J Mol Cell Cardiol 29, 1423–1431 (1997)

Lack of Evidence for Connexin 43 GeneMutations in Human AutosomalRecessive Lateralization DefectsSophie Debrus,1 Sylvie Tuffery,2 Rumiko Matsuoka,3 Omar Galal,4 PierreSarda,5 Ursula Sauer,6 Andre Bozio,7 Bahriye Tanman,8 Annick Toutain,9

Mireille Claustres,2 Denis Le Paslier10 and Patrice Bouvagnet1,11

1CRBM, CNRS ERS 155, INSERM U249, 34033 Montpellier, France, 2Laboratoire de BiochimieGenetique, Institut de Biologie, 34000 Montpellier, France, 3Department of Pediatric Cardiology, theHeart Institute of Japan, Tokyo Women’s Medical College, Shinjuku-ku, 160 Tokyo, Japan, 4King FaisalSpecialist Hospital and Research Centre, Rhyad, Saudi Arabia, 5Service de Pediatrie II, Hopital A. deVilleneuve, 34295 Montpellier, France, 6Kinderklinik, Deutsches Herzzentrum Munchen, 80335Munchen, Germany, 7Service de Cardiologie C, Hopital Cardiovasculaire et Pneumologique, Lyon-Montchat, 69394 Lyon Cedex 03, France, 8Pediatric Cardiology Department, Istanbul CapaUniversity, Turkey, 9Service de Genetique, CHU Tours, 37044 Tours, France, 10CEPH, 27 rue JulietteDodu, 75010 Paris, France, and 11Service de Cardiologie B, Hopital A. de Villeneuve, 34295Montpellier, France

(Received 2 December 1996, accepted in revised form 9 January 1997)

S. D, S. T, R. M, O. G, P. S, U. S, A. B, B. T, A. T, M.C, D. L P P. B. Lack of Evidence for Connexin 43 Gene Mutations in HumanAutosomal Recessive Lateralization Defects. Journal of Molecular and Cellular Cardiology (1997) 29, 1423–1431.Heterotaxy is the failure of the developing embryo to establish normal left–right asymmetry, which is oftenassociated with multiple malformations. Previous studies have identified different mutations in the cytoplasmictail of the connexin 43 (cx 43) gene in six patients from a series of six sporadic cases with defects of lateralityand severe heart malformations. These cases showed that of the genes involved in lateralization defects withautosomal recessive transmission, cx 43 was the most important. This result was challenged by two differentteams, which, on sequencing only the carboxyl terminal end of the cx 43 gene in 30 patients, found no mutations.To assess the responsibility of the cx 43 gene in human autosomal recessive lateralization defects, we tested itsinvolvement in a selected group of 25 patients (19 familial cases) with a wide variety of lateralization defectsand cardiovascular malformations. The whole coding sequence and direct flanking sequences were screened formutations, both by single strand conformation analysis and direct fluorescent sequencing. We could only detecta single base pair insertion in the 3′ untranslated region of one patient. To test the possibility of mutations inother parts of the cx 43 gene, the gene was located onto the physical map of chromosome 6, and flankingpolymorphic markers were genotyped. Haplotype analysis excluded the cx 43 gene locus in nearly all of thefamilial cases of lateralization defects. Thus, our results do not support the suggestion that this gene is implicatedin human autosomal recessive lateralization defects. 1997 Academic Press Limited

K W: Lateralization; Connexin 43; Familial study; Physical mapping; Chromosome 6; YAC.

to establish normal left–right asymmetry, whichIntroductionis often associated with multiple malformations.Typical manifestations include complex heart mal-Heterotaxy is the failure of the developing embryo

Please address all correspondence to: P. Bouvagnet, CRBM, CNRS ERS 155, INSERM U249, 34033 Montpellier, France.

