Lactose Digestion And The Evolutionary Genetics of Lactase Persistance - Ingram Et Al 2009 Human Genetics

7/31/2019 Lactose Digestion And The Evolutionary Genetics of Lactase Persistance - Ingram Et Al 2009 Human Genetics

1/13

Hum Genet (2009) 124:579591

DOI 10.1007/s00439-008-0593-6

123

REVIEW ARTICLE

Lactose digestion and the evolutionary genetics of lactase

persistence

Catherine J. E. Ingram Charlotte A. Mulcare

Yuval Itan Mark G. Thomas Dallas M. Swallow

Received: 6 August 2008 / Accepted: 6 November 2008 / Published online: 26 November 2008

Springer-Verlag 2008

Abstract It has been known for some 40 years that lactase

production persists into adult life in some people but not in

others. However, the mechanism and evolutionary signiW-

cance of this variation have proved more elusive, and con-

tinue to excite the interest of investigators from diVerent

disciplines. This genetically determined trait diVers in fre-

quency worldwide and is due to cis-acting polymorphism

of regulation of lactase gene expression. A single nucleo-

tide polymorphism located 13.9 kb upstream from the lac-

tase gene (C-13910 > T) was proposed to be the cause, and

the 13910*Tallele, which is widespread in Europe was

found to be located on a very extended haplotype of 500 kb

or more. The long region of haplotype conservation reXects

a recent origin, and this, together with high frequencies, is

evidence of positive selection, but also means that

13910*T might be an associated marker, rather than

being causal of lactase persistence itself. Doubt about func-

tion was increased when it was shown that the original SNP

did not account for lactase persistence in most African

populations. However, the recent discovery that there are

several other SNPs associated with lactase persistence in

close proximity (within 100 bp), and that they all reside in a

piece of sequence that has enhancer function in vitro, does

suggest that they may each be functional, and their occur-

rence on diVerent haplotype backgrounds shows that sev-

eral independent mutations led to lactase persistence. Here

we provide access to a database of worldwide distributions

of lactase persistence and of the C-13910*Tallele, as well

as reviewing lactase molecular and population genetics and

the role of selection in determining present day distribu-

tions of the lactase persistence phenotype.

Introduction

Lactase, the small intestinal enzyme responsible for cleav-

ing lactose into its constituent absorbable monosaccharides,

glucose and galactose, is essential for the nourishment of

newborn mammals, whose sole source of nutrition is milk,

in which lactose is the major carbohydrate component. In

adult mammals other than humans lactase production

decreases signiWcantly in quantity following weaning (Bul-

ler et al. 1990; Lacey et al. 1994; Sebastio et al. 1989).

Although individual diVerences in the ability of human

adults to digest milk had been remarked upon in Roman

times, variation in expression of lactase was not established

as a genetically determined trait until the second half of the

twentieth century. Indeed before this, expression of high

levels of lactase in adulthood was considered by people of

European descent to be the normal state of aVairs, and

widespread deWciency of lactase in adults was only appreci-

ated in the early 1960s (Auricchio et al. 1963; Dahlqvist

et al. 1963).

Here, we review all aspects of this polymorphism from

description of phenotype to molecular and evolutionary

Electronic supplementary material The online version of this

article (doi:10.1007/s00439-008-0593-6) contains supplementary

material, which is available to authorized users.

C. J. E. Ingram C. A. Mulcare Y. Itan M. G. Thomas

D. M. Swallow (&)

Department of Genetics Evolution and Environment,

University College London, Wolfson House,

4 Stephenson Way, London NW1 2HE, UK

e-mail: [email protected]

Y. Itan

Centre for Mathematics and Physics in the Life Sciences

and Experimental Biology, CoMPLEX,

University College London, Wolfson House,

4 Stephenson Way, London NW1 2HE, UK
http://dx.doi.org/10.1007/s00439-008-0593-6http://dx.doi.org/10.1007/s00439-008-0593-6


2/13

580 Hum Genet (2009) 124:579591

123

genetics. Since we had noted that the population distribu-

tion data available in many literature reviews contained

anomalous information (as will be discussed below) we

also provide access to a newly constructed database of phe-

notypic data taken from source publications.

Determination of lactase persistence status

People whose lactase persists at high levels throughout

adult life are said to be lactase persistent while those with

little lactase as adults are described as lactase non-persis-

tent (also referred to in the literature as primary adult hypo-

lactasia). Since taking intestinal biopsies from healthy

people is invasive and not acceptable unless the person is

having other investigations, lactase persistence status is

often inferred by a method depending on lactose digestion.

This allows people to be classiWed as lactose digesters and

maldigesters. This diVerence in digestion is measured by a

test traditionally known as a lactose tolerance test and

thus the terms tolerant and intolerant are sometimes used,

though this can be confused with dietary intolerance.

The lactose tolerance test usually involves giving a lac-

tose load after an overnight fast and then measuring blood

glucose or breath hydrogen. A baseline measurement of

blood glucose or breath hydrogen is taken before ingestion

of the lactose, and then at various time intervals thereafter.

An increase in blood glucose indicates lactose digestion

(glucose produced from the lactose hydrolysis is absorbed

into the bloodstream), and no increase, or a Xat line is

indicative of a lactose maldigester (probable lactase non-

persistent) phenotype. An increase in breath hydrogen indi-

cates maldigestion and reXects colonic fermentation of the

lactose, as described in the following section. In both cases

somewhat arbitrary cut-oV points have to be set for distin-

guishing the two phenotypes and both methods inform

upon the persons ability to digest lactose rather than the

given individuals lactase expression. It must therefore be

borne in mind that there will be an underlying error rate,

leading to both false negatives and false positives. The rela-

tive eYciency of the tests has been examined in more than

one study, and the breath hydrogen method was found the

most accurate (Mulcare et al. 2004; Newcomer et al 1975;

Peuhkuri 2000). It is also convenient and cheap. Lactase

levels can, however, be secondarily reduced by gastrointes-

tinal disease, leading to secondary lactose intolerance and

also some people fail to produce hydrogen. In the clinical

setting there are ways of improving the quality of the test.

These include retesting, and giving a dose of a non-digestible

carbohydrate, lactulose, to test for the presence of hydrogen

producing bacteria (see section below), and investigation of

other causes of the lactose intolerance, which might include

examination of biopsy material.

Symptoms of lactose intolerance

Undigested lactose passing through the small intestine

into the colon has two physiological eVects. First, an

osmotic gradient is set up across the gut wall, which

results in an inXux of water, causing symptoms of diar-

rhoea. Second, the lactose can be fermented by colonic

bacteria, to produce fatty acids and gaseous by-products(including hydrogen, used in the tolerance test), poten-

tially causing discomfort, bloating and Xatulence. How-

ever most lactase non-persistent individuals can tolerate

small amounts of lactose (as in tea or coVee), and some

can consume a lot without ill eVects (Scrimshaw and

Murray 1988; Suarez et al. 1997). Variation in the com-

position of the gut Xora between individuals (Hertzler

et al. 1997; Hertzler and Savaiano 1996), as well as a

psychosomatic component (Briet et al. 1997; Peuhkuri

et al. 2000; Saltzman et al. 1999) may account for some

of the interindividual variation in symptoms.

Worldwide distribution of lactase persistence

Surveys of lactase persistence phenotype frequencies

have been carried out in many populations over the

years, so that the global distribution of lactase persis-

tence is now fairly well characterised (Flatz 1987; Swal-

low and Hollox 2000; Table 1 supplementary

information; Fig. 1a). This reveals that lactase non-per-

sistence is the most common phenotype in humans (65%

if one takes into account population census size as

shown in Table 2 of the supplementary information),

with lactase persistence being common only in certain

populations with a long history of pastoralism and milk-

ing (McCracken 1971; Simoons 1970). Lactase persis-

tence is at highest frequency in north-western Europe,

with a decreasing cline to the south and east. On the

Indian subcontinent the frequency of lactase persistence

is higher in the north-west than elsewhere, and further

east than India the lactase persistence frequency is gen-

erally low. In Africa, the distribution is patchy, with

some pastoralist nomadic tribes having high frequencies

of lactase persistence compared with neighbouring

groups living in the same country (Bayoumi et al. 1981,

1982), with a similar pattern observed between Bedouin

and neighbouring populations in the Middle East (Fig. 2,

Cook and al-Torki 1975; Dissanyake et al. 1990; Snook

et al. 1976).

