from ancient DNA, which oftencannot be mapped uniquely to specific, highly similar olfactoryreceptor genes (Hughes et al., 2014). We are hopeful for progress onall of these fronts.

In summary, we have demonstrated that analyses of high-coverage ancient DNA sequence data can facilitate inferencesabout the relative timing of hominin-specific phenotypic changesin diet-related genes. This analysis reveals the utility of ancientDNA approaches for addressing questions about the timing ofevolutionary changes correlated with ecological shifts in homininhistory, including those that are strongly debated by paleoanthro-pologists due to the limitations of the direct fossil record. As bothour functional knowledge of genetic changes and the number ofnuclear genome sequences from ancient hominin individualsexpand, our ability to test such hypotheses and provide novel in-sights about hominin evolution will continue to improve.

Acknowledgments

This work was supported by the Pennsylvania State UniversityCollege of the Liberal Arts (to G.H.P.). Computational analyses weresupported in part by instrumentation funded by National ScienceFoundation grant no. OCI-0821527.

Appendix A. Supplementary data

Supplementary data related to this article can be found at http://dx.doi.org/10.1016/j.jhevol.2014.10.018.

G.H. Perry et al. / Journal of Human Evolution 79 (2015) 55e6362

References

Adzhubei, I.A., Schmidt, S., Peshkin, L., Ramensky, V.E., Gerasimova, A., Bork, P.,Kondrashov, A.S., Sunyaev, S.R., 2010. A method and server for predictingdamaging missense mutations. Nat. Methods 7, 248e249.

Aiello, L.C., Wheeler, P., 1995. The expensive-tissue hypothesis: the brain and thedigestive system in human and primate evolution. Curr. Anthropol. 36,199e221.

Bank, R.A., Hettema, E.H., Muijs, M.A., Pals, G., Arwert, F., Boomsma, D.I., Pronk, J.C.,1992. Variation in gene copy number and polymorphism of the human salivaryamylase isoenzyme system in Caucasians. Hum. Genet. 89, 213e222.

Bersaglieri, T., Sabeti, P.C., Patterson, N., Vanderploeg, T., Schaffner, S.F., Drake, J.A.,Rhodes, M., Reich, D.E., Hirschhorn, J.N., 2004. Genetic signatures of strongrecent positive selection at the lactase gene. Am. J. Hum. Genet. 74, 1111e1120.

Bowmaker, J.K., Hunt, D.M., 2006. Evolution of vertebrate visual pigments. Curr.Biol. 16, R484eR489.

Bufe, B., Breslin, P.A., Kuhn, C., Reed, D.R., Tharp, C.D., Slack, J.P., Kim, U.K., Drayna, D.,Meyerhof, W., 2005. The molecular basis of individual differences in phenyl-thiocarbamide and propylthiouracil bitterness perception. Curr. Biol. 15,322e327.

Bunn, H.T., 2006. Meat made us human. In: Ungar, P.S. (Ed.), Evolution of the HumanDiet: The Known, the Unknown, and the Unknowable. Oxford University Press,New York, pp. 191e211.

Burger, J., Kirchner, M., Bramanti, B., Haak, W., Thomas, M.G., 2007. Absence of thelactase-persistence-associated allele in early Neolithic Europeans. Proc. Natl.Acad. Sci. 104, 3736e3741.

Carmody, R.N., Wrangham, R.W., 2009. The energetic significance of cooking.J. Hum. Evol. 57, 379e391.

Castellano, S., Parra, G., Sanchez-Quinto, F.A., Racimo, F., Kuhlwilm, M., Kircher, M.,Sawyer, S., Fu, Q., Heinze, A., Nickel, B., Dabney, J., Siebauer, M., White, L.,Burbano, H.A., Renaud, G., Stenzel, U., Lalueza-Fox, C., de la Rasilla, M., Rosas, A.,Rudan, P., Brajkovic, D., Kucan, Z., Gusic, I., Shunkov, M.V., Derevianko, A.P.,Viola, B., Meyer, M., Kelso, J., Andres, A.M., P€a€abo, S., 2014. Patterns of codingvariation in the complete exomes of three Neandertals. Proc. Natl. Acad. Sci. 111,6666e6671.