0022–2828/97/051423+09 $25.00/0 mc970380 1997 Academic Press Limited

S. Debrus et al.1424

formations, gastrointestinal malrotation and splenic insertion in the 3′ untranslated region (UTR).Finally, to test the possibility of mutation in otherabnormalities. The occurrence is usually sporadic,

but familial cases have been described, and most parts of the gene (intron, non-coding exon andpromoter region), the cx 43 gene was located ontohave been interpreted as demonstrating autosomal

recessive transmission (de la Monte and Hutchins, the physical map and haplotypes were built aftergenotyping the flanking polymorphic markers. This1985; Distefano et al., 1987; Zlotogora et al., 1987).

A rare X-linked form has been described (Mathias haplotype analysis rules out a possible role of thecx 43 gene in defects of laterality in nearly all ofet al., 1987; Casey et al., 1993; Mikkila et al.,

1994), and a few families with autosomal dominant the familial cases. Thus, the involvement of thisgene in human autosomal recessive lateralizationtransmission have been reported (Niikawa et al.,

1983; Alonso et al., 1995; Lindor et al., 1995; defects is not supported by our results.Casey et al., 1996). These data demonstrate that,in humans, the disruption of at least two genesmay alter the normal development of left–right Materials and Methodsasymmetry. In this study, we will focus on theautosomal recessive form.

Polymerase chain reaction (PCR) amplificationUntil now, two loci producing the autosomalrecessive inherited heterotaxy syndrome have been

Genomic DNA was extracted from blood samplesdescribed in mice: the iv (inversus viscerum) muta-by standard methods. In order to exclude any con-tion (Hummel and Chapman, 1959), mapped ontribution from a processed pseudogene which waschromosome 12 (Brueckner et al., 1989; de Meeusidentified in humans (Fishman et al., 1990), a firstet al., 1992; Alonso et al., 1994), and the invround of polymerase chain reaction (PCR) was(inversion of embryonic turning) mutation, mappedcarried out with primer 1 (sense: 5′ AA-to mouse chromosome 4 (Yokoyama et al., 1993).CAAACAAAACAAAACACTT) and primer 2 (anti-It is therefore expected that, in humans, autosomalsense: 5′ CACCCATCTACCCCATACACC) in a finalrecessive lateralization defects are also hetero-volume of 50 ll (Britz-Cunningham et al., 1995).geneous. In humans, Britz-Cunningham et al.We used 0.5 ll of the first-round product in a second(1995) identified five different mutations in theround of PCR with four other overlapping primercytoplasmic tail of the connexin 43 (cx 43) genesets (Fig. 1 and Table 1). Right primer of set 1in six patients from a series of six sporadic cases with(primer 1R) and sets of primers 2 (primers 2F anddefects of laterality and severe heart malformations.2R) and 3 (primers 3F and 3R) were designed fromThe substitution Ser364Pro was observed five timesthe cx 43 cDNA sequence (Fishman et al., 1990)out of 12, and two independent mutations wereby the program OSP (Hillier and Green, 1991). Leftnoticed in four of the six patients, but no familialprimer of set 1 (primer 1) and primers of set 4 (4Fstudy was undertaken.and 4R) have been described previously (Britz-These results suggested that cx 43 was the mostCunningham et al., 1995).important of the genes involved in lateralization

defects with autosomal recessive transmission.Nevertheless, this result has been challenged byCasey and Ballabio (1995), and Splitt et al. (1995), Polymerase chain reaction–single strand conformation

analysis (PCR–SSCA)who found no mutations in the carboxyl terminalend of cx 43 gene in 18 (15 sporadic and three

The second round of PCR was performed in a finalfamilial cases) and 12 patients with defects of lat-erality, respectively. In order to assess the re- volume of 20 ll with 200 l of deoxynucleosides

triphosphate (dNTP), 10 pmol of each primer,sponsibility of the cx 43 gene in human autosomalrecessive lateralization defects, we tested the in- 1.5 m MgCl2, 10 m Tris (pH 8.3), 50 m KCl,

0.001% gelatin, 0.8 U Taq polymerase (Appligene,volvement of cx 43 in 25 patients with a widevariety of lateralization defects and cardiovascular Illkirch, France), and 0.1 ll of (a32P) deoxycytidine

triphosphate (dCTP) (3000 Ci/mmol) (ICN, Orsay,malformations, including one with a completeatrioventricular conduction block. Moreover, the France). The program was 94°C for 5 min, 25 cycles

of 94°C for 30 s, 55°C for 30 s, and 72°C for 30 s,whole coding sequence of the gene and the directflanking sequences were screened for mutations and a final extension at 72°C for 10 min. The

products obtained with sets 2, 3 and 4 were thenboth by Single Strand Conformation Analysis(SSCA) and direct fluorescent sequencing. With this digested with Dde I, Hinf I and EcoRI, respectively.

