Upload
others
View
5
Download
0
Embed Size (px)
Citation preview
JPET #211722
1
Distinct properties of telmisartan on agonistic activities for PPARγ among
clinically-used ARBs: drug-target interaction analyses
Hirotoshi Kakuta, Eiji Kurosaki, Tatsuya Niimi, Katsuhiko Gato, Yuko
Kawasaki, Akira Suwa, Kazuya Honbou, Tomohiko Yamaguchi, Hiroyuki
Okumura, Masanao Sanagi, Yuichi Tomura, Masaya Orita, Takako Yonemoto,
and Hiroaki Masuzaki
Drug Discovery Research, Astellas Pharma Inc., Ibaraki, Japan (H.K., E.K.,
T.N., K.G., Y.K., A.S., K.H., T.Y., M.S., Y.T., M.O.);Medical Affairs, Astellas
Pharma Inc., Tokyo, Japan (H.O.); Shizuoka Prefectural General Hospital,
Shizuoka, Japan (T.Y.);Division of Endocrinology, Diabetes and Metabolism,
Hematology, Rheumatology (Second Department of Internal Medicine),
Graduate School of Medicine, University of the Ryukyus, Okinawa, Japan
(H.M.)
JPET Fast Forward. Published on January 14, 2014 as DOI:10.1124/jpet.113.211722
Copyright 2014 by the American Society for Pharmacology and Experimental Therapeutics.
This article has not been copyedited and formatted. The final version may differ from this version.JPET Fast Forward. Published on January 14, 2014 as DOI: 10.1124/jpet.113.211722
at ASPE
T Journals on N
ovember 18, 2018
jpet.aspetjournals.orgD
ownloaded from
JPET #211722
2
Running title:
distinct interaction of telmisartan-PPARγ
Correspondence to Hirotoshi Kakuta, M.S.
Drug Discovery Research
Astellas Pharma Inc.
21 Miyukigaoka
Tsukuba 305-8585, Ibaraki, Japan
Tel: +81-29-863-6632
Fax: +81-29-852-2955
E-mail: [email protected]
Number of text pages: 61
Number of tables: 2
Number of figures: 6
Number of references: 65
Number of words in Abstract: 250
Number of words in Introduction: 583
Number of words in Discussion: 2004
This article has not been copyedited and formatted. The final version may differ from this version.JPET Fast Forward. Published on January 14, 2014 as DOI: 10.1124/jpet.113.211722
at ASPE
T Journals on N
ovember 18, 2018
jpet.aspetjournals.orgD
ownloaded from
JPET #211722
3
Abbreviations: ARB, angiotensin II receptor blocker; DG, deoxy glucose; ITC,
isothermal titration calorimetry; PAMPA, parallel artificial membrane
permeability; PPARγ, peroxisome proliferator-activated receptor gamma;
RT-PCR, real-time polymerase chain reaction; SPR, surface plasmon resonance
Recommended section assignment:
Cellular and Molecular
This article has not been copyedited and formatted. The final version may differ from this version.JPET Fast Forward. Published on January 14, 2014 as DOI: 10.1124/jpet.113.211722
at ASPE
T Journals on N
ovember 18, 2018
jpet.aspetjournals.orgD
ownloaded from
JPET #211722
4
Abstract
A proportion of angiotensin II receptor blockers (ARBs) improve glucose
dyshomeostasis and insulin resistance in a clinical setting. Of these ARBs,
telmisartan has the unique property of being a partial agonist for peroxisome
proliferator-activated receptor γ (PPARγ). However, the detailed mechanism of
how telmisartan acts on PPARγ and exerts its insulin-sensitizing effect is poorly
understood. In this context, we investigated the agonistic activity of a variety of
clinically available ARBs on PPARγ using isothermal titration calorimetry
(ITC) and surface plasmon resonance (SPR) system. Based on physicochemical
data, we then re-evaluated the metabolically beneficial effects of telmisartan in
cultured murine adipocytes. ITC and SPR assays demonstrated that telmisartan
exhibited the highest affinity of the ARBs tested. Distribution coefficient and
parallel artificial membrane permeability assays were employed to assess
lipophilicity and cell permeability, for which telmisartan exhibited the highest
levels of both. We next examined the effect of each ARB on insulin-mediated
glucose metabolism in 3T3-L1 preadipocytes. To investigate the impact on
adipogenesis, 3T3-L1 preadipocytes were differentiated with each ARB in
addition to standard inducers of differentiation for adipogenesis. Telmisartan
dose-dependently facilitated adipogenesis and markedly augmented the mRNA
This article has not been copyedited and formatted. The final version may differ from this version.JPET Fast Forward. Published on January 14, 2014 as DOI: 10.1124/jpet.113.211722
at ASPE
T Journals on N
ovember 18, 2018
jpet.aspetjournals.orgD
ownloaded from
JPET #211722
5
expression of aP2, accompanied by an increase in the uptake of 2-deoxyglucose
and protein expression of GLUT4. In contrast, other ARBs showed only
marginal effects in these experiments. In accordance with its highest affinity of
binding for PPARγ as well as the highest cell permeability, telmisartan superbly
activates PPARγ among ARBs tested, thereby providing a fresh avenue for
treating hypertensive patients with metabolic derangement.
This article has not been copyedited and formatted. The final version may differ from this version.JPET Fast Forward. Published on January 14, 2014 as DOI: 10.1124/jpet.113.211722
at ASPE
T Journals on N
ovember 18, 2018
jpet.aspetjournals.orgD
ownloaded from
JPET #211722
6
1. Introduction
Insulin resistance is frequently observed in hypertensive patients
(Lamounier-Zepter et al., 2006; Zavaroni et al., 1992; Lind et al., 1995).
Angiotensin II type 1 (AT1) receptor blockers (ARBs) are widely used for the
treatment of hypertensive patients with fuel dyshomeostasis (Jandeleit-Dahm et
al., 2005; Abuissa et al., 2005), as angiotensin II inhibits physiological
differentiation of adipocytes and interferes with the insulin receptor signaling
pathway via the AT1 receptor (Janke et al., 2002; Velloso et al., 1996). However,
the degree of metabolically beneficial effects on insulin resistance or glucose
dyshomeostasis differs among ARBs (Vitale et al., 2005; Rizos et al., 2010; de
Luis et al., 2010).
Peroxisome proliferator-activated receptors (PPARs) are members of the
nuclear receptor superfamily of ligand-activated transcription factors. A variety
of coactivators and corepressors are involved in the ligand-dependent
transcription of genes, allowing tissue- and ligand-specific activation of target
genes by PPARs. As a main subtype of PPARs, PPARγ controls a wide variety
of genes involved in fuel storage in adipose tissue, and thus plays a crucial role
in the regulation of adipogenesis and insulin sensitivity (Picard and Auwerx,
2002). It has been shown that relative ratio of mRNA level between PPARγ1
This article has not been copyedited and formatted. The final version may differ from this version.JPET Fast Forward. Published on January 14, 2014 as DOI: 10.1124/jpet.113.211722
at ASPE
T Journals on N
ovember 18, 2018
jpet.aspetjournals.orgD
ownloaded from
JPET #211722
7
and PPARγ2 in 3T3-L1 preadipocytes is approximately 10-fold, but it turns to
be equal in differentiated 3T3-L1 adipocytes (Takenaka et al., 2013). It is also
reported that PPARγ1 protein does express in 3T3-L1 adipocytes. PPARγ1 is
expressed in preadipocytes, which increases approximately 8-hold during
adipocyte differentiation. In contrast, PPARγ2 is slightly expressed in
preadipocytes, which increases approximately 180-hold during the adipocyte
differentiation (Jitrapakdee et al., 2005). A wide variety of tissues or cells
express PPARγ1, whereas PPARγ2 is highly restricted to adipocytes (Escher et
al., 2001). PPARγ2 plays a crucial role in regulating the program of adipocyte
differentiation (Tontonoz et al., 1994). Therefore, we evaluated the effect of
telmisartan on PPARγ2 mRNA expression. A subgroup of ARBs has been
reported to augment PPARγ activity (Benson et al., 2004; Schupp et al., 2004),
suggesting that such ARBs could improve insulin resistance, at least in part, via
this activity. However, despite attention being focused on the insulin-sensitizing
effects of ARBs, the direct evidence of ARBs on their interaction with PPARγ
still remains obscure.
Telmisartan, an ARB, has unique chemical properties that enable it to
partially activate PPARγ (Amano et al., 2012) as well as strongly block AT1
receptors (Ohno et al., 2011; Kakuta et al., 2005). We recently demonstrated for
This article has not been copyedited and formatted. The final version may differ from this version.JPET Fast Forward. Published on January 14, 2014 as DOI: 10.1124/jpet.113.211722
at ASPE
T Journals on N
ovember 18, 2018
jpet.aspetjournals.orgD
ownloaded from
JPET #211722
8
the first time that telmisartan formed a ternary complex structure with PPARγ
and a coactivator, steroid receptor coactivator-1 (SRC-1), thereby revealing that
telmisartan directly binds to the ligand-binding domain of PPARγ via a distinct
mode from that of full agonists for PPARγ such as rosiglitazone and farglitazar
(Amano et al., 2012). In addition, telmisartan is known to induce a distinct
subset of genes in adipocytes compared with PPARγ full agonists, indicating
that it acts as a selective PPARγ modulator (SPPARM) (Schupp et al., 2005).
To clarify the mechanism by which telmisartan expresses agonistic activity
for PPARγ, we focused on the direct interaction between ARBs and PPARγ.
Two analytical methods—isothermal titration calorimetry (ITC) and surface
plasmon resonance (SPR)—were employed to precisely determine the binding
affinities of ARBs for PPARγ. Further, to examine whether or not ARBs enable
activation of PPARγ in cellular systems, we investigated physicochemical
properties, such as lipophilicity and cell permeability. Finally, using cultured
murine adipocytes, 3T3-L1 cells, we assessed the impact of the interaction
between ARBs and PPARγ on their PPARγ agonistic activities and resultant
insulin-sensitizing effects.
This article has not been copyedited and formatted. The final version may differ from this version.JPET Fast Forward. Published on January 14, 2014 as DOI: 10.1124/jpet.113.211722
at ASPE
T Journals on N
ovember 18, 2018
jpet.aspetjournals.orgD
ownloaded from
JPET #211722
9
2. Materials and Methods
2.1. Materials
Clinically available angiotensin II AT1 receptor blockers were prepared as
follows: telmisartan (2-(4-{[4-methyl-6-(1-methyl-1H-1,3-benzodiazol-2-yl)-
2-propyl-1H-1,3-benzodiazol-1-yl]methyl}phenyl)benzoic acid) was purchased from
Nippon Boehringer Ingelheim Pharmaceuticals Inc. (Tokyo, Japan) and
irbesartan (2-butyl-3-({4-[2-(2H-1,2,3,4-tetrazol-5-yl)phenyl]phenyl}methyl)-
1,3-diazaspiro[4.4]non-1-en-4-one) from Shionogi Pharmaceutical Pharma Inc.