The noted correlation of lactase persistence phenotype

with the cultural practise of milking generated the hypothe-

sis that this trait has been subject to strong positive selec-

tion (Aoki 1986; Holden and Mace 1997; McCracken 1971;

Simoons 1970, 1978).


3/13

Hum Genet (2009) 124:579591 581

123

Fig. 1 Interpolated maps of the

old world showing the distri-

bution of (a) lactase persistence

data taken from the literature

(Supplementary data Table 1),

(b) -13910*Tdistribution (c)

lactase persistence frequency

predicted from -13910*Tdistri-

bution, using the data collection

to be found in Supplementary

data Table 3. Maps were

generated using PYNGL (http://

www.pyngl.ucar.edu). Only

includes individuals over

12 years of age, who are

unrelated, and literature for

which the original publications

have been located and checked.

Articles in which there was clear

selection bias, and recent

immigrant populations are ex-

cluded, but the data can be found

in Supplementary data Table 1.

The Americas are excluded fromall maps because of the paucity

of data. Most data were obtained

from lactose tolerance tests

using either breath hydrogen or

blood glucose, though in some

cases enzyme assay data were

available. Locations were either

as described precisely in the

publication, or taken from

capital cities or central points of

a country or region where

precise location is not

mentioned. Where more than

one data set was available

weighted averages of the datawere taken. Predicted frequency

taken to bep2 + 2pq, wherep is

the frequency of13910*T.

Data points are shown as dots. It

should be noted that the

interpolation is inaccurate where

there are few data points. A

colour version of this Wgure can

be found in the electronic

supplementary information

(a)

(b)

(c)
http://www.pyngl.ucar.edu/http://www.pyngl.ucar.edu/http://www.pyngl.ucar.edu/http://www.pyngl.ucar.edu/


4/13

582 Hum Genet (2009) 124:579591

123

Identifying the causes of lactase persistence

By the early 1970s it was established that the lactase persis-

tence polymorphism in humans has a genetic cause, and is

inherited in an autosomal dominant manner (Ferguson andMaxwell 1967; Metneki et al. 1984; Sahi 1974). Further

evidence that lactase persistence is a genetic trait, and more

speciWcally that it is caused by a cis-acting element, was

produced in the early 1980s. Ho et al. reported a trimodal

distribution of sucrase:lactase ratios in intestinal samples

from British adults of northern European ancestry. The tri-

modal distribution was interpreted as attributable to groups

of individuals homozygous for lactase persistence (highest

lactase activity), heterozygotes with mid-level activity and

non-persistent homozygotes with low lactase activity (Ho

et al. 1982), and similar results were subsequently obtained

in individuals of German ancestry (Flatz 1984). The inter-mediate lactase activity observed in the heterozygotes indi-

cated that only one copy of the lactase gene was being fully

expressed. Evidence for transcriptional regulation (Escher

et al. 1992) and conWrmatory evidence for the cis-acting

nature of this (Wang et al. 1995) was obtained from mRNA

studies.

Sequencing ofLCTand the immediate promoter region

in Europeans showed no nucleotide changes that were

absolutely associated with persistence/non-persistence(Boll et al. 1991; Lloyd et al. 1992; Poulter et al. 2003).

However, several polymorphisms do exist across the 50 kb

LCT gene and association studies revealed that very few

haplotypes occur in most of the human populations tested,

although greater diversity was observed in African popula-

tions (Hollox et al. 2001). One combination of alleles

designated the A haplotype (Fig. 3) is particularly common

in northern Europe and is associated with lactase persis-

tence (Harvey et al. 1998). A putative causative single

nucleotide polymorphism (C-13910 > T) was subsequently

identiWed 13.9 kb upstream of theLCTtranscription initia-

tion site (Enattah et al. 2002) (Fig. 3). It is located in anintron of an adjacent gene,MCM6, and occurs exclusively

on the background of the A haplotype (Poulter et al. 2003).

The 13910*Tallele was found to associate completely

with lactase persistence, ascertained directly by enzyme

Fig. 2 Examples of countries/

geographic regions in which

individual ethnic groups display

large diVerences in lactose

absorption capacity. See

Supplementary data (Table 1)

for details

0

0.1

0.2

0.3

0.4

0.5

0.6

0.7

0.8

0.9

Beja Jaali Baggara Nilotes Fulani Hausa Ibo Yoruba Jordanian

Bedouin

Non-Bedouin

Jordanians

Saudi

Bedouin

Non-Bedouin

Saudis

Middle EastNigeriaSudan

Lactosed

igesterfrequency

Fig. 3 Diagrammatic representation of the genes MCM6 and LCT.

The arrow indicates the location of13910*T, and the other alleles

shown more recently to be associated with lactase persistence. Loca-

tions of SNPs used forLCTcore haplotype analysis are shown, with the

possible allelic combinations of the four common worldwide 11 SNP

haplotypes described in Hollox et al. (2001). The open circles indicate

an ancestral allele andWlled circles denote the derived allele at a locus.

SNPs used for assessing haplotype background of the lactase persis-

tence associated variants in our own studies are 4, 6, 9 and 10

LCTMCM6

U

A

BC

1 2 3 4 5 6 7 10 118 9

-14010*C

-13915*G

-13910*T

-13907*G


5/13

Hum Genet (2009) 124:579591 583

123

activity in 196 Finnish individuals, and subsequent studies

have conWrmed a tight but not absolute association between

13910*Tand lactase persistence as judged by lactose tol-

erance testing in populations of northern European ancestry

(Bernardes-Silva et al. 2007; Hogenauer et al. 2005; Kerber

et al. 2007; Poulter et al. 2003) and there was also a correla-

tion, but not absolute, between genotypes and enzymatic

activity (Poulter et al. 2003). However the A haplotypeextends far beyond the 50 kbLCTgene region, with carri-

ers of the13910*Tallele having almost identical chromo-

somes extending for nearly 1 Mb (Bersaglieri et al. 2004;

Poulter et al. 2003).

Evidence for function of13910*T

In vitro studies provided evidence that the 13910*Tallele

increases transcription in promoterreporter construct

assays in cell lines (Lewinsky et al. 2005; Olds and Sibley

2003; Troelsen et al. 2003), suggesting that it may have

enhancer activity in vivo. A transcription factor, Oct-1, was

identiWed which bound more strongly to the 13910*T

containing motif than to the alternative C allele, providing a

possible mechanism for up-regulation ofLCT (Lewinsky

et al. 2005), and suggesting that the cause of lactase persis-

tence had been identiWed (Rasinpera et al. 2004), although

many questions remain unanswered.

Population distribution of13910*T:13910*Tdoes

not account for lactase persistence worldwide

and is rare in sub-Saharan African populations

Using carefully checked primary source literature data

(Supplementary Table 1) we failed to obtain the tight corre-

lation of13910*Twith published worldwide lactase per-

sistence phenotype frequency reported elsewhere (Enattah

et al. 2007), but it is clear that in Europe the frequency dis-

tribution of 13910*T is in broad agreement with that

expected from distribution of the phenotype (Fig. 1).

Figure 1a shows an interpolated contour map depicting the

distribution of lactase persistence, prepared from pheno-

typic data taken from all the available literature, in which

we were conWdent of the phenotypic testing, and from

which children, family members, patients selected for

likely intolerance, and twentieth/twenty-Wrst century immi-

grant status were excluded. Figure 1b shows the distribu-

tion of13910*Tand details of the worldwide 13910*T

data can be found in the supplementary information (Sup-

plementary Table 3). Figure 1c showspredictedlactose tol-

erance distribution taken from 13910*T frequencies,

assuming that 13910*Tis the sole cause of lactase persis-

tence and is dominant (p2 + 2pq).

In contrast to the high frequency in Europe, 13910*T

is rare in sub-Saharan African populations (Fig. 1b) even in

those populations where lactase persistence frequency is

reported to be high (Mulcare et al. 2004), and it is also rare

in the Bedouins of the Arabian peninsula, who are also fre-

quently lactose digesters (Ingram et al. 2007). The allele

was also absent from all but one of a series of phenotyped

individuals of Sudanese ancestry (Ingram et al. 2007). Anobvious interpretation was that -13910*Tis not truly causal

of lactase persistence, but is a very strongly associated

marker of the causal element, which appeared on the lactase

persistence carrying (A haplotype) chromosome after

humans had spread out of Africa. However there was also

no association with A haplotype in this African group and

subsequent research indicated genetic heterogeneity.