Aliquots of non-digested and digested products wereapproach, we could only detect a single base pair

Human Connexin 43 and Defects of Laterality 1425

1690 kb

First-round product

TAGATG

3' UTR

21

TAGATG

21 1r312 bp

Exon 2Exon 1

2f 2r427 bp

3f 3r422 bp

4f 4r529 bp

Figure 1 Schematic genomic structure of the human cx 43 gene. Exons are shown by rectangles. The coding regionis shaded. Position, name of the primers used for PCR amplification, and length of PCR products are indicated. Thediagram is not to scale.

Table 1 Sequences of the four sets of primers used for PCR amplification

Set Left primer 5′–3′ Right primer 5′–3′

1 AACAAACAAAACAAAACACTT AGTTGAGTAGGCTTGAAC2 TTAGGCAAACTCCTTGAC CTCGCATTTTCACCTTAC3 CACTTGAAGCAGATTGAG GCATATTTTTGAGACCCA4 GATGGTACCAGAGCGACCCTTACCATGC CCTGGATCCTGTTGAGTACCACCTCCA

denatured and electrophoresed at room tem- Physical mappingperature, in non-denaturing Mutation detection en-hancement (MDE) gels (Bioprobe, Montreuil-sous- The Centre d’Etude du Polymorphisme Humain

(CEPH) yeast artificial chromosome (YAC) librarybois, France) in two different conditions of mi-pools (Chumakov et al., 1995) were screened usinggration: 25 W for 6 h and 6 W for 12 h.primers 1 and 2, specific to the cx 43 gene (seeabove). Positive YAC clones were grown in AHC(Yeast nitrogen base without amino acids 0.67%;Automated fluorescent sequencingAcid-hydrolysed casein 1%; Adenine hemisulfate20 mg/l; 2% D-Glucose; pH 5.8) medium, and totalThe second round of PCR was performed in a finalgenomic DNA was prepared by the use of glassvolume of 50 ll, with the same reaction mix asbeads to disrupt intact cells, followed by phenol/described above, without the (a32P) dCTP. The pro-chloroform/isoamilic alcohol extraction and alcoholgram was 94°C for 5 min, 30 cycles of 94°C forprecipitation. In order to confirm the map position30 s, 55°C for 30 s, and 72°C for 30 s, and a finalof the cx 43 gene with respect to polymorphicextension at 72°C for 10 min.markers of this region, the individual YAC DNAsThe four products were purified using a Jetpurewere screened with D6S1037 (accession ID:GDB:system (Bioprobe) in order to remove primers. They366004) and D6S1712 (accession ID:GDB:were then cycle sequenced using the AmpliTaq618674). PCR were performed in a final volume ofDNA polymerase Fluorescent sequencing (FS) dye20 ll with 200 l of each dNTP, 10 pmol of eachterminator kit according to the manufacturer (Per-primer, 1.5 m MgCl2, 10 m Tris (pH 8.3), 50 mkin Elmer, Roche Molecular Systems, Inc., Branch-KCl, 0.001% gelatin, 0.8 U Taq polymerase (Ap-burg, NJ, USA). Both DNA strands were sequenced.pligene). The PCR conditions consisted of an initialThe sequences were denatured, electrophoresed and

analysed on the ABI 373A DNA Sequencer. denaturation at 94°C for 5 min, followed by 30

S. Debrus et al.1426

cycles of 94°C for 30 s, 57°C for D6S1037 and inversus (SI) and T1 had a sister with asplenia.Individuals D and V were fetuses. Fetus V had62°C for D6S1712 for 30 s, and 72°C for 30 s,

and a final extension at 72°C for 10 min. The other significant defects: she showed a completeatrioventricular conduction block, hydronephrosisamplification products were visualized on 1.4%

agarose gels. and microcysts of the right kidney.