(Tokyo, Japan). These compounds were then extracted by Astellas
Pharmaceutical Inc. (Ibaraki, Japan). Azilsartan (2-ethoxy-1-([2'-(5-oxo-4,5-
dihydro-1,2,4-oxadiazol-3-yl)biphenyl-4-yl]methyl)-1H-benzimidazole-7-
carboxylic acid) was synthesized by Astellas Pharmaceutical Inc. as previously
reported (Kohara et al., 1996). Candesartan (2-ethoxy-1-({4-[2-(2H-1,2,3,4-
tetrazol-5-yl) phenyl]phenyl}methyl)-1H-1,3-benzodiazole-7-carboxylic acid) was
purchased from Sequoia Research Products Ltd. (Pangbourne, UK). A
thiazolidinedione derivative, Pioglitazone ((RS)-5-(4-[2-(5-ethylpyridin-2-yl)
ethoxy]benzyl)thiazolidine-2,4-dione), was purchased from Takeda
Pharmaceutical Co, Ltd. (Osaka, Japan) and then extracted by Astellas
Pharmaceutical Inc.. Farglitazar was synthesized by Astellas Pharmaceutical
This article has not been copyedited and formatted. The final version may differ from this version.JPET Fast Forward. Published on January 14, 2014 as DOI: 10.1124/jpet.113.211722
at ASPE
T Journals on N
ovember 18, 2018
jpet.aspetjournals.orgD
ownloaded from
JPET #211722
10
Inc. as previously reported (Henke et al., 1998). Human recombinant insulin
was purchased from Funakoshi Co., Ltd. (Tokyo, Japan).
3-Isobutyl-1-methylxanthine (IBMX), dexamethasone (DEX), and fetal bovine
serum (FBS) were purchased from Sigma-Aldrich Japan Inc. (Tokyo, Japan).
Dulbecco’s Modified Eagle’s Medium (DMEM) was purchased from Life
Technologies Japan Ltd. (Tokyo, Japan). The lipid assay kit was purchased
from Primary Cell Co., Ltd. (Hokkaido, Japan).
2.2. Cell culture and Oil Red O staining
3T3-L1 cells were purchased from ATCC (Manassas, VA, USA) and
maintained in DMEM supplemented with 10% FBS until they reached a state
of density arrest at 2 days post-confluence on 24-well plates, and then cultured
and differentiated into adipocytes as described (Frost and Lane, 1985;
Ishii-Yonemoto et al., 2010). Briefly, cells were grown for 2 days
post-confluence (referred as Day 0) in 10% FBS/DMEM. Differentiation was
induced with 10% FBS/DMEM containing 0.5 mmol/L IBMX, 0.25 μmol/L
DEX and 1 μg/mL insulin for 2 days. The cells were then incubated in 10%
FBS/DMEM with 1 μg/mL insulin for 2 days and maintained with 10%
FBS/DMEM until Day 6. Telmisartan, irbesartan, azilsartan, candesartan, and
This article has not been copyedited and formatted. The final version may differ from this version.JPET Fast Forward. Published on January 14, 2014 as DOI: 10.1124/jpet.113.211722
at ASPE
T Journals on N
ovember 18, 2018
jpet.aspetjournals.orgD
ownloaded from
JPET #211722
11
pioglitazone were dissolved in DMSO and added to media from Days 0 to 6
with 0.1% of volume. Medium was changed every other day. On Day 6, the
cells were washed with PBS (-) twice, fixed in 3.7% formaldehyde for 1 h at
room temperature and then stained with 0.6% (w/v) Oil Red O solution (60%
isopropanol, 40% water) for 1 h at room temperature. Cells were then washed
with water to remove unbound dye. Oil Red O was eluted with isopropanol and
quantified by measuring the optical absorbance at 510 nm (OD510)
(Ramírez-Zacarías et al., 1992).
2.3. PPARγ protein expression and purification
In comparison with PPARγ1, PPARγ2 contains 30 additional amino acids at
its N-terminus as a consequence of alternative splicing at the 5�-end of the
gene (Tontonoz et al., 1994). It has been shown that PPARγ agonists bind to the
both isoforms with a similar extent of IC50s, and subsequently activate both
isoforms in the same way (Elbrecht et al., 1996). Importantly, ligand binding
domain of PPARγ is subjected to a series of isothermal titration calorimetry
(ITC) experiments (Porcelli et al., 2012). DNA encoding human PPARγ
ligand-binding domain (LBD) (amino acids 225-505) was amplified by PCR.
For ITC studies, DNA was subcloned into the expression vector pET28a
This article has not been copyedited and formatted. The final version may differ from this version.JPET Fast Forward. Published on January 14, 2014 as DOI: 10.1124/jpet.113.211722
at ASPE
T Journals on N
ovember 18, 2018
jpet.aspetjournals.orgD
ownloaded from
JPET #211722
12
(Merck Millipore, Darmstadt, Germany). HisTag-PPARγ LBD was expressed
in Escherichia coli BL21(DE3) (Merck Millipore) and purified as previously
described (Amano et al., 2012). The target protein was dialyzed against buffer
containing 20 mmol/L Tris-HCl, 100 mmol/L NaCl, 2 mmol/L EDTA, 1
mmol/L Tris(2-carboxyethyl)phosphine hydrochloride, pH 8.0 and concentrated
to 15 mg/mL. For SPR studies, DNA was subcloned into the modified
expression vector pAN-4 (Cosmo Bio Co., Ltd. Tokyo, Japan), with an
N-terminal HisTag followed by thrombin cleavage site and AviTag.
HisTag-AviTag-PPARγ LBD was expressed in E. coli BL21(DE3) (Merck
Millipore) transformed with pACYC184 harboring birA gene. In vivo
biotinylation of PPARγ LBD was carried out through expression. The target
protein was purified with Ni-NTA column, dialyzed against (20 mmol/L
Tris-HCl, 100 mmol/L NaCl, 2 mmol/L EDTA, 1 mmol/L
Tris(2-carboxyethyl)phosphine hydrochloride, pH 8.0), and concentrated to 4
mg/mL.
2.4. Isothermal titration calorimetry (ITC)
ITC experiments were carried out using a high-precision MicroCal
Auto-iTC200 system (GE Healthcare UK Ltd, Little Chalfont, Buckinghamshire,
This article has not been copyedited and formatted. The final version may differ from this version.JPET Fast Forward. Published on January 14, 2014 as DOI: 10.1124/jpet.113.211722
at ASPE
T Journals on N
ovember 18, 2018
jpet.aspetjournals.orgD
ownloaded from
JPET #211722
13
UK) (Velazquez-Campoy et al., 2004). All solutions contained within the
calorimetric cell and injector syringe were prepared in the same buffer, which
consisted of PBS, pH 7.4, with 5% DMSO. Binding affinities (Kd = 1/Ka) were
determined by injecting compounds (250 μmol/L-3 mmol/L) into the
calorimetric cell containing 2-25 μmol/L PPARγ at 25 °C. The absence of large
particles (i.e. aggregates) in the compound solutions was confirmed using
dynamic light scattering equipment (DLS, Zetasizer Nano ZS, Malvern, UK)
prior to experiments (Yao et al., 2005). By using DLS, possible compound
aggregates were detected in the pioglitazone solution, indicating the solubility
of this compound in this experimental buffer was too low to determine the
binding affinity with ITC. We therefore used farglitazar as a positive control.
Each experiment was performed as one injection of 0.8 μL followed by 27
injections of 1.4 μL with a 200-s interval between each injection. The heat
evolved after each injection was obtained from the integration of the
calorimetric signal. Data were analyzed using a single binding site model
implemented in the ORIGIN software package (OriginLab, Northampton, MA,
USA) provided with the instrument.
2.5. Surface plasmon resonance (SPR)
This article has not been copyedited and formatted. The final version may differ from this version.JPET Fast Forward. Published on January 14, 2014 as DOI: 10.1124/jpet.113.211722
at ASPE
T Journals on N
ovember 18, 2018
jpet.aspetjournals.orgD
ownloaded from
JPET #211722
14
SPR measurements were performed using a Biacore 4000 (GE Healthcare
UK Ltd.) at 25 °C. HBS-P+ buffer (10 mmol/L HEPES, 150 mmol/L NaCl,
0.05% Surfactant P20, pH 7.4) was used as running buffer. Biotinylated PPARγ
LBD was immobilized on the surface of a SA chip (GE Healthcare) in running
buffer. ARBs at a range of concentrations were then injected into the flow cells
at a flow rate of 30 μL/min for 60 s, followed by dissociation for 60 s Data
were analyzed using Biacore 4000 Evaluation Software version 1.0 for Steady
State Affinity Analysis to determine dissociation constants.
2.6. Assays for lipophilicity and cell permeability
An octanol/pH 7.4 buffer distribution coefficient was used as a quantitative
descriptor of lipophilicity of a series of ARBs. The procedure of distribution
and separation was conducted by the JIS standard protocol (JIS Z7260-107;
OECD Test Guideline 107). The concentrations of the upper phase (1-octanol
phase) and the lower phase (aqueous phase) were measured using an HPLC/MS
system (Agilent LC1100; Agilent Technologies, Palo Alto, CA, USA).
A parallel artificial membrane permeability assay (PAMPA) was employed to
assess cell permeability in a series of ARBs (Avdeef, 2012). The PAMPA
Evolution (pION Inc., Woburn, MA, USA) using a double-sink PAMPATM
This article has not been copyedited and formatted. The final version may differ from this version.JPET Fast Forward. Published on January 14, 2014 as DOI: 10.1124/jpet.113.211722
at ASPE
T Journals on N
ovember 18, 2018
jpet.aspetjournals.orgD
ownloaded from
JPET #211722
15
method was used in this study. In PAMPA, a “sandwich” is formed from a
96-well microtiter plate (PN 110243; pION Inc.) and a 96-well filter plate
(IPVH; Millipore, Bedford, MA, USA), such that each composite well is
divided into 2 chambers: a donor at the bottom and an acceptor at the top. The
donor solutions were adjusted in pH 6.5 (NaOH-treated universal buffer, PN
110151; pION Inc.), while the acceptor solutions were maintained at pH 7.4
(PN 110139; pION Inc.). Following the formation of the sandwich, the plates
were incubated at 25 °C for 2 h in a humidity-saturated atmosphere.