New variants in intron 13 ofMCM6, and multiple

causes of lactase persistence in Africa

Three studies revealed several new sequence variants in

very close proximity (Figs. 3, 4; Table 1) to 13910*T

(Enattah et al. 2008; Ingram et al. 2007; TishkoV et al.

2007), two of which are clearly associated with lactase per-

sistence in diVerent parts of East Africa (13915*G and

14010*C). One of these, 13915*G, was also shown to

be associated with high lactase expression in Saudi Arabia

(Imtiaz et al. 2007). A third SNP, 13907*G, showed

much weaker evidence, but was found in several studies

(Enattah et al. 2008; Ingram 2008; Ingram et al. 2007;

TishkoV et al. 2007), and there were several other candi-

dates found in lactase persistent or milk drinking people

(Enattah et al. 2008; Ingram et al. 2007; Ingram 2008; Tag

et al. 2007; TishkoV et al. 2007). However, even taking

these additional variants into account, and supposing them

all to be functional, association with phenotype was not

complete. Although the occurrence of a few individuals

who carried an allele but were lactose maldigesters could

be explained by secondary lactase loss, individuals who

were digesters but carried no putative causative allele in

this genomic region still had to be explained, indicating that

there may be more, as yet unidentiWed, causal variants. The

genomic region may be particularly susceptible to muta-

tions, and these recent derived variants might simply be

markers of a causal element elsewhere. However, the three

newly described SNPs all occur on diVerent haplotype

backgrounds from each other (using our old nomenclature:

13907*G, on A,13915*G, on C, and14010*Cproba-

bly on B) (Enattah et al. 2008; Ingram et al. 2007; Ingram

2008; TishkoV et al. 2007), although 13907*G is on the

same haplotype as 13910*T. In each case the haplotypes

extend well beyond the 14 kb allele in both directions,

showing clearly that the derived alleles cannot simply be


6/13

584 Hum Genet (2009) 124:579591

123

markers for a single shared causal variant, and that there

must be several independent causes of lactase persistence.

Each of the alleles has a diVerent geographic distribution,

and the preliminary data suggest that -13915*G arose in the

Middle East, while 13907*G and 14010*C arose in

eastern Africa.

Evidence of function for the alleles identiWed in Africa

It is important to critically evaluate the evidence for func-

tion of these recently described alleles. Footprint analysis,

to determine DNAprotein binding sites, of sequence

encompassing the intron 13 region revealed transcription

factor recognition sequences for Cdx-2, GATA, HNF3/

Fox and HNF4 along with Oct-1 (Lewinsky et al. 2005).

Two of the newly identiWed SNPs are located within the

Oct-1 binding site (Fig. 4). Electrophoretic mobility shift

assays (EMSAs) used to ascertain the eVect of the new alle-

les on Oct-1 binding showed that only the original allele,

13910*T containing oligonucleotide probes bound

strongly to Oct-1, -13907*G bound to a much lesser extent

(Enattah et al. 2008; Ingram et al. 2007), and that binding

of the other alleles was less still or undetectable. It can

therefore be concluded that the simple change in binding of

the protein Oct-1 to this site is unlikely to play a critical

role in causing lactase persistence. The identiWcation of the

other associated allele, 14010*C, (TishkoV et al. 2007),

situated 100 bp away from the predicted Oct-1 binding site

would appear to conWrm this.

In vitro promoter/reporter analysis of the newly identi-

Wed MCM6 intron 13 variant alleles however, lends some

support to the idea that they do aVect enhancer activity.

Transcriptional activity of the LCT core promoter was

enhanced up to tenfold by addition of sequences from

MCM6 intron 13 (Lewinsky et al. 2005; Olds and Sibley

2003; TishkoVet al. 2007) which include the ancestral vari-

ant. This activity increased further (by up to 25% more)

when one of the variant alleles (14010*C, 13907*G or

13915*G) was present (TishkoV et al. 2007). This eVect

is in fact small and the authors did not include 13910*T

as a positive control (previously shown to enhance tran-

scription activity a further 80% compared to the ancestral

allele (Troelsen et al. 2003). Although a recent paper of

Enattah et al. (2008) does conWrm an eVect for 13915*G,the results are hard to evaluate because additional

sequences are included in the construct, and the control

13910*Tshows very little eVect in this study. However,

in the Enattah et al. (2008) paper the Caco-2 cells were not

diVerentiated, as they had been in some of the previous

studies (Troelsen et al. 2003). This also Xags the problem of

the appropriateness of the cell model. Caco-2 is a colon cell

line, and the only line known to express lactase and has fea-

tures more comparable with fetal small intestine (Hauri

et al. 1985).

The predictive value of these in vitro functional studies

with respect to the eVect exerted in vivo by particular alle-

les is therefore uncertain, but the observations, together

with those made previously (Lewinsky et al. 2005; Olds

and Sibley 2003; Troelsen et al. 2003) do suggest, though

do not conWrm that this region is important in regulation of

LCT expression. But how it allows low expression in

fetuses, high expression in babies and then down-regulation

in some but not other people is currently hard to envisage.

Studies in mice Xag the complexities of interpretation of in

vitro studies, and indeed in vivo studies highlight the sub-

tleties of tissue and developmental control (Bosse et al.

2006a, b, 2007; van Wering et al. 2004). Unfortunately

there are severe restrictions to animal models in elucidating

this uniquely human polymorphism.

The role of other factors inXuencing lactase expression

The immediate promoter ofLCTis moderately well charac-

terised in rat, pig and human (Fang et al. 2000, 2001;

Krasinski et al. 2001; Lee et al. 2002; Mitchelmore et al.

2000; Spodsberg et al. 1999; Troelsen et al. 1994, 1997;

Fig. 4 Sequence of the enhancer region in intron 13 ofMCM6show-

ing the positions of characterised transcription factor binding sites

(Lewinsky et al. 2005) and the SNPs that have been shown to associate

with lactase persistence. Note that the protein binding region13926

to13909 is comprised of two partially overlapping sites (Oct-1 and

GATA6as indicated). Several other SNPs that have been identiWed by

ourselves and others, in this region, including 13913T > C are not

shown since, as yet, no evidence of association with phenotype is avail-

able

TTTATGTAACTGTTGAATGCTCATACGACCATGGAATTCTTCCCTTTAAAGAGCTTGGTAAGCATTTGAGTGTAGTTGTTAGACGGAGACGATCACGTC

ATAGTTTATAGAGTGCATAAAGAC TAAGTTACCATTTAATACCTTTCATTCAGGAAAAATGTACTTAGACCCTACAATGTACTAGTAGGCCTCTGCGCT

GGCAATACAGATAAGATAA GTAG CC TGGCCTCAAAGGAACTCTCCTCCTTAGGTTGCATTTGTATAATGTTTGATTTTTAGATTGTTCTTTGAGCCCT

GCATTCCACGAGGATAGGTCAGTGGGTATTAACGAGGTAAAAGGGGAGTAGTACGAAAGGGCATTCAAGCGTCCCATCTTCGCTTCAACCAAAGCAGCCC

TGCTTTTTCCTAGTTTTATTAATAGGTTTGATGTAAGGTCGTCTTTGAAA

C

G

T

G

C

T

C

G

Cdx-2

GATA6

Oct-1

HNF3/Fox HNF4

-13684

-14133

-14034

-13934

-13833

-13733


7/13

Hum Genet (2009) 124:579591 585

123

van Wering et al. 2004; Wang et al. 2006), and there are

several allelic variants within the Wrst kilobase of human

sequence (Harvey et al. 1995; Hollox et al. 1999; Lloyd

et al. 1992). Although none of them is causal of persistence,

it is just possible that variations in these SNPs aVect expres-

sion under certain circumstances or at certain developmen-

tal stages: one study shows that the allele -958*T

(characteristic of the B haplotype) reduces binding to anuncharacterised transcription factor (Hollox et al. 1999).

Whilst it has been well established that regulation ofLCTis

predominantly under genetically determined transcriptional

control there is evidence that other factors inXuence inter-

individual diVerences in expression of the enzyme. Hetero-

geneity of the lactase non-persistence phenotype was

reported by a number of research groups in their early studies.

Some investigators observed individuals who show slower/

abnormal processing of their lactase protein (Sterchi et al.

1990; Witte et al. 1990) which may imply variation in post-

translational controls such as proteolytic cleavage, glyco-

sylation and/or transport to the cell surface, which are

involved in the normal processing of lactase (Jacob et al.

