Upload
others
View
2
Download
0
Embed Size (px)
Citation preview
S1
SUPPORTING INFORMATION
Lead Sulfide Nanoparticles Increase Cell Wall Chitin Content and
Induce Apoptosis in Saccharomyces cerevisiae
M. Q. Sun a, Q. L. Yu
b, M.Y. Hu
c, Z.W. Hao
a, C.D. Zhang
a, and M.C. Li
b
a College of Environmental Science and Engineering, Nankai University, Tianjin,
China 300071 b Ministry of Education Key Laboratory of Molecular Microbiology and Technology,
Department of Microbiology, College of Life Science, Nankai University, Tianjin,
China 300071 c Affiliated High School of Nankai University
* Corresponding author:
Chengdong Zhang
Tel/fax: 86-22-66229517; E-mail: [email protected]
Mingchun Li
Tel/fax: 86-22-23508506 ; E-mail: [email protected]
Supplementary Material
S2
Materials and Methods
1. Synthesis and characterization of PbS particles
Three types of PbS particles with different sizes, bulk PbS (named bulk-PbS),
large nano-PbS (named nano-PbS1), small nano-PbS (named PbS2), were synthesized
as Jiang’s methods with modification [1]. All chemicals were reagent grade and used
without further purification or modification.
To synthesize bulk-PbS, 0.0121 g L-cysteine (C3H7NO2S, A.R., molecular weight
121) were dissolved in 30 ml deionized water, 0.0379 g of Pb(AC)2·3H2O was added
and then 10 mL ethylene glycol was added. The resulting mixture was continually
stirred for 10 min and was then transferred into a 50 mL (capacity) Teflon-lined
stainless autoclave. The autoclave was sealed and maintained at 150°C for 17 h. The
system was then cooled to room temperature. The final product was collected, washed
with distilled water and absolute alcohol for several times, vacuum-dried, and kept for
further characterization.
For nano-PbS1 synthesis, 0.121 g L-cysteine (C3H7NO2S, A.R.) was dissolved in
30 mL deionized water, 0.379 g of Pb(AC)2·3H2O and 10 mL ethylene glycol was
added. The resulting mixture was continually stirred for 10 min and was then
transferred into a Teflon-lined stainless autoclave (50 mL capacity). The autoclave
was sealed and maintained at 150 °C for 17 h. The system was then cooled to room
temperature. The final product was collected, washed with distilled water and
absolute alcohol for several times, vacuum-dried, and kept for further
characterization.
S3
For nano-PbS2 synthesis, 0.3644 g hexadecyltrimethylammonium bromide
(CTAB, C16H33(CH3)3NBr, A.R.) and 0.152 g thioacetamide (CH3CSNH2, A.R.) were
dissolved in 40 mL deionized water, and 0.379 g of Pb(AC)2·3H2O was added to the
above solution under stirring. The resulting mixture was continually stirred for 10 min
and was then transferred into a Teflon-lined stainless autoclave (50 mL capacity). The
autoclave was sealed and maintained at 120°C for 14 h. The system was then cooled
to room temperature. The final product was collected, washed with distilled water and
absolute alcohol for several times, vacuum-dried, and kept for further
characterization.
The average diameter of the PbS crystallites was calculated by the Scherer’s
equation: D=α λ/(β cosθ), where D is the particle diameter of nanocrystallite, α is the
constant (0.9), λ is the X-ray wavelength (1.5405Å), β is the half-width of the
diffraction peak.
The particle size distribution and their state of agglomeration/dispersion were
determined by a ZetaPALS (ZETAPALS/BI-200SM, Brookhaven, USA) in YPD
medium. Various PbS particles were suspended in YPD medium to obtain the
concentration of 640 mg/L. After sonicated for 30 min, the suspensions were diluted
10 times in YPD medium for DLS measurements. Diluted samples were used to avoid
multiple scattering.