Mutation screeningGenotyping

The cx 43 gene is composed of a small non-codingDNA samples from all affected and non-affectedfirst exon and a larger second exon encompassingmembers of 25 families, hence a total of 150 in-the entire protein-coding region (Fig. 1). We amp-dividuals, were genotyped for five microsatellitelified four overlapping cx 43 fragments which in-markers which were selected according to theircluded 197 bp of the 3′ end of the unique intron,close vicinity to the cx 43 gene and to their highthe entire coding region and 108 bp of the 3′UTR,level of heterozygosity. For markers D6S261,from the 25 unrelated individuals with lat-D6S287 and D6S262 (Dib et al., 1996), PCR re-eralization defects described in Table 2. For com-actions were performed at the Genethon centreparison, genomic DNA from controls were alsoas described in Vignal et al. (1993). For markersamplified. Each fragment was screened for mut-D6S1037 and D6S1712, PCR were carried out asations by SSCA and cycle sequencing. SSCA wasdescribed above.performed both for the three digested and four non-digested fragments in two different electrophoresisconditions in order to optimize mutation detection.To ensure our ability to detect heterozygotes byResultsfluorescent sequencing, we first cycle sequencedmurine DNA with known heterozygote DNA re-Clinical datagions. By this technique, we found 100% of hetero-zygotes (data not shown). One PCR product (patientAmong 75 cases of lateralization defects, 25 were

selected for this study because they presented a Q1), obtained by using the fourth set of primers,displayed an aberrant migration pattern on SSCAwide variety of lateralization defects and cardiac

malformations. These anomalies are described in gels (Fig. 2). By automated fluorescent sequencing,this sample showed an insertion of an A in theTable 2. Diagnosis of each affected member was

ascertained by history, physical examination, 12- 3′UTR, at base 1308, two bases after the stop codon(typed in bold): base 1300 GATCTAGATAACA (Fig.lead electrocardiogram, echocardiogram and in

some cases by angiogram. Informed consent was 3). This mutation is easily picked up on directsequencing as it yields two overlapping sequencesobtained from affected individuals, or their parents

in cases of affected children. Six cases are sporadic which are out of phase by a single nucleotide. Weestimated the polymorphism frequency from 112and born to non-consanguineous parents (cases F,

G, I, L, N and V). Seven cases are the only ones chromosomes of unrelated healthy individuals at0.045. No additional sequence variants were iden-affected in their family, but were born to con-

sanguineous parents (cases B, C, D, O, P, R and X). tified in any of the 25 patients or in the controlsin the analysed sequence of cx 43, in particular inOut of 12 families with more than one affected

individual, six are inbred families (A, E, H, Q, S and the coding sequence of the cytoplasmic carboxylterminal domain, in which Britz-Cunningham et al.Y) and six non-inbred families (J, K, M, T, U and

W). Altogether there are 39 affected individuals (1995) found mutations for their patients.whose clinical status is summarized in Table 2.Only one affected member of each multiplex familywas screened for mutations (see table legend). Physical mapping of the human cx 43 geneAmong the 25 patients screened for mutations, 22showed a lateralization defect, associated, or not, The human cx 43 gene (locus designation, GJA1)

was localized to a large chromosomal region:with severe heart malformations, including pul-monary stenosis (PS) or pulmonary atresia (PA). 6q21q23.2 (Corcos et al., 1993). Therefore, we

defined more precisely the position of this geneThree patients had an isolated heart malformationand a sibling with a lateralization defect: L1 had a among the genetically mapped polymorphic

markers in this region. Three YAC clones positivebrother with asplenia, S1 had a brother with situs