2.7. Real time polymerase chain reaction
Total RNA was purified from cultured adipocytes on Day 6 using an RNeasy
Mini Kit (Qiagen, Tokyo, Japan) in accordance with the manufacturer’s
instructions, and cDNA was synthesized as previously described (Suwa et al.,
2010). The level of mRNA expression of aP2 (aP2, also known as fatty acid
binding protein, transports fatty acids into cells. The aP2 gene is a
representative target of PPARγ) and PPARγ2 was quantified via real-time
quantitative polymerase chain reaction (RT-PCR) using the SYBR green
method with a PRISM 7900 Sequence Detector (PerkinElmer Applied
Biosystems, CA, USA). The primers for aP2 were tgagcctctgaagtccagata
This article has not been copyedited and formatted. The final version may differ from this version.JPET Fast Forward. Published on January 14, 2014 as DOI: 10.1124/jpet.113.211722
at ASPE
T Journals on N
ovember 18, 2018
jpet.aspetjournals.orgD
ownloaded from
JPET #211722
16
(forward) and acagggtctggtcatgaagga (reverse), while those for PPARγ2 were
caccagtgtgaattacagcaaa (forward) and gctcataggcagtgcatcag (reverse). Results
were normalized to endogenous β-actin mRNA concentrations. The level of
expression was calculated as the percentage of activation (% of activation)
compared to the DMSO control.
2.8. Western blot analysis
On Day 6, adipocytes were washed with ice-cold PBS and dissolved with
CelLytic M solution (Sigma-Aldrich Japan Inc., Tokyo, Japan), kept on ice for
10 min. After centrifugation, supernatant were normalized for protein
concentration using a BCA protein assay kit (Bio-Rad Laboratories Inc., Tokyo,
Japan) and subjected to immunoblotting. Equal amounts of protein lysates were
separated on SDS-polyacrylamide gel and transferred to a polyvinylidene
difluoride membrane, then exposed to anti-GLUT4 antibody (AbD Serotec,
Oxford, UK). The membranes were subsequently probed with horseradish
peroxidase-conjugated secondary antibody (GE Healthcare Bio-Sciences KK,
Tokyo, Japan) and enhanced using an ECL Western Blotting System (GE
Healthcare Bio-Sciences KK, Tokyo, Japan). Chemiluminescence intensity was
quantified using a quantitative digital imaging system (VersaDoc, Bio-Rad, CA,
This article has not been copyedited and formatted. The final version may differ from this version.JPET Fast Forward. Published on January 14, 2014 as DOI: 10.1124/jpet.113.211722
at ASPE
T Journals on N
ovember 18, 2018
jpet.aspetjournals.orgD
ownloaded from
JPET #211722
17
USA). The amount was calculated as the percentage of activation (% of
activation) compared to the DMSO control.
2.9. Assay for 2-Deoxy glucose uptake
On Day 6, glucose transport in 3T3-L1 adipocytes was assessed based on the
uptake of 2-deoxy-[14C]glucose (PerkinElmer Japan, Kanagawa, Japan) as
previously described (Shimaya et al., 1998). Briefly, cells were starved of
serum for 5 h before experiments. Cultured adipocytes were washed with PBS,
and then Krebs-Ringer-Hepes buffer (KRH buffer) or KRH buffer containing
insulin (final concentration of 100 nmol/L) was added and incubation was
continued for 20 min. Glucose transport assays were initiated by the addition of
2-deoxy-[14C]glucose (final concentration: 200 μmol/L, 0.2 μCi) for 10 min at
37 °C. The reaction was terminated by washing with ice-cold PBS. Cells were
disrupted with 0.5% SDS, and radioactivity was determined using a
scintillation counter.
2.10. Statistical Analysis
Data are expressed as mean ± standard error of the mean (S.E.M.). Results
for lipid accumulation in cells, real-time PCR, glucose uptake, and GLUT4
This article has not been copyedited and formatted. The final version may differ from this version.JPET Fast Forward. Published on January 14, 2014 as DOI: 10.1124/jpet.113.211722
at ASPE
T Journals on N
ovember 18, 2018
jpet.aspetjournals.orgD
ownloaded from
JPET #211722
18
protein expression were analyzed by ANOVA followed by Dunnett’s multiple
comparison test to compare the data between the vehicle (DMSO) and treated
groups. Statistical significance was defined as P < 0.05. All analyses were
conducted using GraphPad Prism software (version 5.0, GraphPad, San Diego
CA, USA).
This article has not been copyedited and formatted. The final version may differ from this version.JPET Fast Forward. Published on January 14, 2014 as DOI: 10.1124/jpet.113.211722
at ASPE
T Journals on N
ovember 18, 2018
jpet.aspetjournals.orgD
ownloaded from
JPET #211722
19
3. Results
3.1. Telmisartan exhibited the highest affinity for PPARγ among various
types of ARBs tested
The affinity (Kd = 1/Ka) of the interaction between PPARγ and ARBs was
measured by ITC. In this experiment, the binding of farglitazar, a potent PPARγ
full-agonist, was simultaneously assessed as a positive control. The binding
affinities of a series of compounds are summarized in Table 1. Only telmisartan
exhibited robust binding affinity for PPARγ, scoring a Kd value in a nanomolar
range (Kd = 340 ± 40 nmol/L). In contrast, irbesartan showed marginal binding
affinity for PPARγ (Kd = 10.3 ± 1.5 μmol/L). The value of azilsartan and
candesartan were both >100 μmol/L.
The binding affinities for PPARγ as determined by SPR were as follows:
telmisartan (8.6 ± 0.28 µmol/L), irbesartan (60 ± 6.0 µmol/L), azilsartan (>100
μmol/L) and candesartan (>100 μmol/L). Results obtained by SPR showed a
markedly similar trend to those in ITC (Papalia et al., 2006). Both results are in
agreement with previous reports of the rank order of PPARγ transactivation
ability of ARBs (Benson et al., 2004; Schupp et al., 2004; Kajiya et al., 2011).
3.2. Lipophilicities and cell permeability of ARBs
This article has not been copyedited and formatted. The final version may differ from this version.JPET Fast Forward. Published on January 14, 2014 as DOI: 10.1124/jpet.113.211722
at ASPE
T Journals on N
ovember 18, 2018
jpet.aspetjournals.orgD
ownloaded from
JPET #211722
20
Given that PPARγ is expressed in the nucleus, higher lipophilicity is required
for ARBs to penetrate the lipophilic lipid bilayer (nuclear membrane, cell
membrane) and interact with the PPARγ. We therefore assessed the
lipophilicity and cell permeability of ARBs. Telmisartan exhibited the highest
lipophilicity and the highest cell permeability of the compounds tested (Table
2). In contrast, irbesartan showed moderate lipophilicity and cell permeability.
Azilsartan and candesartan showed subtle lipophilicity and cell permeability.
Correlations between lipophilicity and cell permeability observed in this study
are in good accordance with the previous report (Yamashita et al, 1997).
3.3. Lipid accumulation in 3T3-L1 adipocytes
To investigate the potential impact of each ARB on adipogenesis, 3T3-L1
preadipocytes were differentiated with each ARB, with replenishment of
standard inducers of differentiation (i.e. IBMX, DEX, and insulin) (Frost and
Lane, 1985; Ishii-Yonemoto et al., 2010). As shown in Fig. 1, telmisartan
robustly and dose-dependently facilitated adipose differentiation at a
concentration of 0.3 μmol/L in 3T3-L1 cells. In contrast, only a higher dose (10
μmol/L) of irbesartan slightly induced adipose differentiation. Similarly, a
higher dose (10 μmol/L) of azilsartan or candesartan minutely provoked
This article has not been copyedited and formatted. The final version may differ from this version.JPET Fast Forward. Published on January 14, 2014 as DOI: 10.1124/jpet.113.211722
at ASPE
T Journals on N
ovember 18, 2018
jpet.aspetjournals.orgD
ownloaded from
JPET #211722
21
adipose differentiation. However, the impact was marginal compared with
telmisartan. These results are consistent with those of previous reports (Benson
et al., 2004; Schupp et al., 2004; Kajiya et al., 2011; Fujimoto et al., 2004).
3.4. Effect of ARBs on aP2 and PPARγ2 mRNA in cultured adipocytes
To investigate the potential regulation of PPARγ target genes by ARBs in
adipocytes, compounds were replenished with differentiation media from Day 0
to 6. By addition of 10 μmol/L telmisartan, the mRNA expression level of aP2
was markedly increased by approximately 3.4-fold compared to vehicle
(DMSO) (Fig. 2A). In contrast, other ARBs did not increase the mRNA
expression level of aP2. Further, telmisartan dose-dependently increased the
mRNA expression level of PPARγ2 (Fig. 2B, 3.0-fold increase at 10 μmol/L).
Interestingly, higher dose of irbesartan significantly increased the expression of
PPARγ2 (3.3-fold increase at 10 μmol/L). Azilsartan also significantly
increased the expression of PPARγ2 (2.0-fold increase at 10 μmol/L). However,
of note, these effects were not dose-dependent . In contrast, candesartan did not
increase expression of PPARγ2 at all.
3.5. Effect of ARBs on 2-deoxy glucose transport in 3T3 adipocytes
This article has not been copyedited and formatted. The final version may differ from this version.JPET Fast Forward. Published on January 14, 2014 as DOI: 10.1124/jpet.113.211722
at ASPE
T Journals on N
ovember 18, 2018
jpet.aspetjournals.orgD
ownloaded from
JPET #211722
22
To evaluate potential impact of ARBs on glucose transport in 3T3-L1
adipocytes, a 2-deoxy glucose (2-DG) uptake assay was conducted. As shown
in Fig. 3, even in the absence of insulin, 1 and 10 μmol/L telmisartan
significantly augmented 2-DG uptake in adipocytes by 1.6- and 2.4-fold,
respectively. In the presence of insulin, 1 and 10 μmol/L telmisartan augmented
2-DG uptake in adipocytes by 1.8- and 2.7-fold, respectively. Similarly, in the
absence or presence of insulin, 10 μmol/L irbesartan augmented 2-DG uptake
by 2.3 and 2.1-fold, respectively. In contrast, azilsartan as doses up to 10
μmol/L did not affect 2-DG uptake. Although a higher dose (10 μmol/L) of
candesartan increased 2-DG uptake, the effect was marginal compared with
telmisartan or irbesartan.