1994, 1995, 1996, 2002; Naim and Lentze 1992). Others

have made observations suggestive of epigenetic regulation

(Maiuri et al. 1991, 1994). Although most non-persistent

individuals show no staining for lactase in the jejunal biop-

sies of the small intestine (concordant with low lactase

activity and transcriptional regulation ofLCT), some indi-

viduals show patchy expression of the enzyme in the intes-

tinal epithelia (Maiuri et al. 1991, 1994). This mosaic

expression pattern might be attributable to somatic cell

changes in methylation, or histone acetylation but curiously

this is not attributable to an inherited change in expression

pattern from a single stem cell, since in that case ribbons

of positively stained cells would be expected.

Evolutionary considerations

The original observations in the 1970s and 1980s of a posi-

tive correlation between lactase persistence frequencies and

milk drinking led to the widely held notion that lactase per-

sistence has been subject to positive selection. In the inter-

vening years molecular evidence has accumulated which

would appear to corroborate this hypothesis. Our group Wrst

reported on the unusual pattern of lactase gene haplotype

diversity across populations (Hollox et al. 2001). We found

only four common 50 kb haplotypes outside Africa, with

many more within Africa, and a very high frequency of the

A haplotype in northern Europe, and suggested that the

very diVerent haplotype frequencies observed in N. Europe-

ans as compared to other populations are most probably

explained by a combination of genetic drift and strong pos-

itive selection for lactase persistence (Hollox et al. 2001).Table1

DetailsofSNPsknowntobeassociatedwithlactasepersistenceasofJuly2008

NotethatweandothershaveidentiWedatotaloftenotheralleles(including-139

13*C)withinthe130bpregion-13,9

00to-14,0

30forwhichstudiesoftheirassociation

andfunctionareongoing

Positionof

SNP(inbps

upstreamo

fLCT)

Substitution

(ancestralallele

Wrst,

fromc

omparison

withchimp)

rsNumber

Evidenceofassociationwith

lactasepersistence

Evidenceoffunction

Haplotype

(Holloxetal.2000

nomenclature)

Ge

ographiclocationof

hig

hestobservedfrequency

14,0

10

G

>C

Notincluded

indbSNP

TishkoV

etal.(2007)

TishkoV

etal.(2007)

B

Ke

nya/Tanzania

13,9

15

T>G

rs41380347

Ingrame

tal.(2007),

TishkoV

etal.(2007),

Imtiazetal.(200

7)

TishkoV

etal.(2007),Enattahetal.(2008)

C

SaudiArabia

13,9

10

C

>T

rs4988235

Enattahetal.(2002

)

Troelsenetal.(2003),OldsandSibley(2003),

Lewinskyetal.(2005)

A

Eu

rope

13,9

07

C

>G

rs41525747

TishkoV

etal.(2007)

Ingram(

2008)

TishkoV

etal.(2007),Enattahetal.(2008)

A

Ethiopia/Sudan


8/13

586 Hum Genet (2009) 124:579591

123

More recently it has been shown that 13910*Toccurs

on an unusually extended haplotype background, which is

present in the northern European population at very high

frequency (Bersaglieri et al. 2004; Poulter et al. 2003). This

is consistent with a model of recent positive selection, in

which alleles surrounding the causal variant hitch-hike

rapidly to high frequency due to strong positive selection,

and haplotype length is exaggerated, indicating a recent

mutation event where recombination has not decayed the

allelic associations in the region (reviewed in Sabeti et al.

2006). The 13910*T carrying chromosome is a real

outlier in the context of molecular signatures of selection

compared with the rest of the human genome (HapMap

Consortium 2003). Decreased diversity of microsatellite

polymorphisms (STRs) that occurs in the region ofLCT

and MCM6 was also found for the 13910*T carrying

chromosomes, indicating that this allele has risen in fre-

quency quickly and recently (Coelho et al. 2005; Mulcare

2006) (Fig. 5).

In our own study (Mulcare 2006) we used a marker for

A haplotype chromosomes so that we could compare A

haplotype chromosomes which carry the 13910*Twith A

haplotype chromosomes which do not, thus reducing the

eVect of pooling haplotypes of totally diVerent lineages.

Interestingly, we can see from this that the microsatellite

haplotype that carries 13910*Tis also the most frequent

Fig. 5 Pie charts showing microsatellite LCT/MCM6 haplotypes on

chromosomes of diVerent SNP haplotype background: A haplotypecarrying 13910*T, A haplotype carrying 13910*Cand non-A hap-

lotype chromosomes. 5579*C(rs2278544), SNP 10 in Fig. 3, used as

a marker for A haplotype and 5579*Tas a marker for non-A haplotype,

and the A haplotype chromosomes are subdivided into those that do

and do not carry 13910*T. The lactase persistence associated SNP,

22018*A (rs182549), originally described in Enattah et al. (2002)

was tested on all samples and 22018*A correlated in all but one

sample with 13910*T. Data taken from families and the haplotypes

inferred from family structure. Data sets from: Irish n = 65 chromo-

somes, English n = 64, German, n = 60, French, n = 38, Ashkenazi

Jews n = 96, Armenian, n = 88, Kuwaiti, n = 28, Algerian, n = 20,Ethiopian, Amharic n = 118; n values for main charts shown. The inset

small charts show Ethiopian chromosomes only; n = 93 for non-A hap-

lotype; n = 25 for A haplotype. It can be seen that both groups of A-

haplotype chromosomes share the same modal haplotype as do both

groups of non-A chromosomes. The microsatellites tested are located

in intron 16 ofMCM6, intron 1, 2 and 13 ofLCT, respectively at posi-

tions 13840816, 136804355, 136798196, 136763409, from the Human

Genome Browser (http://genome.cse.ucsc.edu/cgi-bin/hgGateway

July 2003 freeze (colour in online)

-13910*TA haplotype

-13910*CA haplotype,

-13910*Cnon-A haplotype
http://genome.cse.ucsc.edu/cgi-bin/hgGatewayhttp://genome.cse.ucsc.edu/cgi-bin/hgGateway


9/13

Hum Genet (2009) 124:579591 587

123

of the ancestral A haplotype chromosomes in Europeans,

and also in non-Europeans. It can also be seen that within

the non-A lineages there is a fairly frequent microsatellite

haplotype which occurs in Europeans as well as non-Euro-

peans (Fig. 5). It is associated with the B core haplotype in

Europeans, and non-persistence. These observations sug-

gest demographic factors additional to selection for one

particular allele, as proposed previously (Hollox et al.2001). Indeed, in the case of European lactase persistence,

recent demic computer simulations indicate that the spread

of farming from the near east during the Neolithic transition

may have contributed to the high frequencies and genetic

homogeneity of lactase persistence on the continent

(Y. Itan, M. Thomas et al. manuscript in preparation).

Historical origins of lactase persistence; dating

of the lactase persistence associated alleles

Each of the microsatellite diversity studies used the micro-

satellites to attempt to date the expansion of the 13910*T

allele and the date ranges were 7,45012,300 (Coelho et al.

2005), and 7,40010,200 years ago (Mulcare 2006), and

this agrees with date estimates obtained from extended hap-

lotypes of 2,18820,650 years ago (Bersaglieri et al. 2004).

These dates are consistent with models of selection for lac-

tase persistence along with the recent practise of dairying,

approximately 9,000 years ago in Europe. Ancient DNA

data obtained from human bones has shown that the

13910*Tallele was either absent, or present at low fre-

quencies, in early Neolithic Europeans. This is consistent

with the -13910*T allele age estimates and supports a

model whereby the cultural trait of dairying was adopted

prior to lactase persistence becoming frequent (Burger et al.

2007).

The newly discovered 14010*Callele is also reported

to occur as part of an unusually extended haplotype, sug-

gesting that Africans too carry these signatures of recent

positive selection for lactase persistence. In this case the

allele is estimated to be between 1,200 and 23,200 years

old (TishkoVet al. 2007).

The identiWcation of the newly associated alleles them-

selves suggests that lactase persistence has arisen and been

selected for independently in several diVerent human popu-

lations, thus the ability to digest milk has been extremely

advantageous, at least for some, in the last few thousand

years.

What were the evolutionary forces?