Human Connexin 43 and Defects of Laterality 1427

Table 2 Clinical status of the affected individuals. Families are designated by letters andindividuals of multiplex families by arabic numbers. Patients with a symbol in the cx columnwere screened for mutations

cx SI Abdomen Thorax

A 1 ∗ SI L-TGA, VSD, PS2 SI Partial ARPV, ASD, VSD

B ∗ SI Dx, L-IVC, DIRV, MA, PS, LAAC ∗ Dx, CA, AVCD ∗ SI, Aspl ARPV, L-SVC, 2R-IVC, CA, HypoRV, AVC, TAE 1 SI

2 ∗ SI R&L-SVC, ARPV, ASD, VSDF ∗ SI ASD, VSD, L-TGAG ∗ Aspl, med liver Dx, IVC to AV, AVC, TOFH 1 DIRV, AoC, PDA

2 ∗ SI PFO, DORV, IAA (after LSCA)I ∗ SI SV, MA, PSJ 1 ∗ Dx, D-TGA, AVC, DORV, PDA

2 DxK 1 ∗ Aspl ASD, AVC, PDA, RAA, PS

2 Aspl bilat SVC, CA, AVC, PSL 1 ∗ VSD

2 AsplM 1 Polyspl DORV, PS

2 ∗ Polyspl TARPV, ASD, VSD, PSN ∗ SI TOFO ∗ Dx, CA, AVCP ∗ Aspl I-IVC, CA, AVCQ 1 ∗ SA I-IVC, CA, DORV, subvalvular PS

2 ASD, L-TGA, PAR ∗ L-SVC, TARPV, Dx, RAI, CA, AVC, DORV, PSS 1 ∗ L-SVC to CS, I-IVC, VSD, TH, PS

2 SI DIRV, VSD, PST 1 ∗ IVC to AV, probable ARPV, CA, SV, TGA, PA

2 Aspl L-SVC, no R-SVC, ARPV, MA, SV, TGA, PAU 1 ∗ Dx, CA, TGA, PA

2 VSD, ITV ∗ SI, Aspl complete atrioventricular conduction blockW 1 ∗ Dx, CA, DIRV, PA, RAA, PFO, PDA

2 AV to R-SVC, ASD, AVD, VSD, Sub-valv PS, PDAX ∗ Dx, CA, AVC, TGAY 1 SI VSD

2 SI VSD3 ∗ SI VSD, corrected TGA, PA

SI column, patients with a complete situs inversus are noted SI. AoC, aortic coarctation; ARPV, anomalousreturn of pulmonary veins; ASD, atrial septal defect; Aspl, asplenia; AV, azygos vein; AVC, atrioventricularcanal; AVD, atrioventricular discordance; CA, common atrium; CS, coronary sinus; DIRV, double inletright ventricle; DORV, double outlet right ventricle; D-TGA, dextroposition of great arteries; Dx, dextrocardia;FO, foramen ovale; HypoRV, hypoplastic right ventricle; IAA, interrupted aortic arch; I-IVC, interruptedIVC; IT, insufficient tricuspic valve; IVC, interrupted vena cava; LAA, left aortic arch; L-IVC, left IVC;LSCA, left sub-clavian artery; L-SVC, left SVC; L-TGA, left TGA; MA, mitral atresia; med, median; PA,pulmonary atresia; PDA, patent ductus arteriosus; PFO, patent foramen ovale; Polyspl, polysplenia; PS,pulmonary stenosis; PTA, persistent truncus arteriosus; RAA, right aortic arch; RAI, right atrial isomerism;R-IVC, right IVC; R-SVC, right SVC; R-TGA, right TGA; SA, situs ambiguous; SI, situs inversus; SV, singleventricle; SVC, superior vena cava; TA, tricuspid atresia; TARPV, total ARPV; TGA, transposition of thegreat arteries; TH, tricuspid hypoplasia; TOF, tetralogy of Fallot; VSD, ventricular septal defect.

for the cx 43 gene (764 G12, 957 B6, 978 C6) Cambridge, MA, USA). The set of YACs was there-fore screened by PCR for D6S1037, D6S1712 andand the corresponding overlapping YACs, hence a

set of 19 YACs, were obtained from the CEPH YAC primers 1 and 2 of cx 43 gene (Table 1 and Fig.1). The results allowed us to map the human cx 43library (see Materials and Methods). YAC 764 G12

has been shown to be positive for D6S1037, and gene in the interval defined by these two markers,D6S1037 being centromeric with regard toYAC 957 B6 for D6S1037 and D6S1712 (data from

the Whitehead Institute for Biomedical Research, D6S1712.