Copeland, L., Blazek, J., Salman, H., Chiming Tang, M., 2009. Form and functionalityof starch. Food Hydrocolloids 23, 1527e1534.

Coursey, D.G., 1973. Hominid evolution and hypogeous plant foods. Man 8,634e635.

Dabney, J., Knapp, M., Glocke, I., Gansauge, M.T., Weihmann, A., Nickel, B.,Valdiosera, C., Garcia, N., P€a€abo, S., Arsuaga, J.L., Meyer, M., 2013. Completemitochondrial genome sequence of a Middle Pleistocene cave bear recon-structed from ultrashort DNA fragments. Proc. Natl. Acad. Sci. 110,15758e15763.

de Heinzelin, J., Clark, J.D., White, T., Hart, W., Renne, P., WoldeGabriel, G., Beyene, Y.,Vrba, E., 1999. Environment and behavior of 2.5-million-year-old Bouri homi-nids. Science 284, 625e629.

Diamond, J., 2002. Evolution, consequences and future of plant and animaldomestication. Nature 418, 700e707.

Dominy, N.J., Vogel, E.R., Yeakel, J.D., Constantino, P., Lucas, P.W., 2008. Mechanicalproperties of plant underground storage organs and implications for dietarymodels of early hominins. Evol. Biol. 35, 159e175.

Gallego Romero, I., Basu Mallick, C., Liebert, A., Crivellaro, F., Chaubey, G., Itan, Y.,Metspalu, M., Eaaswarkhanth, M., Pitchappan, R., Villems, R., Reich, D., Singh, L.,Thangaraj, K., Thomas, M.G., Swallow, D.M., Mirazon Lahr, M., Kivisild, T., 2012.Herders of Indian and European cattle share their predominant allele for lactasepersistence. Mol. Biol. Evol. 29, 249e260.

Go, Y., Satta, Y., Takenaka, O., Takahata, N., 2005. Lineage-specific loss of function ofbitter taste receptor genes in humans and nonhuman primates. Genetics 170,313e326.

Gowlett, J.A.J., Wrangham, R.W., 2013. Earliest fire in Africa: towards the conver-gence of archaeological evidence and the cooking hypothesis. Azania-Archaeol.Res. Afr. 48, 5e30.

Groot, P.C., Bleeker, M.J., Pronk, J.C., Arwert, F., Mager, W.H., Planta, R.J.,Eriksson, A.W., Frants, R.R., 1989. The human alpha-amylase multigene familyconsists of haplotypes with variable numbers of genes. Genomics 5, 29e42.

Heyer, E., Brazier, L., Segurel, L., Hegay, T., Austerlitz, F., Quintana-Murci, L.,Georges, M., Pasquet, P., Veuille, M., 2011. Lactase persistence in central Asia:phenotype, genotype, and evolution. Hum. Biol. 83, 379e392.

Hohmann, G., Robbins, M., Boesch, C., 2006. Feeding Ecology in Apes and OtherPrimates. Cambridge University Press, Cambridge.

Huerta-Sanchez, E., Jin, X., Asan, Bianba, Z., Peter, B.M., Vinckenbosch, N., Liang, Y.,Yi, X., He, M., Somel, M., Ni, P., Wang, B., Ou, X., Huasang, Luosang, J., Cuo, Z.X.,Li, K., Gao, G., Yin, Y., Wang, W., Zhang, X., Xu, X., Yang, H., Li, Y., Wang, J.,Wang, J., Nielsen, R., 2014. Altitude adaptation in Tibetans caused by intro-gression of Denisovan-like DNA. Nature 512, 194e197.

Hughes, G.M., Teeling, E.C., Higgins, D.G., 2014. Loss of olfactory receptor function inhominin evolution. PLoS One 9, e84714.