2. Growth inhibition by Pb2+
One milliliter of cell suspension was mixed with 1 mL Pb2+
solution (prepared
by dissolving Pb(NO3)2 in YPD medium) in glass tubes and the final concentrations of
S4
Pb2+
were 0, 6.3, 12.5, 25, 50, 100, 200 and 400 mg/L, respectively. The control
contained 2 mL of YPD medium only. The mixtures were then cultured at 30℃ with
shaking at 180 rpm for 24 h. Cells in each tube were counted with haemocytometers.
3. Time-dependent growth inhibition assay
One milliliter of cell suspension was mixed with 1 mL PbS suspension or
Pb(NO3)2 (prepared in YPD medium) solution and the final concentrations of PbS
particles and Pb2+
were 640 mg/L and 100 mg/L, respectively. The mixtures were then
cultured at 30℃ with shaking at 180 rpm for 0, 2, 4, 6, 8, 10, 12, 24 h. Cells at each
time point were counted with haemocytometers.
4. Effect of ascorbic acid on the cell growth
One milliliter of cell suspension was mixed with 1 mL nano-PbS2 suspension and
the final concentration of nano-PbS2 was 640 mg/L. Ten microliters of ascorbic acid
(20 mM, prepared in water, BBI, USA) were added into the mixture to the final
concentration of 100 μM. The mixtures were then cultured at 30℃ with shaking at
180 rpm for 24 h. Cells were counted with haemocytometers.
5. β-galactosidase assays
Cells were harvested and suspended in 1 mL working Z buffer (60 mM Na2HPO4,
40 mM NaH2PO4, 10 mM KCl, 1 mM MgSO4, 0.27% (V/V) β-mercaptoethanol, pH
7.0). Ten microliters of cell suspensions were mixed with 990 μL of dH2O, and the
OD600 of the diluted suspensions was determined. Two hundreds microliter of
suspensions were permeabilized with 20 μL chloroform and 50 μL sodium
dodecylsulphate (0.1% (W/V), prepared in water), and equilibrated at 30℃ for 5 min.
S5
The permeabilized cells were mixed with 700 μL
O-nitrophenyl-β-D-galactopyranoside (5 mg/mL, prepared in working Z buffer, Sigma,
USA), and incubated at 30℃ for certain time (T). The reaction time (T) was
monitored, and when sufficient yellow color has developed the reaction were stopped
by the addition of 500 μL Na2CO3 (1 M). Suspensions were centrifuged at 12000 rpm
for 10 min, and the absorbance of supernatant at 420 nm (OD420) was determined.
Miller units of activity were calculated as (OD420×1000) / (OD 600×T×20) [2].
6. ROS detection
One milliliter of prepared cell suspensions (with OD600 of 0.5) was mixed with 4
μL of DCFH-DA (10 mg/mL, dissolved in ethanol, Sigma USA). After incubated at
30°C for 30 min, cells were harvested, washed and re-suspended in PBS buffer. The
cells were then examined by a fluorescence microscope with the green filter set. The
percent of DCFH-DA-positive (ROS-accumulated) cells was calculated as the number
of DCFH-DA-positive cells divided by the number of total observed cells. At least 20
examined fields were determined [3].
7. MMP measurement
The five hundred microliters of prepared cell suspensions were incubated with 5
μL of JC-1 (1 mg/mL, dissolved in DMSO, Sigma USA) for 30 min at 30℃[4]. The
MMP of stained cells were examined using a flow cytometer (CaLibar, Beckton
Dickson, USA). J-aggregate fluorescence was recorded by the flow cytometer in
fluorescence channel 2 (FL2) and monomer fluorescence in fluorescence channel 1
(FL1).
