Lecture DNA Barcode Taxmol or MolEvo

7/23/2019 Lecture DNA Barcode Taxmol or MolEvo

1/50
http://fatchiyah.lecture.ub.ac.id/mailto:[email protected]


2/50


3/50

DNA barcoding is a technique forcharacterizing species of organisms using ashort DNA sequence from a standard andagreed-upon position in the genome. DNAbarcode sequences are very short relative tothe entire genome and they can be obtainedreasonably quickly and cheaply. Thecytochrome c oxidase subunit 1 mitochondrialregion (COI) is emerging as the standardbarcode region for higher animals. It is 648nucleotide base pairs long in most groups, avery short sequence relative to 3 billion basepairs in the human genome, for example.


4/50

The barcode metaphoris useful though notcorrect in fine detail. That is, all the productsof one type on a supermarket shelf (like a 2-litre bottle of Coca-Cola) share exactly thesame 11-digit barcode, which is distinctfrom all other barcodes. DNA barcodesvary among individuals of the same

species, but only to a very minor degree. Ifthe DNA barcode region is effective, theminor variation within species will be muchsmaller than the differences amongspecies.


5/50

DNA barcodingis a taxonomic method that uses ashort genetic marker in an organism's DNA to identifyit as belonging to a particular species.

It differs from molecular phylogeny in that the main

goal is not to determine classification but to identifyan unknown sample in terms of a knownclassification.[1]

Although barcodes are sometimes used in an effortto identify unknown species or assesswhether species

should be combined or separated,[2]

the utility of DNA barcoding for these purposes is

subject to debate.[3]
http://en.wikipedia.org/wiki/DNA_barcoding#cite_note-Kress-0http://en.wikipedia.org/wiki/DNA_barcoding#cite_note-1http://en.wikipedia.org/wiki/DNA_barcoding#cite_note-1http://en.wikipedia.org/wiki/DNA_barcoding#cite_note-seberg2009-2http://en.wikipedia.org/wiki/DNA_barcoding#cite_note-seberg2009-2http://en.wikipedia.org/wiki/DNA_barcoding#cite_note-seberg2009-2http://en.wikipedia.org/wiki/DNA_barcoding#cite_note-1http://en.wikipedia.org/wiki/DNA_barcoding#cite_note-Kress-0


6/50


7/50


8/50

Why barcode animal and plant species?


9/50

By harnessing advances in electronics and genetics,barcoding will

help many people quickly and cheaply recognizeknown species and retrieve information aboutthem

speed discovery of the millions of species yet tobe named

provide vital new tools for appreciating and

managing the Earths immense and changingbiodiversity.


10/50


11/50

Researchers have developed numerous ways to

identify species by DNA, typically tailoring theapproach to answer a specific question in alimited set of species.

Like convergence on one or a few railroad gauges,barcoding aims to capture the benefits of

standardization, which typically lowers costsand lifts reliability, and thus speeds diffusionand use.


12/50

For barcoding, standardization should help

accelerate construction of a comprehensive,consistent reference library of DNA sequences

speed development of economical technologiesfor species identification.

The goal is that anyone, anywhere, anytime be ableto identify quickly and accurately the species of

a specimen whatever its condition.


13/50

Results so far suggest that a mitochondrial

gene will enable identification of most animalspecies.

For plants, mitochondrial genes do not differ

sufficiently to distinguish among closely relatedspecies. Promising approaches to standardizeplant identification use one or possibly more

barcode regions are under development.


14/50

Mitochondria, energy-producing organelles inplant and animal cells, have their own genome.

Twenty years of research have established theutility of mitochondrial DNA sequences indifferentiating among closely-related animalspecies.

Four properties make mitochondrial genomesespecially suitable for identifying species:


15/50

Greater differences among species, on average 5-

to 10-fold higher in mitochondrial than in

nuclear genes. Thus shorter segments

distinguish among species, and because

shorter, less expensively.


16/50

Copy number.There are 100-10,000 more copies ofmitochondrial than nuclear DNA per cell, makingrecovery, especially from small or partially degradedsamples, easier and cheaper.