Iafrate, A.J., Feuk, L., Rivera, M.N., Listewnik, M.L., Donahoe, P.K., Qi, Y., Scherer, S.W.,Lee, C., 2004. Detection of large-scale variation in the human genome. Nat.Genet. 36, 949e951.

Ingram, C.J., Mulcare, C.A., Itan, Y., Thomas, M.G., Swallow, D.M., 2009. Lactosedigestion and the evolutionary genetics of lactase persistence. Hum. Genet. 124,579e591.

Itan, Y., Powell, A., Beaumont, M.A., Burger, J., Thomas, M.G., 2009. The origins oflactase persistence in Europe. PLoS Comput. Biol. 5, e1000491.

Jacobs, G.H., Neitz, M., Neitz, J., 1996. Mutations in S-cone pigment genes and theabsence of colour vision in two species of nocturnal primate. Proc. Biol. Sci. 263,705e710.

Keller, A., Graefen, A., Ball, M., Matzas, M., Boisguerin, V., Maixner, F., Leidinger, P.,Backes, C., Khairat, R., Forster, M., Stade, B., Franke, A., Mayer, J., Spangler, J.,McLaughlin, S., Shah, M., Lee, C., Harkins, T.T., Sartori, A., Moreno-Estrada, A.,Henn, B., Sikora, M., Semino, O., Chiaroni, J., Rootsi, S., Myres, N.M.,Cabrera, V.M., Underhill, P.A., Bustamante, C.D., Vigl, E.E., Samadelli, M.,Cipollini, G., Haas, J., Katus, H., O'Connor, B.D., Carlson, M.R., Meder, B., Blin, N.,Meese, E., Pusch, C.M., Zink, A., 2012. New insights into the Tyrolean Iceman'sorigin and phenotype as inferred by whole-genome sequencing. Nat. Commun3, 698.

Kim, U.K., Jorgenson, E., Coon, H., Leppert, M., Risch, N., Drayna, D., 2003. Positionalcloning of the human quantitative trait locus underlying taste sensitivity tophenylthiocarbamide. Science 299, 1221e1225.

Krause, J., Fu, Q., Good, J.M., Viola, B., Shunkov, M.V., Derevianko, A.P., P€a€abo, S.,2010. The complete mitochondrial DNA genome of an unknown hominin fromsouthern Siberia. Nature 464, 894e897.

Kruttli, A., Bouwman, A., Akgul, G., Della Casa, P., Ruhli, F., Warinner, C., 2014.Ancient DNA analysis reveals high frequency of European lactase persistenceallele (T-13910) in Medieval Central Europe. PLoS One 9, e86251.

Laden, G., Wrangham, R., 2005. The rise of the hominids as an adaptive shift infallback foods: plant underground storage organs (USOs) and australopith or-igins. J. Hum. Evol. 49, 482e498.

Lalueza-Fox, C., Rompler, H., Caramelli, D., Staubert, C., Catalano, G., Hughes, D.,Rohland, N., Pilli, E., Longo, L., Condemi, S., de la Rasilla, M., Fortea, J., Rosas, A.,Stoneking, M., Schoneberg, T., Bertranpetit, J., Hofreiter, M., 2007.A melanocortin 1 receptor allele suggests varying pigmentation among Nean-derthals. Science 318, 1453e1455.

Lalueza-Fox, C., Gigli, E., de la Rasilla, M., Fortea, J., Rosas, A., 2009. Bitter tasteperception in Neanderthals through the analysis of the TAS2R38 gene. Biol. Lett.5, 809e811.