Because of the worldwide distribution of lactase persis-

tence and the generally coinciding pattern of historically

milk-drinking populations, Simoons and McCracken inde-

pendently suggested, more than 30 years ago, that milk

dependence created strong selection for lactase persistence

(McCracken 1971; Simoons 1970). This has become

known as the culture historical hypothesis, and suggests

that the rise in lactase persistence co-evolved alongside the

cultural adaptation of milk drinking, and its associated

nutritional beneWts. Nevertheless, the correlation is notabsolute and there are exceptions in both directions. For

example there are some ethnic groups who rely heavily on

milk products and for whom cows or camels play a very

important role in their lifestyle, but who have a low

reported frequency of lactase persistence, for example, the

Dinka and Nuer in Sudan (Bayoumi et al. 1982) and the

Somali in Ethiopia (Ingram 2008). Statistical modelling

shows that an incomplete correlation can be accommodated

if some lactase persistent populations have recently stopped

milking or conversely have only recently adopted the habit,

therefore allowing insuYcient time for lactase persistence

to be driven to high frequency (Aoki 1986). Population

migration may also have played an important role. In addi-

tion the cultural practise of milk fermentation (e.g. to

yoghurt or cheese) reduces lactose content allowing non-

persistent individuals to beneWt from milk products.

Holden and Mace using regression analyses and correct-

ing for relatedness of diVerent populations claimed that lac-

tose digestion capacity had most likely evolved as an

adaptation to dairying, and concluded that high frequency

lactose digestion capacity had never evolved without the

prior presence of milking (Holden and Mace 1997). Other

evidence suggested to be in support of the culture-historical

hypothesis has been provided by the observation that high-

intra allelic diversity of cattle milk protein genes in Europe

coincides with the geographic incidence of lactase persis-

tence, which is consistent with large herd sizes kept for

dairying and selection for high milk yields (Beja-Pereira

et al. 2003).

However, it is noteworthy that at least in the Somali, one

of us (CI) has obtained data to suggest that signiWcant quan-

tities of fresh milk are consumed by many who are lactase

non-persistent (Ingram 2008) apparently without any

adverse eVects, and it seems likely that adaptation of the

colonic bacterial Xora allows digestion of lactose by these

people. This means that under normal circumstances lactase

persistence is unlikely to be under very strong selection in

this population, and Wts with the hypothesis that dairying

and milk drinking can emerge before the genetic adapta-

tion. It is likely that only at certain times and under more

extreme circumstances, such as drought and famine, that

the strong selective force operates. This is an extension of

the arid climate hypothesis, Wrst suggested by Cook and

al-Torki (1975). These authors speculated that in desert

climates (i.e. Middle and Near East) where water and food


10/13

588 Hum Genet (2009) 124:579591

123

were scarce, nomadic groups could survive by utilizing

milk as a food source, and in particular, as a source of

clean, uncontaminated Xuid (Cook and al-Torki 1975). This

scenario is particularly pertinent to desert nomads whose

major source of milk is obtained from camels, as these ani-

mals are able to survive up to 2 weeks without food and

water by metabolising the fat contained in their humps. The

beneWts to persistent individuals may have become morepronounced during outbreaks of diarrhoeal disease, when

non-persistent individuals would be unable to utilize milk

as a water source without exacerbating their condition.

More recent research sought to address the question of

why some populations and not others had adopted the cul-

tural habit of milk drinking. The frequencies of lactose mal-

absorption were greater in populations where environmental

conditions, such as extremes of climate or high incidence of

endemic cattle disease, made it impossible to raise livestock

(Bloom and Sherman 2005). The exceptions to the general

distribution were a number of African groups with high lac-

tase persistence frequency who managed to circumvent

harsh environmental conditions by adopting a pastoralist

way of life (Bloom and Sherman 2005).

Obviously, the beneWts of milk drinking cannot be

explained by the arid climate hypothesis in Northern

Europe. Here, the advantage of improved calcium absorp-

tion has been suggested to explain the distribution of the

trait (Flatz and Rotthauwe 1973). The low light levels expe-

rienced at high latitudes are associated with an increased

risk of developing rickets and osteomalacia due to a lack of

vitamin D production (which is synthesized by the skin in

the presence of sunlight). Vitamin D is involved in the gut

absorption of calcium, which is itself an essential mineral

required for bone health. In addition, calcium may help to

prevent rickets by impairing the breakdown of vitamin D in

the liver (Thacher et al. 1999). Although lactase non-persis-

tent individuals could obtain calcium from yoghurt or

cheese, dairy foods that contain reduced lactose, milk pro-

teins and lactose are believed to facilitate the absorption of

calcium (for review see Gueguen and Pointillart 2000).

Hence the ability to drink fresh milk which contains both

calcium and components that stimulate its uptake (includ-

ing small amounts of vitamin D) may have provided an

advantage to persistent individuals.

Just one hypothesis has been put forward which suggests

selection for lactase non-persistence. Since lactase non-per-

sistence is the ancestral state, the need to invoke selection

for non-persistence is counter-intuitive, but should not be

ignored. In this proposal the selective agent is thought to be

malaria (Anderson and Vullo 1994). This proposal came

from the observations of high frequency of lactase non-per-

sistence in regions where malaria is endemic, and that indi-

viduals with Xavin deWciency are at a slightly reduced risk

of infection by malaria. The consumption of milk, which is

rich in riboXavins, was therefore proposed to be unfavour-

able since it would keep Xavin levels in the bloodstream

high. There is currently no support for this hypothesis

(Meloni et al. 1998), and it seems unlikely to contribute to

the current distribution of lactase persistence.

Present day health and medical considerations

Lactose malabsorption can readily be confused with milk

protein allergy, which has quite diVerent causes (reviewed

in Crittenden and Bennett 2005), and in recent times lactose

intolerance has been blamed for causing a variety of sys-

temic conditions, often without clear evidence (Campbell

and Matthews 2005; Matthews et al. 2005). Nonetheless it

does appear that consumption of milk and milk products by

those who cannot digest lactose is a relatively common

cause of irritable bowel syndrome in Europe and the USA

(Vesa et al. 2000). Many commercial dairy products and

other foods (including yoghurts) contain high concentra-

tions of lactose introduced in manufacturing, so that lactose

is more widespread in the diet than it was for that same per-

sons ancestors. Lactose tolerance testing can be a useful way

of detecting lactose malabsorption and enabling avoidance of

the cause, but DNA testing is not yet useful, particularly for

non-Europeans (Swallow 2006; Tag et al. 2008; Weiskir-

chen et al. 2007). In countries such as Finland, where there

is a high frequency of lactase non-persistence in compari-

son with the rest of northern Europe, commercial low

lactose products are readily available (Harju 2003).

Many association studies have attempted to demonstrate

the health beneWts of milk consumption in lactase persistent

people, e.g. by providing protection against osteoporosis

(Enattah et al. 2005a, b; Meloni et al. 2001; Obermayer-

Pietsch et al. 2004), and others have claimed adverse eVects

of lactase persistence and associated high milk consump-

tion (e.g. cataracts, ovarian cancer and diabetes) (Enattah

et al. 2004; Larsson et al. 2006; Meloni et al. 2001; Meloni

et al. 1999; Villako and Maaroos 1994). The often-contra-

dictory Wndings are diYcult to evaluate because of the high

risk of confounding eVects such as mixed ancestry, dietary

intake and variation in gut Xora.

Conclusion

Lactase persistence has been one of the leading examples of

natural selection in humans, and also one of the Wrst clear

examples of polymorphism of a regulatory element. Further

investigation of the molecular mechanisms as well as the

evolutionary forces is however needed to fully understand

this normal variation, which is providing an important

model for understanding gene/culture co-evolution and


11/13

Hum Genet (2009) 124:579591 589

123

disease susceptibility. The information accrued so far

already illustrates the limitations of disease association

studies and SNP tagging to Wnd functional genetic variation

attributable to multiple mutations, even if they are located

in a single gene, and highlights the potential importance of

distant regulatory elements.

Acknowledgments CJEI and CAM were funded by BBSRC CASEstudentships and YI was funded by UCL Graduate school, UCL ORS

and Bnai Brith/Leo Baeck London Lodge scholarships. We thank

Neil Bradman, The Centre for Genetic Anthropology, UCL, for access

to samples and Melford Charitable Trust for funding.