Relatively few differences within speciesin mostcases. Small intraspecific and large interspecificdifferences signal distinct genetic boundariesbetween most species, enabling preciseidentification with a barcode.

Introns, which are non-coding regions interspersedbetween coding regions of a gene, are absent frommitochondrial DNAof most animal species, makingamplification straightforward. Nuclear genes areoften interrupted by introns, making amplificationdifficult or unpredictable.


17/50

Groups with little sequence diversity

Resolution of recently diverged species

Hybrids

Nuclear pseudogenes


18/50

Why select the barcode sequence fromwithin one gene?


19/50

Defining a standard region and making sequencecomparisons among protein-coding genes are

easier because they generally lack insertions ordeletions present in ribosomal genes.

Mitochondrial protein-coding genes generallycontain more differences than the ribosomal

genes and thus are more likely to distinguishamong closely-related species.


20/50

Cytochrome c oxidase I (COI) contains differencesrepresentative of those in other protein-coding genes.

Possible gains in accuracy or cost using a differentprotein-coding gene would likely be small.


21/50

Barcodes identify most animal speciesunambiguously.

Approximately 2-5% of recognized species have

shared or overlapping barcodes with closely-related species. Many of the species withoverlapping barcodes hybridize regularly.

In all groups studied so far, distinct barcodeclusters with biologic co-variation suggestcryptic species.


22/50

BarcodingNorth

American birdshighlightsprobable

cryptic species


23/50


24/50

Can barcodesaid

understandinghistory ofanimal and

plant species?


25/50

CONSORTIUM FOR THE BARCODE OF LIFE (CBOL)is an international

initiative devoted to developing DNA barcoding as a global standard intaxonomy.

CBOLis a collaboration of natural history museums, herbaria, biological

repositories, and biodiversity inventory sites, together with academic

and commercial experts in genomics, taxonomy, electronics, andcomputer science. CBOL has more than 100 institutional members in 40

countries.

The inaugural meeting for CBOLwas held at The National Museum of Natural

History, Washington DC in May 2004. The initial organizational supportfor CBOLwas provided by a 2.5 year grant from the The Alfred P. Sloan


26/50

identifying plant leaves even whenflowers or fruit are not available,

identifying insect larvae (which typicallyhave fewer diagnostic characters thanadults),

identifying the diet of an animal based

on stomach contents or faeces,[4]

and identifying products in commerce

(for example, herbal supplements orwood).[1]
http://en.wikipedia.org/wiki/DNA_barcoding#cite_note-3http://en.wikipedia.org/wiki/DNA_barcoding#cite_note-Kress-0http://en.wikipedia.org/wiki/DNA_barcoding#cite_note-Kress-0http://en.wikipedia.org/wiki/DNA_barcoding#cite_note-3


27/50

Facilitating identification andrecognition of named (described)species:

linking life history stages, genders;

differentiating cryptic species; identifying gut contents;

human disease vectors;

agricultural pests;

biosecurity (?).

James Hanken

Museum of Comparative Zoology

Harvard University, USA


28/50

A desirable locus for DNA barcoding should be

standardized (so that large databases of sequencesfor that locus can be developed),[5]

present in most of the taxa of interest andsequencable without species-specific PCR primers,[5]

short enough to be easily sequenced with current

technology,[6]

and provide a large variation betweenspecies yet a relatively small amount of variationwithin a species.[7]

Although several loci have been suggested, a

common set of choices are: For animals and many other eukaryotes, themitochondrial CO1 gene