3.6. Effect of ARBs on GLUT4 protein level in 3T3-L1 adipocytes
We assessed the effect of each ARB on GLUT4 protein expression in
adipocytes. As shown in Fig. 4, telmisartan at 10 μmol/L significantly increased
GLUT4 protein 3.0-fold. Similarly, irbesartan at 10 μmol/L significantly
increased GLUT4 protein expression 2.8-fold. In contrast, azilsartan and
candesartan did not increase GLUT4 protein expression.
This article has not been copyedited and formatted. The final version may differ from this version.JPET Fast Forward. Published on January 14, 2014 as DOI: 10.1124/jpet.113.211722
at ASPE
T Journals on N
ovember 18, 2018
jpet.aspetjournals.orgD
ownloaded from
JPET #211722
23
4. Discussion
Affinity analyses of ARBs to PPARγ
ITC and SPR are the latest techniques for characterizing the direct
interaction of drugs and their target proteins (Holdgate et al., 2013; Núñez et al.,
2012; Renaud and Delsuc, 2009). Both techniques can be used to determine the
affinity (Kd) between a drug and its target protein in solution. ITC monitors
thermal changes (i.e. thermodynamics) upon complex formation, while SPR
monitors the process of association and dissociation between drugs and their
target proteins. One advantage of ITC assays is that samples can be used
without chemical modification, physical immobilization or a combination of
the two. Therefore, the interaction between a drug and its target protein can be
elucidated in an environment that closely reflects physiological conditions. To
our knowledge, the present study is the first direct demonstration of the binding
of each ARB for PPARγ.
Using ITC and SPR assays, we demonstrated that, among a series of ARBs,
telmisartan exhibited the highest affinity for PPARγ. The binding affinities of
ARBs show good correlation with transcriptional activities obtained from
biochemical assays, indicating that the initial binding to PPARγ is a pivotal step
This article has not been copyedited and formatted. The final version may differ from this version.JPET Fast Forward. Published on January 14, 2014 as DOI: 10.1124/jpet.113.211722
at ASPE
T Journals on N
ovember 18, 2018
jpet.aspetjournals.orgD
ownloaded from
JPET #211722
24
in transcriptional activation.
The superior binding affinity of telmisartan for PPARγ may be attributable to
its unique chemical structure. The molecular structure of telmisartan is divided
into two parts that consist of biphenyl carboxylic acid (the A-Part) and two
benzimidazole rings (the B-Part) (Fig. 5 inset). The A-Part is conserved in most
ARBs, but in telmisartan the carboxylic acid is substituted for bioisostere
tetrazole. Further, the B-Part of telmisartan is distinct from those of other ARBs
(Fig. 5 outset).
We recently revealed the complex structure of PPARγ with telmisartan via
X-ray crystallographic analysis (Amano et al., 2012). As shown in Fig. 5 inset,
part of the two benzimidazole rings occupies a lipophilic narrow pocket
surrounded by Ile281, Cys285, Leu356, Phe363 and His449 residues. In
general, binding of a compound to its target protein is mainly controlled by
complementarity in shape and physicochemical properties (lipophilic and
electrostatic characters). From this perspective, the benzimidazole rings of
telmisartan might be advantageous, for two reasons. First, the two
benzimidazole rings, which can form a co-planner conformation, might fit into
the narrow, flat pocket of PPARγs. Second, the lipophilic property of
benzimidazole rings as well as the pocket surface of PPARγ, are favorable for
This article has not been copyedited and formatted. The final version may differ from this version.JPET Fast Forward. Published on January 14, 2014 as DOI: 10.1124/jpet.113.211722
at ASPE
T Journals on N
ovember 18, 2018
jpet.aspetjournals.orgD
ownloaded from
JPET #211722
25
hydrophobic interaction, which is further reinforced by the stacking interaction
between the benzene ring of the central benzimidazole ring and His449. Of
note, the N3’ nitrogen of the central benzimidazole ring forms a hydrogen bond
with Tyr473, which appears to be essential for PPARγ agonism (Amano et al.,
2012). In contrast, other ARBs would be unable to bind PPARγ and form a
hydrogen bond with Tyr473, in a similar fashion to telmisartan (Fig. 5, outset).
For example, olmesartan and valsartan have bulky, non-planar substituents,
which are unfavorable for accessing the narrow and flat pocket of PPARγ.
Further, azilsartan, candesartan, eprosartan, olmesartan, and valsartan contain
carboxylic acid, the high acidity of which might hamper these compounds’
binding to the lipophilic surface of PPARγ. Eprosartan, irbesartan, losartan,
olmesartan, and valsartan also lack benzene rings adjacent to the imidazole
rings, which might reduce stacking interaction with His449. Taken together,
markedly high affinity of telmisartan for PPARγ observed in the ITC and SPR
can be attributed to the optimal complementarity in shape and lipophilicity.
Physicochemical properties of ARBs
Here, we demonstrated for the first time that telmisartan exhibits the highest
cell permeability of tested ARBs. Since PPARγ is localized in the nucleus,
This article has not been copyedited and formatted. The final version may differ from this version.JPET Fast Forward. Published on January 14, 2014 as DOI: 10.1124/jpet.113.211722
at ASPE
T Journals on N
ovember 18, 2018
jpet.aspetjournals.orgD
ownloaded from
JPET #211722
26
robust lipophilicity is critical for compounds to interact with the target through
the highly lipophilic lipid bilayer (nuclear membrane and cell membrane).
Consistent with a previous report (Yamashita et al., 1997), this study
demonstrated good correlation between lipophilicity and cell permeability in
each ARB. Indeed, when telmisartan was incubated with primary cultures of
murine mesangial cells, considerably high intracellular levels of the compound
were detected by high-performance liquid chromatography analysis (Shao et al.,
2007). In contrast, intracellular concentrations of losartan were undetectable in
the same assay (Shao et al., 2007). This result also supports our finding that the
concentration of telmisartan required to induce adipocyte differentiation is the
lowest of the ARBs tested. In addition to the direct PPARγ agonistic properties,
these data further suggest that the degree of lipophilicity of ARBs may also
affect activating potency of PPARγ.
In addition to lipophilicity, the mode of action of telmisartan is pivotal in the
activation of PPARγ. As reported by Schupp et al., telmisartan acts as a partial
agonist for PPARγ (Schupp et al., 2004). Crystallographic analysis revealed
that telmisartan exhibits a distinct binding mode from full agonists for PPARγ
(Amano et al., 2012). Binding of telmisartan to PPARγ results in unstable
interaction with its helix 12, which may recruit unique subset of co-activators.
This article has not been copyedited and formatted. The final version may differ from this version.JPET Fast Forward. Published on January 14, 2014 as DOI: 10.1124/jpet.113.211722
at ASPE
T Journals on N
ovember 18, 2018
jpet.aspetjournals.orgD
ownloaded from
JPET #211722
27
This binding pattern may also explain the mechanism by which telmisartan
expresses a unique subset of genes. PPARγ-coactivator-1 α (PGC-1α) binds to
PPARγ to induce the expression of key enzymes involved in the mitochondrial
respiration chain, thereby stimulating energy expenditure. Steroid receptor
coactivator-1 (SRC-1) stabilizes the binding of PGC-1α to PPARγ. Notably,
transcriptional intermediary factor-2 (TIF-2) competes with SRC-1 for the
formation of PGC-1α/PPARγ complexes, leading to an increase in
PPARγ-mediated triglyceride storage within adipocytes (Picard et al., 2002).
Therefore, an increase in the ratio of TIF-2 to SRC-1 in adipocytes might
contribute to the progression of obesity and insulin resistance (Picard et al.,
2002). A previous study revealed that telmisartan enhanced transcriptional
activation of PPARγ without recruitment of TIF-2 (Schupp et al., 2005). In this
context, we may reasonably speculate that TIF-2-independent activation of
PPARγ by telmisartan may prevent the gain of body fat and favor insulin
sensitization (Fig. 6B) (Schupp et al., 2005; Araki et al., 2006; Sugimoto et al.,
2006; Shimabukuro et al., 2007). As we described in Discussion section, we
speculate that telmisartan could augment PGC-1α action in an indirect manner
by decreasing the ratio of TIF-2 (lipid accumulating co-activator) to SRC-1
(anti-lipid accumulating co-activator) in 3T3-L1 adipocytes, partly because
This article has not been copyedited and formatted. The final version may differ from this version.JPET Fast Forward. Published on January 14, 2014 as DOI: 10.1124/jpet.113.211722
at ASPE
T Journals on N
ovember 18, 2018
jpet.aspetjournals.orgD
ownloaded from
JPET #211722
28
telmisartan enhances the transcriptional activity of PPARγ without recruitment
of TIF-2. Telmisartan does activate adipogenesis through partial agonistic
activity for PPARγ. However, it should be noted that telmisartan-controlled
balance between TIF-2 vs. SRC-1 in adipocytes may be beneficial for
prevention of body fat accumulation (Schupp et al., 2005; Araki et al., 2006;
Sugimoto et al., 2006; Shimabukuro et al., 2007). In contrast, PPARγ full
agonists such as pioglitazone are associated with unwelcome weight gain via
the robust recruitment of TIF-2. Weight reduction lowers arterial blood pressure
in obese hypertensive patients, suggesting a close association between energy
homeostasis and blood pressure (Busetto et al., 2001). A line of evidence has
suggested that hypertrophic adipocyte-derived hypertensive substances such as
leptin and angiotensinogen are involved in pathogenesis of obesity-related
hypertension (Wajchenberg, 2000). Taken together, in telmisartan, less potency
of body fat accumulation through partial agonistic activity for PPARγ as well as
AT1-R blockade coordinately improve hypertension in animals with elevated
blood pressure.
Of note, the concentration of telmisartan required for the augmentation of
lipid accumulation or glucose uptake in cultured adipocytes is achieved in the
plasma of hypertensive patients treated with telmisartan, but not with irbesartan
This article has not been copyedited and formatted. The final version may differ from this version.JPET Fast Forward. Published on January 14, 2014 as DOI: 10.1124/jpet.113.211722
at ASPE
T Journals on N
ovember 18, 2018
jpet.aspetjournals.orgD
ownloaded from
JPET #211722
29
(Israili, 2000; Marino et al., 1999). One exception was azilsartan, albeit only at
high concentrations, which slightly but significantly augmented the lipid
accumulation and mRNA level of PPARγ2 in a dose-independent manner.
Based on these results, ARBs other than telmisartan might not exert
PPARγ-dependent metabolically beneficial effects in hypertensive patients
treated with conventional clinical dosage.