Lazaridis, I., Patterson, N., Mittnik, A., Renaud, G., Mallick, S., Kirsanow, K.,Sudmant, P.H., Schraiber, J.G., Castellano, S., Lipson, M., Berger, B., Economou, C.,Bollongino, R., Fu, Q., Bos, K.I., Nordenfelt, S., Li, H., de Filippo, C., Prüfer, K.,Sawyer, S., Posth, C., Haak, W., Hallgren, F., Fornander, E., Rohland, N.,Delsate, D., Francken, M., Guinet, J.M., Wahl, J., Ayodo, G., Babiker, H.A.,Bailliet, G., Balanovska, E., Balanovsky, O., Barrantes, R., Bedoya, G., Ben-Ami, H.,Bene, J., Berrada, F., Bravi, C.M., Brisighelli, F., Busby, G.B., Cali, F., Churnosov, M.,Cole, D.E., Corach, D., Damba, L., van Driem, G., Dryomov, S., Dugoujon, J.M.,Fedorova, S.A., Gallego Romero, I., Gubina, M., Hammer, M., Henn, B.M.,Hervig, T., Hodoglugil, U., Jha, A.R., Karachanak-Yankova, S., Khusainova, R.,Khusnutdinova, E., Kittles, R., Kivisild, T., Klitz, W., Kucinskas, V.,Kushniarevich, A., Laredj, L., Litvinov, S., Loukidis, T., Mahley, R.W., Melegh, B.,Metspalu, E., Molina, J., Mountain, J., Nakkalajarvi, K., Nesheva, D., Nyambo, T.,Osipova, L., Parik, J., Platonov, F., Posukh, O., Romano, V., Rothhammer, F.,Rudan, I., Ruizbakiev, R., Sahakyan, H., Sajantila, A., Salas, A., Starikovskaya, E.B.,Tarekegn, A., Toncheva, D., Turdikulova, S., Uktveryte, I., Utevska, O., Vasquez, R.,Villena, M., Voevoda, M., Winkler, C.A., Yepiskoposyan, L., Zalloua, P.,Zemunik, T., Cooper, A., Capelli, C., Thomas, M.G., Ruiz-Linares, A., Tishkoff, S.A.,Singh, L., Thangaraj, K., Villems, R., Comas, D., Sukernik, R., Metspalu, M.,Meyer, M., Eichler, E.E., Burger, J., Slatkin, M., P€a€abo, S., Kelso, J., Reich, D.,Krause, J., 2014. Ancient human genomes suggest three ancestral populationsfor present-day Europeans. Nature 513, 409e413.

Leonard, W.R., Robertson, M.L., 1992. Nutritional requirements and human evolu-tion - a bioenergetics model. Am. J. Hum. Biol. 4, 179e195.

Luca, F., Perry, G.H., Di Rienzo, A., 2010. Evolutionary adaptations to dietary changes.A. Rev. Nutr. 30, 291e314.

MacArthur, D.G., Tyler-Smith, C., 2010. Loss-of-function variants in the genomes ofhealthy humans. Hum. Mol. Genet. 19, R125eR130.

MacArthur, D.G., Balasubramanian, S., Frankish, A., Huang, N., Morris, J., Walter, K.,Jostins, L., Habegger, L., Pickrell, J.K., Montgomery, S.B., Albers, C.A., Zhang, Z.D.,Conrad, D.F., Lunter, G., Zheng, H., Ayub, Q., DePristo, M.A., Banks, E., Hu, M.,Handsaker, R.E., Rosenfeld, J.A., Fromer, M., Jin, M., Mu, X.J., Khurana, E., Ye, K.,Kay, M., Saunders, G.I., Suner, M.M., Hunt, T., Barnes, I.H., Amid, C., Carvalho-Silva, D.R., Bignell, A.H., Snow, C., Yngvadottir, B., Bumpstead, S., Cooper, D.N.,Xue, Y., Romero, I.G., Wang, J., Li, Y., Gibbs, R.A., McCarroll, S.A., Dermitzakis, E.T.,Pritchard, J.K., Barrett, J.C., Harrow, J., Hurles, M.E., Gerstein, M.B., Tyler-Smith, C., 2012. A systematic survey of loss-of-function variants in humanprotein-coding genes. Science 335, 823e828.