For land plants, the concatenation of the rbcLandmatKchloroplast genes[5
http://en.wikipedia.org/wiki/DNA_barcoding#cite_note-janzen2009-4http://en.wikipedia.org/wiki/DNA_barcoding#cite_note-janzen2009-4http://en.wikipedia.org/wiki/DNA_barcoding#cite_note-kress2008-5http://en.wikipedia.org/wiki/DNA_barcoding#cite_note-kress2008-5http://en.wikipedia.org/wiki/DNA_barcoding#cite_note-6http://en.wikipedia.org/wiki/DNA_barcoding#cite_note-6http://en.wikipedia.org/w/index.php?title=MatK&action=edit&redlink=1http://en.wikipedia.org/wiki/DNA_barcoding#cite_note-janzen2009-4http://en.wikipedia.org/wiki/RbcLhttp://en.wikipedia.org/w/index.php?title=MatK&action=edit&redlink=1http://en.wikipedia.org/wiki/DNA_barcoding#cite_note-janzen2009-4http://en.wikipedia.org/wiki/DNA_barcoding#cite_note-janzen2009-4http://en.wikipedia.org/w/index.php?title=MatK&action=edit&redlink=1http://en.wikipedia.org/wiki/RbcLhttp://en.wikipedia.org/wiki/DNA_barcoding#cite_note-6http://en.wikipedia.org/wiki/DNA_barcoding#cite_note-kress2008-5http://en.wikipedia.org/wiki/DNA_barcoding#cite_note-janzen2009-4http://en.wikipedia.org/wiki/DNA_barcoding#cite_note-janzen2009-4


29/50


30/50

Species identification using DNA barcodes starts withthe specimen. Barcoding projects obtain specimensfrom a variety of sources. Some are collected in thefield, others come from the vast collections housed in

natural history museums, zoos, botanical gardens andseed banks to name a few. In the laboratory, technicians use a tiny piece of

tissue from the specimen to extract its DNA. Thebarcode region is isolated, replicated using a processcalled PCR amplification and then sequenced. The

sequence is represented by a series of letters CATGrepresenting the nucleic acidscytosine, adenine,thymine and guanine.


31/50


32/50

if you wrote down the barcode sequenceof an Arctic warbler (Phylloscopusborealis), for example, it would look like

this: CCTATACCTAATCTTCGGAGCATGAGCG

GGCATGGTAGGC....

And its image looks like this:


33/50

Once the barcodesequence has been

obtained, it is placed in theBarcode of Life DataSystems (BOLD) databasea reference library of DNAbarcodes that can be usedto assign identities tounknown specimens.

BOLD is a searchablerepository for barcoderecords, storing specimendata and images as well assequences and trace files.

It provides an identificationengine based on thecurrent barcode libraryand monitors the numberof barcode sequencerecords and speciescoverage.


34/50

Most eukaryote cells contain mitochondria,and mitochondrial DNA (mtDNA) has arelatively fast mutation rate, which results insignificant variation in mtDNA sequencesbetween species

and, in principle, a comparatively smallvariance within species. A 648-bp region of themitochondrial cytochrome c oxidase subunit I(COI) gene was proposed as a potential

'barcode'. As of 2009, databases of CO1 sequencesincluded at least 620,000 specimens from over58,000 species of animals, larger thandatabases available for any other gene


35/50


36/50

DNA is particularly useful to study animal

plankton, because the organisms are frequentlyrare, fragile, and/or small.

Evolutionarily-conserved body plans for somegroups (e.g., copepods) makes morphological

identification difficult and mistakes likely.

Many species are widespread or circumglobal;DNA can be used to evaluate taxonomicsignificance of geographic variation.

DNA-based species identification will speedanalysis of samples for known species.

Zooplankton will test barcode protocols, since15 animal groups (phyla) are represented.

Why Barcode Zooplankton?


37/50

Link morphological / molecular systematic analysis

for global zooplankton assemblage DNA barcode ~7,000 described species in 15 phyla

Submit DNA, specimen & collection data:- Barcode section of GenBank- CMarZ database with environmental data

- Searchable from OBIS portal

Reveal cryptic species within circumglobal speciesby population genetic analysis

Discover new species by sampling biodiversity

hotspots, unexplored ocean regions, deep sea

Assess zooplankton diversity by environmental

sequencing of unsorted samples

Develop automatable DNA chip-based approaches

and protocols to identify and quantify species

Barcoding Goals for CMarZ


38/50

Barcoding Euphausiids (Crustacea)

Fourteen of 86 euphausiid

species were identified byPeter Wiebe.