Pharmacological properties of telmisartan in adipocytes and its clinical
implications
With its prominent agonistic activity for PPARγ, telmisartan has been
reported to improve insulin resistance and glucose dyshomeostasis both in
humans and rodents (Benson et al., 2004; Rizos et al., 2009; Takagi et al., 2013;
Mori et al., 2011; Fujisaka et al., 2011). Telmisartan has been reported to
significantly decrease the plasma levels of fasting insulin and triglycerides, also
significantly decrease the value of HOMA-R (homeostasis model assessment
for insulin resistance: index of insulin resistance), while telmisartan has been
reported to significantly increase the plasma levels of adiponectin and
HDL-cholesterol in diabetic patients with hypertension (Miura et al., 2005,
Watanabe et al., 2010). Furthermore, systematic reviews of randomized clinical
This article has not been copyedited and formatted. The final version may differ from this version.JPET Fast Forward. Published on January 14, 2014 as DOI: 10.1124/jpet.113.211722
at ASPE
T Journals on N
ovember 18, 2018
jpet.aspetjournals.orgD
ownloaded from
JPET #211722
30
trials clearly demonstrate that telmisartan is superior to other ARBs in the
amelioration of fasting plasma levels of glucose, insulin, triglyceride, and
insulin resistance, which is accompanied by a significant increase in plasma
adiponectin levels (Takagi and Umemoto, 2012a; 2012b; 2012c; Suksomboon
et al., 2012).
Previous report demonstrated that telmisartan significantly increased serum
adiponectin level in hypertensive patients with metabolic risk factors (Yano et
al., 2007). Because adiponectin gene expression in adipocytes is strongly
controlled by PPARγ (Maeda et al., 2001), it is reasonable to speculate that
partial agonistic activity for PPARγ in telmisartan of clinical doses significantly
elevate the circulating level of adiponectin in humans. Adiponectin is shown to
stimulate glucose utilization and fatty-acid oxidation by the activation of
AMP-kinase, and subsequently improve insulin resistance (Yamauchi et al,
2001, 2002). In this context, telmisartan would be beneficial for hypertensive
patients with multiple metabolic risk factors.
In the present study, telmisartan augmented 2-DG uptake in adipocytes at a
concentration of 0.3 μmol/L, comparable to that in the plasma of patients
treated with conventional clinical dosage. Further, Furukawa et al. recently
reported that telmisartan but not candesartan increased the phosphorylation of
This article has not been copyedited and formatted. The final version may differ from this version.JPET Fast Forward. Published on January 14, 2014 as DOI: 10.1124/jpet.113.211722
at ASPE
T Journals on N
ovember 18, 2018
jpet.aspetjournals.orgD
ownloaded from
JPET #211722
31
insulin receptors, insulin receptor substrate-1, and Akt by insulin in a
“differentiated� 3T3-L1 adipocyte system, suggesting that telmisartan
increases insulin sensitivity. In addition, the authors also reported that
up-regulation of glucose uptake by telmisartan was inhibited by a PPARγ
antagonist, T0070907, indicating that telmisartan acts via PPARγ activation in
adipose tissue (Furukawa et al., 2011). We previously reported that telmisartan
augments mRNA level of aP2 (a representative molecular indicator of PPARγ
activation) in 3T3-L1 cells (Fujimoto et al., 2004). In our report, the effect of
telmisartan was examined in both “differentiating” adipocytes and
“differentiated” adipocytes using 3T3-L1 cellular systems. Notably, telmisartan
did increase aP2 mRNA level at lower doses in differentiating adipocytes than
in differentiated adipocytes. Based on our previous findings, in the present
study, we examined the effect of telmisartan in differentiating adipocytes.
Therefore, it is likely to speculate that telmisartan would increase
phosphorylation of IR, IRS-1, and Akt at lower doses (1 μmol/L or lower) in
the differentiating 3T3-L1 adipocytes than in Furukawa’s differentiated 3T3-L1
adipocytes.
On the other hand, Lakshmanan reported that telmisartan attenuates
oxidative stress and rescue the down-regulation of Ang-(1-7) mas receptor
This article has not been copyedited and formatted. The final version may differ from this version.JPET Fast Forward. Published on January 14, 2014 as DOI: 10.1124/jpet.113.211722
at ASPE
T Journals on N
ovember 18, 2018
jpet.aspetjournals.orgD
ownloaded from
JPET #211722
32
protein (Lakshmanan et al., 2011) in murine kidney. In the same report, they
reported that telmisartan rescued the down-regulation of PGC-1α protein in
murine kidney, and thus they suggest that telmisartan might increase the
PPARγ and its downstream, PGC-1α expressions through the up-regulation of
Ang-(1-7) mas receptor. Therefore, there is a possibility that rescue of
down-regulation of Ang-(1-7) mas receptor by telmisartan might also
contribute to its metabolically-beneficial effects.
Collectively, our data support the notion that telmisartan exerts a variety of
metabolically beneficial effects within clinically available oral doses.
Conclusion
In this study of ARBs tested in a series of advanced analytical assays,
telmisartan exhibited the highest cell permeability and the highest binding
affinity and the highest agonistic activities for PPARγ. The concentration of
ARBs required for the augmentation of glucose uptake in cultured adipocytes is
achieved only in the plasma of hypertensive patients treated with telmisartan.
Such effects were not observed in irbesartan, azilsartan or candesartan. In this
context, among clinically used ARBs, telmisartan might solely exert
PPARγ-dependent metabolically beneficial effects in clinical settings. As we
This article has not been copyedited and formatted. The final version may differ from this version.JPET Fast Forward. Published on January 14, 2014 as DOI: 10.1124/jpet.113.211722
at ASPE
T Journals on N
ovember 18, 2018
jpet.aspetjournals.orgD
ownloaded from
JPET #211722
33
describe in introduction, angiotensin II inhibits physiological differentiation of
adipocytes and interferes with the insulin receptor signaling via the AT1
receptor. Thus, in general, ARBs are considered to improve insulin resistance
by the blockade of AT1-receptor. Furthermore, telmisartan may also improve
insulin resistance via PPARγ agonistic activity. Therefore, it is reasonable to
speculate that telmisartan could outweigh the action of other ARBs (Fig.6). Our
findings provide novel insight into the therapeutic options for hypertensive
patients with insulin resistance and convergence of metabolic risk factors.
This article has not been copyedited and formatted. The final version may differ from this version.JPET Fast Forward. Published on January 14, 2014 as DOI: 10.1124/jpet.113.211722
at ASPE
T Journals on N
ovember 18, 2018
jpet.aspetjournals.orgD
ownloaded from
JPET #211722
34
Acknowledgements
We thank Mitsubishi Chemical Medience Corporation for help with the cell
experiments. We also thank Mr. F. Hirayama and Mr. T. Yamanaka for
extracting telmisartan and irbesartan from tablets and synthesizing azilsartan.
This article has not been copyedited and formatted. The final version may differ from this version.JPET Fast Forward. Published on January 14, 2014 as DOI: 10.1124/jpet.113.211722
at ASPE
T Journals on N
ovember 18, 2018
jpet.aspetjournals.orgD
ownloaded from
JPET #211722
35
Authorship Contributions
Participated in research design:
Kakuta, Kurosaki, Niimi, Kawasaki, Suwa, Yamaguchi, Okumura, Sanagi,
Tomura, Orita, Yonemoto, and Masuzaki
Conducted experiments:
Kakuta, Kurosaki, Gato, Kawasaki, Suwa, Honbou, Yamaguchi, and
Masuzaki
Contributed new reagents or analytic tools:
Kakuta, Gato, Kawasaki, Suwa, and Honbou
Performed data analysis:
Kakuta, Kurosaki, Niimi, Gato, Kawasaki, Suwa, Honbou, Yamaguchi,
Okumura, and Masuzaki
Wrote or contributed to the writing of the manuscript:
Kakuta, Kurosaki, Niimi, Gato, Kawasaki, Suwa, Honbou, Yamaguchi,
Okumura, Sanagi, Tomura, Orita, Yonemoto, and Masuzaki
This article has not been copyedited and formatted. The final version may differ from this version.JPET Fast Forward. Published on January 14, 2014 as DOI: 10.1124/jpet.113.211722
at ASPE
T Journals on N
ovember 18, 2018
jpet.aspetjournals.orgD
ownloaded from
JPET #211722
36
References
Abuissa H, Jones PG, Marso SP, and O’Keefe JH (2005).
Angiotensin-converting enzyme inhibitors or angiotensin receptor blockers
for prevention of type 2 diabetes. A meta-analysis of randomized clinical
trials. J Am Coll Cardiol 46:821-826
Amano Y, Yamaguchi T, Ohno K, Niimi T, Orita M, Sakashita H, and Takeuchi
M (2012). Structural basis for telmisartan-mediated partial activation of
PPAR gamma. Hypertens Res 35:715-719
Araki K, Masaki T, Katsuragi I, Tanaka K, Kakuma T, and Yoshimatsu H
(2006). Telmisartan prevents obesity and increases the expression of
uncoupling protein 1 in diet-induced obese mice. Hypertension 48:51-57
Avdeef A (2012). Permeability-PAMPA, In Absorption and drug development:
solubility, permeability, and charge state Second edition ed., pp319-498,
Wiley. com.
Benson SC, Pershadsingh HA, Ho CI, Chittiboyina A, Desai P, Pravenec M, Qi
N, Wang J, Avery MA, and Kurtz TW (2004). Identification of telmisartan as
a unique angiotensin II receptor antagonist with selective PPARγ-modulating
activity. Hypertension 43:993-1002
This article has not been copyedited and formatted. The final version may differ from this version.JPET Fast Forward. Published on January 14, 2014 as DOI: 10.1124/jpet.113.211722
at ASPE
T Journals on N
ovember 18, 2018
jpet.aspetjournals.orgD
ownloaded from
JPET #211722
37
Busetto L. (2001) Visceral obesity and the metabolic syndrome. Effect of
weight loss. Nutr Metab Cardiovasc Dis;11:195-204
de Luis DA, Conde R, González-Sagrado M, Aller R, Izaola O, Dueñas A,
Castrillón JL, and Romero E (2010). Effects of telmisartan vs olmesartan on
metabolic parameters, insulin resistance and adipocytokines in hypertensive
obese patients. Nutr Hosp 25:275-279
Elbrecht A, Chen Y, Cullinan CA, Hayes N, Leibowitz MD, Moller DE, and
Berger J. (1996) Molecular cloning, expression and characterization of
human peroxisome proliferator activated receptors γ1 and γ2. Biochem
Biophys Res Commun 224:431-437
Escher P, Braissant O, Basu-Modak S, Michalik L, Wahli W, and Desvergne B.