Mandel, A.L., Breslin, P.A., 2012. High endogenous salivary amylase activity isassociated with improved glycemic homeostasis following starch ingestion inadults. J. Nutr. 142, 853e858.

Mann, N., 2000. Dietary lean red meat and human evolution. Eur. J. Nutr. 39, 71e79.McGeachin, R.L., Akin, J.R., 1982. Amylase levels in the tissues and body fluids of

several primate species. Comp. Biochem. Physiol. A 72, 267e269.McPherron, S.P., Alemseged, Z., Marean, C.W., Wynn, J.G., Reed, D., Geraads, D.,

Bobe, R., Bearat, H.A., 2010. Evidence for stone-tool-assisted consumption ofanimal tissues before 3.39 million years ago at Dikika, Ethiopia. Nature 466,857e860.

Meyer, M., Kircher, M., Gansauge, M.T., Li, H., Racimo, F., Mallick, S., Schraiber, J.G.,Jay, F., Prüfer, K., de Filippo, C., Sudmant, P.H., Alkan, C., Fu, Q., Do, R.,Rohland, N., Tandon, A., Siebauer, M., Green, R.E., Bryc, K., Briggs, A.W.,

G.H. Perry et al. / Journal of Human Evolution 79 (2015) 55e63 63

Stenzel, U., Dabney, J., Shendure, J., Kitzman, J., Hammer, M.F., Shunkov, M.V.,Derevianko, A.P., Patterson, N., Andres, A.M., Eichler, E.E., Slatkin, M., Reich, D.,Kelso, J., P€a€abo, S., 2012. A high-coverage genome sequence from an archaicDenisovan individual. Science 338, 222e226.

Meyer, M., Fu, Q., Aximu-Petri, A., Glocke, I., Nickel, B., Arsuaga, J.L., Martinez, I.,Gracia, A., de Castro, J.M., Carbonell, E., P€a€abo, S., 2014. A mitochondrial genomesequence of a hominin from Sima de los Huesos. Nature 505, 403e406.

Milton, K., 1999. A hypothesis to explain the role of meat-eating in human evolu-tion. Evol. Anthropol. 8, 11e21.

Nagy, D., Tomory, G., Csanyi, B., Bogacsi-Szabo, E., Czibula, A., Priskin, K., Bede, O.,Bartosiewicz, L., Downes, C.S., Rasko, I., 2011. Comparison of lactase persistencepolymorphism in ancient and present-day Hungarian populations. Am. J. Phys.Anthropol. 145, 262e269.

Olalde, I., Allentoft, M.E., Sanchez-Quinto, F., Santpere, G., Chiang, C.W.,Degiorgio, M., Prado-Martinez, J., Rodriguez, J.A., Rasmussen, S., Quilez, J.,Ramirez, O., Marigorta, U.M., Fernandez-Callejo, M., Prada, M.E., Encinas, J.M.,Nielsen, R., Netea, M.G., Novembre, J., Sturm, R.A., Sabeti, P., Marques-Bonet, T.,Navarro, A., Willerslev, E., Lalueza-Fox, C., 2014. Derived immune and ancestralpigmentation alleles in a 7,000-year-old Mesolithic European. Nature 507,225e228.

Organ, C., Nunn, C.L., Machanda, Z., Wrangham, R.W., 2011. Phylogenetic rate shiftsin feeding time during the evolution of Homo. Proc. Natl. Acad. Sci. 108,14555e14559.

Parry, C.M., Erkner, A., le Coutre, J., 2004. Divergence of T2R chemosensory receptorfamilies in humans, bonobos, and chimpanzees. Proc. Natl. Acad. Sci. 101,14830e14834.

Peng, M.S., He, J.D., Zhu, C.L., Wu, S.F., Jin, J.Q., Zhang, Y.P., 2012. Lactase persistencemay have an independent origin in Tibetan populations from Tibet, China.J. Hum. Genet. 57, 394e397.

Perry, G.H., Verrelli, B.C., Stone, A.C., 2005. Comparative analyses reveal a complexhistory of molecular evolution for human MYH16. Mol. Biol. Evol. 22, 379e382.