References

Anderson B, Vullo C (1994) Did malaria select for primary adult

lactase deWciency? Gut 35:14871489

Aoki K (1986) A stochastic model of gene-culture coevolution sug-

gested by the culture-historical hypothesis. Proc Natl Acad Sci

USA 83:29292933Auricchio S, Rubino A, Semenza G, Landolt M, Prader A (1963) Iso-

lated intestinal lactase deWciency in the adult. Lancet 2:324326

Bayoumi RA, Saha N, Salih AS, Bakkar AE, Flatz G (1981) Distribu-

tion of the lactase phenotypes in the population of the Democratic

Republic of the Sudan. Hum Genet 57:279281

Bayoumi RA, Flatz SD, Kuhnau W, Flatz G (1982) Beja and Nilotes:

nomadic pastoralist groups in the Sudan with opposite distribu-

tions of the adult lactase phenotypes. Am J Phys Anthropol

58:173178

Beja-Pereira A, Luikart G, England PR, Bradley DG, Jann OC, Berto-

relle G, Chamberlain AT, Nunes TP, Metodiev S, Ferrand N,

Erhardt G (2003) Gene-culture coevolution between cattle milk

protein genes and human lactase genes. Nat Genet 35:311313

Bernardes-Silva CF, Pereira AC, de Fatima Alves da Mota, Krieger JE,

Laudanna AA (2007) Lactase persistence/non-persistence vari-ants, C/T_13910 and G/A_22018, as a diagnostic tool for lactose

intolerance in IBS patients. Clin Chim Acta 386:711

Bersaglieri T, Sabeti PC, Patterson N, Vanderploeg T, SchaVner SF,

Drake JA, Rhodes M, Reich DE, Hirschhorn JN (2004) Genetic

signatures of strong recent positive selection at the lactase gene.

Am J Hum Genet 74:11111120

Bloom G, Sherman PW (2005) Dairying barriers aVect the distribution

of lactose malabsorption. Evol Human Behav 26:301312

Boll W, Wagner P, Mantei N (1991) Structure of the chromosomal

gene and CDNAs coding for lactase-phlorizin hydrolase in hu-

mans with adult-type hypolactasia or persistence of lactase. Am J

Hum Genet 48:889902

Bosse T, Piaseckyj CM, Burghard E, Fialkovich JJ, Rajagopal S, Pu

WT, Krasinski SD (2006a) Gata4 is essential for the maintenance

of jejunalileal identities in the adult mouse small intestine. MolCell Biol 26:90609070

Bosse T, van Wering HM, Gielen M, Dowling LN, Fialkovich JJ,

Piaseckyj CM, Gonzalez FJ, Akiyama TE, Montgomery RK,

Grand RJ, Krasinski SD (2006b) Hepatocyte nuclear factor-

1alpha is required for expression but dispensable for histone acet-

ylation of the lactase-phlorizin hydrolase gene in vivo. Am J

Physiol Gastrointest Liver Physiol 290:G1016G1024

Bosse T, Fialkovich JJ, Piaseckyj CM, Beuling E, Broekman H, Grand

RJ, Montgomery RK, Krasinski SD (2007) Gata4 and Hnf1alpha

are partially required for the expression of speciWc intestinal

genes during development. Am J Physiol Gastrointest Liver Phys-

iol 292:G1302G1314

Briet F, Pochart P, Marteau P, Flourie B, Arrigoni E, Rambaud JC

(1997) Improved clinical tolerance to chronic lactose ingestion in

subjects with lactose intolerance: a placebo eVect? Gut 41:632

635

Buller HA, Kothe MJC, Goldman DA, Grubman SA, Sasak WV, Mat-

sudaira PT, Montgomery RK, Grand RJ (1990) Coordinate

expression of lactase-phlorizin hydrolase mRNA and enzyme lev-

els in rat intestine during development. J Biol Chem 265:6978

6983

Burger J, Kirchner M, Bramanti B, Haak W, Thomas MG (2007) Ab-

sence of the lactase-persistence-associated allele in early Neo-

lithic Europeans. Proc Natl Acad Sci USA 104:37363741

Campbell AK, Matthews SB (2005) Darwins illness revealed. Post-

grad Med J 81:248251

Coelho M, Luiselli D, Bertorelle G, Lopes AI, Seixas S, stro-Bisol G,

Rocha J (2005) Microsatellite variation and evolution of human

lactase persistence. Hum Genet 117:329339

Cook GC, al-Torki MT (1975) High intestinal lactase concentrations in

adult Arabs in Saudi Arabia. Br Med J 3:135136

Crittenden RG, Bennett LE (2005) Cows milk allergy: a complex dis-

order. J Am Coll Nutr 24:582S591S

Dahlqvist A, Hammond B, Crane R, Dunphy J, Littman A (1963)

Intestinal lactase deWciency and lactose intolerance in adults: pre-

liminary report. Gastroenterology 45:488491Dissanyake AS, El-Munshid HA, Al-Qurain A (1990) Prevalence of

primary adult lactose malabsorption in the eastern province of

Saudi Arabia. Ann Saudi Med 10:598601

Enattah NS, Sahi T, Savilahti E, Terwilliger JD, Peltonen L, Jarvela I

(2002) IdentiWcation of a variant associated with adult-type hyp-

olactasia. Nat Genet 30:233237

Enattah NS, Forsblom C, Rasinpera H, Tuomi T, Groop PH, Jarvela I

(2004) The genetic variant of lactase persistence C (13910) T as

a risk factor for type I and II diabetes in the Finnish population.

Eur J Clin Nutr 58:13191322

Enattah N, Pekkarinen T, Valimaki MJ, Loyttyniemi E, Jarvela I

(2005a) Genetically deWned adult-type hypolactasia and self-re-

ported lactose intolerance as risk factors of osteoporosis in

Finnish postmenopausal women. Eur J Clin Nutr 59:11051111

Enattah NS, Sulkava R, Halonen P, Kontula K, Jarvela I (2005b)Genetic variant of lactase-persistent C/T-13910 is associated with

bone fractures in very old age. J Am Geriatr Soc 53:7982

Enattah NS, Trudeau A, PimenoVV, Maiuri L, Auricchio S, Greco L,

Rossi M, Lentze M, Seo JK, Rahgozar S, Khalil I, Alifrangis M,

Natah S, Groop L, Shaat N, Kozlov A, Verschubskaya G, Comas

D, Bulayeva K, Mehdi SQ, Terwilliger JD, Sahi T, Savilahti E,

Perola M, Sajantila A, Jarvela I, Peltonen L (2007) Evidence of

still-ongoing convergence evolution of the lactase persistence

T-13910 alleles in humans. Am J Hum Genet 81:615625

Enattah NS, Jensen TG, Nielsen M, Lewinski R, Kuokkanen M, Rasin-

pera H, El-Shanti H, Seo JK, Alifrangis M, Khalil IF, Natah A,

Ali A, Natah S, Comas D, Mehdi SQ, Groop L, Vestergaard EM,

Imtiaz F, Rashed MS, Meyer B, Troelsen J, Peltonen L (2008)

Independent introduction of two lactase-persistence alleles into

human populations reXects diVerent history of adaptation to milkculture. Am J Hum Genet 82:5772

Escher JC, de Koning ND, van Engen CG, Arora S, Buller HA, Mont-

gomery RK, Grand RJ (1992) Molecular basis of lactase levels in

adult humans. J Clin Invest 89:480483

Fang R, Santiago NA, Olds LC, Sibley E (2000) The homeodomain

protein Cdx2 regulates lactase gene promoter activity during

enterocyte diVerentiation. Gastroenterology 118:115127

Fang R, Olds LC, Santiago NA, Sibley E (2001) GATA family tran-

scription factors activate lactase gene promoter in intestinal Caco-

2 cells. Am J Physiol Gastrointest Liver Physiol 280:G58G67

Ferguson A, Maxwell J (1967) Genetic aetiology of lactose intoler-

ance. Lancet 2:188190


12/13

590 Hum Genet (2009) 124:579591

123

Flatz G (1984) Gene dosage eVect on intestinal lactase activity demon-

strated in vivo. Am J Hum Genet 36:306310

Flatz G (1987) Genetics of lactose digestion in humans. In: Harris H,

Hirschhorn K (eds) Advances in human genetics, vol 16. Plenum

Press, New York, pp 177

Flatz G, Rotthauwe HW (1973) Lactose nutrition and natural selection.

Lancet 2:7677

Gueguen L, Pointillart A (2000) The bioavailability of dietary calcium.

J Am Coll Nutr 19:119S136S

HapMap Consortium (2003) The International HapMap Project.