(2001) Rat PPARs: Quantitative analysis in adult rat tissues and regulation in
fasting and refeeding. Endocrinology 142:4195-4202
Frost SC, and Lane MD (1985). Evidence for the involvement of vicinal
sulfhydryl groups in insulin-activated hexose transport by 3T3-L1 adipocytes.
J Biol Chem 260:2646-2652
Fujimoto M, Masuzaki H, Tanaka T, Yasue S, Tomita T, Okazawa K, Fujikura J,
Chusho H, Ebihara K, Hayashi T, Hosoda K, and Nakao K (2004). An
angiotensin II AT1 receptor antagonist, telmisartan augments glucose uptake
This article has not been copyedited and formatted. The final version may differ from this version.JPET Fast Forward. Published on January 14, 2014 as DOI: 10.1124/jpet.113.211722
at ASPE
T Journals on N
ovember 18, 2018
jpet.aspetjournals.orgD
ownloaded from
JPET #211722
38
and GLUT4 protein expression in 3T3-L1 adipocytes. FEBS Letters.
576:492-497
Fujisaka S, Usui I, Kanatani Y, Ikutani M, Takasaki I, Tsuneyama K, Tabuchi Y,
Bukhari A, Yamazaki Y, Suzuki H, Senda S, Aminuddin A, Nagai Y, Takatsu
K, Kobayashi M, and Tobe K (2011). Telmisartan improves insulin resistance
and modulates adipose tissue macrophage polarization in high-fat-fed mice.
Endocrinology 152:1789-1799
Furukawa H, Mawatari K, Koyama K, Yasui S, Morizumi R, Shimohata T,
Harada N, Takahashi A, and Nakaya Y (2011). Telmisartan increases
localization of glucose transporter 4 to the plasma membrane and increases
glucose uptake via peroxisome proliferator-activated receptor γ in 3T3-L1
adipocytes. Eur J Pharmacol 660:485-491
Henke BR, Blanchard SG, Brackeen MF, Brown KK, Cobb JE, Collins JL,
Harrington WW, Hashim MA, Hull-Ryde EA, Kaldor I, Kliewer SA, Lake
DH, Leesnitzer LM, Lehmann JM, Lenhard JM, Orband-Miller LA, Miller
JF, Mook RA Jr, Noble SA, Oliver W Jr, Parks DJ, Plunket KD, Szewczyk
JR, and Willson TM (1998). N-(2-Benzoylphenyl)-L-tyrosine PPARγ
aginists. 1. Discovery of a novel series of potent antihyperglycemic and
antihyperlipidemic agents. J Med Chem 41:5020-5036
This article has not been copyedited and formatted. The final version may differ from this version.JPET Fast Forward. Published on January 14, 2014 as DOI: 10.1124/jpet.113.211722
at ASPE
T Journals on N
ovember 18, 2018
jpet.aspetjournals.orgD
ownloaded from
JPET #211722
39
Holdgate G, Geschwindner S, Breeze A, Davies G, Colclough N, Temesi D, and
Ward L (2013). Biophysical methods in drug discovery from small molecule
to pharmaceutical. In Protein-Ligand Interactions, Williams MA. ; Daviter T.
Eds. ; Humana Press: 1008:pp327-355
Ishii-Yonemoto T, Masuzaki H, Yasue S, Okada S, Kozuka C, Tanaka T,
Noguchi M, Tomita T, Fujikura J, Yamamoto Y, Ebihara K, Hosoda K, and
Nakao K (2010). Glucocorticoid reamplification within cells intensifies
NF-κB and MAPK signaling and reinforces inflammation in activated
preadipocytes. Am J Physiol Endocrinol Metab 298:E930-E940
Israili ZH (2000). Clinical pharmacokinetics of angiotensin II (AT1) receptor
blockers in hypertension. J Hum Hypertens 14 (Suppl. 1):S73-S86
Jandeleit-Dahm KA, Tikellis C, Reid CM, Johnston CI, and Cooper ME (2005).
Why blockade of the renin-angiotensin system reduces the incidence of
new-onset diabetes. J Hypertens 23:463-473
Janke J, Engeli S, Gorzelniak K, Luft FC, and Sharma AM (2002). Mature
adipocytes inhibit in vitro differentiation of human preadipocytes via
angiotensin type 1 receptors. Diabetes 51:1699-1707
Jitrapakdee S, Slawik M, Medina-Gomez G, Campbell M, Wallace JC, Sethi JK,
O’Rahilly S and Vidal-Puig AJ (2005) The peroxisome proliferator-activated
This article has not been copyedited and formatted. The final version may differ from this version.JPET Fast Forward. Published on January 14, 2014 as DOI: 10.1124/jpet.113.211722
at ASPE
T Journals on N
ovember 18, 2018
jpet.aspetjournals.orgD
ownloaded from
JPET #211722
40
receptor-γ regulates murine pyruvate carboxylase gene expression in vivo
and in vitro. J Biol Chem 280:27466-27476
Kajiya T, Ho C, Wang J, Vilardi R, and Kurtz TW (2011). Molecular and
cellular effects of azilsartan: a new generation angiotensin II receptor blocker.
J Hypertens 29:2476-2483
Kakuta H, Sudoh K, Sasamata M, and Yamagishi S (2005). Telmisartan has the
strongest binding affinity to angiotensin II type 1 receptor: Comparison with
other angiotensin II type 1 receptor blockers. Int J Clin Pharmacol Res
25:41-46
Kohara Y, Kubo K, Imamiya E, Wada T, Inada Y, and Naka T (1996). Synthesis
and angiotensin II receptor antagonistic activities of benzimidazole
derivatives bearing acidic heterocycles as novel tetrazole bioisosteres. J Med
Chem 39:5228-5235
Lakshmanan AR, Watanabe K, Thandavarayan RA, Sari FR, Harima M,
Giridharan VV, Soetikno V, Kodama M, and Aizawa Y (2011) Telmisartan
attenuates oxidative stress and renal fibrosis in streptozotocin induced
diabetic mice with the alteration of angiotensin-(1-7) mas receptor
expression associated with its PPAR-γ agonist action. Free Radic Res
45:575-584
This article has not been copyedited and formatted. The final version may differ from this version.JPET Fast Forward. Published on January 14, 2014 as DOI: 10.1124/jpet.113.211722
at ASPE
T Journals on N
ovember 18, 2018
jpet.aspetjournals.orgD
ownloaded from
JPET #211722
41
Lamounier-Zepter V, Ehrhart-Bornstein M, and Bornstein SR (2006). Insulin
resistance in hypertension and cardiovascular disease. Best Pract Res Clin
Endocrinol Metab 20:355-367
Lind L, Berne C, and Lithell H (1995). Prevalence of insulin resistance in
essential hypertension. J Hypertens 13:1457-1462
Maeda N, Takahashi M, Funahashi T, Kihara S, Nishizawa H, Kishida K,
Nagaretani H, Matsuda M, Komuro R, Ouchi N, Kuriyama H, Hotta K,
Nakamura T, Shimomura I, and Matsuzawa Y (2001) PPARγ ligands
increase expression and plasma concentrations of adiponectin, an
adipose-derived protein. Diabetes;50:2094-2099
Marino MR, Langenbacher KM, Ford NF, Raymond RH, Manning J,
Vesterqvist O, Shamblen EC, and Lasseter KC (1999). Pharmacodynamics
and pharmacokinetics of irbesartan in patients with mild to moderate
hypertension. J Cardiovasc Pharmacol Ther 4:67-75
Miura Y, Yamamoto N, Tsunekawa S, Taguchi S, Eguchi Y, Ozaki N, and
Oiso Y. (2005) Replacement of valsartan and candesartan by telmisartan in
hypertensive patients with type 2 diabetes: metabolic and antiatherogenic
consequences. Diabet Care 28:757-758
Mori Y, Tanaka T, Matsuura K, Yokoyama J, and Utsunomiya K (2011).
This article has not been copyedited and formatted. The final version may differ from this version.JPET Fast Forward. Published on January 14, 2014 as DOI: 10.1124/jpet.113.211722
at ASPE
T Journals on N
ovember 18, 2018
jpet.aspetjournals.orgD
ownloaded from
JPET #211722
42
Influence of telmisartan on insulin response after glucose loading in obese
patients with hypertension: ARB trial of hypertension in obese patients with
hyperinsulinemia assessed by oral glucose tolerance test (ATHLETE). Adv
Ther 28:698-706
Núñez S, Venhorst J, and Kruse CG (2012). Target-drug interactions: first
principles and their application to drug discovery. Drug Discov Today
17:10-22
Ohno K, Amano Y, Kakuta H, Niimi T, Takakura S, Orita M, Miyata K,
Sakashita H, Takeuchi M, Komuro I, Higaki J, Horiuchi M, Kim-Mitsuyama
S, Mori Y, Morishita R, and Yamagishi S (2011). Unique “delta lock”
structure of telmisartan is involved in its strongest binding affinity to
angiotensin II type 1 receptor. Biochem Biophys Res Commun 404:434-437
Papalia GA, Leavitt S, Bynum MA, Katsamba PS, Wilton R, Qiu H, Steukers
M, Wang S, Bindu L, Phogat S, Giannetti AM, Ryan TE, Pudlak VA,
Matusiewicz K, Michelson KM, Nowakowski A, Pham-Baginski A, Brooks J,
Tieman BC, Bruce BD, Vaughn M, Baksh M, Cho YH, Wit MD, Smets A,
Vandersmissen J, Michiels L, and Myszka DG (2006). Comparative analysis
of 10 small molecules binding to carbonic anhydrase II by different
investigators using Biacore technology. Anal Biochem 359:94-105
This article has not been copyedited and formatted. The final version may differ from this version.JPET Fast Forward. Published on January 14, 2014 as DOI: 10.1124/jpet.113.211722
at ASPE
T Journals on N
ovember 18, 2018
jpet.aspetjournals.orgD
ownloaded from
JPET #211722
43
Picard F, and Auwerx J (2002). PPARγ and glucose homeostasis. Annu Rev
Nutr 22:167-197
Picard F, Géhin M, Annicotte J, Rocchi S, Champy MF, O’Malley BW,
Chambon P, and Auwerx J (2002). SRC-1 and TIF2 control energy balance
between white and brown adipose tissues. Cell 111:931-941
Porcelli L, Gilardi F, Laghezza A, Piemontese L, Mitro N, Azzariti A, Altieri F,
Cervoni L, Fracchiolla G, Giudici M, Guerrini U, Lavecchia A, Montanari R,
Giovanni CD, Paradiso A, Pochetti G, Simone GM, Tortorella P, Crestani M,
and Loiodice F (2012) Synthesis, characterization and biological evaluation
of ureidofibrate-like derivatives endowed with peroxisome
proliferator-activated receptor activity. J Med Chem 55:37-54
Ramírez-Zacarías JL, Castro-Muñozledo F, and Kuri-Harcuch W (1992).