S. Debrus et al.1428

this individual. It is important to note that D6S1037and D6S1712 are so closely mapped that no re-combination event is expected and none was ac-tually observed in 270 meiosis. In the seven familieswith consanguineous parents and a single affectedchild, in six out of seven the affected individual isnot homozygous. In family P (Fig. 4), identity-by-descent of the affected individual could not beinferred with directly flanking markers, because themother is homozygous. But at the most distal andproximal markers which were tested, the parentshave no common alleles. In the six families withconsanguineous parents and multiple affectedmembers, only one individual is homozygous atfour of the five markers, but his father, who is alsoaffected, is heterozygous at all markers. An exampleof a family with two non-homozygote affected in-dividuals is presented in Figure 4 (family A).

Figure 2 SSCA of the 529 bp fragment of the humanAmong the six non-inbred multiplex families weconnexin 43 gene digested with EcoRI showing the shifted

can eliminate the implication of cx 43 gene forbands corresponding to the A-insertion (lane 5). Lanes1, 2, 3, 4, 6, 7: unrelated individuals with normal families J, K, M, T and U, because affected individualspatterns. do not have the same genotype. An example is

shown in Figure 4 (family T). In contrast, in familyGenotyping

W, we cannot rule out the cx 43 locus for thesetwo affected sisters, because they had the same

All affected and non-affected members of the familialhaplotypes, apart from the most telomeric marker

cases were typed with five polymorphic markers,D6S262. Thus, these results rule out the cx 43

which cover a region of roughly 12 c. The markerlocus in the genesis of lateralization defects in 16

order and intermarker genetic distance are as fol-out of 19 families.

lows: D6S261-2cM-D6S287-1cM-D6S1037-cx43-No conclusion could be drawn for the six simplex

D6S1712-9cM-D6S262. These markers were se-families, because we assumed that the disease has

lected according to their close vicinity to the cxan incomplete penetrance.

43 gene and to their high level of heterozygosity.Haplotypes were constructed in order to minimizerecombination events. For a recessive disease gene,in an inbred family, the phenotypically affected Discussionmember(s) should be homozygous-by-descent forthe disease bearing-allele (Farrall, 1993). The whole The cx 43 gene codes for a protein involved in gap

junctions, and it has been postulated that thissegment of the chromosome flanking the diseaselocus is also likely to be homozygous-by-descent in form of cell–cell communication may play a role in

Figure 3 Electrophoregram of the sequence analysis in the reverse direction of part of the 529 bp fragment of the cx43 gene for a control DNA and patient Q1. The arrow shows the A-insertion for patient Q1.

Human Connexin 43 and Defects of Laterality 1429

67355

37358

57355

443513

57355

443413

57355

37358

57355

443413

57355

37358

67356

57355

Family P

114332

14542

114332

14548

65542

114332

14542

56758

Family W

43548

64158

17747

64158

17747

43357

43548

64158

17747

43548

64158

43357

Family A

57348

37341

57344

34362

57348

34362

34544

57348

34362

37341

Family T

I

II

I

II

Figure 4 Pedigrees of families A, P, T and W. Generations are indicated on the left. Haplotypes are indicated beloweach individual, with paternal alleles on the left and maternal alleles on the right when possibly inferred. Recombinationevents are symbolized by an “×”. From top to bottom (centromere to telomere), numbers are as follows : D6S261,D6S287, D6S1037, D6S1712 and D6S262. D6S1037 and D6S1712 are typed in bold. Affection status is shown asfollows: solid symbol, affected; clear symbol, unaffected. The deceased individual is crossed.