Perry, G.H., Dominy, N.J., Claw, K.G., Lee, A.S., Fiegler, H., Redon, R., Werner, J.,Villanea, F.A., Mountain, J.L., Misra, R., Carter, N.P., Lee, C., Stone, A.C., 2007. Dietand the evolution of human amylase gene copy number variation. Nat. Genet.39, 1256e1260.

Plantinga, T.S., Alonso, S., Izagirre, N., Hervella, M., Fregel, R., van der Meer, J.W.,Netea, M.G., de la Rua, C., 2012. Low prevalence of lactase persistence inNeolithic South-West Europe. Eur. J. Hum. Genet. 20, 778e782.

Prüfer, K., Racimo, F., Patterson, N., Jay, F., Sankararaman, S., Sawyer, S., Heinze, A.,Renaud, G., Sudmant, P.H., de Filippo, C., Li, H., Mallick, S., Dannemann, M.,Fu, Q., Kircher, M., Kuhlwilm, M., Lachmann, M., Meyer, M., Ongyerth, M.,Siebauer, M., Theunert, C., Tandon, A., Moorjani, P., Pickrell, J., Mullikin, J.C.,Vohr, S.H., Green, R.E., Hellmann, I., Johnson, P.L., Blanche, H., Cann, H.,Kitzman, J.O., Shendure, J., Eichler, E.E., Lein, E.S., Bakken, T.E., Golovanova, L.V.,Doronichev, V.B., Shunkov, M.V., Derevianko, A.P., Viola, B., Slatkin, M., Reich, D.,Kelso, J., P€a€abo, S., 2014. The complete genome sequence of a Neanderthal fromthe Altai Mountains. Nature 505, 43e49.

Raghavan, M., Skoglund, P., Graf, K.E., Metspalu, M., Albrechtsen, A., Moltke, I.,Rasmussen, S., Stafford, T.W. Jr., Orlando, L., Metspalu, E., Karmin, M.,Tambets, K., Rootsi, S., Magi, R., Campos, P.F., Balanovska, E., Balanovsky, O.,Khusnutdinova, E., Litvinov, S., Osipova, L.P., Fedorova, S.A., Voevoda, M.I.,DeGiorgio, M., Sicheritz-Ponten, T., Brunak, S., Demeshchenko, S., Kivisild, T.,Villems, R., Nielsen, R., Jakobsson, M., Willerslev, E., 2014. Upper PalaeolithicSiberian genome reveals dual ancestry of Native Americans. Nature 505, 87e91.

Ranciaro, A., Campbell, M.C., Hirbo, J.B., Ko, W.Y., Froment, A., Anagnostou, P.,Kotze, M.J., Ibrahim, M., Nyambo, T., Omar, S.A., Tishkoff, S.A., 2014. Geneticorigins of lactase persistence and the spread of pastoralism in Africa. Am. J.Hum. Genet. 94, 496e510.

Rasmussen, M., Li, Y., Lindgreen, S., Pedersen, J.S., Albrechtsen, A., Moltke, I.,Metspalu, M., Metspalu, E., Kivisild, T., Gupta, R., Bertalan, M., Nielsen, K.,Gilbert, M.T., Wang, Y., Raghavan, M., Campos, P.F., Kamp, H.M., Wilson, A.S.,Gledhill, A., Tridico, S., Bunce, M., Lorenzen, E.D., Binladen, J., Guo, X., Zhao, J.,Zhang, X., Zhang, H., Li, Z., Chen, M., Orlando, L., Kristiansen, K., Bak, M.,Tommerup, N., Bendixen, C., Pierre, T.L., Gronnow, B., Meldgaard, M.,Andreasen, C., Fedorova, S.A., Osipova, L.P., Higham, T.F., Bronk Ramsey, C.,Hansen, T.V., Nielsen, F.C., Crawford, M.H., Brunak, S., Sicheritz-Ponten, T.,Villems, R., Nielsen, R., Krogh, A., Wang, J., Willerslev, E., 2010. Ancient humangenome sequence of an extinct Palaeo-Eskimo. Nature 463, 757e762.