Quantitation of adipose conversion and triglycerides by staining
intracytoplasmic lipids with Oil red O. Histochemistry 97:493-497
Renaud JP, and Delsuc MA (2009). Biophysical techniques for ligand screening
and drug design. Curr Opin Pharmacol 9:622-628
Rizos CV, Elisaf MS, and Liberopoulos EN (2009). Are the pleiotropic effects
of telmisartan clinically relevant? Curr Pharm Des 15:2815-2832
Rizos CV, Milionis HJ, Kostapanos MS, Florentin M, Kostara CE, Elisaf MS,
This article has not been copyedited and formatted. The final version may differ from this version.JPET Fast Forward. Published on January 14, 2014 as DOI: 10.1124/jpet.113.211722
at ASPE
T Journals on N
ovember 18, 2018
jpet.aspetjournals.orgD
ownloaded from
JPET #211722
44
and Liberopoulos EN (2010). Effects of rosuvastatin combined with
olmesartan, irbesartan, or telmisartan on indices of glucose metabolism in
Greek adults with impaired fasting glucose, hypertension, and mixed
hyperlipidemia: A 24-week, randomized, open-label, prospective study. Clin
Ther 32:492-505
Schupp M, Clemenz M, Gineste R, Witt H, Janke J, Helleboid S, Hennuyer N,
Ruiz P, Unger T, Staels B, and Kintscher U (2005). Molecular
characterization of new selective peroxisome proliferator-activated receptor
γ modulators with angiotensin receptor blocking activity. Diabetes
54:3442-3452
Schupp M, Janke J, Clasen R, Unger T, and Kintscher U (2004). Angiotensin
type 1 receptor blockers induce peroxisome proliferator-activated receptor-γ
activity. Circulation 109:2054-2057
Shao J, Nangaku M, Inagi R, Kato H, Miyata T, Matsusaka T, Noiri E, and
Fujita T (2007). Receptor-independent intracellular radical scavenging
activity of an angiotensin II receptor blocker. J Hypertens 25:1643-1649
Shimabukuro M, Tanaka H, and Shimabukuro T (2007). Effects of telmisartan
on fat distribution in individuals with the metabolic syndrome. J Hypertens
25:841-848
This article has not been copyedited and formatted. The final version may differ from this version.JPET Fast Forward. Published on January 14, 2014 as DOI: 10.1124/jpet.113.211722
at ASPE
T Journals on N
ovember 18, 2018
jpet.aspetjournals.orgD
ownloaded from
JPET #211722
45
Shimaya A, Kurosaki E, Shioduka K, Nakano R, Shibasaki M, and Shikama H
(1998). YM268 increases the glucose uptake, cell differentiation, and mRNA
expression of glucose transporter in 3T3-L1 adipocytes. Horm Metab Res
30:543-548
Sugimoto K, Qi NR, Kazdová L, Pravenec M, Ogihara T, and Kurtz TW (2006).
Telmisartan but not valsartan increases caloric expenditure and protects
against weight gain and hepatic steatosis. Hypertension 47:1003-1009
Suksomboon N, Poolsup N, and Prasit T (2012). Systematic review of the
effect of telmisartan on insulin sensitivity in hypertensive patients with
insulin resistance or diabetes. J Clin Pharm Ther 37:319-327
Suwa A, Kurama T, Yamamoto T, Sawada A, Shimokawa T, and Aramori I
(2010). Glucose metabolism activation by SHIP2 inhibitors via up-regulation
of GLUT1 gene in L6 myotubes. Eur J Pharmacol 642:177-182
Takagi H, Niwa M, Mizuno Y, Goto S, and Umemoto T (2013). Telmisartan as
a metabolic sartan: The first meta-analysis of randomized controlled trials in
metabolic syndrome. J Am Soc Hypertens 7:229-235
Takagi H, and Umemoto T (2012a). Telmisartan increases adiponectin levels: A
meta-analysis and meta-regression of randomized head-to-head trials. Int J
Cardiol 155:448-451
This article has not been copyedited and formatted. The final version may differ from this version.JPET Fast Forward. Published on January 14, 2014 as DOI: 10.1124/jpet.113.211722
at ASPE
T Journals on N
ovember 18, 2018
jpet.aspetjournals.orgD
ownloaded from
JPET #211722
46
Takagi H, and Umemoto T (2012b). Telmisartan improves insulin sensitivity: A
meta-analysis of randomized head-to-head trials. Int J Cardiol 156:92-96
Takagi H, and Umemoto T (2012c). Telmisartan reduces triglyceride levels
over other angiotensin II receptor blockers: A meta-analysis of randomized
head-to-head trials. Int J Cardiol 157:403-407
Takenaka Y, Inoue I, Nakano T, Shinoda Y, Ikeda M, Awata T, and Katayama S.
(2013) A novel splicing variant peroxisome proliferator-activated receptor-γ
(Pparγ1sv) cooperatively regulates adipocyte differentiation with Pparγ2.
PLoS One 8:e65583
Tontonoz P, Hu E, and Spiegelman BM. (1994) Stimulation of adipogenesis in
fibroblasts by PPARγ2, a lipid-activated transcription factor. Cell
79:1147-1156
Velazquez-Campoy A, Ohtaka H, Nezami A, Muzammil S, and Freire E (2004).
Isothermal titration calorimetry. in Curr Protoc Cell Biol Chapter 17:Unit
178
Velloso LA, Folli F, Sun XJ, White MF, Saad MJ, and Kahn CR (1996).
Cross-talk between the insulin and angiotensin signaling systems. Proc Natl
Acad Sci. USA 93:12490-12495
Vitale C., Mercuro G, Castiglioni C, Cornoldi A, Tulli A, Fini M, Volterrani M,
This article has not been copyedited and formatted. The final version may differ from this version.JPET Fast Forward. Published on January 14, 2014 as DOI: 10.1124/jpet.113.211722
at ASPE
T Journals on N
ovember 18, 2018
jpet.aspetjournals.orgD
ownloaded from
JPET #211722
47
and Rosano GM (2005). Metabolic effect of telmisartan and losartan in
hypertensive patients with metabolic syndrome. Cardiovasc Diabetol 4:6
Wajchenberg BL. (2000) Subcutaneous and visceral adipose tissue: their
relation to the metabolic syndrome. Endocr Rev 21:697-738
Watanabe M, Inukai K, Sumita T, Ikebukuro K, Ito D, Kurihara S, Ono H,
Awata T, and Katayama S. (2010) Effects of telmisartan on insulin
resistance in Japanese type 2 diabetic patients. Intern Med 49:1843-1847
Yamashita S, Tanaka Y, Endoh Y, Taki Y, Sakane T, Nadai T, and Sezaki H
(1997). Analysis of drug permeation across Caco-2 monolayer: Implication
for predicting in vivo drug absorption. Pharm Res 14:486-491
Yamauchi T, Kamon J, Minokoshi Y, Ito Y, Waki H, Uchida S, Yamashita S,
Noda M, Kita S, Ueki K, Eto K, Akanuma Y, Froguel P, Foufelle F, Ferre P,
Carling D, Kimura S, Nagai R, Kahn BB, and Kadowaki T (2002)
Adiponectin stimulates glucose utilization and fatty-acid oxidation by
activating AMP-activated protein kinase. Nat Med 8:1288-1295
Yamauchi T, Kamon J, Waki H, Terauchi Y, Kubota N, Hara K, Mori Y, Ide T,
Murakami K, Tsuboyama-Kasaoka N, Ezaki O, Akanuma Y, Gavrilova O,
Vinson C, Reitman ML, Kagechika H, Shudo K, Yoda M, Nakano Y, Tobe K,
Nagai R, Kimura S, Tomita M, Froguel P, and Kadowaki T. (2001) The
This article has not been copyedited and formatted. The final version may differ from this version.JPET Fast Forward. Published on January 14, 2014 as DOI: 10.1124/jpet.113.211722
at ASPE
T Journals on N
ovember 18, 2018
jpet.aspetjournals.orgD
ownloaded from
JPET #211722
48
fat-derived hormone adiponectin reverses insulin resistance associated with
both lipoatrophy and obesity. Nat Med 7:941-946
Yano Y, Hoshide S, Ishikawa J, Noguchi C, Tukui D, Hidaka T, Tada M,
Kanemaru Y, Yano A, Ishikawa S, Shimada K, and Kario K (2007) The
differential effects of angiotensin II type 1 receptor blockers on
microalbminuria in relation to low-grade inflammation in metabolic
hypertensive patients. Am J Hypertens 20:565-572
Yao B, Collins B, and Chen M (2005). Light scattering to detect compound
aggregation in screening assays. DrugPlus International
Zavaroni I, Mazza S, Dall’Aglio E, Gasparini P, Passeri M, and Reaven GM
(1992). Prevalence of hyperinsulinaemia in patients with high blood pressure.
J Intern Med 231:235-240
This article has not been copyedited and formatted. The final version may differ from this version.JPET Fast Forward. Published on January 14, 2014 as DOI: 10.1124/jpet.113.211722
at ASPE
T Journals on N
ovember 18, 2018
jpet.aspetjournals.orgD
ownloaded from
JPET #211722
49
Footnotes
While this research was supported by Astellas Pharma Inc., Drs. Yonemoto
and Masuzaki declare no conflicts of interest concerning the present
manuscript.
Dr. Masuzaki is supported in part by Grants-in-Aid from the Ministry of
Education, Culture, Sports, Science and Technology of Japan (MEXT)
KAKENHI [Grant 24591338, (2012~2014)] and by Special Account Budget for
Education and Research (2011~2015) granted by the Japan Ministry of
Education, Culture, Sports, Science and Technology of Japan.