Nature 426:789796

Harju M (2003) Chromatographic and enzymatic removal of lactose

from milk, IDF World Dairy Summit, Bruges, BELGIQUE

(09/2003) 2004, no 389, pp 48

Harvey CB, Pratt WS, Islam I, Whitehouse DB, Swallow DM (1995)

DNA polymorphisms in the lactase gene. Linkage disequilibrium

across the 70-kb region. Eur J Hum Genet 3:2741

Harvey CB, Hollox EJ, Poulter M, Wang Y, Rossi M, Auricchio S, Iq-

bal TH, Cooper BT, Barton R, Sarner M, Korpela R, Swallow DM

(1998) Lactase haplotype frequencies in Caucasians: association

with the lactase persistence/non-persistence polymorphism. Ann

Hum Genet 62(Pt 3):215223

Hauri HP, Sterchi EE, Bienz D, Fransen JA, Marxer A (1985) Expres-

sion and intracellular transport of microvillus membrane hydro-lases in human intestinal epithelial cells. J Cell Biol 101:838851

Hertzler SR, Savaiano DA (1996) Colonic adaptation to daily lactose

feeding in lactose maldigesters reduces lactose intolerance. Am J

Clin Nutr 64:232236

Hertzler SR, Savaiano DA, Levitt MD (1997) Fecal hydrogen produc-

tion and consumption measurementsresponse to daily lactose

ingestion by lactose maldigesters. Dig Dis Sci 42:348353

Ho MW, Povey S, Swallow DM (1982) Lactase polymorphism in adult

British natives: estimating allele frequencies by enzyme assays in

autopsy samples. Am J Hum Genet 34:650657

Hogenauer C, Hammer HF, Mellitzer K, Renner W, Krejs GJ, Toplak

H (2005) Evaluation of a new DNA test compared with the lactose

hydrogen breath test for the diagnosis of lactase non-persistence.

Eur J Gastroenterol Hepatol 17:371376

Holden C, Mace R (1997) Phylogenetic analysis of the evolution oflactose digestion in adults. Hum Biol 69:605628

Hollox EJ, Poulter M, Wang Y, Krause A, Swallow DM (1999) Com-

mon polymorphism in a highly variable region upstream of the

human lactase gene aVects DNAprotein interactions. Eur J Hum

Genet 7:791800

Hollox EJ, Poulter M, Zvarik M, Ferak V, Krause A, Jenkins T, Saha

N, Kozlov AI, Swallow DM (2001) Lactase haplotype diversity in

the Old World. Am J Hum Genet 68:160172

Imtiaz F, Savilahti E, Sarnesto A, Trabzuni D, Al-Kahtani K, Kagevi

I, Rashed MS, Meyer BF, Jarvela I (2007) The T/G 13915 variant

upstream of the lactase gene (LCT) is the founder allele of lactase

persistence in an urban Saudi population. J Med Genet 44:e89

Ingram CJE (2008) The evolutionary genetics of lactase persistence in

Africa and the Middle East. Ph.D. thesis University of London

Ingram CJE, Elamin MF, Mulcare CA, Weale ME, Tarekegn A, RagaTO, Bekele E, Elamin FM, Thomas MG, Bradman N, Swallow

DM (2007) A novel polymorphism associated with lactose toler-

ance in Africa: multiple causes for lactase persistence? Hum Gen-

et 120:779788

Jacob R, Brewer C, Fransen JA, Naim HY (1994) Transport, function,

and sorting of lactase-phlorizin hydrolase in MadinDarby canine

kidney cells. J Biol Chem 269:27122721

Jacob R, Bulleid NJ, Naim HY (1995) Folding of human intestinal lac-

tase-phlorizin hydrolase. J Biol Chem 270:1867818684

Jacob R, Radebach I, Wuthrich M, Grunberg J, Sterchi EE, Naim HY

(1996) Maturation of human intestinal lactase-phlorizin hydro-

lase: generation of the brush border form of the enzyme involves

at least two proteolytic cleavage steps. Eur J Biochem 236:789

795

Jacob R, Peters K, Naim HY (2002) The prosequence of human lac-

tase-phlorizin hydrolase modulates the folding of the mature en-

zyme. J Biol Chem 277:82178225

Kerber M, Oberkanins C, Kriegshauser G, Kollerits B, senbach-Glan-

inger A, Fuchs D, Ledochowski M (2007) Hydrogen breath test-

ing versus LCT genotyping for the diagnosis of lactose

intolerance: a matter of age? Clin Chim Acta 383:9196

Krasinski SD, van Wering HM, Tannemaat MR, Grand RJ (2001)

DiVerential activation of intestinal gene promoters: functional

interactions between GATA-5 and HNF-1 alpha. Am J Physiol

Gastrointest Liver Physiol 281:G69G84

Lacey SW, Naim HY, Magness RR, Gething M-J, Sambrook JF (1994)

Expression of lactase-phlorizin hydrolase in sheep is regulated at

the RNA level. Biochem J 302:929935

Larsson SC, Orsini N, Wolk A (2006) Milk, milk products and lactose

intake and ovarian cancer risk: a meta-analysis of epidemiological

studies. Int J Cancer 118:431441

Lee SY, Wang Z, Lin CK, Contag CH, Olds LC, Cooper AD, Sibley E

(2002) Regulation of intestine-speciWc spatiotemporal expression

by the rat lactase promoter. J Biol Chem 277:1309913105

Lewinsky RH, Jensen TG, Moller J, Stensballe A, Olsen J, Troelsen JT

(2005) T-13910 DNA variant associated with lactase persistenceinteracts with Oct-1 and stimulates lactase promoter activity in

vitro. Hum Mol Genet 14:39453953

Lloyd M, Mevissen G, Fischer M, Olsen W, Goodspeed D, Genini M,

Boll W, Semenza G, Mantei N (1992) Regulation of intestinal lac-

tase in adult hypolactasia. J Clin Invest 89:524529

Maiuri L, Raia V, Potter J, Swallow DM, Ho MW, Fiocca R, Finzi G,

Cornaggia M, Capella C, Quaroni A, Auricchio S (1991) Mosaic

pattern of lactase expression in villous enterocytes in human

adult-type hypolactasia. Gastroenterology 100:359369

Maiuri L, Rossi M, Raia V, Garipoli V, Hughes LA, Swallow D, Noren

O, Sjostrom H, Auricchio S (1994) Mosaic regulation of lactase

in human adult-type hypolactasia. Gastroenterology 107:5460

Matthews SB, Waud JP, Roberts AG, Campbell AK (2005) Systemic

lactose intolerance: a new perspective on an old problem. Post-

grad Med J 81:167173McCracken RD (1971) Lactase deWciencyexample of dietary evolu-

tion. Curr Anthropol 12:479

Meloni T, Colombo C, Ruggiu G, Dessena M, Meloni GF (1998) Pri-

mary lactase deWciency and past malarial endemicity in Sardinia.

Ital J Gastroenterol Hepatol 30:490493

Meloni GF, Colombo C, La VC, Ruggiu G, Mannazzu MC, Ambrosini

G, Cherchi PL (1999) Lactose absorption in patients with ovarian

cancer. Am J Epidemiol 150:183186

Meloni GF, Colombo C, La VC, PaciWco A, Tomasi P, Ogana A, Mari-

naro AM, Meloni T (2001) High prevalence of lactose absorbers

in Northern Sardinian patients with type 1 and type 2 diabetes

mellitus. Am J Clin Nutr 73:582585

Metneki J, Cziezel A, Flatz SD, Flatz G (1984) A study of lactose

absorption capacity in twins. Hum Genet 67:296300

Mitchelmore C, Troelsen JT, Spodsberg N, Sjostrom H, Noren O(2000) Interaction between the homeodomain proteins Cdx2 and

HNF1alpha mediates expression of the lactase-phlorizin hydro-

lase gene. Biochem J 346(Pt 2):529535

Mulcare (2006) The evolution of the lactase persistence phenotype.