S6
8. MCA1 gene expression
Then treated cells were harvested, washed with dH2O, and suspended in LETS
buffer (10 mM Tris-HCl, 10 mM Na2EDTA, 10 mM LiCl, 0.2% SDS, dissolved in
diethypyrocarbonate-treated dH2O). Cells were then disrupted by glass beads with
vortex. Cell total RNA was isolated using Total RNA extraction kit (TIANGEN,
China) following the manufacturer’s instructions, then treated with DNaseⅠ(Takara,
China) to remove genomic DNA, and reversely transcribed to cDNA by M-MLV
reverse transcriptase (Promega, Madison, USA). RT-PCR reactions were performed
using TranStart Green qPCR SuperMix (Transgene, China) with 5 replicates, using
the primers MCA1-5RT (5’ GGATGCGCAACCCAATGA 3’) and MCA1-3RT (5’
AAATCTTCAGTTTGGCCACCAT 3’) [5]. The ACT1 gene was used as the
endogenous control. The PCR protocol consisted of a primary denaturation step at 94℃
for 3 min, followed by 40 cycles of denaturation at 94℃ for 20 s, annealing at 58℃
for 20 s, and extension at 68℃ for 30 s [6]. Results were analyzed using iQTM
5
software (Bio-Rad, Hercules, USA).
9. DAPI staining
The prepared cells were fixed with 1 mL of 4% (v/v) formaldehyde for 10 min,
then collected by centrifugation, washed with PBS buffer, re-suspended in 1 mL PBS
buffer, and stained with 1 μL of DAPI (10 mg/mL, prepared in dH2O, BBI, USA) for
20 min. The cells were then collected, washed 3 times with PBS buffer, and examined
by a fluorescence microscope (BX-41, Olympus, Japan) using the DAPI filter [7]. At
least 20 fields were examined.
S7
10. Membrane permeability assay
Yeast plasma membrane permeability was assayed according to Nargund’s
method [5]. One milliliter of yeast suspensions was mixed with 1 mL PbS suspensions
or Pb2+
solution to the final concentrations of 640 mg/L PbS particles or 100 mg/L
Pb2+
respectively. The suspensions were incubated at 30℃ with shaking at 180 rpm
for 6 or 12 h. Cells were harvested, washed, and re-suspended in YPD medium to
OD600 of 1.0. One milliliter of cell suspensions were stained with 2 μL of propidium
iodide (PI, 10 mg/mL, prepared in water, Sigma USA) at 30℃ for 2 h with shaking at
60 rpm. Cells were observed by a fluorescence microscope with the red filter set.
PI-positive and total yeast cells were counted. The percent of PI-positive cells against
the total cells were calculated. At least 20 fields were examined.
S8
Results and Discussion
Fig. S1. SEM images of bulk-PbS, nano-PbS1and nano-PbS2, respectively.
S9
Fig. S2. XRD patterns of various PbS particles.
The XRD patterns of the three PbS particles contain nine distinguishable peaks,
which correspond to the crystal planes of 111, 200, 220, 311, 222, 400, 331, 420 and
422. The XRD patterns are identical to reported PbS material [8], and did not show
signals from the precursor Pb (AC)2 or other derivatives. These results demonstrate
that high purity PbS particles were formed. In addition, the dominant and sharp peaks
indicated that the PbS particles were highly crystalline.
S10
Fig S3 Time-dependent growth inhibition of yeast cells incubated with 640 mg/L PbS
particles or 100 mg/L Pb2+
. The error bars indicate standard deviations, n = 5.
S11
Fig S4 Determination of chitin contents in the control cells as a function of time.
S12
Fig S5. Growth inhibition of yeast cells incubated with various concentrations of Pb
2+
for 24 h. The error bars indicate standard deviations, n = 5.
S13
Fig. S6. Fluorescence microscope images of yeast cells stained by FDA to evaluate
the cell viability. Before FDA staining the cells were incubated with 640 mg/L of PbS
particles or 100 mg/L Pb2+
for 6 h. The cells in the control were not treated with lead
material.
S14
Fig. S7 EDS of particles deposited on the surface and in the close vicinity of yeast
cells in Fig 3B and 3C.
S15
Fig S8 Florescence images of cells after CFW staining under the treatment of 640
mg/L bulk-PbS or 100 mg/L Pb2+
for 6 h.