Rasmussen, M., Anzick, S.L., Waters, M.R., Skoglund, P., DeGiorgio, M.,Stafford, T.W. Jr., Rasmussen, S., Moltke, I., Albrechtsen, A., Doyle, S.M.,Poznik, G.D., Gudmundsdottir, V., Yadav, R., Malaspinas, A.S., White, S.S. V,Allentoft, M.E., Cornejo, O.E., Tambets, K., Eriksson, A., Heintzman, P.D.,Karmin, M., Korneliussen, T.S., Meltzer, D.J., Pierre, T.L., Stenderup, J., Saag, L.,Warmuth, V.M., Lopes, M.C., Malhi, R.S., Brunak, S., Sicheritz-Ponten, T.,Barnes, I., Collins, M., Orlando, L., Balloux, F., Manica, A., Gupta, R., Metspalu, M.,Bustamante, C.D., Jakobsson, M., Nielsen, R., Willerslev, E., 2014. The genome of

a Late Pleistocene human from a Clovis burial site in western Montana. Nature506, 225e229.

Redon, R., Ishikawa, S., Fitch, K.R., Feuk, L., Perry, G.H., Andrews, T.D., Fiegler, H.,Shapero, M.H., Carson, A.R., Chen, W., Cho, E.K., Dallaire, S., Freeman, J.L.,Gonzalez, J.R., Gratacos, M., Huang, J., Kalaitzopoulos, D., Komura, D.,MacDonald, J.R., Marshall, C.R., Mei, R., Montgomery, L., Nishimura, K.,Okamura, K., Shen, F., Somerville, M.J., Tchinda, J., Valsesia, A., Woodwark, C.,Yang, F., Zhang, J., Zerjal, T., Armengol, L., Conrad, D.F., Estivill, X., Tyler-Smith, C.,Carter, N.P., Aburatani, H., Lee, C., Jones, K.W., Scherer, S.W., Hurles, M.E., 2006.Global variation in copy number in the human genome. Nature 444, 444e454.

Reich, D., Green, R.E., Kircher, M., Krause, J., Patterson, N., Durand, E.Y., Viola, B.,Briggs, A.W., Stenzel, U., Johnson, P.L., Maricic, T., Good, J.M., Marques-Bonet, T.,Alkan, C., Fu, Q., Mallick, S., Li, H., Meyer, M., Eichler, E.E., Stoneking, M.,Richards, M., Talamo, S., Shunkov, M.V., Derevianko, A.P., Hublin, J.-J., Kelso, J.,Slatkin, M., P€a€abo, S., 2010. Genetic history of an archaic hominin group fromDenisova Cave in Siberia. Nature 468, 1053e1060.

Roebroeks, W., Villa, P., 2011. On the earliest evidence for habitual use of fire inEurope. Proc. Natl. Acad. Sci. 108, 5209e5214.

Sams, A.J., Hawks, J., Keinan, A., 2014. The utility of ancient human DNA forimproving allele age estimates, with implications for demographic models andtests of natural selection. J. Hum. Evol. http://dx.doi.org/10.1016/j.jhevol.2014.10.009.

Sankararaman, S., Mallick, S., Dannemann, M., Prüfer, K., Kelso, J., P€a€abo, S.,Patterson, N., Reich, D., 2014. The genomic landscape of Neanderthal ancestry inpresent-day humans. Nature 507, 354e357.

Schoeninger, M.J., Bunn, H.T., Murray, S.S., Marlett, J.A., 2001. Composition of tubersused by Hadza foragers of Tanzania. J. Food Comp. Anal. 14, 15e25.

Stanford, C.B., 1999. The Hunting Apes: Meat Eating and the Origins of HumanBehavior. Princeton University Press, Princeton.