50 euphausiids including 19species of Euphausia havebeen barcoded to date.

Barcoding for Euphausiids:

Good at species identification

Can reveal cryptic species


39/50

Barcoding Medusozoans (Cnidaria)

Barcoding is done by Brian

Ortman (UConn/USA).

13 species of siphonophores

greatly expanded, much of

siphonophore diversity (160spp.)


40/50

Offers alternative taxonomic identification

tool for situations in which morphology isinconclusive.

Focus on one or a small number of genesprovides greater efficiency of effort.

Cost of DNA sequencing is dropping rapidlydue to technical advances.

Potential capacity for high throughput andprocessing large numbers of samples.

Once reference database is established,can be applied by non-specialist.

James Hanken




41/50

Assumes intraspecific variation is negligible,

or at least lower than interspecific values. No single gene will work for all taxa (e.g.,

COI is not appropriate for vascular plants,or even for some animals).

Single-gene approach is less precise thanusing multiple genes; may introduceunacceptable error.

Some of the most attractive aspects rely on

future technology, e.g., handheldsequencer.

James Hanken




42/50

requires integration of a field informationmanagement system (FIMS), laboratory informationmanagement system (LIMS), sequence analysis tools,workflow tracking to connect field data and

laboratory data, database submission tools andpipeline automation for scaling up to eco-systemscale projects.

Geneious Procan be used for the sequence analysiscomponents, and the two plugins made freelyavailable through the Moorea Biocode Project,

the Biocode LIMS and Genbank Submissionpluginshandle integration with the FIMS, the LIMS, workflowtracking and database submission
http://en.wikipedia.org/wiki/Geneioushttp://software.mooreabiocode.org/index.php?title=Main_Page%7CGeneioushttp://software.mooreabiocode.org/index.php?title=Main_Page%7CGeneioushttp://software.mooreabiocode.org/index.php?title=Main_Page%7CGeneioushttp://software.mooreabiocode.org/index.php?title=Main_Page%7CGeneioushttp://software.mooreabiocode.org/index.php?title=Main_Page%7CGeneioushttp://software.mooreabiocode.org/index.php?title=Main_Page%7CGeneioushttp://software.mooreabiocode.org/index.php?title=Main_Page%7CGeneioushttp://en.wikipedia.org/wiki/Geneioushttp://en.wikipedia.org/wiki/Geneioushttp://en.wikipedia.org/wiki/Geneious


43/50

the role of any molecular diagnostic is to aid research, not to serve

as an end in itself. Barcoding is independent of questions as towhether individual taxa are species, what species are (or should be),and where they fit in a unified tree of life. Barcoding is not an end initself, but will boost the rate of discovery. The unique contribution ofDNA barcoding to taxonomy and systematics is a compressed

timeline for the exploration and analysis of biodiversity.


44/50

Astraptes fulgerator, skipperbutterfly.

Wide-ranging; southern U.S. tonorthern Argentina.

In northwestern Costa Rica,comprises complex of 10 sympatricspecies that are distinct in DNAsequence (COI), larval coloration,food plants, and subtle

morphological traits.

D. Janzen, et al., submitted


45/50

Food plant:Celtis

iguanaea

Food plant:

Trigonia (2species); larvae

will starve if

reared on plants

used by other

larval types.


46/50

0

0.2

0.4

0.6

0.8

1.0

2 4 8 16 32 64%

Propo

rtion

ofspecies

pairs

0

0.2

0.4

0.6

0.8

1.0

2 4 8 16 32 64%

n = 13,320

n = 17

Annelida, Arthropoda, Chordata, Mollusca,

Echinodermata, Nematoda, Platyhelminthes

Cnidaria (corals, anemones,

jellyfish, sea pens, etc.)

Between-species sequence

divergence in COI (%)


47/50

K2P (%)


48/50

Sequence data

Voucher specimensand electronicdatabases

Digital images


49/50

See alsoNature426: 514 (4 Dec 2003)


50/50

Documents

Lecture DNA Barcode Taxmol or MolEvo