S16
Fig. S9. Fluorescence microscope images of yeast cells stained by DCFH-DA to
evaluate ROS generation. Before DCFH-DA staining the yeast cells were incubated
with 640 mg/L PbS particles or 100 mg/L Pb2+
for 6 h. The control cells were not
treated with lead material.
S17
Fig. S10. Changes of mitochodrial membran potential (MMP) in yeast cells by flow
cytometry withour treatment or under the treatments of 640 mg/L PbS particles or 100
mg/L Pb2+
for 6 h; 100 μM of CCCP was used as a positive control. FL1-H, densities
of green fluorescence; FL2-H, densities of red fluorescence.
S18
Fig. S11. Changes of mitochodrial membran potential in yeast cells by flow cytometry
under the treatments of 160, 320, 640 and 1280 mg/L nano-PbS2 for 6 h, respectively.
FL1-H, densities of green fluorescence; FL2-H, densities of red fluorescence.
S19
Fig S12 Effect of the addtion of ascorbic acid on cell growth. Cells were incubated
with 640 mg/L nano-PbS2 for 24 h with or without 100 μM ascorbic acid addtion. The
error bars indicate standard deviations, n = 5. Identical letters indicate no statistical
differences among treatments (P < 0.05).
S20
Fig S13 The ratio of PI-positive cells to total cell numbers under the treatments of 640
mg/L PbS particles or 100 mg/L Pb2+
for 6 or 12 h. There was no statistical difference
(p > 0.05) between the untreated and treated cell. Error bars indicated standard
deviations, n = 20.
Reference
[1] Jiang, Y., Wu, Y., Xie, B., Yuan, S., Liu, X., Qian, Y., Hydrothermal preparation of
uniform cubic-shaped PbS nanocrystals, J Cryst. Growth, 231 (2001) 248-251.
[2] Q. Yu, H. Wang, N. Xu, X. Cheng, Y. Wang, B. Zhang, L. Xing and M. Li, Spf1
strongly influences calcium homeostasis, hyphal development, biofilm formation
and virulence in Candida albicans, Microbiology 158 (2012) 2272-2282.
[3] X. Ding, Q. Yu, N. Xu, Y. Wang, X. Cheng, K. Qian, Q. Zhao, B. Zhang, L. Xing
and M. Li, Ecm7, a regulator of HACS, functions in calcium homeostasis
maintenance, oxidative stress response and hyphal development in Candida
albicans, Fungal Genet. Biol. 57 (2013) 23-32.
[4] S. T. Smiley, M. Reers, C. Mottola-Hartshorn, M. Lin, A. Chen, T. W. Smith, G. D.
Steele-Jr and L. B. Chen, Intracellular heterogeneity in mitochondrial membrane
potentials revealed by a J-aggregate-forming lipophilic cation JC-1, Proc. Natl.
Acad. Sci. U S A 88 (1991) 3671-3675.
[5] A. M. Nargund, S. V. Avery and J. E. Houghton, Cadmium induces a
heterogeneous and caspase-dependent apoptotic response in Saccharomyces
cerevisiae, Apoptosis 13 (2008) 811-821.
[6] Q. Yu, X. Ding, N. Xu, X. Cheng, K. Qian, B. Zhang, L. Xing and M. Li, In Vitro
activity of verapamil singly and in combination with fluconazole or tunicamycin
against Candida albicans biofilms. Int. J. Antimicrob. Agents 41 (2013) 179-182.
[7] I. Hwang, J. Lee, J. H. Hwang, K Kim and D.G. Lee, Silver nanoparticles induce
apoptotic cell death in Candida albicans through the increase of hydroxyl radicals.
S21
FEBS J. 279 (2012) 1327-1338.
[8] J. Sun and W. E. Buhro, The use of single-source precursors for the
solution-liquid-solid growth of metal sulfide semiconductor nanowires, Angew.
Chem. Int. Edit. 47 (2008) 3215-3218.