development, by mediating the exchange of mor- defects and heart malformations. Britz-Cun-ningham et al. (1995) kindly provided us with thephogenetic signals (for a review see Kumar and

Gilula, 1996). Recent evidence for the importance phenotypic description of their mutated patients.The following are constant findings in their het-of cx 43 in cardiac development and physiology

has been provided by targeted disruption of the cx erotaxia patients: double outlet right ventricle, pul-monary atresia or severe pulmonary stenosis, atrial43 gene in mice (Reaume et al., 1995). Homozygous

mice containing a non-functional cx 43 gene de- isomerism, bronchopulmonary isomerism, splenicabnormalities, functional single ventricle, and con-veloped to term, but died shortly after birth. No

lateralization defects were observed, but the outflow duction block or delayed atrioventricular con-duction. Thus, we carefully selected our casestract of the right ventricle was abnormal.

These facts led Britz-Cunningham et al. (1995) according to their various anatomical types of lat-eralization defects, including one with a completeto search for mutations in the cytoplasmic carboxyl

terminal domain of the cx 43 gene, which contains atrioventricular conduction block.The whole coding sequence and the direct flank-several predicted consensus sites for phos-

phorylation by protein kinases, in patients showing ing sequences of the cx 43 gene were screened formutations in 25 patients. We detected only thea variety of congenital heart anomalies. They found

mutations in six out of six sporadic cases of patients insertion of an A in the 3′UTR for one patient. Thispatient, Q1, was descended from a consanguineouswith lateralization defects, which suggested that

mutations in the cx 43 gene account for a large marriage, and inherited this polymorphism fromhis unaffected father. We did not find this insertionpercentage of heterotaxy cases. Because of the con-

troversial results of Casey and Ballabio (1995), and in his brother, who presents heart defects. Therefore,we concluded that this variant was unlikely to beSplitt et al. (1995), we tried to answer the question

of whether cx 43 was implicated in defects of of functional significance. None of the 25 patientsshowed a mutation in the screened sequences. Ourlaterality. With this aim, we selected 19 familial and

six sporadic cases with various types of lateralization results are thus in agreement with those of Casey

S. Debrus et al.1430

F, M A, et al., 1996. Friedreichs ataxia: auto-and Ballabio (1995) and Splitt et al. (1995), assomal recessive disease caused by an intronic GAApreviously described, and with a recent report oftriplet expansion. Science 271: 1423–1427.

Gebbia et al. (1996). But mutations could have C B, D M, J KL, B A, 1993. Mappingoccurred in the promoter, or in the remaining a gene for familial situs abnormalities to human chro-

mosome Xq24-q27.1. Nat Genet 5: 403–407.intronic sequences that have not been investigated,C B, B A, 1995. Correspondence. N Engl Jas has previously been described for some genes

Med 333: 941.(Campuzano et al., 1996). We therefore decided toC B, C BF, V C, V H, B J,

perform a haplotype analysis, since 19 out of our H J, B A, H JJ, 1996. Autosomal dom-25 cases are familial cases. It was possible to exclude inant transmission of familial laterality defects. Am J

Med Genet 61: 325–328.the cx 43 gene locus in the lateralization defectsC IM, R P, L G I, B-observed in 16 out of the 19 families. For the three

C C, B A, G S, S P,remaining families, we could not totally excludeG G, P E, G I, et al., 1995. A YAC

this locus. contig map of the human genome. Nature 377 (Suppl.):In summary, our study was done on a significant 175.

C IA, M EU, L-C R, 1993. Humanpanel of patients showing a wide range of defectsconnexin 43 gene locus, GJA1, sublocalized to bandof laterality, sometimes associated with severe heart6q21→q23.2. Cytogenet Cell Genet 64: 31–32.diseases, such as those described by Britz-Cun-

D C, F S, F C, S D, D N, Vningham et al. (1995). We found no mutations in A, M P, M S, H J, S E, Lthe whole coding sequence, even in the patient M, G G, M J, W J, 1996. A

comprehensive genetic map of the human genomewith a complete atrioventricular conduction block.based on 5264 microsatellites. Nature 380: 152–154.Thus, our results exclude this gene in most, if

D G, R MG, G S, M D, Snot all, human autosomal recessive lateralizationP, M F, 1987. Dextrocardia with and without

defects. situs inversus in two sibs. Am J Med Genet 27: 929–934.F M, 1993. Homozygosity mapping: familiarity

breeds debility. Nat Genet 5: 107–108.F GI, S DC, L LA, 1990. Molecular

characterization and functional expression of thehuman cardiac gap junction channel. J Cell Biol 111:Acknowledgements589–598.