Stedman, H.H., Kozyak, B.W., Nelson, A., Thesier, D.M., Su, L.T., Low, D.W.,Bridges, C.R., Shrager, J.B., Minugh-Purvis, N., Mitchell, M.A., 2004. Myosin genemutation correlates with anatomical changes in the human lineage. Nature 428,415e418.

Sverrisdottir, O.O., Timpson, A., Toombs, J., Lecoeur, C., Froguel, P., Carretero, J.M.,Arsuaga Ferreras, J.L., Gotherstrom, A., Thomas, M.G., 2014. Direct estimates ofnatural selection in Iberia indicate calcium absorptionwas not the only driver oflactase persistence in Europe. Mol. Biol. Evol. 31, 975e983.

Tan, Y., Yoder, A.D., Yamashita, N., Li, W.H., 2005. Evidence from opsin genes rejectsnocturnality in ancestral primates. Proc. Natl. Acad. Sci. 102, 14712e14716.

Tishkoff, S.A., Reed, F.A., Ranciaro, A., Voight, B.F., Babbitt, C.C., Silverman, J.S.,Powell, K., Mortensen, H.M., Hirbo, J.B., Osman, M., Ibrahim, M., Omar, S.A.,Lema, G., Nyambo, T.B., Ghori, J., Bumpstead, S., Pritchard, J.K., Wray, G.A.,Deloukas, P., 2007. Convergent adaptation of human lactase persistence in Af-rica and Europe. Nat. Genet. 39, 31e40.

Ungar, P.S., Grine, F.E., Teaford, M.F., 2006. Diet in early Homo: A review of theevidence and a new model of adaptive versatility. A. Rev. Anthropol 35,209e228.

Vernot, B., Akey, J.M., 2014. Resurrecting surviving Neandertal lineages frommodern human genomes. Science 343, 1017e1021.

Vincent, A.S., 1984. Plant foods in savanna environments: a preliminary report oftubers eaten by the Hadza of northern Tanzania. World Archaeol. 17, 131e148.

Wang, X., Grus, W.E., Zhang, J., 2006. Gene losses during human origins. PLoS Biol. 4,e52.

Wooding, S., 2006. Phenylthiocarbamide: A 75-Year Adventure in Genetics andNatural Selection. Genetics 172, 2015e2023.

Wooding, S., Kim, U.K., Bamshad, M.J., Larsen, J., Jorde, L.B., Drayna, D., 2004. Naturalselection and molecular evolution in PTC, a bitter-taste receptor gene. Am. J.Hum. Genet. 74, 637e646.

Wooding, S., Bufe, B., Grassi, C., Howard, M.T., Stone, A.C., Vazquez, M., Dunn, D.M.,Meyerhof, W., Weiss, R.B., Bamshad, M.J., 2006. Independent evolution of bitter-taste sensitivity in humans and chimpanzees. Nature 440, 930e934.

Wrangham, R.W., Carmody, R., 2010. Human adaptation to the control of fire. Evol.Anthropol. 19, 187e199.

Wrangham, R., Conklin-Brittain, N., 2003. Cooking as a biological trait. Comp. Bio-chem. Physiol. A 136, 35e46.

Wrangham, R.W., Jones, J.H., Laden, G., Pilbeam, D., Conklin-Brittain, N., 1999. Theraw and the stolen e cooking and the ecology of human origins. Curr.Anthropol. 40, 567e594.

Yamaguchi-Kabata, Y., Shimada, M.K., Hayakawa, Y., Minoshima, S., Chakraborty, R.,Gojobori, T., Imanishi, T., 2008. Distribution and effects of nonsense poly-morphisms in human genes. PLoS One 3, e3393.

Yngvadottir, B., Xue, Y., Searle, S., Hunt, S., Delgado, M., Morrison, J., Whittaker, P.,Deloukas, P., Tyler-Smith, C., 2009. A genome-wide survey of the prevalenceand evolutionary forces acting on human nonsense SNPs. Am. J. Hum. Genet. 84,224e234.