This article has not been copyedited and formatted. The final version may differ from this version.JPET Fast Forward. Published on January 14, 2014 as DOI: 10.1124/jpet.113.211722
at ASPE
T Journals on N
ovember 18, 2018
jpet.aspetjournals.orgD
ownloaded from
JPET #211722
50
Figure legends
Figure 1. Effect of each ARB or pioglitazone on adipose differentiation in
3T3-L1 adipocytes. Telmisartan, irbesartan, azilsartan, candesartan, and
pioglitazone were dissolved in DMSO (vehicle) and added to media during the
course of adipocyte differentiation (Day 0-6). (A) Differentiated adipocytes
were fixed and stained with Oil Red O at day 6. Microscopic images
(magnitude 10×) of cells are shown. (B) Lipid accumulation was assessed via
quantification of OD510 in destained Oil Red O with isopropanol. Data are
expressed as mean ± S.E.M. from quadruplicate experiments. *P < 0.05, ***P <
0.001 (Dunnett’s multiple comparison test) compared with vehicle
(DMSO)-treated group. TEL: telmisartan, IRB: irbesartan, AZL: azilsartan,
CAN: candesartan, PIO: pioglitazone
Figure 2. Effect of ARBs and pioglitazone on the mRNA expression of aP2
and PPARγ2 in differentiating 3T3-L1 adipocytes. Cells were treated with
each compound during the course of adipocyte differentiation (Day 0-6). Total
RNA was extracted, and mRNA for aP2 (A) or PPARγ2 (B) was determined via
quantitative RT-PCR. Quantification of relative mRNA expression is shown.
Results were normalized to the signal generated from β-actin mRNA. Data are
This article has not been copyedited and formatted. The final version may differ from this version.JPET Fast Forward. Published on January 14, 2014 as DOI: 10.1124/jpet.113.211722
at ASPE
T Journals on N
ovember 18, 2018
jpet.aspetjournals.orgD
ownloaded from
JPET #211722
51
expressed as mean ± S.E.M. from triplicate or quadruplicate experiments. **P
< 0.01, ***P < 0.001 (Dunnett’s multiple comparison test) compared with
vehicle (DMSO)-treated group. TEL: telmisartan, IRB: irbesartan, AZL:
azilsartan, CAN: candesartan, PIO: pioglitazone
Figure 3. Effect of each ARB or pioglitazone on basal and
insulin-stimulated 2-deoxy glucose (DG) uptake in 3T3-L1 adipocytes.
Cells were treated with each compound during the course of adipocyte
differentiation (Day 0-6). 2-DG uptake was measured in the absence (A) or
presence (B) of 100 nmol/L insulin. Data are expressed as mean ± S.E.M. from
quadruplicate experiments. *P < 0.05, **P < 0.01, ***P < 0.001 (Dunnett’s
multiple comparison test) compared with vehicle (DMSO)-treated group. TEL:
telmisartan, IRB: irbesartan, AZL: azilsartan, CAN: candesartan, PIO:
pioglitazone
Figure 4. Effect of each ARB or pioglitazone on GLUT4 protein expression
in 3T3-L1 adipocytes. Cells were treated with each compound during the
course of adipocyte differentiation (Day 0-6). On Day 6, total cell lysates were
prepared, and equal amounts of protein were subjected to Western blotting.
This article has not been copyedited and formatted. The final version may differ from this version.JPET Fast Forward. Published on January 14, 2014 as DOI: 10.1124/jpet.113.211722
at ASPE
T Journals on N
ovember 18, 2018
jpet.aspetjournals.orgD
ownloaded from
JPET #211722
52
Quantification of relative protein expression was plotted. Data are expressed as
mean ± S.E.M. from triplicate experiments. **P <0.01 (Dunnett’s multiple
comparison test) compared with vehicle (DMSO)-treated group. TEL:
telmisartan, IRB: irbesartan, AZL: azilsartan, CAN: candesartan, PIO:
pioglitazone
Figure 5. Unique structure of telmisartan. (A) Chemical structure of
telmisartan divided into the A-Part, which contains biphenyl carboxylic acid,
and the B-Part, which contains two benzimidazole rings. The central
benzimidazole ring of the B-Part is shown in green. (B) Top view of telmisartan
bound to PPARγ. The structure is available in Protein Data Bank (PDB
ID:3VN2). Telmisartan is shown in a space-filling model. Amino acid residue
of PPARγ is shown in a wire frame model. Gray atoms indicate carbon atoms
of the A-Part. Yellow and green atoms indicate carbon atoms of the central
benzimidazole ring and other region of the B-Part, respectively. Cyan atoms
indicate carbon atoms of PPARγ. Red and blue atoms indicate oxygen and
nitrogen atoms, respectively. Tyr473 makes a hydrogen bond with telmisartan.
(C) Side view of the B-Part in the hydrophobic and narrow pocket of PPARγ. A
cross-sectional view is shown from the direction indicated by the arrow in (B).
This article has not been copyedited and formatted. The final version may differ from this version.JPET Fast Forward. Published on January 14, 2014 as DOI: 10.1124/jpet.113.211722
at ASPE
T Journals on N
ovember 18, 2018
jpet.aspetjournals.orgD
ownloaded from
JPET #211722
53
In this view, the A-Part is removed to make it easier to recognize the B-Part.
(Outside of inset) Chemical structures of typical ARBs are shown around the
inset. Sections corresponding to the central benzimidazole ring of telmisartan
are shown in green.
Figure 6. (A) Insulin signal transduction pathway and mechanism of
insulin resistance induced by Ang II. (B) Role of TIF-2, SRC-1 in energy
metabolism of adipocytes. (A) Insulin signal transduction pathway and
mechanism of insulin resistance induced by Ang II. Ang II stimulation
mediated by AT1-R induces serine phosphorylation of IRS-1, impairing insulin
induced signal transduction towards Akt and the downstream molecules. Ang
II: angiotensin II, AT1-R: angiotensin II type 1 receptor, IR: insulin receptor,
IRS-1: insulin receptor substrate-1, Tyr-p, phosphorylated Tyrosine, PI3-K:
phosphatidylinositol-3 kinase, Akt: protein kinase B (B) Scheme illustrating the
hypothetical role of TIF-2 and SRC-1 in obesity and insulin resistance. The
lack of TIF-2 in adipocyte suppresses its competition with SRC-1 for PGC-1α,
and promotes the formation of SRC-1/PGC-1α complex, subsequently
stimulates energy expenditure. This protects against fat accumulation and
favors insulin sensitization.
This article has not been copyedited and formatted. The final version may differ from this version.JPET Fast Forward. Published on January 14, 2014 as DOI: 10.1124/jpet.113.211722
at ASPE
T Journals on N
ovember 18, 2018
jpet.aspetjournals.orgD
ownloaded from
JPET #211722
54
Table 1. Binding affinities of ARBs against PPARγ assessed by isothermal
titration calorimetry
Compound Kd
Telmisartan
μM
0.34 ± 0.04
Irbesartan 10.3 ± 1.5
Azilsartan >100
Candesartan >100
Farglitazar 0.01 ± 0.02
The binding affinities (Kd = 1/Ka) were determined at 25 °C by isothermal
titration calorimetry. The PPARγ solution (approximately 25 μmol/L) in the
calorimetric cell was titrated with ARB solutions (1.4 μL per injection of 250
μmol/L-3 mmol/L) dissolved in the same buffer (PBS, pH 7.4 with 5% DMSO).
Data are expressed as mean ± S.E.M. from independent triplicate experiments.
This article has not been copyedited and formatted. The final version may differ from this version.JPET Fast Forward. Published on January 14, 2014 as DOI: 10.1124/jpet.113.211722
at ASPE
T Journals on N
ovember 18, 2018
jpet.aspetjournals.orgD
ownloaded from
JPET #211722
55
Table 2. Lipophilicities and cell permeability of ARBs assessed by
high-performance liquid chromatography/mass spectrometry system and
parallel artificial membrane permeability assay (PAMPA)
Compound Lipophilicity Cell
permeability
Telmisartan
2.6 ± 0.0
10-6cm/sec
27.1 ± 1.4
Irbesartan 1.3 ± 0.0 6.6 ± 0.5
Azilsartan -0.9 ± 0.0 0.7 ± 0.2
Candesartan -1.5 ± 0.0 0.4 ± 0.2
Lipophilicities of a series of ARBs were determined as 1-octanol/water
distribution coefficient at pH 7.4 (LogD) by using high-performance liquid
chromatography/mass spectroscopy system. The procedure of distribution and
separation was conducted by the JIS standard (JIS Z7260-107; OECD Test
Guideline 107). Cell permeability was assessed by a parallel artificial
membrane permeability assay (PAMPA) (Avdeef, 2012). 125-μm-thick
microfilter disc (0.45-μm diameter pores) coated with a 20% (w/v) dodecane
solution of a lecithin mixture was used as artificial cell membrane. Data are
expressed as mean ± S.E.M. from independent triplicate experiments.
This article has not been copyedited and formatted. The final version may differ from this version.JPET Fast Forward. Published on January 14, 2014 as DOI: 10.1124/jpet.113.211722
at ASPE
T Journals on N
ovember 18, 2018
jpet.aspetjournals.orgD
ownloaded from
JPET #211722
56
Fig. 1
This article has not been copyedited and formatted. The final version may differ from this version.JPET Fast Forward. Published on January 14, 2014 as DOI: 10.1124/jpet.113.211722
at ASPE
T Journals on N
ovember 18, 2018
jpet.aspetjournals.orgD
ownloaded from
JPET #211722
57
Fig. 2
This article has not been copyedited and formatted. The final version may differ from this version.JPET Fast Forward. Published on January 14, 2014 as DOI: 10.1124/jpet.113.211722
at ASPE
T Journals on N
ovember 18, 2018
jpet.aspetjournals.orgD
ownloaded from
JPET #211722
58
Fig. 3
This article has not been copyedited and formatted. The final version may differ from this version.JPET Fast Forward. Published on January 14, 2014 as DOI: 10.1124/jpet.113.211722
at ASPE
T Journals on N
ovember 18, 2018
jpet.aspetjournals.orgD
ownloaded from
JPET #211722
59
Fig. 4
This article has not been copyedited and formatted. The final version may differ from this version.JPET Fast Forward. Published on January 14, 2014 as DOI: 10.1124/jpet.113.211722
at ASPE
T Journals on N
ovember 18, 2018
jpet.aspetjournals.orgD
ownloaded from
JPET #211722
60
Fig. 5
This article has not been copyedited and formatted. The final version may differ from this version.JPET Fast Forward. Published on January 14, 2014 as DOI: 10.1124/jpet.113.211722
at ASPE
T Journals on N
ovember 18, 2018
jpet.aspetjournals.orgD
ownloaded from
JPET #211722
61
Fig. 6
This article has not been copyedited and formatted. The final version may differ from this version.JPET Fast Forward. Published on January 14, 2014 as DOI: 10.1124/jpet.113.211722
at ASPE
T Journals on N
ovember 18, 2018
jpet.aspetjournals.orgD
ownloaded from