G M, T JA, C B, 1996. Failure to detectWe thank M. K. Jean for technical assistance. Thisconnexin 43 mutations in 38 cases of sporadic and

work was supported by Ministere de I’Enseignement familial heterotaxy. Circulation 94: 1909–1912.Superieur et de la Recherche, grants from SESERAC, H L, G P, 1991. OSP: a computer program

for choosing PCR and DNA sequencing primers. In:Association Francaise contre les Myopathies (AFM),anonymous (ed.). PCR methods and applications. ColdGREG and Fondation de France, in addition to CNRSSpring Harbor, NY: Cold Spring Harbor Laboratoryand INSERM support.Press, 1: 124–128.

H KP, C DB, 1959. Visceral inversion andassociated anomalies in the mouse. J Hered 50: 9–13.

K NM, G NB, 1996. The gap junction com-munication channel. Cell 84: 381–388.

References L NM, S WA, A CA, M VV,O JM, 1995. Asplenia in two father–son pairs. Am

A S, M A, D J, B P, 1994. J Med Genet 56: 10–11.M RS, L RV, J KL, 1987. X-linked lat-Genetic map of Igh-C distal region on murine chro-

mosome 12. Mouse Genome 92: 508–510. erality sequences: situs inversus, complex cardiac de-fects, splenic defects. Am J Hum Genet 28: 111–116.A S, P ME, R W, M J, C S,

G JW, D I, T S, R MC, D M A, A S, D J, B P, 1992.A detailed linkage map of subtelomeric murine chro-J, B P, 1995. Heterotaxia syndrome and auto-

somal dominant inheritance. Am J Med Genet 56: mosome 12 region including the situs inversus muta-tion locus iv. Mamm Genome 3: 637–643.12–15.

B-C SH, S MM, Z CW, F M SP, J M, K R, T T, SKOJ, 1994. X-linked laterality sequence in a family withWH, 1995. Mutations of the connexin43 gap-junction

gene in patients with heart malformations and defects carrier manifestations. Am J Med Genet 49: 435–438. M SM, H GM, 1985. Brief clinicalof laterality. N Engl J Med 332: 1323–1329.

B M, D’E P, H AL, 1989. Link- report: sisters with polysplenia. Am J Med Genet 21:171–173.age mapping of a mouse gene, iv, that controls left–right

asymmetry of the heart and viscera. Proc Natl Acad Sci N N, K S, M M, H I, KT, 1983. Familial clustering of situs inversus totalis,USA 86: 5035–5038.

C V, M L, M MD, P L, and asplenia and polysplenia syndrome. Am J MedGenet 16: 43–47.C M, C F, M E, R F, D

Human Connexin 43 and Defects of Laterality 1431

R AG, S PA, K S, L BL, Z mosome analysis. San Diego, CA: Academic Press Inc.,1: 211–221.D, D TC, J SC, K GM, R J, 1995.

Cardiac malformation in neonatal mice lacking con- Y T, C N, J NA, M CA,E FFB, O PA, 1993. Reversal of left–rightnexin43. Science 267: 1831–1834.

S MP, B J, G J, 1995. Correspondence. N asymmetry: a situs inversus mutation. Science 260:679–682.Engl J Med 333: 941.

V A, 1993. Non-radioactive multiplex procedure Z J, S MS, G Y, 1987. Familialsitus invs and congenital heart defects. Am J Med Genetfor genotyping of microsatellite markers. In: Adolph

KW (ed.). Methods in molecular genetics: gene and chro- 26: 181–184.