Ph.D. thesis University of London, London, UK

Mulcare CA, Weale ME, Jones AL, Connell B, Zeitlyn D, Tarekegn A,

Swallow DM, Bradman N, Thomas MG (2004) The T allele of a

single-nucleotide polymorphism 13.9 kb upstream of the lactase

gene (LCT) (C-13.9kbT) does not predict or cause the lactase-per-

sistence phenotype in Africans. Am J Hum Genet 74:11021110

Naim HY, Lentze MJ (1992) Impact ofO-glycosylation on the function

of human intestinal lactase-phlorizin hydrolase. Characterization


13/13

Hum Genet (2009) 124:579591 591

123

of glycoforms varying in enzyme activity and localization of

O-glycoside addition. J Biol Chem 267:2549425504

Newcomer AD, McGill DB, Thomas PJ, Hofmann AF (1975) Prospec-

tive comparison of indirect methods for detecting lactase deW-

ciency. N Engl J Med 293:12321236

Obermayer-Pietsch BM, Bonelli CM, Walter DE, Kuhn RJ, Fahrleit-

ner-Pammer A, Berghold A, Goessler W, Stepan V, Dobnig H,

Leb G, Renner W (2004) Genetic predisposition for adult lactose

intolerance and relation to diet, bone density, and bone fractures.

J Bone Miner Res 19:4247

Olds LC, Sibley E (2003) Lactase persistence DNA variant enhances

lactase promoter activity in vitro: functional role as a cis regula-

tory element. Hum Mol Genet 12:23332340

Peuhkuri (2000) Lactose, lactase, and bowel disorders, Ph.D. thesis,

University of Helsinki, Finland

Peuhkuri K, Vapaatalo H, Korpela R, Teuri U (2000) Lactose intoler-

ancea confusing clinical diagnosis. Am J Clin Nutr 71:600602

Poulter M, Hollox E, Harvey CB, Mulcare C, Peuhkuri K, Kajander K,

Sarner M, Korpela R, Swallow DM (2003) The causal element for

the lactase persistence/non-persistence polymorphism is located

in a 1 Mb region of linkage disequilibrium in Europeans. Ann

Hum Genet 67:298311

Rasinpera H, Savilahti E, Enattah NS, Kuokkanen M, Totterman N,

Lindahl H, Jarvela I, Kolho KL (2004) A genetic test which canbe used to diagnose adult-type hypolactasia in children. Gut

53:15711576

Sabeti PC, SchaVner SF, Fry B, Lohmueller J, Varilly P, Shamovsky

O, Palma A, Mikkelsen TS, Altshuler D, Lander ES (2006) Posi-

tive natural selection in the human lineage. Science 312:1614

1620

Sahi T (1974) The inheritance of selective adult-type lactose malab-

sorption. Scand J Gastroenterol 9:173

Saltzman JR, Russell RM, Golner B, Barakat S, Dallal GE, Goldin BR

(1999) A randomized trial ofLactobacillus acidophilus BG2FO4

to treat lactose intolerance. Am J Clin Nutr 69:140146

Scrimshaw NS, Murray EB (1988) The acceptability of milk and milk

products in populations with a high prevalence of lactose intoler-

ance. Am J Clin Nutr 48:10791159

Sebastio G, Villa M, Sartorio R, Guzzetta V, Poggi V, Auricchio S,Boll W, Mantei N, Semenza G (1989) Control of lactase in human

adult-type hypolactasia and in weaning rabbits and rats. Am J

Hum Genet 45:489497

Simoons FJ (1970) Primary lactose intolerance and the milking habit:

a problem in biological and cultural interrelations, II. A culture

historical hypothesis. Am J Dig Dis 15:695710

Simoons FJ (1978) The geographic hypothesis and lactose malabsorp-

tiona weighing of the evidence. Dig Dis 23:963980

Snook CR, Mahmoud JN, Chang WP (1976) Lactose tolerance in adult

Jordanian Arabs. Trop Geogr Med 28:333335

Spodsberg N, Troelsen JT, Carlsson P, Enerback S, Sjostrom H, Noren

O (1999) Transcriptional regulation of pig lactase-phlorizin

hydrolase. Involvement of HNF-1 and FREACs. Gastroenterol-

ogy 116:842854

Sterchi E, Mills P, Fransen J, Hauri H, Lentze M, Naim H, Ginsel L,Bond J (1990) Biogenesis of intestinal lactase-phlorizin hydrolase

in adults with lactose intolerance. Evidence for reduced biosyn-

thesis and slowed-down maturation in enterocytes. J Clin Invest

86:13291337

Suarez FL, Savaiano D, Arbisi P, Levitt MD (1997) Tolerance to the

daily ingestion of two cups of milk by individuals claiming

lactose intolerance. Am J Clin Nutr 65:15021506

Swallow DM (2006) DNA test for hypolactasia premature. Gut

55:131132

Swallow DM, Hollox EJ (2000) The genetic polymorphism of intesti-

nal lactase activity in adult humans. In: Scriver CR, Beaudet AL,

Sly WS, Valle D (eds) The metabolic and molecular basis of

inherited disease. McGraw-Hill, New York, pp 16511662

Tag CG, SchiZers MC, Mohnen M, Gressner AM, Weiskirchen R

(2007) A novel proximal 13914G > A base replacement in the

vicinity of the common-13910T/C lactase gene variation results

in an atypical LightCycler melting curve in testing with the Mu-

taREAL lactase test. Clin Chem 53:146148

Tag CG, Oberkanins C, Kriegshauser G, Ingram CJ, Swallow DM,

Gressner AM, Ledochowski M, Weiskirchen R (2008) Evaluation

of a novel reverse-hybridization StripAssay for typing DNA vari-

ants useful in diagnosis of adult-type hypolactasia. Clin Chim

Acta 392:5862

Thacher TD, Fischer PR, Pettifor JM, Lawson JO, Isichei CO, Reading

JC, Chan GM (1999) A comparison of calcium, vitamin D, or

both for nutritional rickets in Nigerian children. N Engl J Med

341:563568

TishkoVSA, Reed FA, Ranciaro A, Voight BF, Babbitt CC, Silverman

JS, Powell K, Mortensen HM, Hirbo JB, Osman M, Ibrahim M,

Omar SA, Lema G, Nyambo TB, Ghori J, Bumpstead S, Pritchard

JK, Wray GA, Deloukas P (2007) Convergent adaptation of hu-man lactase persistence in Africa and Europe. Nat Genet 39:31

40

Troelsen JT, Mehlum A, Olsen J, Spodsberg N, Hansen GH, Prydz H,

Noren O, Sjostrom H (1994) 1 kb of the lactase-phlorhizin hydro-

lase promoter directs post-weaning decline and small intestinal-

speciWc expression in transgenic mice. FEBS Lett 342:291296

Troelsen JT, Mitchelmore C, Spodsberg N, Jensen AM, Noren O, Sjo-

strom H (1997) Regulation of lactase-phlorizin hydrolase gene

expression by the caudal-related homoeodomain protein Cdx-2.

Biochem J 322(Pt 3):833838

Troelsen JT, Olsen J, Moller J, Sjostrom H (2003) An upstream poly-

morphism associated with lactase persistence has increased en-

hancer activity. Gastroenterology 125:16861694

van Wering HM, Bosse T, Musters A, de Jong E, de Jong N, Hogen

Esch CE, Boudreau F, Swain GP, Dowling LN, Montgomery RK,Grand RJ, Krasinski SD (2004) Complex regulation of the lac-

tase-phlorizin hydrolase promoter by GATA-4. Am J Physiol

Gastrointest Liver Physiol 287(4):G899909

Vesa TH, Marteau P, Korpela R (2000) Lactose intolerance. J Am Coll

Nutr 19:165S175S

Villako K, Maaroos H (1994) Clinical picture of hypolactasia and lac-

tose intolerance. Scand J Gastroenterol Suppl 202:3654

Wang Y, Harvey CB, Pratt WS, Sams VR, Sarner M, Rossi M, Auric-

chio S, Swallow DM (1995) The lactase persistence/non-persis-

tence polymorphism is controlled by a cis-acting element. Hum

Mol Genet 4:657662

Wang Z, Maravelias C, Sibley E (2006) Lactase gene promoter frag-

ments mediate diVerential spatial and temporal expression pat-

terns in transgenic mice. DNA Cell Biol 25:215222

Weiskirchen, Tag CG, Mengsteab S, Gressner AM, Ingram CJE, Swal-low DM (2007) Pitfalls in LightCycler Diagnosis of the single-

nucleotide polymorphism 13.9 kb upstream of the lactase gene

that is associated with adult-type hypolactasia

Witte J, Lloyd M, Lorenzsonn V, Korsmo H, Olsen W (1990) The

biosynthetic basis of adult lactase deWciency. J Clin Invest

86:13381342

Documents

Lactose Digestion And The Evolutionary Genetics of Lactase Persistance - Ingram Et Al 2009 Human Genetics